DOCSLIB.ORG

Molecular Analysis of Ethyl Methanesulfonate-Induced

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Analysis of Ethyl Methanesulfonate-Induced [CANCERRESEARCH54,3001-3006,June1, 1994] Molecular Analysis of Ethyl Methanesulfonate-induced Mutations at the hprt Gene in the Ethyl Methanesulfonate-sensitive Chinese Hamster Cell Line EM-Cl! and Its Parental Line CHO9' Christel W. Op het Veld, Matgorzata Z. Zdzienicka, Harry Vrieling, Paul H. M. Lohman, and Albert A. van Zeeland2 MGC-Department of Radiation Genetics and Chemical Muzagenesis, State University of Leiden, Wassenaarseweg 72, 2333 AL Leiden [C. W. 0. h. V., M. Z. Z., H. V., P. H. M. L., A. A. V. Z.J, and J. A. Cohen Institute, Interuniversizy Research Institute for Radiopathology and Radiation Protection, Leiden [M. Z. Z., H. V., A. A. v. Z.J, the Netherlands ABSTRACF strong nucleophiles like the N-7 position of guanine, resulting in a relatively low 06/N-7-alkylguanine ratio. The Chinese hamster cell line EM-Cl! has been shown to be 5 times Molecular analysis of induced mutations, i.e. , the determination of more sensitive than its parental line CHO9, but not hypermutable, after mutational spectra, provides a valuable tool for the identification of treatment with ethyl methanesulfonate. Ethyl methanesulfonate-induced adducts that are involved in mutation induction. Moreover, the use of mutational spectra were determined at the hprt locus to investigate DNA repair deficient cell lines will generate additional information whether the same ndducts are responsible for mutation induction in both cell lines. The mutational spectra for EM-C!! and CHO9 show an im concerning the mutagenic potential of different types of DNA adducts. portent difference. GC-'AT transitions were found in both cell lines at Recently, a Chinese hamster ovary cell line, EM-Cl 1, which is very similar frequencies; however, the spectrum of CHO9 contains a class of sensitive to the cell killing effects of EMS, was isolated in our AT—'GCtransitions,which seems to be replaced by a group of deletions laboratory (2). EM-Cl 1 belongs to the same complementation group in EM-Cl!. Since the ethyl methanesulfonate-induced mutation frequency as EM9 (3) which shows a strongly enhanced cytotoxicity as well as for both lines is the same at equal exposure, it is hypothesized that the hypermutability after EMS treatment. Both cell lines are slow in the lesions leading to AT—'GCtransitions in CHO9 are responsible for the repair of DNA single strand breaks and the defect in these mutants is deletions in EM-Cl!. This phenomenon might be explained if the respon complemented by the human xrcc-l gene, isolated by Thompson et al. sible adduct(s) in CHO9 is bypassed resulting in replication errors, while (4). However, the precise biochemical defect remains to be deter blocking DNA synthesis in EM-Cl! causing the observed increase in cell mined (2, 3). A few differences have been observed between these death. In surviving EM-C!! cells, DNA strand exchanges might have two Chinese hamster ovary cell mutants. EM-Cl 1 is not sensitive to occurred at the position of stalled replication forks, leading to gross Uv irradiationandonlyslightlysensitivetoX-rays(2),whereasEM9 molecular changes. The adduct probably responsible for the AT—GC is sensitive to UV and X-rays (3). Thus EM-Cl 1 may have a more transitions in CHO9 and the deletions in EM-C!! is 3-ethyladenine. specific defect in the repair of DNA damage induced by alkylating agents and, therefore, appears to be a valuable tool for the determi INTRODUCFION nation of the nature of mutagenic lesions induced by monofunctional alkylating agents. Monofunctional alkylating agents such as EMS3 act directly on In this study we have used EM-Cl 1 and its parental line CHO9 to oxygen and nitrogen atoms in DNA bases and with oxygen moieties study the effects of EMS on the frequency and molecular nature of the of the phosphate