DOCSLIB.ORG

Katherine Yaacoub

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Katherine Yaacoub Année 2017 THÈSE / UNIVERSITÉ DE RENNES 1 sous le sceau de l’Université Bretagne Loire pour le grade de DOCTEUR DE L’UNIVERSITÉ DE RENNES 1 Mention : Biologie Ecole doctorale VAS Présentée par Katherine Yaacoub Préparée à l’unité de recherche INSERM U1242-COSS Chimie, Oncogenèse, Stress et Signalisation, CLCC Eugène Marquis Thèse soutenue à BIOSIT, Rennes c-FLIP as a potent le 27 Avril 2017 anticancer target : devant le jury composé de : Enhancement of Nathalie RIOUX-LECLERCQ Professeur au CHU de Rennes / Présidente du jury cancer cell apoptosis Sylvie FOURNEL Professeur à l’Université de Strasbourg / rapporteur by compounds Bruno SEGUI Professeur à l’Université de Toulouse/ rapporteur identified through Marie-Thérèse DIMANCHE-BOITREL virtual screening DR2 à l’Université de Rennes 1/ examinateur Vincent FERRIERES Professeur à ENSCR de Rennes/ examinateur Thierry GUILLAUDEUX MCU à l’Université de Rennes 1/ directeur de thèse Acknowledgements First of all, I would like to express my sincere gratitude to all the jury members for being a part of my project’s evaluation and for taking the time to read this manuscript. The success of our work relies heavily on the support and the advices of my thesis director Dr. Thierry Guillaudeux. I would like to take this opportunity to thank you for accepting me as student, for helping me to ameliorate my skills, and for encouraging me to improve my intellectual potential. You trusted me over the past three years and you taught me how a successful and independent student has to be. I am proud to have been your PhD student. Dr. Rémy Pedeux, let me call you the “Secret Guardian” of my thesis, you have been always ready to answer my questions and always welcoming when I knocked your door ten times a day! Thank you for saving my work when I did many mistakes, and for re-establishing my experiments on the right path. Pr. Richard Danielllou, Pr. Pascal Bonnet, Dr. Pierre Lafite, and Dr. Samia Aci-Sèche, thank you for giving me the chance to join your laboratory in Orléans and to do an important part of my thesis there. Thank you for your technical advices, constructive remarks and inspiring conversations. I would like to thank COSS team members for these extra-professional and wonderful moments and for your conviviality and benevolence. Special thanks for the Lebanese “Association of Specialization and Scientific Orientation”, that offered me a scholarship for higher education during these three years. Without your contribution, I would not have the chance to come to France and get this degree. I warmly thank all my lovely friends in Rennes, who showed me their immense support. Chaza, Ramona, Nour, Bassil, Nicolas and Emna. You all supported me and listened to my complaints with interest. Thank you for sharing with me these adorable moments in Rennes. Without you I would not have this humorous and amazing stay in France. I will end by thanking my family who supported me throughout this thesis despite the distance. Precious Mom & Dad, you are the reason of my success, thank you for helping me to strengthen my weakness. Firas & Marcel, you are the most warmhearted brothers in the world, thank you for being always by my side. Uncles, Aunties particularly Helene, and cousins, your support is much appreciated. THANK YOU ALL… 1 Abstract FLIP (FLICE Inhibitory Protein) is an anti-apoptotic protein which shares sequence similarity with the pro-apoptotic protein caspase-8. FLIP competes with caspase-8 for binding to the adaptor protein FADD (Fas-associated death domain), thus it inhibits caspase-8 activation, thereby blocking apoptosis. During the development of molecules interfering with anti-apoptotic proteins, searching for inhibitors of FLIP protein which