Staying Well Connected – Lithistid Sponges on Seamounts Merrick Ekins1, Dirk Erpenbeck2, Gert Wo¤Rheide3 and John N

Journal of the Marine Biological Association of the United Kingdom, 2016, 96(2), 437–451. # Marine Biological Association of the United Kingdom, 2015 doi:10.1017/S0025315415000831 Staying well connected – Lithistid sponges on seamounts merrick ekins1, dirk erpenbeck2, gert wo¤rheide3 and john n. a. hooper1,4 1Queensland Museum, PO Box 3300, South Brisbane 4101, Brisbane, Queensland, Australia, 2Department of Earth and Environmental Sciences and GeoBio-Center, Ludwig-Maximilians-Universita¨tMu¨nchen, Richard-Wagner-Straße 10, 80333 Mu¨nchen, Germany, 3SNSB – Bavarian State Collections for Palaeontology and Geology, Richard-Wagner-Straße 10, 80333 Mu¨nchen, Germany, 4Eskitis Institute for Drug Discovery, Grifﬁth University, Brisbane 4111, Queensland, Australia

Three species of lithistid sponges, Neoaulaxinia zingiberadix, Isabella mirabilis and Neoschrammeniella fulvodesmus were collected from deep seamounts off New Caledonia to address questions about their population structure, gene flow and the relative contribution of sexual and asexual reproductive strategies to their populations. The sponges were tested by sequencing the ITS (internal transcribed spacer) and CO1 regions of their genomes. These rare and presumably ancient sponges have a distribution restricted to seamounts in the south-western Pacific. Deep seamounts represent geographically separated islands. Although the sponges could be expected to have sexual reproduction restricted to near neighbours due to low sexual dispersal opportunities via larvae, this study found surprisingly high levels of gene flow between the seamounts. Amongst the specimens of N. zingiberadix taken from two seamounts there was no population structure; CO1 resulted in identical genotypes. For the population structure within N. fulvodesmus, as revealed by ITS, most of the variation was within each individual from the six seamounts on which it occurred and CO1 revealed no difference between individuals or seamounts. The third species I. mirabilis showed four genotypes based on CO1, which were distributed across all the seamounts. Indirect measures of different species showed a range of reproductive strategies from asexual to sexual, but with much higher connection between seamounts than previously thought. Individual seamounts did not show a separate population structure as one might expect from ‘islands’. The conclusion must be that these sponges have mechanisms to attain greater dispersal than previously thought.

Keywords: Lithistid, population genetics, seamounts, gene ﬂow, dispersal, reproduction, Neoaulaxinia zingiberadix, Isabella mirabilis, Neoschrammeniella fulvodesmus

Submitted 23 January 2015; accepted 19 May 2015; ﬁrst published online 22 June 2015

INTRODUCTION transmission of a sexual form, such as detached tissue still undergoing post fertilization development (Maldonado & Sponges occupy widely divergent biogeographic regions. This Uriz, 1999b), sperm and eggs, or a swimming or crawling may be a testament to their ability to colonize over long dis- larval stage that lasts for only a few days (Maldonado & tances, or their ability to adapt and evolve to suit changing Riesgo, 2008). These are potentially transmitted via currents, environments. Yet the mechanisms whereby they do this, in waves, storms or using vectors such as ﬁsh or echinoderms. particular the relative importance of both sexual and asexual Asexual reproduction has also been observed and includes reproduction strategies, is largely unknown for many abiotic factors such as physical fragmentation (Wulff, 1991) sponges. Sponges found on seamounts are isolated, sub- and biotic factors such as ﬁssion, budding (e.g. Teixido merged and independent offering an opportunity to test et al., 2006; Ereskovsky & Tokina, 2007) and gemmule forma- various possibilities. tion (Sara` et al., 2002). Both strategies have been shown to Sponges are known to use both sexual and asexual repro- occur in individual sponges concurrently (Leong & Pawlik, ductive strategies to survive and prosper (Kaye, 1990) and 2010) or successionally (Ereskovsky & Tokina, 2007). It is both sexual and asexual components to enable long-range dis- the sponges’ ability to use both of these strategies synergistic- persal and colonization of new habitats (see overview in ally, that improves their dispersal ability (Maldonado & Uriz, Maldonado & Riesgo, 2008). Active locomotion of entire indi- 1999a). The formation of external buds of hexactinellids in the vidual sponges has been observed in response to environmen- stable environment of Antarctic waters (Teixido et al., 2006) tal factors (Bond & Harris, 1988; Maldonado & Uriz, 1999b), may enable the formation of a stable clonal population in but such an ability, used to readjust the sponge position at the the immediate vicinity. The formation of gemmules generally microhabitat scale (displacements from millimetres to centi- associated with freshwater sponges also occur in some marine metres) cannot account for population dispersal. Dispersal sponges (Sara` et al., 2002). However, these gemmules are of sexual stages is generally assumed to involve the expected to have dispersal abilities on par with sexual propagules. The formation of bubble-like buds in Oscarella spp. (Ereskovsky & Tokina, 2007) and Leucetta changosensis

Corresponding author: Dendy, 1913 (Wo¨rheide et al., 2008) shows a previously M. Ekins unnoticed far-reaching asexual dispersal mechanism. Email: [email protected] Merging of conspeciﬁc sponges (Wulff, 1990) also provides

437

Downloaded from https://www.cambridge.org/core. UB der LMU München, on 03 Dec 2018 at 14:12:47, subject to the Cambridge Core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0025315415000831 438 merrick ekins et al.

another possible asexual reproduction mechanism which is Population research in sponges has largely concentrated on not usually accompanied by meiotic recombination but biogeography (Nichols & Barnes, 2005), the movement of carried out by totipotent somatic cells in sponges. species into or out of the Mediterranean Sea (Duran et al., Colonization of new locations by asexual stages may, 2004a), survival in the South Pacific (Wo¨rheide et al., alternatively, be more commonly due to the dispersal of frag- 2002a) and ecological specialization (Duran & Ru¨tzler, ments or entire sponges, via waves, currents, storms and 2006). Much of the work on sponge population genetics has cyclones, or as a passenger on substrates such as debris. shown genetic differentiation at geographic scales (Klautau There are several characteristics that may indicate an et al., 1999; Duran et al., 2004a, b; Bentlage & Worheide, asexual or clonal population including frequent recovery of 2007; Hoshino et al., 2008;Wo¨rheide et al., 2008; Xavier genotypes, correlation between different independent et al., 2010); for a review see Uriz & Turon (2012). By com- markers, linkage disequilibrium and the absence of sexual parison, only a small amount of research has been carried reproductive structures. Direct observation of deep sea out on small scales as would occur on a seamount. Two sponge dispersal is not currently feasible, although observa- Mediterranean studies on Crambe crambe (Schmidt, 1862) tions indicate it can be done at great expense (Teixido et al., (Calderon et al., 2007) and Scopalina lophyropoda Schmidt, 2006). In other sessile invertebrates such as corals, asexual 1862 (Blanquer et al., 2009) showed genetic structure at this reproduction is common and is an adaptation that succeeds small scale consistent with what one would expect from a both in moderate to high levels of disturbance (Le Goff- poorly dispersing sexual stage, although this result could be Vitry et al., 2004; Miller & Ayre, 2004) and stable environ- confused by the presence of chimeric individuals (Blanquer ments (Foster et al., 2007) as it enables well-adapted & Uriz, 2011). Seamounts have been predicted to have large individuals (Ayre & Willis, 1988) to rapidly colonize environ- amounts of population structure because of spatial separation ments or maintain dominance in environments unfavourable and limited dispersal mechanisms coupled with high levels of for sexual reproduction (Wulff, 1991; Hughes et al., 1992). asexual reproduction (Richer de Forges et al., 2000; Samadi Branching corals, which have relatively fragile morphology, et al., 2006). Seamounts are believed to be particularly suscep- are more likely to have high asexual components tible to genetic drift due to their small size (Le Goff-Vitry et al., (Le Goff-Vitry et al., 2004) than more stable massive corals 2004). Seamounts are not ephemeral and, coupled with low (Foster et al., 2007). By contrast, the coral excavating sponge gene flow due to distance and hydraulics, structure within Cliona delitrix Pang, 1973 was shown to not have clonal populations would be expected (Samadi et al., 2006). propagation, as was expected, resulting from coral breakage However, research on crustaceans collected from New (Zilberberg et al., 2006b). Caledonian seamounts showed that previous perceived high Research has been carried out exploring the contributions endemism (Richer de Forges et al., 2000) was not the case of sexual and asexual recruitment on sponges from physical for seamounts. Instead the crustaceans had high levels of observations (Battershill & Bergquist, 1990; Wulff, 1991). gene flow between the seamounts. The only exception in However, other indirect methods to assess the relative input fact was a gastropod that had limited larval dispersal of sexual and asexual reproductive forms in the dispersal (Samadi et al., 2006). process have been used including histocompatibility (Neigel This study focuses on three rare, deep and isolated species & Avise, 1983), allozymes (Zilberberg et al., 2006a; Whalan of lithisitid (‘rock’) sponges from deep seamounts in New et al., 2008), mitochondrial DNA such as CO1 sequence Caledonia that are several million years old (Richer de data (Duran et al., 2004a; Whalan et al., 2008; Dailianis Forges et al., 2000), Neoaulaxinia zingiberadix (Kelly, 2007), et al., 2011), microsatellites (Duran et al., 2002, 2004c; Isabella mirabilis (Schlacher-Hoenlinger et al., 2005) and Blanquer et al., 2005), introns (Bentlage & Worheide, 2007; Neoschrammeniella fulvodesmus (Le´vi & Le´vi, 1983). Wo¨rheide et al., 2008) and nuclear ribosomal internal tran- Lithistids on these seamounts may be relict fauna from the scribed spacer (ITS) sequence data (Lopez et al., 2002; Mesozoic Era (Le´vi, 1991), surviving on refuge habitat Wo¨rheide et al., 2002a, b; Duran et al., 2004a; Nichols & (Samadi et al., 2007). Lithistids are found in most parts of Barnes, 2005; Duran & Ru¨tzler, 2006; Hoshino et al., 2008). the world at great depths. They are believed to be long lived Within an individual sponge, the multiple copies of the ITS and slow growing and, as such, display K reproductive strat- have been suggested to be not yet homogenized by concerted egies such as ovipary (Reiswig, 1973; Fromont & Bergquist, evolution (Duran et al., 2004a). However, intra-genomic poly- 1994). Lithistid sponges constitute a polyphyletic collection morphisms (IGPs) within individual sponges have been of disparate families and genera grouped together by the detected in about half of sponge species tested (Duran et al., common presence of desmas. However, the latter remains sig- 2004a;Wo¨rheide et al., 2004). This indicates that the variation nificantly unresolved based on morphology, and still awaits occurring within individuals may be responsible for much of independent datasets to support or refute morphometric the variation attributed to different species, genera and even hypotheses (e.g. Pisera & Le´vi, 2002). Indeed because lithistids families. Indeed in phylogenetic studies the populations represent an artificial group split into several unrelated orders should always be screened before phylogenetic comparisons (Schuster et al., 2015), it is likely there will be varying repro- are carried out between different taxa. Other researchers ductive strategies within the lithistids. Only one study on have also detected ITS polymorphisms ranging from single reproduction in lithistids has been reported (Maldonado & base changes (Lopez et al., 2002), several nucleotides (Duran Bergquist, 2002; Maldonado & Riesgo, 2008). and this is et al., 2004a) and variable sites (Schmitt et al., 2005) based purely on studies from Theonella, which has been through to examples of up to 13 sequence types per individual recently revised to Astrophorida (Hall et al., 2014). The one (Wo¨rheide et al., 2004). Intra-genomic variation is the pres- study indicated the Theonella is gonochoric and oviparous ence of multiple genotypes within an individual sponge. which means they release zygotes or early embryos that However, it may also be an example of multiple sponges develop externally (Maldonado & Bergquist, 2002; forming of chimeras (Blanquer & Uriz, 2011). Maldonado & Riesgo, 2008). However, these reproductive