backbone. A broad spectrum of DNA lesions is induced mutations in the hprt gene. formed, consisting of alkylated bases, phosphotriesters, and abasic sites due to spontaneous hydrolysis of unstable alkylation products or MATERIALS AND METHODS enzymatic hydrolysis by DNA glycosylases. The types of DNA le sions induced by an alkylating agent depend upon the reaction mech Cell Culture Conditions. EM-Cu Chinese hamsterovary cells and the anism and the reactivity of the alkylating agent, which can be ex parental line CHO9 were cultured in Ham's modified F-lO medium lacking pressed by the Swain-Scott constant. Alkylating agents with a low s hypoxanthine and thymidine and supplemented with 15% newborn calf serum (Gibco), 100 units/mi penicillin, and 0.1 mg/ml streptomycin (2). value, such as N-ethyl-N-nitrosourea (s 0.26), react with the nu EMS survival and mutation induction at the hprt locus were determined cleophilic centers in the DNA via a SN1 reaction, in which the rate according to the method of Zdzienicka and Simons (5). In brief, i0@cells were limiting step is the formation of the alkyl cation. These agents show treated in suspension for 1 h at 37°C in serum-free medium supplemented with a relatively low selectivity in their alkylation reaction. Since the 20 mi@t4-(2-hydroxyethyl)l-piperazethanesulfonic acid (pH 7.4) in a total number of oxygen atoms in DNA available for alkylation is larger volume of 10 ml. EMS (Eastman Co., Rochester, NY) was added directly to than the number of nitrogen atoms, compounds with a low s value the suspension or, in case of low exposures, EMS was diluted in phosphate give high levels of O-alkylation relatively to N-alkylations. These buffered saline just before use. agents further have a low chromosome breaking ability relative to Following treatment, cells were washed twice with phosphate buffered their capacity to induce gene mutations (1). EMS belongs to the saline, resuspended in medium with 15% newborn calf serum, and subse alkylating agents with a relatively high s value (s = 0.67) and follows quently cells were (a) seeded for survival (200 cells/94-mm dish; 5 dishes/ group) and (b) propagated for expression of induced mutants (3.5 X 10@'—2X a mixed SN1/SN2 type reaction. Therefore, EMS also reacts with 106 cells/l50-mm dish; 4 dishes/group); these dishes were subcultured after 4 days. Eight days after treatment cells were seeded for (a) cloning efficiency Received 12/22/93; accepted 3/28/94. (200 cells/94-mm dish; 5 dishes/group) and (b) selection of hprt-deficient Thecostsof publicationofthisarticleweredefrayedinpartby thepaymentofpage mutants (10@ cells/94-mm dish; 20 dishes/group) in medium containing 5 charges. This article must therefore be hereby marked advertisement in accordance with 18U.S.C.Section1734solelyto indicatethisfact. p@g/ml6TG.The mutant frequency was calculated by correcting the frequency I This work was supported by Grant KWF.90.04 from the Dutch Cancer Society (the of 6TG resistant clones with the corresponding cloning efficiency. Netherlands) and Grant EV5V-CF91-0012 from the Commission of the European Com Isolation of hprt Mutants for Moleculnr Analysis. To isolate hprt defi munities. dent mutants, 4—5 X i0@ C1-1O9 or EM-Cu cells were treated with 5 m@i 2 To whom requests for reprints should be addressed. 3 The abbreviations used are: EMS, ethyl methanesulfonate; 6TG, 6-thioguanine; EMS. After treatment, cells were washed twice, resuspended in complete cDNA, complementary DNA; PCR, polymerase chain reaction. medium, and subsequently divided in aliquots of 3.5 X l0@cells for CHO9 and 3001 Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1994 American Association for Cancer Research. 