[CANCERRESEARCH54,3001-3006,June1, 1994] Molecular Analysis of Ethyl Methanesulfonate-induced Mutations at the hprt Gene in the Ethyl Methanesulfonate-sensitive Chinese Hamster Cell Line EM-Cl! and Its Parental Line CHO9' Christel W. Op het Veld, Matgorzata Z. Zdzienicka, Harry Vrieling, Paul H. M. Lohman, and Albert A. van Zeeland2 MGC-Department of Radiation Genetics and Chemical Muzagenesis, State University of Leiden, Wassenaarseweg 72, 2333 AL Leiden [C. W. 0. h. V., M. Z. Z., H. V., P. H. M. L., A. A. V. Z.J, and J. A. Cohen Institute, Interuniversizy Research Institute for Radiopathology and Radiation Protection, Leiden [M. Z. Z., H. V., A. A. v. Z.J, the Netherlands ABSTRACF strong nucleophiles like the N-7 position of guanine, resulting in a relatively low 06/N-7-alkylguanine ratio. The Chinese hamster cell line EM-Cl! has been shown to be 5 times Molecular analysis of induced mutations, i.e. , the determination of more sensitive than its parental line CHO9, but not hypermutable, after mutational spectra, provides a valuable tool for the identification of treatment with ethyl methanesulfonate. Ethyl methanesulfonate-induced adducts that are involved in mutation induction. Moreover, the use of mutational spectra were determined at the hprt locus to investigate DNA repair deficient cell lines will generate additional information whether the same ndducts are responsible for mutation induction in both cell lines. The mutational spectra for EM-C!! and CHO9 show an im concerning the mutagenic potential of different types of DNA adducts. portent difference. GC-'AT transitions were found in both cell lines at Recently, a Chinese hamster ovary cell line, EM-Cl 1, which is very similar frequencies; however, the spectrum of CHO9 contains a class of sensitive to the cell killing effects of EMS, was isolated in our AT—'GCtransitions,which seems to be replaced by a group of deletions laboratory (2). EM-Cl 1 belongs to the same complementation group in EM-Cl!. Since the ethyl methanesulfonate-induced mutation frequency as EM9 (3) which shows a strongly enhanced cytotoxicity as well as for both lines is the same at equal exposure, it is hypothesized that the hypermutability after EMS treatment. Both cell lines are slow in the lesions leading to AT—'GCtransitions in CHO9 are responsible for the repair of DNA single strand breaks and the defect in these mutants is deletions in EM-Cl!. This phenomenon might be explained if the respon complemented by the human xrcc-l gene, isolated by Thompson et al. sible adduct(s) in CHO9 is bypassed resulting in replication errors, while (4). However, the precise biochemical defect remains to be deter blocking DNA synthesis in EM-Cl! causing the observed increase in cell mined (2, 3). A few differences have been observed between these death. In surviving EM-C!! cells, DNA strand exchanges might have two Chinese hamster ovary cell mutants. EM-Cl 1 is not sensitive to occurred at the position of stalled replication forks, leading to gross Uv irradiationandonlyslightlysensitivetoX-rays(2),whereasEM9 molecular changes. The adduct probably responsible for the AT—GC is sensitive to UV and X-rays (3). Thus EM-Cl 1 may have a more transitions in CHO9 and the deletions in EM-C!! is 3-ethyladenine. specific defect in the repair of DNA damage induced by alkylating agents and, therefore, appears to be a valuable tool for the determi INTRODUCFION nation of the nature of mutagenic lesions induced by monofunctional alkylating agents. Monofunctional alkylating agents such as EMS3 act directly on In this study we have used EM-Cl 1 and its parental line CHO9 to oxygen and nitrogen atoms in DNA bases and with oxygen moieties study the effects of EMS on the frequency and molecular nature of the of the phosphate backbone. A broad spectrum of DNA lesions is induced mutations in the hprt gene. formed, consisting of alkylated bases, phosphotriesters, and abasic sites due to spontaneous hydrolysis of unstable alkylation products or MATERIALS AND METHODS enzymatic hydrolysis by DNA glycosylases. The types of DNA le sions induced by an alkylating agent depend upon the reaction mech Cell Culture Conditions. EM-Cu Chinese hamsterovary cells and the anism and the reactivity of the alkylating agent, which can be ex parental line CHO9 were cultured in Ham's modified F-lO medium lacking pressed by the Swain-Scott constant. Alkylating agents with a low s hypoxanthine and thymidine and supplemented with 15% newborn calf serum (Gibco), 100 units/mi penicillin, and 0.1 mg/ml streptomycin (2). value, such as N-ethyl-N-nitrosourea (s 0.26), react with the nu EMS survival and mutation induction at the hprt locus were determined cleophilic centers in the DNA via a SN1 reaction, in which the rate according to the method of Zdzienicka and Simons (5). In