modes are more likely to be strategies to suit the current envir- Spicules were dissociated by dissolving sponge tissue in onmental conditions (Ereskovsky, 2010). Lithistids have been boiling nitric acid, rinsed in water and resuspended in abso- reported to have either parenchymella or clavablastula larval lute ethanol. They were then either mounted in Durcupan types, with free swimming planktonic or crawling demersal ACM (Sigma-Aldrich, Australia) and examined under an larval stages (Hooper & Van Soest, 2002). Some of the larval Olympus BH-1 light microscope, or ignited on an SEM stub stages are thought to survive for only a few hours and up to and examined using a Hitachi H1000 SEM. 3 weeks (Maldonado & Bergquist, 2002). However, other For molecular work, samples from 131 specimens were astrophorid sponge genera Thoosa and Alectona produce an taken by cutting a 5 mm3 section of sponge tissue from the uncilliated hoplitomella larvae, which shows great dispersal middle of the specimen. DNA was extracted using a characteristics, using its protruding spicules to float for long DNAeasyw Tissue Kit (Qiagen, Australia) according to the periods of time (Maldonado & Bergquist, 2002; Borchiellini manufacturer’s instructions. The ribosomal internal tran- et al., 2004; Maldonado, 2004; Bautista-Guerrero et al., scribed spacer (ITS) region, including the entire ITS1, 5.8S 2010). The sexual structures and larval stages have not been rRNA and ITS2 regions, was amplified using primers RA2: observed for the three species used in this research. GTCCCTGCCCTTTGTACACA and ITS2.2: CCTGGTT However, because of the limited dispersal characteristics of AGTTTCTTTTCCTCCGC. PCR amplifications were sponge larvae in general, sponge populations have been carried out in a 25 mL volume reaction, with 1 unit of thought to have local low genetic variability, high genetic HotmasterTaqw (Eppendorf), 200 mM of mixed dNTPs and structure and incipient species (Jablonski, 1986; Jackson, 10 mM of each primer. Reaction conditions consisted of a 1986;Wo¨rheide et al., 2005). Nonetheless, due to the large dis- denaturing step of 2 min at 958C, 35 cycles of 20 s at 958C, persal characteristics of some deep sea astrophorids, these 10 s at 588C, and 1 min at 658C, followed by a final extension lithistids may indeed have greater dispersal characteristics of 10 min at 658C. The PCR product was electrophoresed on a but require specific environmental conditions to survive that 0.5% agarose gel for 1 h at 90 volts, the single band excised, may occur only on deep seamounts. and the 1 kb product purified using Perfectprep Gel The depths from which the lithistid sponges used in this Cleanup kit (Eppendorf, Germany). The PCR product was study are recovered (270–1032 m depth range) would have then cloned using pDrive Vector (Qiagen) following the man- 1 enabled survival during the glacial ice age without having to ufacturer’s instructions, modified to half concentration, i.e. 2X move down the slope to colder deeper water. In addition, reaction and the addition of 800 mLof378C SOC during these populations are unlikely to have suffered disturbance transformations. Successful recombinants were selected and from human activities, few surface climatic effects, little preda- grown in liquid culture and plasmid DNA isolated via alkaline tion, and since they are on seamounts they are unlikely to have lysis minipreps (Sambrook et al., 1989). Between two and been affected by continental erosion. The main aim of this seven plasmids per specimen were sequenced directly in research is to evaluate if there are discrete populations of 12 mL reactions containing 3 mLof5× BigDye Terminator these three lithistid species on different seamount ‘islands’ up Buffer (Applied Biosystems, Australia), 0.8 mM of either to almost 200 km apart, with the abyssal floor between these M13F or T7 universal primer, 200 ng of plasmid DNA, and seamounts at 4000 m depth. Previous research on fauna 1 mL Big Dye Terminator Mix v3.1 (Applied Biosystems, from seamounts has found highly localized species distribu- Australia). Reactions were denatured for 5 min at 948C, fol- tions and apparent speciation between island groups or ridge lowed by 30 cycles of 10 s at 968C, 5 s at 508C, and 4 min at systems in the south-western Pacific (Richer de Forges et al., 608C. The sequencing reactions were precipitated using 2000). This research is the first attempt to investigate if speci- 75 mL of a 70% ethanol solution with 0.0002 M MgSO4 and mens of an individual sponge species from different seamounts centrifuged at 3600 rpm for 15 min before the supernatant belong to genetically distinct populations (genotypes), or are was discarded. Sequencing was carried out on an ABI truly widespread as their present taxonomy suggests. Further 3730 × 196 capillary automated DNA sequencer. Sequences we will use direct (i.e. genotypes) and indirect (i.e. linkage dis- were aligned using SequencherTM 4.5 (Genecodes) and equilibrium) tests to measure the relative components of sexual BIOEDIT 7.0.4.1 (Hall, 1999). and asexual reproduction within this species of sponge. CO1 data has been obtained during the barcoding of the Queensland Museum sponge collection in the course of the Sponge Barcoding Project (www.spongebarcoding.org) MATERIALS AND METHODS (Wo¨rheide & Erpenbeck, 2007). The DNA extraction followed a plate-based extraction method (Vargas et al., 2010). Sampling, DNA extraction and sequencing Fragments of CO1 standard barcoding fragment were amplified using the degenerated barcoding primers dgLCO1490 and The lithistid specimens sponges were collected by dredge from dgHCO2198 (Meyer et al., 2005) with annealing temperature deep seamounts off New Caledonia across 10 sites at depths of 438C. The PCR products were purified with ExoSAP-IT ranging from 270 to 1032 m. The only specimens collected (Affymetrix) or standard Ammonium Acetate-Ethanol pre- by trawling of up to 14 km transect length were the specimens cipitation before cycle sequencing both strands with the Big from Eponge North. The sponges were frozen immediately Dye Terminator Mix v3.1 (Applied Biosystems, Australia) fol- following collection. All specimens were registered at the lowing the manufacturer’s protocol and sequencing on an ABI Queensland Museum, registration numbers between QM 3730 automated sequencer. The poriferan origin of the G329756 to QM G331837 (Table 1). The species were identi- sequences was checked by a BLAST search against the fied morphologically by soaking thin tissue section in NCBI GenBank nr database (http://www.ncbi.nlm.nih.gov/). Histo-Clear II (National Diagnostics, USA) for 24 h before Sequences were base called and assembled to a 563 bp align- mounting in Histomount (National Diagnostics, USA), and ment in CodonCode Aligner v3.7.1.1 and subsequently examined under an Olympus BH-1 light microscope. aligned in Sea-View 4 (Galtier et al., 1996) using Muscle 3.6

Table 1. List of the species and the collection data of all of the specimens used in this study.