is overexpressed in a very large number of cancers, has failed. This is partly due to the fact that little FLIP structural information is available at present. TRAIL is a member of TNFα superfamily. It has been described to activate the apoptotic signaling pathways. TRAIL showed great interest in anti-cancer therapy, due to its ability to induce tumor cell death without any effect on normal cells. However, the efficacy of TRAIL is limited by several molecular mechanisms. One of these mechanisms is the overexpression of FLIP which is able to compromise the therapeutic use of TRAIL. The main goal of this project is to develop novel inhibitory molecules able to interfere with FLIP in tumor cells without any effect on the homologous protein caspase 8. After the construction of FLIP and caspase-8 proteins on the basis of the crystallographic structure of the viral FLIP and FADD respectively, the first docking experiments using a chemical library of the National Cancer Institute NCI have been carried out. The most interesting molecules, being selective for FLIP versus caspase 8, were selected and tested on lung cancer cell lines that overexpress FLIP protein. Co-administration of FLIP inhibitors with TRAIL was performed to verify the restoration of the apoptotic pathway in cancer cells. A molecular test of "Pull down assay" was done in order to confirm the inhibition of the FLIP/FADD interaction. Finally, the evaluation of caspases activity was carried out to confirm the reactivation of the apoptotic machinery after TRAIL/FLIP-inhibitors combination. In conclusion, the combination of TRAIL with FLIP inhibitors resulted in apoptosis restoration in resistant tumor cells. These newly identified compounds may serve later as potential elements in cancer treatment field. 2 Résumé Plusieurs protéines anti-apoptotiques sont surexprimées dans les cellules tumorales où elles contribuent à la transformation des cellules cancéreuses et à leur résistance à la plupart des traitements. L’échappement aux mécanismes apoptotiques contribue à la carcinogénèse et à la progression tumorale, mais il participe également à la résistance aux traitements, puisque les différentes thérapies anti-cancéreuses aujourd’hui utilisées que ce soit la chimiothérapie, la radiothérapie ou l’immunothérapie agissent majoritairement en activant les voies de signalisation conduisant à la mort cellulaire et tout particulièrement à l’apoptose. Aussi, ces molécules anti-apoptotiques sont des cibles de choix dans l’élaboration de nouvelles approches thérapeutiques. Des composés ciblant les protéines anti-apoptotiques soit au niveau de leur ARNm (oligonucléotides antisens), soit au niveau protéique (petites molécules inhibitrices) ont été développés et sont actuellement en phase d’évaluation préclinique, voire clinique pour certains d’entre eux. Néanmoins dans cette course au développement de molécules interférant avec les protéines anti-apoptotiques, des inhibiteurs ciblant la protéine anti-apoptotique c-FLI font défaut. Ceci est en partie dû au fait que peu d’informations structurales de c-FLIP sont disponible à l’heure actuelle. FLIP (FLICE Inhibitory Protein) est une protéine inhibitrice qui interfère dans le recrutement des caspases initiatrices 8 et 10 de la mort cellulaire programmée (apoptose) dans la région cytoplasmique des récepteurs de mort activés. Grâce aux fortes identités de séquences partagées entre c-FLIP et les deux procaspases-8/10, c-FLIP est capable d’empêcher leur interaction avec les récepteurs de mort par l’intermédiaire du complexe supramoléculaire DISC (Death Inducing Signalling Complex), bloquant ainsi leur activation. La protéine FLIP possède deux domaines effecteurs de mort (Death Effector Domains DEDs : DED1 and DED2) positionnés en tandem qui miment le prodomaine des procaspases- 8/10. FLIP peut