3-ETHYI.ADENINE CAUSES AT-' OC TRANS@ON5 Table 1 Primers used for molecular analysis of hprt mutants Primer sequence Positiona cDNA synthesis vrl-16 5' GCAGAUCAAcTFGAATFCFCATC 3' 681 to 658 PCR cDNA vrll0-m13 5' CGACG1TGTAAAACGACGGCCAGT 675 to658 TCAACTTGAATFCFCATC 3b zee-P 5' GGCflCCFCCTCAGACCGCT 3' —50to —31 PCR genomic DNA ham @5C 5' AGcTFATGCFCFGA1TFGAAATCAGCFG 3' E2:—42to —15 ham 23 5' AUAAGATCVFACVFACCFGTCCATAATC 3' 12:17 to E2:96 ham 35C 5' GGAACFCGTCFATfCCGTGATITFA 3' E3:—34 to —10 ham 33 5' AAATACATACAAAACTAGGAUGCC 3' 13:58 to 34 ham 45C 5' GTGTATFCAAGAATATGCATGTAAATGATG 3' E4:—45to —16 ham 43 5' CAAGTGAGTGATFGAAAGCACAGTFAC 3' 14:80 to 54 ham 55C 5' AACATAT000TCAAATAUOTFCTAATAG 3' E5:—141to—112 ham 53 5' GGCVfACCTATAGTATACACACTAAGCFA 3' 15:68 to 42 ham 75C 5' GTFCFArFGTCITFCCCATATGTC 3' E7:—49to —26 Sequencing m13 5' GTAAAACGACGGCCAGTG 3' vrl-2 5' GCAAGCfTGCAACCI'TAACC 3' 490 to 471 zee-6 5' CFGATAAAATCFACAGTCAT 3' 302 to 283 zee-4 5' CCATGAGGAATAAACAC 3' 119 to 93 a Positions in the coding region are numbered according to the method of Jolly et aL (29) with the A of the ATG initiation codon being the first nucleotide. A designation such as 11:5 refers to the fifth base of intron 1. b Bases in italics, M13 sequence. C 5'-Biotinylated primer. aliquots of 5 X i0@for EM-Cl 1. Each population was subcultured separately Mutational Spectrum of CHO9. hprt-deficient mutants were iso to ensure that all mutants obtained were independent. After 8 days of expres lated after an exposure to S m@i EMS. The spontaneous mutant sion time, each culture was harvested separately and 10@cells were seeded per frequency for CHO9 was 0.9 X i05, whereas after S mi@iEMS the plate (2 dishes/culture) in 6TG containing medium. After an additional growth mutant frequency was 22.8 X i0@, which indicates that most of the period of 10 days, only one 6TG resistant colony from each set of dishes was hprt mutants isolated for mutational analysis was induced by the EMS isolated. treatment. The RNA of the mutants was used to synthesize hprt cDNA In total, 25 independent hprt mutants from CHO9 and 41 hprt mutants from EM-Cu were isolated.
Load more

Recommended publications
  • Principles and Methods for the Risk Assessment of Chemicals in Food
    WORLD HEALTH ORGANIZATION ORGANISATION MONDIALE DE LA SANTE EHC240: Principles and Methods for the Risk Assessment of Chemicals in Food SUBCHAPTER 4.5. Genotoxicity Draft 12/12/2019 Deadline for comments 31/01/2020 The contents of this restricted document may not be divulged to persons other than those to whom it has been originally addressed. It may not be further distributed nor reproduced in any manner and should not be referenced in bibliographical matter or cited. Le contenu du présent document à distribution restreinte ne doit pas être divulgué à des personnes autres que celles à qui il était initialement destiné. Il ne saurait faire l’objet d’une redistribution ou d’une reproduction quelconque et ne doit pas figurer dans une bibliographie ou être cité. Hazard Identification and Characterization 4.5 Genotoxicity ................................................................................. 3 4.5.1 Introduction ........................................................................ 3 4.5.1.1 Risk Analysis Context and Problem Formulation .. 5 4.5.2 Tests for genetic toxicity ............................................... 14 4.5.2.2 Bacterial mutagenicity ............................................. 18 4.5.2.2 In vitro mammalian cell mutagenicity .................... 18 4.5.2.3 In vivo mammalian cell mutagenicity ..................... 20 4.5.2.4 In vitro chromosomal damage assays .................. 22 4.5.2.5 In vivo chromosomal damage assays ................... 23 4.5.2.6 In vitro DNA damage/repair assays ....................... 24 4.5.2.7 In vivo DNA damage/repair assays ....................... 25 4.5.3 Interpretation of test results ......................................... 26 4.5.3.1 Identification of relevant studies............................. 27 4.5.3.2 Presentation and categorization of results ........... 30 4.5.3.3 Weighting and integration of results .....................