brief, i0@cells were limiting step is the formation of the alkyl cation. These agents show treated in suspension for 1 h at 37°C in serum-free medium supplemented with a relatively low selectivity in their alkylation reaction. Since the 20 mi@t4-(2-hydroxyethyl)l-piperazethanesulfonic acid (pH 7.4) in a total number of oxygen atoms in DNA available for alkylation is larger volume of 10 ml. EMS (Eastman Co., Rochester, NY) was added directly to than the number of nitrogen atoms, compounds with a low s value the suspension or, in case of low exposures, EMS was diluted in phosphate give high levels of O-alkylation relatively to N-alkylations. These buffered saline just before use. agents further have a low chromosome breaking ability relative to Following treatment, cells were washed twice with phosphate buffered their capacity to induce gene mutations (1). EMS belongs to the saline, resuspended in medium with 15% newborn calf serum, and subse alkylating agents with a relatively high s value (s = 0.67) and follows quently cells were (a) seeded for survival (200 cells/94-mm dish; 5 dishes/ group) and (b) propagated for expression of induced mutants (3.5 X 10@'—2X a mixed SN1/SN2 type reaction. Therefore, EMS also reacts with 106 cells/l50-mm dish; 4 dishes/group); these dishes were subcultured after 4 days. Eight days after treatment cells were seeded for (a) cloning efficiency Received 12/22/93; accepted 3/28/94. (200 cells/94-mm dish; 5 dishes/group) and (b) selection of hprt-deficient Thecostsof publicationofthisarticleweredefrayedinpartby thepaymentofpage mutants (10@ cells/94-mm dish; 20 dishes/group) in medium containing 5 charges. This article must therefore be hereby marked advertisement in accordance with 18U.S.C.Section1734solelyto indicatethisfact. p@g/ml6TG.The mutant frequency was calculated by correcting the frequency I This work was supported by Grant KWF.90.04 from the Dutch Cancer Society (the of 6TG resistant clones with the corresponding cloning efficiency. Netherlands) and Grant EV5V-CF91-0012 from the Commission of the European Com Isolation of hprt Mutants for Moleculnr Analysis. To isolate hprt defi munities. dent mutants, 4—5 X i0@ C1-1O9 or EM-Cu cells were treated with 5 m@i 2 To whom requests for reprints should be addressed. 3 The abbreviations used are: EMS, ethyl methanesulfonate; 6TG, 6-thioguanine; EMS. After treatment, cells were washed twice, resuspended in complete cDNA, complementary DNA; PCR, polymerase chain reaction. medium, and subsequently divided in aliquots of 3.5 X l0@cells for CHO9 and 3001 Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1994 American Association for Cancer Research. 3-ETHYI.ADENINE CAUSES AT-' OC TRANS@ON5 Table 1 Primers used for molecular analysis of hprt mutants Primer sequence Positiona cDNA synthesis vrl-16 5' GCAGAUCAAcTFGAATFCFCATC 3' 681 to 658 PCR cDNA vrll0-m13 5' CGACG1TGTAAAACGACGGCCAGT 675 to658 TCAACTTGAATFCFCATC 3b zee-P 5' GGCflCCFCCTCAGACCGCT 3' —50to —31 PCR genomic DNA ham @5C 5' AGcTFATGCFCFGA1TFGAAATCAGCFG 3' E2:—42to —15 ham 23 5' AUAAGATCVFACVFACCFGTCCATAATC 3' 12:17 to E2:96 ham 35C 5' GGAACFCGTCFATfCCGTGATITFA 3' E3:—34 to —10 ham 33 5' AAATACATACAAAACTAGGAUGCC 3' 13:58 to 34 ham 45C 5' GTGTATFCAAGAATATGCATGTAAATGATG 3' E4:—45to —16 ham 43 5' CAAGTGAGTGATFGAAAGCACAGTFAC 3' 14:80 to 54 ham 55C 5' AACATAT000TCAAATAUOTFCTAATAG 3' E5:—141to—112 ham 53 5' GGCVfACCTATAGTATACACACTAAGCFA 3' 15:68 to 42 ham 75C 5' GTFCFArFGTCITFCCCATATGTC 3' E7:—49to —26 Sequencing m13 5' GTAAAACGACGGCCAGTG 3' vrl-2 5' GCAAGCfTGCAACCI'TAACC 3' 490 to 471 zee-6 5' CFGATAAAATCFACAGTCAT 3' 302 to 283 zee-4 5' CCATGAGGAATAAACAC 3' 119 to 93 a Positions in the coding region are numbered according to the method of Jolly et aL (29) with the A of the ATG initiation codon being the first nucleotide. A designation such as 11:5 refers to the fifth base of intron 1. b Bases in italics, M13 sequence. C 5'-Biotinylated primer. aliquots of 5 X i0@for EM-Cl 1. Each population was subcultured separately Mutational Spectrum of CHO9. hprt-deficient mutants were iso to ensure that all mutants obtained were independent. After 8 days of expres lated after an exposure to S m@i EMS. The spontaneous mutant sion time, each culture was harvested separately and 10@cells were seeded per frequency for CHO9 was 0.9 X i05, whereas after S mi@iEMS the plate (2 dishes/culture) in 6TG containing medium. After an additional growth mutant frequency was 22.8 X i0@, which indicates that most of the period of 10 days, only one 6TG resistant colony from each set of dishes was hprt mutants isolated for mutational analysis was induced by the EMS isolated. treatment. The RNA of the mutants was used to synthesize hprt cDNA In total, 25 independent hprt mutants from CHO9 and 41 hprt mutants from EM-Cu were isolated.