être recrutée avec FADD (Fas Associated Death Domain) via son DED2 au sein du DISC, empêchant ainsi l’activation des β procaspases. Trois isoformes de la protéine cytosolique FLIP ont été caractérisées à ce jour ainsi que 6 protéines homologues virales (v- FLIP) qui permettent ainsi de prolonger la survie des cellules qu’ils infectent. La structure cristallographique récente de v-FLIP a permis de révéler que les 2 domaines effecteurs de mort (DED 1/β) étaient associés l’un avec l’autre de manière très étroite principalement grâce à des interactions hydrophobes conservées. FLIP est une protéine anti-apoptotique extrêmement importante que l’on retrouve surexprimée dans un très grand nombre de tumeurs d’origines tissulaires variées, comme les 3 carcinomes colorectaux, les carcinomes gastriques, les carcinomes pancréatiques, les lymphomes de Hodgkin, les lymphomes B folliculaires, les leucémies lymphoïdes chroniques, les mélanomes, les carcinomes du sein, les carcinomes ovariens, les cancers de l’utérus, ainsi que les carcinomes de la vessie et de la prostate, et elle participe fortement au développement tumoral et à la résistance aux molécules thérapeutiques. De nombreux travaux ont permis de montrer que FLIP était un acteur déterminant dans la résistance à la mort induite par des ligands pro-apoptotiques tels que TRAIL et que la diminution de son expression sensibilisait de nombreuses cellules tumorales préalablement résistantes à la mort. A l’inverse l’expression forcée de FLIP rend les cellules résistantes au TRAIL. Ces observations démontrent bien que FLIP apparait comme une cible thérapeutique de choix, en particulier pour les différents types de tumeurs précités et pour lesquels le caractère malin agressif et la résistance aux agents thérapeutiques sont très étroitement dépendants de la surexpression de cette protéine. En outre, v-FLIP K1γ de l’herpesvirus 8 humain (HHV8, qualifié d’herpesvirus associé au sarcome de Kaposi, KSHV) joue également un rôle oncogénique en inhibant
Load more

Recommended publications
  • Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice
    Loyola University Chicago Loyola eCommons Biology: Faculty Publications and Other Works Faculty Publications 2013 Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice Mihaela Palicev Gunter P. Wagner James P. Noonan Benedikt Hallgrimsson James M. Cheverud Loyola University Chicago, [email protected] Follow this and additional works at: https://ecommons.luc.edu/biology_facpubs Part of the Biology Commons Recommended Citation Palicev, M, GP Wagner, JP Noonan, B Hallgrimsson, and JM Cheverud. "Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice." Genome Biology and Evolution 5(10), 2013. This Article is brought to you for free and open access by the Faculty Publications at Loyola eCommons. It has been accepted for inclusion in Biology: Faculty Publications and Other Works by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. © Palicev et al., 2013. GBE Genomic Correlates of Relationship QTL Involved in Fore- versus Hind Limb Divergence in Mice Mihaela Pavlicev1,2,*, Gu¨ nter P. Wagner3, James P. Noonan4, Benedikt Hallgrı´msson5,and James M. Cheverud6 1Konrad Lorenz Institute for Evolution and Cognition Research, Altenberg, Austria 2Department of Pediatrics, Cincinnati Children‘s Hospital Medical Center, Cincinnati, Ohio 3Yale Systems Biology Institute and Department of Ecology and Evolutionary Biology, Yale University 4Department of Genetics, Yale University School of Medicine 5Department of Cell Biology and Anatomy, The McCaig Institute for Bone and Joint Health and the Alberta Children’s Hospital Research Institute for Child and Maternal Health, University of Calgary, Calgary, Canada 6Department of Anatomy and Neurobiology, Washington University *Corresponding author: E-mail: [email protected].