    [Show full text]
  • DNA Polymerase III of Escherichia Coli Is Required for Uvand Ethyl
    Proc. Natl. Acad. Sci. USA Vol. 84, pp. 4195-4199, June 1987 Genetics DNA polymerase III of Escherichia coli is required for UV and ethyl methanesulfonate mutagenesis (DNA replication/SOS repair) MICHAEL E. HAGENSEE, TERRY L. TIMME, SHARON K. BRYAN, AND ROBB E. MOSES Department of Cell Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030 Communicated by Daniel Nathans, March 9, 1987 (receivedfor review January 7, 1987) ABSTRACT Strains of Escherichia coli possessing the polC+ by transduction. Strain ERli is an E486 (polC486) (8) pebAl mutation, a functional DNA polymerase I, and a derivative made by P1 transduction ofa TnJO linked topcbAl temperature-sensitive mutation in DNA polymerase m can from RM552. Strain RM552 is an ESli (8) derivative con- survive at the restrictive temperature (430C) for DNA poly- taining TnJO linked to pcbAl (zic-J: :TnJO) transduced from a merase m. The mutation rate of the bacterial genome of such CSM61 derivative (7). Strain SB229 was constructed by strains after exposure to either UV light or ethyl methanesul- transduction of recA56 srlJ300::TnJO into JM103. fonate was measured by its rifampicin resistance or amino acid Plasmid pDS4-26 was provided by C. McHenry. It contains requirements. In addition, Weigle mutagenesis of preirradi- the coding region for the a subunit of DNA polymerase III ated X phage was also measured. In all cases, no increase in (9). Plasmid pSB5 is a clone of the a subunit of DNA mutagenesis was noted at the restrictive temperature for DNA polymerase III derived in our laboratory. polymerase HI. Introduction of a cloned DNA polymerase HI Materials.
    [Show full text]
  • Spontaneous and Ethyl Methanesulfonate-Induced Mutations Controlling Viability in Drosophila Melanogaster
    SPONTANEOUS AND ETHYL METHANESULFONATE-INDUCED MUTATIONS CONTROLLING VIABILITY IN DROSOPHILA MELANOGASTER. I. RECESSIVE LETHAL MUTATIONS OHM1 OHNISHI Laboratory of Genetics, Faculty of Agriculture, Kyoto University, Kyoto 606, Japan Manuscript received December 18, 1976 Revised copy received July 15,1977 ABSTRACT The efficiency of the adult feeding method for EMS treatment in Dro- sophila melanogaster was studied by measuring the frequency of induced recessive lethals on the second chromosome. The treatment was most effective when mature spermatozoa or spermatids were treated and was much less effec- tive on earlier stages. The number of mutations induced was proportional to the concentration except at the highest doses. The recessive lethal rate was estimated to be about 0.012 per second chromosome per IO-4~.In addition, about 0.004-0.005 recessive lethals per 10-4 M were found in a later genera- tion in chromosomes that had not shown the lethal effect in the previous gen- eration. When the experiments are done in a consistent manner and gametes treated as mature sperm or spermatids are sampled, the results are highly reproducible. However, modifications of the procedure, such as starvation before EMS treatment, can considerably alter the effectiveness of the mutagen. A central problem in population genetics is the relative importance of various factors determining genetic variability in natural populations. Interest in recurrent mutation as a major source of variation has been stimulated by the work of MUKAIand his associates (MUKAI1964; MUKAIet al. 1972), who re- ported a very high spontaneous rate for viability-affecting polygenic mutations in Drosophila melanogaster. From the standpoint of human welfare, the im- portance of mutations is enhanced by the possibility that a number of chemi- cals in our environment may be mutagenic.