Queensland Museum Species Location Depth Depth Latitude Longitude ITS CO1 Registration Deploy (m) Retrieve (m) (Degrees) (Degrees)

G329825 N. clavata Jumeau East 470 621 23.715 S 168.257 E ITS CO1 G329756 N. fulvodesmus Jumeau East 470 621 23.715 S 168.257 E ITS CO1 G329757 N. fulvodesmus Jumeau East 470 621 23.715 S 168.257 E ITS CO1 G329758 N. fulvodesmus Jumeau East 470 621 23.715 S 168.257 E ITS G329759 N. fulvodesmus Jumeau East 470 621 23.715 S 168.257 E ITS G329760 N. fulvodesmus Jumeau East 470 621 23.715 S 168.257 E ITS G329761 N. fulvodesmus Jumeau East 470 621 23.715 S 168.257 E ITS CO1 G329762 N. fulvodesmus Jumeau East 470 621 23.715 S 168.257 E ITS CO1 G329763 N. fulvodesmus Jumeau East 470 621 23.715 S 168.257 E ITS G329764 N. fulvodesmus Jumeau East 470 621 23.715 S 168.257 E ITS G329765 N. fulvodesmus Jumeau East 470 621 23.715 S 168.257 E ITS G329766 N. fulvodesmus Zorro South 623 691 25.400 S 168.333 E ITS G329767 N. fulvodesmus Zorro South 623 691 25.400 S 168.333 E ITS G329768 N. fulvodesmus Zorro South 623 691 25.400 S 168.333 E ITS G329769 N. fulvodesmus Zorro South 623 691 25.400 S 168.333 E ITS CO1 G329770 N. fulvodesmus Zorro South 623 691 25.400 S 168.333 E ITS G329771 N. fulvodesmus Zorro South 623 691 25.400 S 168.333 E ITS G329772 N. fulvodesmus Zorro South 623 691 25.400 S 168.333 E ITS G329773 N. fulvodesmus Zorro South 623 691 25.400 S 168.333 E ITS G329774 N. fulvodesmus Zorro South 623 691 25.400 S 168.333 E ITS G329775 N. fulvodesmus Zorro South 623 691 25.400 S 168.333 E ITS G329776 N. fulvodesmus Zorro North 666 1000 25.344 S 168.309 E ITS G329777 N. fulvodesmus Zorro North 666 1000 25.344 S 168.309 E ITS G329778 N. fulvodesmus Zorro North 666 1000 25.344 S 168.309 E ITS G329779 N. fulvodesmus Zorro North 666 1000 25.344 S 168.309 E ITS G329780 N. fulvodesmus Zorro North 666 1000 25.344 S 168.309 E ITS G329781 N. fulvodesmus Zorro North 666 1000 25.344 S 168.309 E ITS G329782 N. fulvodesmus Zorro North 666 1000 25.344 S 168.309 E ITS G329783 N. fulvodesmus Zorro North 666 1000 25.344 S 168.309 E ITS G329784 N. fulvodesmus Zorro North 666 1000 25.344 S 168.309 E ITS G329785 N. fulvodesmus Zorro North 666 1000 25.344 S 168.309 E ITS G329786 N. fulvodesmus Eponge North 530 540 24.887 S 168.364 E ITS G329787 N. fulvodesmus Eponge North 530 540 24.887 S 168.364 E ITS G329788 N. fulvodesmus Eponge North 530 540 24.887 S 168.364 E ITS G329789 N. fulvodesmus Eponge North 530 540 24.887 S 168.364 E ITS G329790 N. fulvodesmus Eponge North 530 540 24.887 S 168.364 E ITS G329791 N. fulvodesmus Eponge North 530 540 24.887 S 168.364 E ITS G329792 N. fulvodesmus Eponge North 530 540 24.887 S 168.364 E ITS G329793 N. fulvodesmus Eponge North 530 540 24.887 S 168.364 E ITS G329794 N. fulvodesmus Eponge North 530 540 24.887 S 168.364 E ITS G329795 N. fulvodesmus Eponge North 530 540 24.887 S 168.364 E ITS G329796 N. fulvodesmus Eponge South 518 586 24.937 S 168.361 E ITS G329797 N. fulvodesmus Eponge South 518 586 24.937 S 168.361 E ITS G329798 N. fulvodesmus Eponge South 518 586 24.937 S 168.361 E ITS G329799 N. fulvodesmus Eponge South 518 586 24.937 S 168.361 E ITS G329800 N. fulvodesmus Eponge South 518 586 24.937 S 168.361 E ITS G329801 N. fulvodesmus Eponge South 518 586 24.937 S 168.361 E ITS G329802 N. fulvodesmus Eponge South 518 586 24.937 S 168.361 E ITS G329803 N. fulvodesmus Eponge South 518 586 24.937 S 168.361 E ITS G329804 N. fulvodesmus Eponge South 518 586 24.937 S 168.361 E ITS G329805 N. fulvodesmus Eponge South 518 586 24.937 S 168.361 E ITS G329806 N. fulvodesmus Kaimon Maru 600 896 24.756 S 168.104 E ITS CO1 G329807 N. fulvodesmus Kaimon Maru 600 896 24.756 S 168.104 E ITS G329808 N. fulvodesmus Kaimon Maru 600 896 24.756 S 168.104 E ITS G329809 N. fulvodesmus Kaimon Maru 600 896 24.756 S 168.104 E ITS G329810 N. fulvodesmus Kaimon Maru 600 896 24.756 S 168.104 E ITS G329811 N. fulvodesmus Kaimon Maru 600 896 24.756 S 168.104 E ITS G329812 N. fulvodesmus Kaimon Maru 600 896 24.756 S 168.104 E ITS G329813 N. fulvodesmus Kaimon Maru 600 896 24.756 S 168.104 E ITS CO1 G329814 N. fulvodesmus Kaimon Maru 600 896 24.756 S 168.104 E ITS G329815 N. fulvodesmus Kaimon Maru 600 896 24.756 S 168.104 E ITS CO1 G329816 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1 G329817 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1

Continued

Table 1. Continued

Queensland Museum Species Location Depth Depth Latitude Longitude ITS CO1 Registration Deploy (m) Retrieve (m) (Degrees) (Degrees)