    [Show full text]
  • Download Download
    Supplementary Figure S1. Results of flow cytometry analysis, performed to estimate CD34 positivity, after immunomagnetic separation in two different experiments. As monoclonal antibody for labeling the sample, the fluorescein isothiocyanate (FITC)- conjugated mouse anti-human CD34 MoAb (Mylteni) was used. Briefly, cell samples were incubated in the presence of the indicated MoAbs, at the proper dilution, in PBS containing 5% FCS and 1% Fc receptor (FcR) blocking reagent (Miltenyi) for 30 min at 4 C. Cells were then washed twice, resuspended with PBS and analyzed by a Coulter Epics XL (Coulter Electronics Inc., Hialeah, FL, USA) flow cytometer. only use Non-commercial 1 Supplementary Table S1. Complete list of the datasets used in this study and their sources. GEO Total samples Geo selected GEO accession of used Platform Reference series in series samples samples GSM142565 GSM142566 GSM142567 GSM142568 GSE6146 HG-U133A 14 8 - GSM142569 GSM142571 GSM142572 GSM142574 GSM51391 GSM51392 GSE2666 HG-U133A 36 4 1 GSM51393 GSM51394 only GSM321583 GSE12803 HG-U133A 20 3 GSM321584 2 GSM321585 use Promyelocytes_1 Promyelocytes_2 Promyelocytes_3 Promyelocytes_4 HG-U133A 8 8 3 GSE64282 Promyelocytes_5 Promyelocytes_6 Promyelocytes_7 Promyelocytes_8 Non-commercial 2 Supplementary Table S2. Chromosomal regions up-regulated in CD34+ samples as identified by the LAP procedure with the two-class statistics coded in the PREDA R package and an FDR threshold of 0.5. Functional enrichment analysis has been performed using DAVID (http://david.abcc.ncifcrf.gov/)
    [Show full text]
  • S41467-020-18249-3.Pdf
    ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible.
    [Show full text]
  • ING3 Is Essential for Asymmetric Cell Division During Mouse Oocyte Maturation
    ING3 Is Essential for Asymmetric Cell Division during Mouse Oocyte Maturation Shinnosuke Suzuki1, Yusuke Nozawa1, Satoshi Tsukamoto2, Takehito Kaneko3, Hiroshi Imai1, Naojiro Minami1* 1 Laboratory of Reproductive Biology, Graduate School of Agriculture, Kyoto University, Kyoto, Japan, 2 Laboratory Animal and Genome Sciences Section, National Institute of Radiological Sciences, Chiba, Japan, 3 Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, Kyoto, Japan Abstract ING3 (inhibitor of growth family, member 3) is a subunit of the nucleosome acetyltransferase of histone 4 (NuA4) complex, which activates gene expression. ING3, which contains a plant homeodomain (PHD) motif that can bind to trimethylated lysine 4 on histone H3 (H3K4me3), is ubiquitously expressed in mammalian tissues and governs transcriptional regulation, cell cycle control, and apoptosis via p53-mediated transcription or the Fas/caspase-8 pathway. Thus, ING3 plays a number of important roles in various somatic cells. However, the role(s) of ING3 in germ cells remains unknown. Here, we show that loss of ING3 function led to the failure of asymmetric cell division and cortical reorganization in the mouse oocyte. Immunostaining showed that in fully grown germinal vesicle (GV) oocytes, ING3 localized predominantly in the GV. After germinal vesicle breakdown (GVBD), ING3 homogeneously localized in the cytoplasm. In oocytes where Ing3 was targeted by siRNA microinjection, we observed symmetric cell division during mouse oocyte maturation. In those oocytes, oocyte polarization was not established due to the failure to form an actin cap or a cortical granule-free domain (CGFD), the lack of which inhibited spindle migration. These features were among the main causes of abnormal symmetric cell division.