    [Show full text]
  • Effects of Ethyl Methanesulfonate on Morphological and Physiological Traits of Plants Regenerated from Stevia (Stevia Rebaudiana Bertoni) Calli
    Gerami et al.: Effects of ethyl methanesulfonate morphological and physiological traits of plants regenerated from stevia - 373 - EFFECTS OF ETHYL METHANESULFONATE ON MORPHOLOGICAL AND PHYSIOLOGICAL TRAITS OF PLANTS REGENERATED FROM STEVIA (STEVIA REBAUDIANA BERTONI) CALLI GERAMI, M.1 – ABBASPOUR, H.1* – GHASEMIOMRAN, V.2* – PIRDASHTI, H.2 1Department of Biology, Damghan Branch, Islamic Azad University, Damghan, Iran (Mahyar Gerami: +98-11-44221387, e-mail: [email protected]; Dr. Hossein Abbaspour: +98-232-5235016, e-mail: [email protected]) 2Department of Agronomy & Plant Breeding, Genetics and Agricultural Biotechnology Institute of Tabarestan, Sari Agricultural Sciences and Natural Resources University, Sari, Iran (Dr. Valiollah Ghasemiomran: +98-11-33687744, e-mail: [email protected]; Dr.Hemmatollah Pirdashti: +98-11-33687744, e-mail:[email protected]) *Corresponding authors e-mail: [email protected], [email protected] (Received 8th Nov 2016; accepted 17th Jan 2017) Abstract. Calli induced from leaf explants cultured on medium containing 0.1 mg/L thidiazuron (TDZ) were exposed to various concentrations of EMS ( 0.1, 0.2, and 0.5%) at different time courses (30, 60, and 120 minutes). The effects of the various concentrations of EMS and different exposure times and the interactions of these factors on the traits of regenerated calli were significant. The number of produced shoots declined with increases in EMS concentrations and in exposure durations. EMS also had significant effects on the morphological and physiological traits of the regenerated plants. Among the 12 studied traits, the M10, M11, and M6 mutant lines exhibited the highest variation in terms of morphological and physiological characteristics compared to the control.
    [Show full text]
  • ETHYL METHANESULFONATE-INDUCED REVERSION of BACTERIOPHAGE T4rii MUTANTS
    ETHYL METHANESULFONATE-INDUCED REVERSION OF BACTERIOPHAGE T4rII MUTANTS DAVID R. KRIEG Biology Division, Oak Ridge National Laboratory,l Oak Ridge, Tennessee Received December 11. 1962 methanesulfonate (EMS2) is an alkylating agent that can react with E~~a~ellularvirus particles to produce many mutations with rather little killing (LOVELESS1958). The induced mutations may be delayed by several generations (GREENand KRIEG1961 ) . The mutagen reacts with three of the four bases naturally occurring in DNA (REINERand ZAMENHOF1957; BROOKES and LAWLEY1960, 1961a, 1962; PAL1962), yet there is reason to suspect that it might be quite specific as to the type of base pair changes it usually induces. The purpose of this investigation was to compare the frequencies of EMS-induced mutations at various sites within the rII region of bacteriophage T4, and to test the notion that predominantly one type of base pair substitution might be induced. Four years ago in this laboratory, during a search for strongly EMS-revertible point mutants. D. M. GREENfound that some AP mutants [mutants which had been produced from standard I+ phage by AP) were quite EMS-revertible, but that none of the 18 EMS-produced mutants he examined were induced by EMS to revert to a comparable extent. This prompted the working hypothesis that one of the base pair transitions-either GC to AT or AT to GC-was much more strongly inducible by EMS than was the other transition. It was decided to test this possible specificity by checking a group of EMS mutants for EMS-induced reversion by a more sensitive test than had been previously employed, and to test similarly additional base analog and proflavin mutants.