G329818 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1 G329819 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1 G329821 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1 G329822 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1 G329823 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1 G329824 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1 G329826 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G329827 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G329828 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G329829 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G329830 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G329831 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G329832 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G329833 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G329834 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G329835 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G318751 I. mirabilis Jumeau West 285 285 23.685 S 168.017 E CO1 G329906 I. mirabilis Jumeau West 285 285 23.685 S 168.017 E CO1 G329908 I. mirabilis Jumeau West 285 285 23.685 S 168.017 E CO1 G329909 I. mirabilis Jumeau West 285 285 23.685 S 168.017 E CO1 G329910 I. mirabilis Jumeau West 285 285 23.685 S 168.017 E CO1 G329911 I. mirabilis Jumeau West 285 285 23.685 S 168.017 E CO1 G329912 I. mirabilis Jumeau West 285 285 23.685 S 168.017 E CO1 G329913 I. mirabilis Jumeau West 285 285 23.685 S 168.017 E CO1 G329914 I. mirabilis Jumeau West 285 285 23.685 S 168.017 E CO1 G329915 I. mirabilis Jumeau West 285 285 23.685 S 168.017 E CO1 G329916 I. mirabilis Kaimon Maru 320 345 24.753 S 168.121 E CO1 G329917 I. mirabilis Kaimon Maru 320 345 24.753 S 168.121 E CO1 G329918 I. mirabilis Kaimon Maru 320 345 24.753 S 168.121 E CO1 G329919 I. mirabilis Kaimon Maru 320 345 24.753 S 168.121 E CO1 G329920 I. mirabilis Kaimon Maru 320 345 24.753 S 168.121 E CO1 G329921 I. mirabilis Kaimon Maru 320 345 24.753 S 168.121 E CO1 G329922 I. mirabilis Kaimon Maru 320 345 24.753 S 168.121 E CO1 G329923 I. mirabilis Kaimon Maru 320 345 24.753 S 168.121 E CO1 G329924 I. mirabilis Kaimon Maru 320 345 24.753 S 168.121 E CO1 G329925 I. mirabilis Kaimon Maru 320 345 24.753 S 168.121 E CO1 G329926 I. mirabilis Blanc Nouveau 2 275 348 23.277 S 168.233 E CO1 G329927 I. mirabilis Blanc Nouveau 2 275 348 23.277 S 168.233 E CO1 G329929 I. mirabilis Blanc Nouveau 2 275 348 23.277 S 168.233 E CO1 G329930 I. mirabilis Blanc Nouveau 2 275 348 23.277 S 168.233 E CO1 G329931 I. mirabilis Blanc Nouveau 2 275 348 23.277 S 168.233 E CO1 G329932 I. mirabilis Blanc Nouveau 2 275 348 23.277 S 168.233 E CO1 G329933 I. mirabilis Blanc Nouveau 2 275 348 23.277 S 168.233 E CO1 G329934 I. mirabilis Blanc Nouveau 2 275 348 23.277 S 168.233 E CO1 G329935 I. mirabilis Blanc Nouveau 2 275 348 23.277 S 168.233 E CO1 G329936 I. mirabilis Munida 270 350 22.998 S 168.363 E CO1 G329937 I. mirabilis Munida 270 350 22.998 S 168.363 E CO1 G329938 I. mirabilis Munida 270 350 22.998 S 168.363 E CO1 G329939 I. mirabilis Munida 270 350 22.998 S 168.363 E CO1 G329940 I. mirabilis Munida 270 350 22.998 S 168.363 E CO1 G329941 I. mirabilis Munida 270 350 22.998 S 168.363 E CO1 G329942 I. mirabilis Munida 270 350 22.998 S 168.363 E CO1 G329943 I. mirabilis Munida 270 350 22.998 S 168.363 E CO1 G329944 I. mirabilis Munida 270 350 22.998 S 168.363 E CO1 G329945 I. mirabilis Munida 270 350 22.998 S 168.363 E CO1 G329952 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1 G329953 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G331823 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G331825 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G331827 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G331828 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G331829 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G331830 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1

Continued

Table 1. Continued

Queensland Museum Species Location Depth Depth Latitude Longitude ITS CO1 Registration Deploy (m) Retrieve (m) (Degrees) (Degrees)

G331831 N. zingiberadix Introuvable 591 1032 24.663 S 168.674 E CO1 G331832 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1 G331833 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1 G331834 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1 G331836 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1 G331837 N. zingiberadix Jumeau East 470 621 23.715 S 168.257 E CO1

(Edgar, 2004). Sequences are published in NCBI GenBank RESULTS (Acc. No. KR270646-KR270725) and in the Sponge Barcoding Database (www.spongebarcoding.org). Neoschrammeniella fulvodesmus A total of 114 ITS genotypes were recovered from the 57 speci- Analyses of genetic variation mens (Table 2). A higher number of genotypes, and higher Genetic diversity was expressed as nucleotide diversity (p; the gene and nucleotide diversities were found for ITS1 than for probability that two randomly chosen homologous nucleo- ITS2 and 5.8S. There were 24 nucleotide differences in the tides differ) and gene diversity (h; the probability that two ran- 5.8S rRNA section, with only six single base changes found domly chosen genotypes differ), and calculated in Arlequin in the 5.8S region. One sequence had two of these changes 3.1 (Excoffier et al., 2005). The hierarchical distribution and only two sequences shared the same change and they of genetic diversity was analysed in the AMOVA framework were from different seamounts. Overall gene diversity was (Analysis of Molecular Variance) also using Arlequin 3.1, high (h ¼ 0.9843) when compared with nucleotide diversity where genetic variation was partitioned into within- (p ¼ 0.127324). individual, among-individual within-population, and among- Six of the 114 genotypes were found in a single specimen. population components. Significance of variance components In two of the 57 specimens, only one plasmid was successfully was assessed using 10 000 randomizations. Within-individual sequenced. Of the remaining 55 individuals for which multiple variation was included as a variance component due to the sequences were obtained, 52 (94.5%) exhibited intra-genomic presence of IGPs. Pairwise FSTs between sampled populations polymorphism, with between two and six genotypes present were calculated in Arlequin 3.1. To indirectly assess the con- within an individual specimen. tribution of sexual vs asexual modes of reproduction, we An AMOVA looking at the individuals and the variation examined levels of linkage disequilibrium, where high levels within each individual shows 84.57% of the variation is indicate either non-random sexual reproduction (inbreeding) within the individuals, compared with 15.66% between the or asexual reproduction. Linkage disequilibrium was calcu- individuals within each seamount (Table 3). The most lated in Arlequin 3.1 (Excoffier et al., 2005). Analyses of the common genotype occurred 14 times and 63 genotypes three lithistid species were carried out independently. occurred only once. Sequencing of the ITS was only carried out for N. fulvodesmus. The AMOVA for all of the populations and for the entire The CO1 fragment of N. fulvodesmus was only sequenced on sequence including ITS1 and ITS2 indicates that virtually all eight individuals to detect if there was any variation within of the variation (97.38%) is contained within each seamount this species, while all collected I. mirabilis and N. zingiberadix (Table 4). were screened. Most of the genotypes (71/114) were found on a single seamount, with the number of unique genotypes ranging from six at Zorro North to 19 at Eponge South (Figure 1). Most shared Phylogenetic analyses genotypes were limited to two seamounts (40 genotypes), Maximum likelihood reconstructions were performed with however, one genotype occurred at three seamounts RAxML-7.2.5 (Stamatakis, 2006) under the GTR + (Jumeau East, Eponge North and Zorro North). The most GAMMA model of substitution. Branch support was inferred common genotype (14 specimens) occurred at four seamounts with 1000 rapid bootstrap replicates. (Jumeau East, Kaimon Maru, Eponge South and Zorro North)

Table 2. Comparison of diversities and FSTsofN. fulvodesmus calculated from ITS on the seamounts in order of increasing latitude.

Seamount Sample size (N) Number of Number of Nucleotide Gene FST sequences genotypes (h) diversity (p) diversity (h)

Jumeau East 9 31 20 0.101965 0.9600 0.04672 Kaimon-Maru 9 39 35 0.248202 0.9638 0.01040 Eponge North 10 23 21 0.311829 1.0000 20.00279 Eponge South 10 35 29 0.046155 0.8758 0.06069 Zorro North 9 31 27 0.315330 0.9815 20.00678 Zorro South 10 38 29 0.100148 0.9644 0.04725 All 57 197 152 0.127324 0.9843

Table 3. AMOVA results of the entire ITS sequence of N. fulvodesmus between seamounts, between individuals within seamounts and within individuals.

Source of variation Degrees of freedom Sum of squares Variance components Percentage of variation FST Between seamounts 5 625.243 20.22734 20.24 0.15426 Between individual genotypes 43 5052.946 14.94180 15.66 within seamounts Within individuals 77 6211.692 80.67132 84.57 Total 125 11,889.881 95.38578

and the second most common genotype (8 specimens) also When the seamounts are clustered geographically, the vari- occurred at four seamounts (Jumeau East, Kaimon Maru, ation is distributed within each population rather than Eponge South and Zorro South). No genotype was shared between populations or groups of populations even when across all six seamounts. adjacent seamounts are compared with other seamounts. When each seamount is regarded as a distinct population, There is no latitudinal gradient showing genetic flow from the pairwise genetic differences (Table 5) showed that the two the north to south nor is there flow from the south to the pairs of populations that are physically closest together, i.e. north. There was no latitudinal gradient between the sea- Zorro North and Zorro South, and Eponge North and mounts. Neither was there any longitudinal gradient for Eponge South, show significant pairwise FST. The only other gene diversity, nucleotide diversity and haplotypic diversity significant pairwise differences are between Zorro South and between the seamounts. There were no significant bathymetric Jumeau East, and between Zorro South and Eponge South. gradients, or bathymetric ranges amongst the genotypes or the

Table 4. AMOVA results of the entire ITS sequence of N. fulvodesmus between seamounts and within seamounts.

Source of variation Degrees of freedom Sum of squares Variance components Percentage of variation FST Between seamounts 5 592.141 2.02720 2.62 0.02624 Within seamounts 123 9254.269 75.23796 97.38 Total 128 9846.411 77.26516

Fig. 1. Distribution of the N. fulvodesmus ITS genotypes on the seamounts (ALA, 2014).

Table 5. Pairwise differences in FST of N. fulvodesmus calculated from ITS between the seamounts using the distance method.