    [Show full text]
  • Mir-17-92 Fine-Tunes MYC Expression and Function to Ensure
    ARTICLE Received 31 Mar 2015 | Accepted 22 Sep 2015 | Published 10 Nov 2015 DOI: 10.1038/ncomms9725 OPEN miR-17-92 fine-tunes MYC expression and function to ensure optimal B cell lymphoma growth Marija Mihailovich1, Michael Bremang1, Valeria Spadotto1, Daniele Musiani1, Elena Vitale1, Gabriele Varano2,w, Federico Zambelli3, Francesco M. Mancuso1,w, David A. Cairns1,w, Giulio Pavesi3, Stefano Casola2 & Tiziana Bonaldi1 The synergism between c-MYC and miR-17-19b, a truncated version of the miR-17-92 cluster, is well-documented during tumor initiation. However, little is known about miR-17-19b function in established cancers. Here we investigate the role of miR-17-19b in c-MYC-driven lymphomas by integrating SILAC-based quantitative proteomics, transcriptomics and 30 untranslated region (UTR) analysis upon miR-17-19b overexpression. We identify over one hundred miR-17-19b targets, of which 40% are co-regulated by c-MYC. Downregulation of a new miR-17/20 target, checkpoint kinase 2 (Chek2), increases the recruitment of HuR to c- MYC transcripts, resulting in the inhibition of c-MYC translation and thus interfering with in vivo tumor growth. Hence, in established lymphomas, miR-17-19b fine-tunes c-MYC activity through a tight control of its function and expression, ultimately ensuring cancer cell homeostasis. Our data highlight the plasticity of miRNA function, reflecting changes in the mRNA landscape and 30 UTR shortening at different stages of tumorigenesis. 1 Department of Experimental Oncology, European Institute of Oncology, Via Adamello 16, Milan 20139, Italy. 2 Units of Genetics of B cells and lymphomas, IFOM, FIRC Institute of Molecular Oncology Foundation, Milan 20139, Italy.
    [Show full text]
  • Supporting Information
    Supporting Information Pouryahya et al. SI Text Table S1 presents genes with the highest absolute value of Ricci curvature. We expect these genes to have significant contribution to the network’s robustness. Notably, the top two genes are TP53 (tumor protein 53) and YWHAG gene. TP53, also known as p53, it is a well known tumor suppressor gene known as the "guardian of the genome“ given the essential role it plays in genetic stability and prevention of cancer formation (1, 2). Mutations in this gene play a role in all stages of malignant transformation including tumor initiation, promotion, aggressiveness, and metastasis (3). Mutations of this gene are present in more than 50% of human cancers, making it the most common genetic event in human cancer (4, 5). Namely, p53 mutations play roles in leukemia, breast cancer, CNS cancers, and lung cancers, among many others (6–9). The YWHAG gene encodes the 14-3-3 protein gamma, a member of the 14-3-3 family proteins which are involved in many biological processes including signal transduction regulation, cell cycle pro- gression, apoptosis, cell adhesion and migration (10, 11). Notably, increased expression of 14-3-3 family proteins, including protein gamma, have been observed in a number of human cancers including lung and colorectal cancers, among others, suggesting a potential role as tumor oncogenes (12, 13). Furthermore, there is evidence that loss Fig. S1. The histogram of scalar Ricci curvature of 8240 genes. Most of the genes have negative scalar Ricci curvature (75%). TP53 and YWHAG have notably low of p53 function may result in upregulation of 14-3-3γ in lung cancer Ricci curvatures.
    [Show full text]
  • Overexpression of ING3 Is Associated with Attenuation of Migration and Invasion in Breast Cancer
    EXPERIMENTAL AND THERAPEUTIC MEDICINE 22: 699, 2021 Overexpression of ING3 is associated with attenuation of migration and invasion in breast cancer HUIMENG LI1*, HENGYU ZHANG1*, XIN TAN1*, DEQUAN LIU1, RONG GUO1, MAOHUA WANG1, YIYIN TANG1, KAI ZHENG1, WENLIN CHEN1, HONGWAN LI1, MINGJIAN TAN1, KE WANG1, RUI LIU2 and SHICONG TANG1 1Department of Breast Surgery, The Third Affiliated Hospital of Kunming Medical University, Yunnan Cancer Hospital, Kunming, Yunnan 650118; 2Department of Clinical Laboratory, The Second Affiliated Hospital of Kunming Medical University, Kunming, Yunnan 650101, P.R. China Received May 9, 2020; Accepted March 24, 2021 DOI: 10.3892/etm.2021.10131 Abstract. Inhibitor of growth 3 (ING3) has been identified Notably, statistically significant differences were observed as a potential cancer drug target, but little is known about its in long‑term survival between patients with luminal A role in breast cancer. Thus, the present study aimed to inves‑ (P=0.04) and HER2‑enriched (P=0.008) breast cancer, with tigate ING3 expression in breast cancer, its clinical value, and high and low expression levels of ING3. The results of the how ING3 influences the migration and invasion of breast Transwell migration and invasion assays demonstrated that cancer cells. The Cancer Genome Atlas and UALCAN data‑ overexpression of ING3 significantly inhibited the migra‑ bases were used to analyze ING3 expression in cancer tissues tory and invasive abilities of MCF7 (P<0.05) and HCC1937 and normal tissues. Survival analysis was performed using the (P<0.05) cells. The results of the wound healing assay UALCAN, UCSC Xena and KM‑plot databases.