    [Show full text]
  • GENETIC EFFECTS of ETHYL METHANESULFONATE and GAMMA RAY TREATMENT of the PROEMBRYO in MAIZE HE Well Differentiated Meristematic
    GENETIC EFFECTS OF ETHYL METHANESULFONATE AND GAMMA RAY TREATMENT OF THE PROEMBRYO IN MAIZE N. K. CHATTERJEEl, A. L. CASPAR, AND W. R. SINGLETON The Blandy Experimental Farm, University of Virginia, Boyce Received April 29, 1965 HE well differentiated meristematic region in the embryo of a mature maize Tseed limits the classical seed irradiation procedure in the study of induced mu- tations in this plant. The meristematic region contains up to six embryonic leaves (STEINand STEFFENSEN1959). Any mutation induced by irradiating a seed will be produced in only a sector of the plant, and the mutated area is not likely to occur both in the ear and tassel. A mutation thus occurring in either of them would result in a heterozygous plant in the second generation 'which segregates in the third generation. This difficulty could be overcome by using the one-celled proembryo as the experimental material, which affords an opportunity of obtain- ing a uniform (nonchimeric) plant. Moreover, studies on radiosensitivities of developing embryos of plants and animals by different workers (STADLER1930; BUTLER 1936; RUSSELLand Rus- SELL 1954; SARIC1957; MERICLEand MERICLE1961; etc.), since the pioneering radiation work of GAGER(1908) with developing embryos of Oenothera, have shown that early embryonic stages are more sensitive to radiation than are later stages. The work of STADLER(1930) on the genetic effects of X rays on maize proembryos has indicated the potentialities of the maize proembryo in the study of radiation induced mutations. Work at the Blandy Experimental Farm of the University of Virginia (SINGLETON1961 ; VARMA,CASPAR and SINGLETON1962, 1963) has shown that the 24-48 hour old maize proembryo is a sensitive stage for inducing mutations by gamma radiation.
    [Show full text]
  • 811.Full.Pdf
    Copyright 0 1986 by the Genetics Society of America DNA SEQUENCE ANALYSIS OF MUTAGENICITY AND SITE SPECIFICITY OF ETHYL METHANESULFONATE IN UVR+ AND UVRB- STRAINS OF ESCHERICHIA COLI PHILIP A. BURNS,' FRANCES L. ALLEN AND BARRY W. GLICKMAN Department of Biology, York University, 4700 Keele Street, Toronto, Ontario, M3J lP3 Canada Manuscript received December 11, 1985 Revised copy accepted April 26, 1986 ABSTRACT EMS-induced mutations within a 180 base pair region of the lacl gene of E. coli were cloned and sequenced. In total, 105 and 79 EMS-induced mutations from a Uvr+ and a UvrB- strain, respectively, were sequenced. The specificity of EMS-induced mutagenesis was very similar in the two strians; G:C + A:T transitions accounted for all but three of the mutants. The overall frequency of induced mutation was fivefold higher in the UvrB- strain compared to the Uvr+ strain. This demonstrates, at the DNA sequence level, that the presumed pre- mutagenic lesion, 06-ethylguanine, is subject to repair by the uvrABC excision repair system of E. coli. An analysis of mutation frequencies with respect to neighboring base sequence, in the two strains, shows that 06-ethylguanine lesions adjacent to A:T base pairs present better targets for the excision repair machin- ery than those not adjacent to A:T base pairs. UTATIONAL spectra produced by mutagens in various repair back- M grounds can provide important information about the role of different premutagenic lesions and repair systems in the mutagenic process. Until re- cently, such studies have involved the characterization of comparatively small numbers of mutants or reversion analyses at relatively few sites.
