Gene Expression Patterns in the Histopathological Classification of Epithelial Ovarian Cancer
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Table 2. Significant
Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S. -
Watsonjn2018.Pdf (1.780Mb)
UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Uncovering Ubiquitin and Ubiquitin-Like Signaling Networks Alfred C
REVIEW pubs.acs.org/CR Uncovering Ubiquitin and Ubiquitin-like Signaling Networks Alfred C. O. Vertegaal* Department of Molecular Cell Biology, Leiden University Medical Center, Albinusdreef 2, 2333 ZA Leiden, The Netherlands CONTENTS 8. Crosstalk between Post-Translational Modifications 7934 1. Introduction 7923 8.1. Crosstalk between Phosphorylation and 1.1. Ubiquitin and Ubiquitin-like Proteins 7924 Ubiquitylation 7934 1.2. Quantitative Proteomics 7924 8.2. Phosphorylation-Dependent SUMOylation 7935 8.3. Competition between Different Lysine 1.3. Setting the Scenery: Mass Spectrometry Modifications 7935 Based Investigation of Phosphorylation 8.4. Crosstalk between SUMOylation and the and Acetylation 7925 UbiquitinÀProteasome System 7935 2. Ubiquitin and Ubiquitin-like Protein Purification 9. Conclusions and Future Perspectives 7935 Approaches 7925 Author Information 7935 2.1. Epitope-Tagged Ubiquitin and Ubiquitin-like Biography 7935 Proteins 7925 Acknowledgment 7936 2.2. Traps Based on Ubiquitin- and Ubiquitin-like References 7936 Binding Domains 7926 2.3. Antibody-Based Purification of Ubiquitin and Ubiquitin-like Proteins 7926 1. INTRODUCTION 2.4. Challenges and Pitfalls 7926 Proteomes are significantly more complex than genomes 2.5. Summary 7926 and transcriptomes due to protein processing and extensive 3. Ubiquitin Proteomics 7927 post-translational modification (PTM) of proteins. Hundreds ff fi 3.1. Proteomic Studies Employing Tagged of di erent modi cations exist. Release 66 of the RESID database1 (http://www.ebi.ac.uk/RESID/) contains 559 dif- Ubiquitin 7927 ferent modifications, including small chemical modifications 3.2. Ubiquitin Binding Domains 7927 such as phosphorylation, acetylation, and methylation and mod- 3.3. Anti-Ubiquitin Antibodies 7927 ification by small proteins, including ubiquitin and ubiquitin- 3.4. -
Long Noncoding Rnas in Vascular Smooth Muscle Cells Regulate
www.nature.com/scientificreports OPEN Long noncoding RNAs in vascular smooth muscle cells regulate vascular calcifcation Received: 21 November 2018 Geon Jeong1,2,3, Duk-Hwa Kwon1,4, Sera Shin1,4, Nakwon Choe1,4, Juhee Ryu1,2,3,4, Accepted: 27 March 2019 Yeong-Hwan Lim1,2,3, Jaetaek Kim1,5, Woo Jin Park1,6, Hyun Kook1,3,4 & Young-Kook Kim 1,2,3 Published: xx xx xxxx Vascular calcifcation is characterized by the accumulation of hydroxyapatite crystals, which is a result of aberrant mineral metabolism. Although many clinical studies have reported its adverse efects on cardiovascular morbidity, the molecular mechanism of vascular calcifcation, especially the involvement of long noncoding RNAs (lncRNAs), is not yet reported. From the transcriptomic analysis, we discovered hundreds of lncRNAs diferentially expressed in rat vascular smooth muscle cells (VSMCs) treated with inorganic phosphate, which mimics vascular calcifcation. We focused on Lrrc75a-as1 and elucidated its transcript structure and confrmed its cytoplasmic localization. Our results showed that calcium deposition was elevated after knockdown of Lrrc75a-as1, while its overexpression inhibited calcium accumulation in A10 cells. In addition, Lrrc75a-as1 attenuated VSMCs calcifcation by decreasing the expression of osteoblast-related factors. These fndings suggest that Lrrc75a-as1 acts as a negative regulator of vascular calcifcation, and may serve as a possible therapeutic target in vascular calcifcation. Vascular calcifcation is caused by an imbalance of mineral metabolism, especially calcium phosphate metabo- lism1. It decreases vessel wall tension and increases vascular stifness, thereby increasing the risk of myocardial ischemia, heart failure, arrhythmias, and other cardiovascular diseases2. Vascular calcifcation includes several major types including medial arterial calcifcation, intimal atherosclerosis, and arterial calcifcation of chronic kidney diseases3. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Quantigene Flowrna Probe Sets Currently Available