    [Show full text]
  • Genetically Modified Macrophages and Renal Regeneration
    Genetically Modified Macrophages and Renal Regeneration Chrysoula Mastora ADVERTIMENT. La consulta d’aquesta tesi queda condicionada a l’acceptació de les següents condicions d'ús: La difusió d’aquesta tesi per mitjà del servei TDX (www.tdx.cat) i a través del Dipòsit Digital de la UB (diposit.ub.edu) ha estat autoritzada pels titulars dels drets de propietat intel·lectual únicament per a usos privats emmarcats en activitats d’investigació i docència. No s’autoritza la seva reproducció amb finalitats de lucre ni la seva difusió i posada a disposició des d’un lloc aliè al servei TDX ni al Dipòsit Digital de la UB. No s’autoritza la presentació del seu contingut en una finestra o marc aliè a TDX o al Dipòsit Digital de la UB (framing). Aquesta reserva de drets afecta tant al resum de presentació de la tesi com als seus continguts. En la utilització o cita de parts de la tesi és obligat indicar el nom de la persona autora. ADVERTENCIA. La consulta de esta tesis queda condicionada a la aceptación de las siguientes condiciones de uso: La difusión de esta tesis por medio del servicio TDR (www.tdx.cat) y a través del Repositorio Digital de la UB (diposit.ub.edu) ha sido autorizada por los titulares de los derechos de propiedad intelectual únicamente para usos privados enmarcados en actividades de investigación y docencia. No se autoriza su reproducción con finalidades de lucro ni su difusión y puesta a disposición desde un sitio ajeno al servicio TDR o al Repositorio Digital de la UB.
    [Show full text]
  • Gene Section Review
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST-CNRS Gene Section Review ING3 (inhibitor of growth family, member 3) Audrey Mouche, Katherine Yaacoub, Thierry Guillaudeux, Rémy Pedeux INSERM U917, Microenvironnement et Cancer, Rennes, France, Universite de Rennes 1, Rennes, France (AM, KY, RP, TG); Etablissement Francais du Sang, Rennes, France (RP); UMS Biosit 3480 CNRS/018 INSERM (TG) Published in Atlas Database: November 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/ING3ID40977ch7q31.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/62489/11-2014-ING3ID40977ch7q31.pdf DOI: 10.4267/2042/62489 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2015 Atlas of Genetics and Cytogenetics in Oncology and Haematology Abstract Review on ING3, with data on DNA/RNA, on the protein encoded and where the gene is implicated. Identity Other names: Eaf4, ING2, MEAF4, p47ING3 HGNC (Hugo): ING3 Location: 7q31.31 DNA/RNA Description In 1996, Karl Riabowol's group identified a new Tumor Suppressor Gene (TSG) by using subtractive hybridization between cDNAs from normal mammary epithelial cells and mammary epithelial cells from tumor. This experiment was followed by an in vivo screen for tumourigenesis. Using this method, the authors identified a new candidate TSG that they named ING1 for INhibitor of Growth 1 (Garkavtsev et al., 1996). Few years later, ING2, ING3, ING4 and ING5 were identified by homology search. ING3 was identified through bioinformatic analyses in order to find human EST clone showing Figure 1. Chromosomal localization of the ING3 gene in a high homology with the p33ING1b and p33ING2 Homo sapiens.