    [Show full text]
  • Genome-Wide Analysis of Artificial Mutations Induced by Ethyl
    G C A T T A C G G C A T genes Article Genome-Wide Analysis of Artificial Mutations Induced by Ethyl Methanesulfonate in the Eggplant (Solanum melongena L.) 1,2, , 1,2 1,2 1,2 1,2 1,2 Xi-ou Xiao * y, Wenqiu Lin , Ke Li , Xuefeng Feng , Hui Jin and Huafeng Zou 1 South Subtropical Crop Research Institute Chinese Academy of Tropical Agricultural Sciences, Zhanjiang City 524091, China 2 Zhanjiang City Key Laboratory for Tropical Crops Genetic Improvement, Guangdong Province, Zhanjiang City 524091, China * Correspondence: [email protected]; Tel.:+86-0759-2859139 Present Address: Room 507, Huxiu Road No.1, Mazhang District, Zhanjiang 52491, y Guangdong Province, China. Received: 14 June 2019; Accepted: 1 August 2019; Published: 7 August 2019 Abstract: Whole-genome sequences of four EMS (ethyl methanesulfonate)-induced eggplant mutants were analyzed to identify genome-wide mutations. In total, 173.01 GB of paired-end reads were obtained for four EMS-induced mutants and (WT) wild type and 1,076,010 SNPs (single nucleotide polymorphisms) and 183,421 indels were identified. The most common mutation type was C/G to T/A transitions followed by A/T to G/C transitions. The mean densities were one SNP per 1.3 to 2.6 Mb. The effect of mutations on gene function was annotated and only 7.2% were determined to be deleterious. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis showed 10 and 11 genes, which were nonsynonymous mutation or frameshift deletion in 48-5 and L6-5 involved in the anthocyanin biosynthesis or flavone and flavonol biosynthesis.
    [Show full text]
  • Title: Effects of Ethyl Methanesulfonate (EMS) on Seedling and Yield Contributing Traits in Basmati Rice
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 17 March 2021 doi:10.20944/preprints202103.0453.v1 Title: Effects of Ethyl methanesulfonate (EMS) on Seedling and Yield contributing Traits in Basmati Rice Authors list: Muhammad Rashid, Nuclear Institute for Agriculture and Biology College, Pakistan Institute of Engineering and Applied Sciences (NIAB-C, PIEAS), Jhang Road, Faisalabad 38000, Pakistan. email:[email protected] Areeqa Shamshad, Nuclear Institute for Agriculture and Biology College, Pakistan Institute of Engineering and Applied Sciences (NIAB-C, PIEAS), Jhang Road, Faisalabad 38000, Pakistan email:[email protected] Ljupcho Jankuloski, FAO/IAEA, Plant Breeding and Genetics Laboratories, Vienna, Austria email: [email protected] Abstract Increasing genetic diversity in crop plants has been used for chemical mutagenesis. Through the application of various mutagenic agents, over 430 new varieties have been derived as rice mutants (Oryza sativa L.) Chemical mutagens such as ethyl methane sulphonate (EMS), diepoxybutane derivative (DEB), sodium azide, and gamma ray, x-ray, and quick neutron irradiation have been commonly used to induce a large number of functional variations in rice and others crops. Among chemical mutagens, ethyl methane sulfonate (EMS) is the alkylating agent most widely used in plants because it induces nucleotide substitutions to be extremely frequent, as detected in various genomes. In this study, seeds of potential genotype of the popular variety, (Oryza sativa L. Super Basmati variety) were treated with EMS at concentrations of 0.25%, 0.50%, 0.75%, 1% and 1.5%. Various measurements on the M1 generation determined EMS sensitivity. As concentration of applied EMS increased, will decrease in germination, shoot length, root length, plant height, productive tillers, Panicle Length, Total Spikelet, sterile spikelet and fertility under field conditions were observed in M1 generation as compared to the non-treatment control.