Seamount Jumeau East Kaimon-Maru Eponge North Eponge South Zorro North Zorro South

Jumeau East 0.00000 Kaimon-Maru 0.01597 0.00000 Eponge North 0.06331 20.02924 0.00000 Eponge South 20.01924 0.05118 0.11365∗ 0.00000 Zorro North 20.02223 0.01823 0.06110 0.00663 0.00000 Zorro South 0.06132∗ 20.02529 20.03920 0.09611∗ 0.06125∗ 0.00000

∗Indicates signiﬁcant difference from 0 at P ¼ 0.05.

diversities. Most of the depths of the dredges on the sea- longitudinal or depth separation. All specimens were from mounts from which the specimens of N. fulvodesmus were two seamounts Jumeau East and Introvable and there was recovered were from around 500 m depth (ranging from no separation between the seamounts (Table 8). 470 to 691 m) (Table 1), with the exception of Kaimon Linkage disequilibrium was not calculated because of the Maru and Zorro North which reached depths of 896 and monomorphism at all the loci of the CO1 fragment. No mor- 1000 m respectively. Interestingly the highest diversities phological differences were detected between the specimens. were found from the Eponge North seamount with the smal- lest depth range of dredges. All of the individual populations showed significant levels Isabella mirabilis of linkage disequilibrium amongst the polymorphic loci as Sequencing of the CO1 fragment of all specimens of the shown in Table 6. species I. mirabilis, divided the specimens into four distinct Eight individuals were screened using CO1 from three sea- genotypes with one very large genotype comprising the major- mounts to detect if there was any variation within this species. ity of specimens (23/38) (Figure 2). These sponges were from Table 7 compares the diversity of the seamounts, which is four seamount sites, each seamount with three or four geno- zero, and there were no polymorphic loci found in the CO1 types (Table 9). There was one genotype present only in two fragment. All eight individuals were found to belong to the specimens. There were other genotypes comprised of five same mtDNA genotype and were found at all three seamounts and eight individuals (Figure 3). All four seamounts had (Figure 3). These eight individuals when analysed with ITS three of the four genotypes in different combinations, so found 23 of the 114 genotypes. This ranged from two indivi- there was no specialization of genotypes for a specific sea- duals with only one genotype detected to another individual mount. All of the specimens were collected from between with eight genotypes. These are likely to be related to the 270 and 348 m depth (Table 1) and the genotypes were not number of clones sequenced. specific for any particular depth. Morphological analysis of Pairwise differences in FST using the distance method the genotypes of I. mirabilis only revealed variation in the rela- between the seamounts for CO1was not calculated for N. ful- tive proportions of microscleres. vodesmus because of the low numbers of individuals sampled Significant differences were found in FST values in sea- from the population, likewise linkage disequilibrium could not mounts of the species I. mirabilis between Jumeau West and be calculated because there were no polymorphic loci. All the Munida, and Jumeau West and Blanc Nouveau 2 only loci at the CO1 fragment were monomorphic. No morpho- (Table 10, see also Figure 2). In order to test for population logical differences were detected between the specimens. subdivision the seamounts were clustered into two groups as identified by FST analysis. One group contained the two seamounts of Munida and Blanc Nouveau 2, and the other Neoaulaxinia zingiberadix group contained the seamounts Jumeau West and Kaimon All 32 specimens of N. zingiberadix were identical for CO1 Maru. This revealed that 97.79% of the variation was found sequenced region (Figure 3). There was no latitudinal, within the seamount clusters, so there was no population structure here. Clustering of the seamounts using a distance-related latitudinal gradient provided a higher signal Table 6. Summary of significant polymorphic loci of N. fulvodesmus with of the variation spread between the populations, with cluster- linkage disequilibrium. ing of Jumeau West, Munida and Blanc Nouveau 2 compared with Kaimon Maru. On all accounts most of the variation is Seamount Number of Loci significant % of loci with included within the populations (92.66%). combinations disequilibrium significant linkage (P 5 0.05) disequilibrium Linkage disequilibrium was calculated for the polymorphic loci at the seamounts. For two sites, Munida and Blanc Jumeau East 171 28 16.4% Nouveau 2, there were no polymorphic loci with significant Zorro South 435 50 11.5% linkage disequilibrium. This contrasts with the other two sea- Zorro North 105 20 19.0% mounts of Jumeau West and Kaimon Maru, which had both Eponge North 231 13 5.6% of the polymorphic loci showing significant (P ¼ 0.05) Eponge South 276 35 12.7% linkage disequilibrium. This is all overshadowed by the fact Kaimon-Maru 435 63 14.5% Combined 45 26 57.8% that for the CO1 region from the 597 usable nucleotide sites populations there were polymorphisms only at a maximum of three sites for Munida and all other seamounts had two polymorphic

Table 7. Comparison of diversities of the seamounts of N. fulvodesmus from CO1 in order of increasing latitude.

Seamount Sample size (N) Number of sequences Number of genotypes (h) Nucleotide diversity (p) Gene diversity (h)

Jumeau East 4 4 1 0 1 Kaimon Maru 3 3 1 0 1 Zorro South 1 1 1 0 1 Total 8 8 1 0 1

Table 8. Comparison of diversities of N. zingiberadix calculated from CO1 of the seamounts in order of increasing latitude.

Seamount Sample size (N) Number of sequences Number of genotypes (h) Nucleotide diversity (p) Gene diversity (h)

Jumeau East 14 14 1 0 1 Introuvable 18 18 1 0 1 Total 32 32 1 0 1

Fig. 2. Distribution of the I. mirabilis CO1 genotypes on the seamounts (ALA, 2014).

Table 9. Comparison of diversities of I. mirabilis calculated from CO1 of the seamounts in order of increasing latitude.

Seamount Sample size (N) Number of sequences Number of genotypes (h) Nucleotide diversity (p) Gene diversity (h)

Munida 10 10 4 0.001266 1 Blanc Nouveau 2 9 9 3 0.000723 1 Jumeau WestWest 9 9 3 0.001719 1 Kaimon Maru 10 10 3 0.002049 1 Total 38 38 4 0.010 1

Fig. 3. CO1 maximum likelihood reconstruction of the samples analysed in this study. Numbers following the taxon names are Queensland Museum collection numbers (QM G) or GenBank accession numbers. Numbers on the branches indicate rapid bootstrap support values (.70). The scale bar depicts substitutions per site.

sites. This contrasts strongly to the two other species, which gene ﬂows between the seamounts. Seamounts are topograph- showed no polymorphism at all for the CO1. ically small and isolated, suggesting an island model, which has led to an expectation of high endemism and species rich- ness on seamounts (Richer de Forges et al., 2000). From a DISCUSSION purely geomorphological sense one would expect each separate seamount to behave at least as a discrete population. These This study demonstrates that the three lithistid sponge popu- seamounts would then have reduced gene ﬂow and be particu- lations have varying levels of population connectivity amongst larly susceptible to genetic drift because of their small size seamounts, ranging from very well connected subpopulations (Le Goff-Vitry et al., 2004). However, the results in the on individual seamounts to subpopulations with moderate present study did not support this. Contrary to the island