QuantiGene FlowRNA Probe Sets Currently Available Accession No. Species Symbol Gene Name Catalog No. NM_003452 Human ZNF189 zinc finger protein 189 VA1-10009 NM_000057 Human BLM Bloom syndrome VA1-10010 NM_005269 Human GLI glioma-associated oncogene homolog (zinc finger protein) VA1-10011 NM_002614 Human PDZK1 PDZ domain containing 1 VA1-10015 NM_003225 Human TFF1 Trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in) VA1-10016 NM_002276 Human KRT19 keratin 19 VA1-10022 NM_002659 Human PLAUR plasminogen activator, urokinase receptor VA1-10025 NM_017669 Human ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like VA1-10029 NM_017699 Human SIDT1 SID1 transmembrane family, member 1 VA1-10032 NM_000077 Human CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) VA1-10040 NM_003150 Human STAT3 signal transducer and activator of transcripton 3 (acute-phase response factor) VA1-10046 NM_004707 Human ATG12 ATG12 autophagy related 12 homolog (S. cerevisiae) VA1-10047 NM_000737 Human CGB chorionic gonadotropin, beta polypeptide VA1-10048 NM_001017420 Human ESCO2 establishment of cohesion 1 homolog 2 (S. cerevisiae) VA1-10050 NM_197978 Human HEMGN hemogen VA1-10051 NM_001738 Human CA1 Carbonic anhydrase I VA1-10052 NM_000184 Human HBG2 Hemoglobin, gamma G VA1-10053 NM_005330 Human HBE1 Hemoglobin, epsilon 1 VA1-10054 NR_003367 Human PVT1 Pvt1 oncogene homolog (mouse) VA1-10061 NM_000454 Human SOD1 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) -
Heat Shock Factors: Integrators of Cell Stress, Development and Lifespan
REVIEWS Heat shock factors: integrators of cell stress, development and lifespan Malin Åkerfelt*‡, Richard I. Morimoto§ and Lea Sistonen*‡ Abstract | Heat shock factors (HSFs) are essential for all organisms to survive exposures to acute stress. They are best known as inducible transcriptional regulators of genes encoding molecular chaperones and other stress proteins. Four members of the HSF family are also important for normal development and lifespan-enhancing pathways, and the repertoire of HSF targets has thus expanded well beyond the heat shock genes. These unexpected observations have uncovered complex layers of post-translational regulation of HSFs that integrate the metabolic state of the cell with stress biology, and in doing so control fundamental aspects of the health of the proteome and ageing. Polytene chromosome In the early 1960s, Ritossa made the seminal discovery of shock response. Here, we present the recent discover- A chromosome that undergoes temperature-induced puffs in polytene chromosomes ies of novel target genes and physiological functions multiple rounds of DNA of Drosophila melanogaster larvae salivary glands1. of HSFs, which have changed the view that HSFs act replication, without cell A decade later, it was shown that the puffing pattern solely in the heat shock response. Based on the current division, and produces many sister chromatids that remain corresponded to a robust activation of genes encoding knowledge of small-molecule activators and inhibitors of synapsed together; for the heat shock proteins (HSPs), which function as HSFs, we also highlight the potential for pharmacologic example, in larval salivary molecular chaperones2. The heat shock response is a modulation of HSF-mediated gene regulation. -
Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7, -
Bone Morphogenetic Protein-4 Affects Both Trophoblast and Non-Trophoblast Lineage-Associated Gene Expression in Human Embryonic Stem Cells
Vol.2, No.4, 163-175 (2012) Stem Cell Discovery http://dx.doi.org/10.4236/scd.2012.24021 Bone morphogenetic protein-4 affects both trophoblast and non-trophoblast lineage-associated gene expression in human embryonic stem cells Margaret L. Shirley1,2*, Alison Venable1*, Raj R. Rao3, Nolan L. Boyd4, Steven L. Stice1,5,6, David Puett1#, Prema Narayan7# 1Department of Biochemistry and Molecular Biology, University of Georgia, Athens, USA; #Corresponding Author: [email protected] 2Department of Psychiatry, University of California, San Francisco, USA 3Department of Chemical and Life Science Engineering, School of Engineering, Virginia Commonwealth University, Richmond, USA 4Cardiovascular Innovation Institute, University of Louisville, Louisville, USA 5Regenerative Bioscience Center, University of Georgia, Athens, USA 6Department of Animal and Dairy Sciences, University of Georgia, Athens, USA 7Department of Physiology, Southern Illinois University School of Medicine, Carbondale, USA; #Corresponding Author: [email protected] Received 5 May 2012; revised 4 June 2012; accepted 1 July 2012 ABSTRACT