    [Show full text]
  • Principles for Evaluating Health Risks in Children Associated with Exposure to Chemicals
    This report contains the collective views of an international group of experts and does not necessarily represent the decisions or the stated policy of the United Nations Environment Programme, the International Labour Organization or the World Health Organization. Environmental Health Criteria 237 PRINCIPLES FOR EVALUATING HEALTH RISKS IN CHILDREN ASSOCIATED WITH EXPOSURE TO CHEMICALS First drafts prepared by Dr Germaine Buck Louis, Bethesda, USA; Dr Terri Damstra, Research Triangle Park, USA; Dr Fernando Díaz- Barriga, San Luis Potosi, Mexico; Dr Elaine Faustman, Washington, USA; Dr Ulla Hass, Soborg, Denmark; Dr Robert Kavlock, Research Triangle Park, USA; Dr Carole Kimmel, Washington, USA; Dr Gary Kimmel, Silver Spring, USA; Dr Kannan Krishnan, Montreal, Canada; Dr Ulrike Luderer, Irvine, USA; and Dr Linda Sheldon, Research Triangle Park, USA Published under the joint sponsorship of the United Nations Environment Programme, the International Labour Organization and the World Health Organization, and produced within the framework of the Inter-Organization Programme for the Sound Management of Chemicals. The International Programme on Chemical Safety (IPCS), established in 1980, is a joint venture of the United Nations Environment Programme (UNEP), the International Labour Organization (ILO) and the World Health Organization (WHO). The overall objec- tives of the IPCS are to establish the scientific basis for assessment of the risk to human health and the environment from exposure to chemicals, through international peer review processes,
    [Show full text]
  • EMS-Induced Mutagenesis of Clostridium Carboxidivorans for Increased Atmospheric CO2 Reduction Efficiency and Solvent Production
    microorganisms Article EMS-Induced Mutagenesis of Clostridium carboxidivorans for Increased Atmospheric CO2 Reduction Efficiency and Solvent Production Naoufal Lakhssassi 1,2, Azam Baharlouei 1, Jonas Meksem 3, Scott D. Hamilton-Brehm 4, David A. Lightfoot 2, Khalid Meksem 2,* and Yanna Liang 1,5,* 1 Department of Civil and Environmental Engineering, 1230 Lincoln Drive, Southern Illinois University Carbondale, Carbondale, IL 62901, USA; [email protected] (N.L.); [email protected] (A.B.) 2 Department of Plant, Soil, and Agricultural Systems, Southern Illinois University, Carbondale, IL 62901, USA; [email protected] 3 Trinity College of Arts and Sciences, Duke University, Durham, NC 27708, USA; [email protected] 4 Department of Microbiology, Southern Illinois University, Carbondale, IL 62901, USA; [email protected] 5 Department of Environmental and Sustainable Engineering, 1400 Washington Ave, State University of New York at Albany, Albany, NY 12222, USA * Correspondence: [email protected] (K.M.); [email protected] (Y.L.) Received: 1 July 2020; Accepted: 10 August 2020; Published: 14 August 2020 Abstract: Clostridium carboxidivorans (P7) is one of the most important solvent-producing bacteria capable of fermenting syngas (CO, CO2, and H2) to produce chemical commodities when grown as an autotroph. This study aimed to develop ethyl methanesulfonate (EMS)-induced P7 mutants that were capable of growing in the presence of CO2 as a unique source of carbon with increased solvent formation and atmospheric CO2 reduction to limit global warming. Phenotypic analysis including growth and end product characterization of the P7 wild type (WT) demonstrated that this strain grew better at 25 ◦C than 37 ◦C when CO2 served as the only source of carbon.
    [Show full text]
  • A Review of the Genetic Effects of Ethyl Methanesulfonate Gary A. Sega
    Mutation Research, 134 (1984) 113-142 113 Elsevier MTR 07179 A review of the genetic effects of ethyl methanesulfonate Gary A. Sega Biology Division, Oak Ridge National Laboratory *, Oak Ridge, TN 37831 (U.S.A.) (Received 10 October 1983) (Revision received 23 May 1984) (Accepted 25 May 1984) Contents Summary .............................................................................. 113 Introduction ........................................................................... 114 Chemical and physical properties ............................................................. 114 Interaction with DNA ..................................................................... 115 Review of mutagenicity data ................................................................ 117 Effects of EMS in viruses ................................................................. 117 Genetic effects in prokaryotes .............................................................. 118 Genetic effects in fungi .................................................................. 119 Genetic effects in plants .................................................................. 121 Insects ................................................................................ 123 Drosophila ........................................................................... 123 Other insects .......................................................................... 125 Mammalian cell culture .................................................................... 126 Chinese hamster cells ...................................................................
    [Show full text]