Table 10. Pairwise differences in FST of I. mirabilis calculated from CO1 sponges are long lived and slow growing coupled with slow between the seamounts using the distance method. mitochondrial substitutions (Shearer et al., 2002). The over- whelming proportion of diversity detected by ITS within the Seamount Munida Blanc Jumeau Kaimon Nouveau 2 West Maru same specimens of N. fulvodesmus is contained within intragenomic diversity, and in comparison there are comparatively Munida 0.00000 small differences within seamounts and virtually no differences Blanc Nouveau 2 20.08221 0.00000 ∗ ∗ between seamounts. With the ITS there were no examples of Jumeau West 0.21921 0.36719 0.00000 the same genotype occurring at all six sites, but there were Kaimon Maru 20.00076 20.00130 20.01170 0.00000 many unique genotypes at each seamount. Because these ∗Indicates significant difference from 0 at P ¼ 0.05. species appear to be very slow growing and long lived there does not need to be much gene flow between the seamounts to maintain the genetic uniformity and the vagility of the model, seamounts are not surrounded by hydrological barriers larval stage may still be quite low. In theory, the exchange of and populations might have high gene flow between sea- a single individual between large populations is enough to mounts, a finding also concluded by other researchers counter any effects from genetic drift (Silva & Russo, 2000) (Samadi et al., 2007; Clark et al., 2012). The lack of significant and with a sponge with a generation time of potentially difference between the sites studied here indicates all the sea- several hundred years this is not impossible. mounts form one meta-population. The alleged high rates of Clusters of ITS genotypes in N. fulvodesmus on seamounts gene flow of the species studied here amongst the seamounts are likely to be the result of either: adjacent settling of larvae, are presumably caused largely by currents, e.g. migration of clonality via asexual reproduction, colony fragmentation into larvae, sponge tissue drifting or transmission on ghost nets. discrete individuals, inbreeding populations or even self- With potentially year-round reproduction sponges would be fertilizing populations. However, it could also be a function able to take advantage of differing seasonal currents to of sampling as deep sea lithistids have been observed to migrate (Longo et al., 2012). The concept of a short-lived adhere to the rock in distinct clusters (Ekins’ personal observa- crawling stage as suggested for some sponge species tions from ROV research Deep Down Under Expedition; www. (Hooper & Van Soest, 2002) is likely to be untenable here. deepdownunder.de). Much of the diversity in sponge popula- Indeed, the presence of the large trough between these sea- tions has previously been attributed to sex and not asexuality mounts likely represents a serious barrier to crawling larvae. (Dailianis et al., 2011; Uriz & Turon, 2012). However, It is most likely that the sponges studied here have a highly asexual components may also add to the diversity by colony mobile longer-lived egg and sperm stage or egg/zygote phase formation of multiple genotypes such as chimeras. Chimeras than previously thought which enables them to survive the have been reported in other sessile marine invertebrates, e.g. distance between the seamounts. Other studies have found corals (Puill-Stephan et al., 2009), ascidians (Sommerfeldt that species of molluscs with high genetic structure have et al., 2003) as well as sponges (Wulff, 1990; Maldonado, larvae with low dispersal ability and species with low genetic 1998; Blanquer & Uriz, 2011). Somatic mutations have also structure have larvae with high dispersal ability (Todd et al., been suggested as a potential mean for increasing genotypic 1998; Boisselier-Dubayle, 1999; Kyle & Boulding, 2000; diversity within an individual (Buss, 1982), but these options Collin, 2001). Bohonak (1999) indicated there is a correspond- appear less likely to explain the diversity observed here. ence between dispersal and gene flow. A sexual population is evidenced by the variation in the ITS All specimens of Neoaulaxinia zingiberadix and region in N. fulvodesmus, high levels of gene and genotypic Neoschrammeniella fulvodesmus, when sequenced for CO1, diversity coupled with low levels of nucleotide diversity. showed only one single genotype. CO1 sequencing of Isabella However, while within this species there are also indirect indi- mirabilis revealed four genotypes and each seamount had cators of asexual components as evidenced by the occurrence three of the four genotypes. There was no specialization for of the same common genotypes on the different seamounts genotypes on each seamount. Therefore this species is an and significant linkage disequilibrium, however asexual repro- example of a lithistid species that mixes well between sea- duction in rock sponges has yet to be described. For N. fulvo- mounts. This also confirms that CO1 provides resolution at desmus and N. zingiberadix the dominance of one genotype in population level for this species. Other researchers using CO1 CO1 may be seen as an indication of asexuality, however this have also reported low numbers of genotypes, although in dif- has to be tempered by the conservation of the CO1 gene ferent sponge species (Wo¨rheide, 2006;Hoshinoet al., 2008; (Shearer et al., 2002; Erpenbeck et al., 2006). The multiple Whalan et al., 2008; Dailianis et al., 2011). The presence of genotypes present in I. mirabilis indicate there is some only one genotype in N. zingiberadix and N. fulvodesmus balance between asexual and sexual reproduction at least in hints that genetic drift has occurred. The formation of external some part of the species history that has been maintained buds of hexactinellids in the stable environment of the on different seamounts. This phenomenon has also been Antarctic waters (Teixido et al., 2006) may enable the forma- found in sponges (Zilberberg et al., 2006a), corals (Foster tion of a stable clonal population in the immediate vicinity. et al., 2007; Morrison et al., 2011) and ascidians Indeed the formation of buds was observed on one of the speci- (Perez-Portela & Turon, 2008). For I. mirabilis it just means mens of I. mirabilis in this study. If the ancestral population of that it had recombination events at some point even prior to one of these lithistid sponges was separated a long time ago but asexual transmission between the seamounts, which has reproduced clonally we would expect two discrete populations. been maintained in the population by asexual reproduction. All the seamounts are most likely functioning as a single popu- The lack of subdivision indicates that either they all arose lation suggested by the presence of one single CO1 genotype of together and evolved very slowly with no continued diver- N. zingiberadix and N. fulvodesmus. An alternative explanation gence or they are mixing and interbreeding, with substantial to the lack of genotypic diversity in CO1 is because the rock gene flow between the seamounts.

Molecular studies of other sponges have detected strong REFERENCES spatial structure and restricted gene flow, reproductively iso- lating the populations and thus increasing the chance for spe- Atlas of Living Australia (ALA) (2014). Available at: http://bie.ala.org.au/ ciation (e.g. Duran et al., 2004a; Blanquer et al., 2009). Cryptic (accessed 16 April 2014). speciation amongst what was thought to be cosmopolitan Ayre D.J. and Willis B.L. (1988) Population structure in the coral Pavona species correlates with potential speciation, presumably due cactus: clonal genotypes show little phenotypic plasticity. Marine to the low dispersal abilities of many sponges (Wo¨rheide Biology 99, 495–505. et al., 2002b; Duran & Ru¨tzler, 2006; Blanquer & Uriz, 2007). Battershill C.N. and Bergquist P.R. (1990) The influence of storms on The lack of any genetic differences along latitudinal or lon- asexual reproduction, recruitment, and survivorship of sponges. In gitudinal gradients indicates that currents around the sea- Ru¨tzler K. (eds) New perspectives in sponge biology. Washington, mounts potentially have eddies, caused by the unidirectional DC: Smithsonian Institution Press, pp. 397–403. East Australian Current heading south-easterly, along the Bautista-Guerrero E., Carballo J.L. and Maldonado M. (2010) Western edge of the Norfolk Ridge (Ridgway & Dunn, Reproductive cycle of the coral-excavating sponge Thoosa mismalolli 2003). The two pairs of seamounts that have physically close (Clionaidae) from Mexican Pacific coral reefs. Invertebrate Biology pairs of seamounts, i.e. Zorro North and Zorro South, and 129, 285–296. Eponge North and Eponge South are not genetically close. This result is in contrast to Duran & Ru¨tzler (2006) who Bentlage B. and Worheide G. (2007) Low generic structuring among only found virtually all of the populations of Chondrilla cf. Pericharax heteroraphis (Porifera; Calcarea) population from the Great Barrier Reef (Australia), revealed by analysis of nrDNA and nucula Schmidt, 1862, to be significantly different. nuclear intron sequences. Coral Reefs 26, 807–816. This study demonstrates that sponge populations on the deep seamounts studied here appear to be well connected. Blanquer A. and Uriz M.J. (2007) Cryptic speciation in marine sponges Despite being topographically small and isolated, the individ- evidenced by mitochondrial and nuclear genes. A phylogenetic ual seamounts do not show high levels of population structure approach. Molecular Phylogenetics and Evolution 45, 392–397. based on the molecular loci studied here. Not only do sea- Blanquer A. and Uriz M.J. (2011) “Living together apart”: the hidden mounts share the same sponge species they also share the genetic diversity of sponge populations. Molecular Biology and same genotypes indicating a mixture of sexual and asexual Evolution 28, 2435–2438. reproductive strategies with better dispersal properties than Blanquer A., Uriz M.J. and Caujape-Castells J. (2009) Small-scale spatial previously thought. genetic structure in Scopalina lophyropoda, and encrusting sponge with philopatric larval dispersal and frequent fission and fusion events. Marine Ecology Progress Series 380, 95–102. Blanquer A., Uriz M.J. and Pascal M. (2005) Polymorphic microsatellite ACKNOWLEDGEMENTS loci isolated from the marine sponge Scopalina lophyropoda (Demospongiae: Halichondrida). Molecular Ecology Notes 5, 466–468. We would like to thank Bertrand Richer de Forges and Thomas Schlacher for collection of the specimens and all Bohonak A.J. (1999) Dispersal, gene flow and population structure. Quarterly Review of Biology 74, 21–45. the crew and scientific staff on the ‘RV Alis’ for the NORFOLK 2 Cruise. We would like to thank Emma Boisselier-Dubayle M.C. (1999) Genetic relationships between marine Sherlock from the Natural History Museum for providing a and marginal-marine populations of Cerithium species from the fragment of the holotype of N. zingiberadix for examination. Mediterranean Sea. Marine Biology 135, 671–682. We would also like to thank Kathryn Hall, Monika Bryce Bond C. and Harris A.K. (1988) Locomotion of sponges and its physical and Jessica Worthington-Wilmer for technical advice, labora- mechanism. Journal of Experimental Zoology 246, 271–284. tory support and assistance. ME and DE would especially like Borchiellini C., Alivon E. and Vacelet J. (2004) The systematic position to thank Dan Jackson, Alina Craige, Maja Adamska, Gabriele of Alectona (Porifera, Demospongiae): a tetractinellid sponge. Bu¨ttner and Simone Scha¨tzle for help with molecular work Bollettino dei Musei e degli Istituti Biologici della Universita` di and Bernie Degnan for making space in his laboratory for Genova 68, 209–217. cloning. We also would like to thank Liam Town and Carol Buss L.W. (1982) Somatic cell parasitism and the evolution of somatic Wicking for help with sequencing alignment and Andrea tissue compatibility. Proceedings of the National Academy of Sciences Crowther for suggestions about nested clade analysis. We USA 79, 5337–5341. would also like to thank Andrzej Pisera for his help with identification of one of the specimens of N. fulvodesmus. ME Calderon I., Ortega N., Duran S., Becerro M.A., Pascal M. and Turon would also like to thank Judy Powell and Monique Grol for X. (2007) Finding the relevant scale: clonality and genetic structure in help with the manuscript. a marine invertebrate (Carme crambe, Porifera). Molecular Ecology 16, 1799–1810. Clark M.R., Schlacher T.A., Rowden A.A., Stocks K.I. and Consalvey M. (2012) Science priorities for seamounts: research links to conservation FINANCIAL SUPPORT and management. PLoS ONE, e29232. doi:10.1371/journal.pone. 0029232. This research received in part funding of the Alfred P. Sloan Collin R. (2001) The effects of mode of development on phylogeography Foundation, Census of Marine Life’s Barcode of Life and population structure of North Atlantic Crepidula (Gastropoda: Initiative (#2007-12-1-C4: ‘DNA Barcoding of Marine Calyptraeidae). Molecular Ecology 10, 2249–2262. Biodiversity (MarBOL)’). DE and GW acknowledge funding Dailianis T., Tsigenopoulos C.S., Dounas C. and Voultsiadou E. (2011) from the Deutsche Forschungsgemeinschaft projects (DFG) Genetic diversity of the imperilled bath sponge Spongia officinalis ER611/3-1, WO896/15-1. Linnaeus, 1759 across the Mediterranean Sea: patterns of population