cells were obtained. Gene expression by EB was characterized by an up-regulation of a num- Human embryonic stem cells (hESC) can be in- ber of genes associated with trophoblast, ecto- duced to differentiate to trophoblast by bone derm, endoderm, and mesoderm, and the pro- morphogenetic proteins (BMPs) and by aggre- duction of hCG and progesterone confirmed that gation to form embryoid bodies (EB), but there trophoblast-like cells were formed. These re- are many differences and controversies regard- sults suggest that, in the presence of FGF-2, ing the nature of the differentiated cells. Our BG02 cells respond to BMP4 to yield tropho- goals herein were to determine if BG02 cells form trophoblast-like cells (a) in the presence of blast-like cells, which are also obtained upon EB BMP4-plus-basic fibroblast growth factor (FGF-2) formation. -
Transcription Factor Gene Expression Profiling and Analysis of SOX Gene Family Transcription Factors in Human Limbal Epithelial
Transcription factor gene expression profiling and analysis of SOX gene family transcription factors in human limbal epithelial progenitor cells Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat. vorgelegt von Dr. med. Johannes Menzel-Severing aus Bonn Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg Tag der mündlichen Prüfung: 7. Februar 2018 Vorsitzender des Promotionsorgans: Prof. Dr. Georg Kreimer Gutachter: Prof. Dr. Andreas Feigenspan Prof. Dr. Ursula Schlötzer-Schrehardt 1 INDEX 1. ABSTRACTS Page 1.1. Abstract in English 4 1.2. Zusammenfassung auf Deutsch 7 2. INTRODUCTION 2.1. Anatomy and histology of the cornea and the corneal surface 11 2.2. Homeostasis of corneal epithelium and the limbal stem cell paradigm 13 2.3. The limbal stem cell niche 15 2.4. Cell therapeutic strategies in ocular surface disease 17 2.5. Alternative cell sources for transplantation to the corneal surface 18 2.6. Transcription factors in cell differentiation and reprogramming 21 2.7. Transcription factors in limbal epithelial cells 22 2.8. Research question 25 3. MATERIALS AND METHODS 3.1. Human donor corneas 27 3.2. Laser Capture Microdissection (LCM) 28 3.3. RNA amplification and RT2 profiler PCR arrays 29 3.4. Real-time PCR analysis 33 3.5. Immunohistochemistry 34 3.6. Limbal epithelial cell culture 38 3.7. Transcription-factor knockdown/overexpression in vitro 39 3.8. Proliferation assay 40 3.9. Western blot 40 3.10. Statistical analysis 41 2 4. RESULTS 4.1. Quality control of LCM-isolated and amplified RNA 42 4.2. -
SPEN Protein Expression and Interactions with Chromatin in Mouse Testicular Cells
156 3 REPRODUCTIONRESEARCH SPEN protein expression and interactions with chromatin in mouse testicular cells Joanna Korfanty1, Tomasz Stokowy2, Marek Chadalski1, Agnieszka Toma-Jonik1, Natalia Vydra1, Piotr Widłak1, Bartosz Wojtaś3, Bartłomiej Gielniewski3 and Wieslawa Widlak1 1Maria Sklodowska-Curie Institute – Oncology Center, Gliwice Branch, Gliwice, Poland, 2Department of Clinical Science, University of Bergen, Bergen, Norway and 3Laboratory of Molecular Neurobiology, Neurobiology Center, Nencki Institute of Experimental Biology, PAS, Warsaw, Poland Correspondence should be addressed to W Widlak; Email: [email protected] Abstract SPEN (spen family transcription repressor) is a nucleic acid-binding protein putatively involved in repression of gene expression. We hypothesized that SPEN could be involved in general downregulation of the transcription during the heat shock response in mouse spermatogenic cells through its interactions with chromatin. We documented predominant nuclear localization of the SPEN protein in spermatocytes and round spermatids, which was retained after heat shock. Moreover, the protein was excluded from the highly condensed chromatin. Chromatin immunoprecipitation experiments clearly indicated interactions of SPEN with chromatin in vivo. However, ChIP-Seq analyses did not reveal any strong specific peaks both in untreated and heat shocked cells, which might suggest dispersed localization of SPEN and/or its indirect binding to DNA. Using in situ proximity ligation assay we found close in vivo associations of SPEN with MTA1 (metastasis-associated 1), a member of the nucleosome remodeling complex with histone deacetylase activity, which might contribute to interactions of SPEN with chromatin. Reproduction (2018) 156 195–206 Introduction However, regulation of osteocalcin expression by SPEN depends on its interactions with other proteins.