    [Show full text]
  • ING3 (NM 019071) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC218424 ING3 (NM_019071) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ING3 (NM_019071) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ING3 Synonyms: Eaf4; ING2; MEAF4; p47ING3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC218424 representing NM_019071 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTGTACCTAGAAGACTATCTGGAAATGATTGAGCAGCTTCCTATGGATCTGCGGGACCGCTTCACGG AAATGCGCGAGATGGACCTGCAGGTGCAGAATGCAATGGATCAACTAGAACAAAGAGTCAGTGAATTCTT TATGAATGCAAAGAAAAATAAACCTGAGTGGAGGGAAGAGCAAATGGCATCCATCAAAAAAGACTACTAT AAAGCTTTGGAAGATGCAGATGAGAAGGTTCAGTTGGCAAACCAGATATATGACTTGGTAGATCGACACT TGAGAAAGCTGGATCAGGAACTGGCTAAGTTTAAAATGGAGCTGGAAGCTGATAATGCTGGAATTACAGA AATATTAGAGAGGCGATCTTTGGAATTAGACACTCCTTCACAGCCAGTGAACAATCACCATGCTCATTCA CATACTCCAGTGGAAAAAAGGAAATATAATCCAACTTCTCACCATACGACAACAGATCATATTCCTGAAA AGAAATTTAAATCTGAAGCTCTTCTATCCACCCTTACGTCAGATGCCTCTAAGGAAAATACACTAGGTTG TCGAAATAATAATTCCACAGCCTCTTCTAACAATGCCTACAATGTGAATTCCTCCCAACCTCTGGGATCC TATAACATTGGCTCGTTATCTTCAGGAACTGGTGCAGGGGCAATTACCATGGCAGCTGCTCAAGCAGTTC AGGCTACAGCTCAGATGAAGGAGGGACGAAGAACATCAAGTTTAAAAGCCAGTTATGAAGCATTTAAGAA TAATGACTTTCAGTTGGGAAAAGAATTTTCAATGGCCAGGGAAACAGTTGGCTATTCATCATCTTCGGCA CTTATGACAACATTAACACAGAATGCCAGTTCATCAGCAGCCGACTCACGGAGTGGTCGAAAGAGCAAAA
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • Original Article Identification of Differentially Expressed Genes Between Male and Female Patients with Acute Myocardial Infarction Based on Microarray Data
    Int J Clin Exp Med 2019;12(3):2456-2467 www.ijcem.com /ISSN:1940-5901/IJCEM0080626 Original Article Identification of differentially expressed genes between male and female patients with acute myocardial infarction based on microarray data Huaqiang Zhou1,2*, Kaibin Yang2*, Shaowei Gao1, Yuanzhe Zhang2, Xiaoyue Wei2, Zeting Qiu1, Si Li2, Qinchang Chen2, Yiyan Song2, Wulin Tan1#, Zhongxing Wang1# 1Department of Anesthesiology, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China; 2Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China. *Equal contributors and co-first au- thors. #Equal contributors. Received May 31, 2018; Accepted August 4, 2018; Epub March 15, 2019; Published March 30, 2019 Abstract: Background: Coronary artery disease has been the most common cause of death and the prognosis still needs further improving. Differences in the incidence and prognosis of male and female patients with coronary artery disease have been observed. We constructed this study hoping to understand those differences at the level of gene expression and to help establish gender-specific therapies. Methods: We downloaded the series matrix file of GSE34198 from the Gene Expression Omnibus database and identified differentially expressed genes between male and female patients. Gene ontology, Kyoto Encyclopedia of Genes and Genomes pathway enrichment analy- sis, and GSEA analysis of differentially expressed genes were performed. The protein-protein interaction network was constructed of the differentially expressed genes and the hub genes were identified. Results: A total of 215 up-regulated genes and 353 down-regulated genes were identified. The differentially expressed pathways were mainly related to the function of ribosomes, virus, and related immune response as well as the cell growth and proliferation.
    [Show full text]