differentiation and implications for taxonomy and conservation. Jackson J.B.C. (1986) Modes of dispersal of clonal benthic invertebrates: Molecular Ecology 20, 3757–3772. consequences for species’ distributions and genetic structure of local populations. Bulletin of Marine Science 39, 588–606. Duran S., Giribet G. and Turon X. (2004a) Phylogeographical history of the sponge Crambe crambe (Porifera, Poecilosclerida): range expan- Kaye H.R. (1990) Reproduction in West Indian commercial sponges: sion and recent invasion of the Macaronesian islands from the oogenesis, larval development, and behaviour. In Ru¨tzler K. (eds) Mediterranean Sea. Molecular Ecology 13, 109–122. New perspectives in sponge biology. Washington, DC: Smithsonian Institution Press, pp. 161–435. Duran S., Pascal M., Estoup A. and Turon X. (2004c) Strong population structure in the marine sponge Crambe crambe (poecilosclerida) as Kelly M. (2007) The marine fauna of New Zealand: Porifera: lithistis revealed by microsatellite markers. Molecular Ecology 13, 511–522. Demospongiae (Rock Sponges). NIWA Biodiversity Memoir 121, 1–100. Duran S., Pascal M., Estoup A. and Turon X. (2002) Polymorphic microsatellite loci in the sponge Crambe crambe (Porifera: Klautau M., Russo C.A.M., Lazoski C., Boury-Esnault N., Thorpe J.P. Poecilosclerida) and their variation in two distant populations. and Sole´-Cava A.M. (1999) Does cosmopolitanism result from over- Molecular Ecology Notes 2, 478–480. conservative systematics? A case study using the marine sponge Chondrilla nucula. Evolution 53, 1414–1422. Duran S., Pascual M. and Turon X. (2004b) Low levels of genetic variation in mtDNA sequences over the western Mediterranean and Kyle C.J. and Boulding E.G. (2000) Comparative population genetic Atlantic range of the sponge Crambe crambe (Poecilosclerida) structure of marine gastropods (Littorina spp.) with and without Crambe crambe (Poecilosclerida). Marine Biology 144, 31–35. pelagic larval dispersal. Marine Biology 137, 835–845. Duran S. and Ru¨tzler K. (2006) Ecological speciation in a Caribbean Le Goff-Vitry M.C., Pybus O.G. and Rogers A.D. (2004) Genetic struc- marine sponge. Molecular Phylogenetics and Evolution 40, 292–297. ture of the deep-sea coral Lophelia pertusa in the northeast Atlantic revealed by microsatellites and internal transcribed spacer sequences. Edgar R.C. (2004) MUSCLE: multiple sequence alignment with high Molecular Ecology 13, 537–549. accuracy and high throughput. Nucleic Acids Research 32, 1792–1797. Leong W. and Pawlik J.R. (2010) Fragments of propagules? Reproductive Ereskovsky A.V. (2010) The comparative embryology of sponges. tradeoffs among Callyspongia spp. from Florida coral reefs. Oikos 119, Saint-Petersburg: Springer. 1417–1422. Ereskovsky A.V. and Tokina D.B. (2007) Asexual reproduction in homo- Le´vi C. (1991) Lithistid sponges from the Norfolk Rise. Recent and scleromorph sponges (Porifera; Homoscleromorpha). Marine Biology Mesozoic genera. In Reitner J. and Keupp H. (eds) Fossil and recent 151, 425–434. sponges. Berlin: Springer-Verlag, pp. 72–82. Erpenbeck D., Hooper J.N.A. and Wo¨rheide G. (2006) CO1 phylogenies Le´vi C. and Le´vi P. (1983) E´ponges Te´tractinellides et Lithistides bath- in diploblasts and the ‘Barcoding of Life’ – are we sequencing a sub- yales de Nouvelle-Cale´donie. Bulletin du Museúm National optimal partition? Molecular Ecology Notes 6, 550–553. d’Histoire Naturelle, Paris (4) 5, 101–168. Excoffier L., Laval G. and Schneider S. (2005) Arlequin ver. 3.0: an inte- Longo C., Pontassuglia C., Corriero G. and Gaino E. (2012) Life-cycle grated software package for population genetics data analysis. traits of Paraleucilla magna, a calcerous sponge invasive in a coastal Evolutionary Bioinformatics Online 1, 47–50. Mediterranean basin. PLoS ONE 7, 1–12. Foster N.L., Iliana B.B. and Mumby P.J. (2007) Sexual vs. asexual recom- Lopez J.V., Peterson C.L., Willoughby R., Wright A.E., Enright E., bination in an ecosystem engineer: the massive coral Montastrea Zoladz S., Reed J.K. and Pomponi S.A. (2002) Characterization of annularis. Journal of Animal Ecology 76, 384–391. genetic markers for in vitro cell line identification of the marine sponge Axinella corrugata. Journal of Heredity 93, 27–36. Fromont J. and Bergquist P.R. (1994) Reproductive biology of three sponge species of the genus Xestospongia (Porifera: Demospongiae: Maldonado M. (1998) Do chimeric sponges have improved chances of Petrosiida) from the Great Barrier Reef. Coral Reefs 13, 119–126. survival? Marine Ecology Progress Series 164, 301–306. Galtier N., Gouy M. and Gautier C. (1996) SEAVIEW and Maldonado M. (2004) Choanoflagellates, choanocytes, and animal multi- PHYLO_WIN: two graphic tools for sequence alignment and molecu- cellularity. Invertebrate Biology 123, 231–242. lar phylogeny. Computer Applications in the Biosciences 12, 543–548. Maldonado M. and Bergquist P.R. (2002) Phylum porifera. In Young C. Hall K.A., Ekins M.G. and Hooper J.N.A. (2014) Two new desma-less (eds) Atlas of marine invertebrate larvae. San Diego, CA: Academic species of Theonella Gray, 1868, (Demospongiae: Astrophorida: Press, pp. 21–49. Theonellidae) from the Great Barrier Reef, Australia, and a Maldonado M. and Riesgo A. (2008) Reproduction in the Phylum re-evaluation of one species assigned previously to Dercitus Gray, Porifera: a synoptic overview. Treballs de la SCB 59, 29–49. 1867. Zootaxa 3814, 451–477. Maldonado M. and Uriz M.J. (1999a) Sexual propagation by sponge frag- Hall T.A. (1999) Bioedit: a user friendly biological sequence alignment ments. Nature 398, 476. editor and analyis program for Windows 95/98/NT. Nuclei Acids Symposium Series 41, 95–98. Maldonado M. and Uriz M.J. (1999b) An experimental approach to the ecological significance of microhabitat-scale movement in an encrust- Hooper J.N.A. and Van Soest R.W.M. (2002) Systema Porifera. A guide ing sponge. Marine Ecology Progress Series 185, 239–255. to the classification of sponges. New York: Kluwer Academic/Plenum Publishers. Meyer C.P., Geller J.B. and Paulay G. (2005) Fine scale endemism on coral reefs: archipelagic differentiation in turbinid gastropods. Hoshino S., Saito D.S. and Fujita T. (2008) Contrasting genetic structure Evolution 59, 113–125. of two Pacific Hymeniacidon species. Hydrobiologia 603, 313–326. Miller K.J. and Ayre D.J. (2004) The role of sexual and asexual reproduc- Hughes T.P., Ayre D.J. and Connell J.H. (1992) Evolutionary ecology of tion in structuring high latitude populations of the reef coral corals. Trends in Ecology and Evolution 40, 357–365. Pocillopora damicornis. Heredity 92, 557–568. Jablonski D. (1986) Larval ecology and macroevolution in marine inver- Morrison C.L., Ross S.W., Nizinski M.S., Brooke S., Jarnegren J., tebrates. Bulletin of Marine Science 39, 565–587. Waller R.G., Johnson R.L. and King T.L. (2011) Genetic

discontinuity among regional populations of Lophelia pertusa in the Sommerfeldt A.D., Bishop J.D.D. and Wood C.A. (2003) Chimerism North Atlantic Ocean. Conservation Genetics 12, 713–729. following fusion in a clonal ascidian (Urochordata). Biological Journal of the Linnean Society 79, 182–192. Neigel J.E. and Avise J.C. (1983) Histocompatibility bioassays of population structure in marine sponges. Clonal structure in Verongia longis- Stamatakis A. (2006) RAxML-VI-HPC: maximum likelihood-based sima and Iotrochota birotulata. Journal of Heredity 74, 134–140. phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688–2690. Nichols S.A. and Barnes P.A.G. (2005) A molecular phylogeny and historical biogeography of the marine sponge genus Placospongia Teixido N., Gili J.P., Uriz M.J., Gutt J. and Arntz W.E. (2006) (Phylum Porifera) indicate low dispersal capabilities and widespread Observations of asexual reproductive strategies in Antarctic hexacti- crypsis. Journal of Experimental Marine Biology and Ecology 323, nellid sponges from ROV video records. Deep Sea Research II 53, 1–15. 972–984.

Perez-Portela R. and Turon X. (2008) Cryptic divergence and strong Todd C.D., Lambert W.J. and Thorpe J.P. (1998) The genetic structure population structure in the colonial invertebrate Pycnoclavella commu- of intertidal populations of two species of nudibranch mollusks with nis (Ascidiacea) inferred from molecular data. Zoology 111, 163–178. planktotrophic and pelagic lecithotrophic larval stages: are pelagic larvae ‘for’ dispersal? Journal of Experimental Marine Biology and Pisera A. and Le´vi C. (2002) ‘Lithistid’ Demospongiae. In Hooper J.N.A. Ecology 228, 1–28. and Van Soest R.W.M. (eds) Systema Porifera: a guide to the classiﬁca- tion of sponges. New York: Kluwer Academic/Plenum Publishers. Uriz M.J. and Turon X. (2012) Sponge ecology in the molecular era. Advances in Marine Biology 61, 345–410. Puill-Stephan E., Willis B.L., van Herwerden L. and van Oppen J.H. (2009) Chimerism in wild adult populations of the broadcast spawning Vargas S., Erpenbeck D., Schuster A., Sacher K., Bu¨ttner G., Scha¨tzle S. coral Acropora millepora on the Great Barrier Reef. PLoS ONE 4, and Wo¨rheide G. (2010) A high-throughput, low-cost Porifera DNA e7751. barcoding pipeline. In VIII. World Sponge Conference. Girona, Spain.

Reiswig H.M. (1973) Population dynamics of three Jamaican Whalan S., De Nys C., Smith-Keune R., Evans B.R., Battershill C.N. and Demospongiae. Bulletin of Marine Science 23, 191–226. Jerry D.R. (2008) Low genetic variability within and among populations of the brooding sponge Rhopaloeides odorabile on the central Richer de Forges B., Koslow J.A. and Poore G.C.B. (2000) Diversity and Great Barrier Reef. Aquatic Biology 3, 111–119. endemism of the benthic seamount fauna in the southwest Pacific. Nature 405, 944–947. Wo¨rheide G. (2006) Low variation in partial cytochrome oxidase subunit i (CO1) across mitochondrial sequences in the coralline demosponge Ridgway K.R. and Dunn J.R. (2003) Mesoscale structure of the mean East Astrosclera willeyana across the Indo-Pacific. Marine Biology 148, Australian Current System and its relationship with topography. 907–912. Progress in Oceanography 56, 189–222. Wo¨rheide G., Degnan B.M., Hooper J.N.A. and Reitner J. (2002b) Samadi S., Bottan L., Macpherson E. and Richer de Forges B. and Biogeography and taxonomy of the Indo-Pacific reef cave dwelling Boisselier M.C. (2006) Seamount endemism questioned by the geo- coralline demosponge Astrosclera ‘willeyana’: new data from nuclear graphic distribution and population genetic structure of marine inver- internal transcribed spacer sequences. In Moosa K.M., et al. (eds) tebrates. Marine Biology 149, 1463–1475. Proceedings of the 9th International Coral Reef Symposium, Bali, Samadi S., Schlacher T. and Richer de Forges B. (2007) Seamount Indonesia 23–27 October 2000. State Ministry for the Environment, benthos. In Pitcher T.J., Horato T., Hart P.J.B., Clark M.R., Hagger Indonesia, Indonesian Institute of Sciences & The International N. and Santos R.S. (eds) Seamounts: ecology, fisheries and conservation. Society for Reef Studies, pp. 339–345. Carlton: Blackwell Publishing. Wo¨rheide G., Epp L.S. and Macis L. (2008) Deep genetic divergences Sambrook J., Fritsch E.F. and Maniatis T. (1989) Molecular cloning: a among Indo-Pacific populations of the coral reef sponge Leucetta cha- laboratory manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring gosensis (Leucettidae): founder effects, vicariance, or both? BMC Harbor Laboratory Press. Evolutionary Biology 8, 1–18.

Sara` A., Cerrano C. and Sara M. (2002) Viviparious development in the Wo¨rheide G. and Erpenbeck D. (2007) DNA taxonomy of sponges – Antarctic sponge Stylocordyla borealis Loven, 1868. Polar Biology 25, progress and perspectives. Journal of the Marine Biological 425–431. Association of the United Kingdom 87, 1629–1633.

Schlacher-Hoenlinger M.A., Pisera A. and Hooper J.N.A. (2005) Wo¨rheide G., Hooper J. and Degnan B.M. (2002a) Phylogeography of Deep-sea “lithistid” assemblages from the Norfolk Ridge (New western Paciﬁc Leucetta ‘chagosensis’ (Porifera: Calcarea) from riboso- Caledonia), with description of seven new species and a new genus mal DNA sequences: implications for population history and conser- (Porifera, Demospongiae). Zoosystema 27, 649–698. vation of the Great Barrier Reef World Heritage Area (Australia). Molecular Ecology 11, 1753–1768. Schmitt S., Hentschel U., Zea S., Dandekar T. and Wolf M. (2005) ITS-2 and 18S gene phylogeny of Aplysiniidae (Verongida, Demospongiae). Wo¨rheide G., Nichols S.A. and Goldberg J. (2004) Intragenomic Journal of Molecular Evolution 60, 237–336. variation of the rDNA internal transcribed spacers in sponges (Phylum Porifera): implications for phylogenetic studies. Molecular Schuster A., Erpenbeck D., Pisera A., Hooper J.N.A., Bryce M., Phylogenetics and Evolution 33, 816–830. Fromont J. and Wo¨rheide G. (2015) Deceptive desmas: molecular phylogenetics suggests a new classiﬁcation and uncovers convergent Wo¨rheide G., Sole´-Cava A.M. and Hooper J.N.A. (2005) Biodiversity, evolution of lithistid demosponges. PLoS ONE 10, e116038. molecular ecology and phylogeography of marine sponges: patterns, implications and outlooks. Integrative and Comparative Biology 45, Shearer T.L., Van Oppen M.J.H., Romano S.L. and Wo¨rheide G. (2002) 377–385. Slow mitochondrial DNA sequence evolution in the Anthozoa (Cnidaria). Molecular Ecology 11, 2475–2487. Wulff J.L. (1990) Patterns and processes of size change in Caribbean demosponges of branching morphology. In Ru¨tzler K. (eds) New per- Silva E.P. and Russo C.A.M. (2000) Techniques and statistical data ana- spectives in sponge biology. Washington, DC: Smithsonian Institution lysis in molecular population genetics. Hydrobiologia 420, 119–135. Press, pp. 425–435.

Wulff J.L. (1991) Asexual fragmentation, genotype success and popula- Zilberberg C., Sole´-Cava A.M. and Klautau M. (2006a) The extent tion dynamics of erect branching sponges. Journal of Experimental of asexual reproduction in sponges of the genus Chondrilla Marine Biology and Ecology 149, 227–247. (Demospongiae: Chondrosida) from the Caribbean and the Brazilian coasts. Journal of Experimental Marine Biology and Ecology 336, Xavier J.R., Rachello-Dolmen P.G., Parra-Velandia F., Scho¨nbeg 211–220. C.H.L., Brewer J.A.J. and Van Soest R.W.M. (2010) Molecular evi- dence of cryptic speciation in the “cosmopolitan” excavating sponge Cliona celata (Porifera, Clionaidae). Molecular Phylogenetics and Evolution 56, 13–20. Zilberberg C., Maldonado M. and Sole´-Cava A.M. (2006b) Assessment Correspondence should be addressed to: of the relative contribution of asexual propagation in a population of M. Ekins the coral-excavating sponge Cliona delitrix from the Bahamas. Coral Queensland Museum, PO Box 3300, South Brisbane 4101, Reefs 25, 297–301. Brisbane, Queensland, Australia and email: [email protected]