DOCSLIB.ORG

Genetic Switchboard for Synthetic Biology Applications

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Switchboard for Synthetic Biology Applications Genetic switchboard for synthetic biology applications Jarred M. Calluraa,b,c, Charles R. Cantorb,1, and James J. Collinsa,b,c,d,1 aHoward Hughes Medical Institute, bDepartment of Biomedical Engineering, and cCenter for BioDynamics, Boston University, Boston, MA 02215; and dWyss Institute for Biologically Inspired Engineering, Harvard University, Boston, MA 02215 Contributed by Charles R. Cantor, March 5, 2012 (sent for review February 6, 2012) A key next step in synthetic biology is to combine simple circuits into number of riboregulator variants; this expansion was needed to higher-order systems. In this work, we expanded our synthetic complete a genetic switchboard. We used two distinct rational riboregulation platform into a genetic switchboard that indepen- design strategies that focused on different components of dently controls the expression of multiple genes in parallel. First, we riboregulation. Using RR12 as the prototype, we replaced its designed and characterized riboregulator variants to complete the RBS with an engineered RBS of similar strength and mutated foundation of the genetic switchboard; then we constructed the the bases involved in the initial crRNA–taRNA recognition switchboard sensor, a testing platform that reported on quorum- complex. After obtaining a set of four orthogonal variants, we signaling molecules, DNA damage, iron starvation, and extracellular assembled the riboregulators onto two plasmids in single cells to magnesium concentration in single cells. As a demonstration of the create the genetic switchboard and tested the performance of the biotechnological potential of our synthetic device, we built a metab- switchboard in a biosensing setup with easily detectable outputs. The switchboard sensor simultaneously regulates four differen- olism switchboard that regulated four metabolic genes, pgi, zwf, β edd,andgnd, to control carbon flow through three Escherichia coli tiable reporters, GFP, mCherry, -galactosidase, and luciferase, glucose-utilization pathways: the Embden–Meyerhof, Entner–Dou- with four environmentally sensitive promoters, pLuxI, PLlexO, P , and pMgrB, respectively. Measured reporter levels doroff, and pentose phosphate pathways. We provide direct evi- LfurO showcase the tight and powerful regulation, with minimal dence for switchboard-mediated shunting of metabolic flux by crosstalk, provided by the genetic switchboard. measuring mRNA levels of the riboregulated genes, shifts in the Biological circuitry that regulates many genes in parallel lends activities of the relevant enzymes and pathways, and targeted itself to a variety of biotechnological applications and particu- changes to the E. coli metabolome. The design, testing, and imple- larly to metabolic engineering. Synthetic biology has a history of mentation of the genetic switchboard illustrate the successful con- providing components for metabolic engineering, such as bio- struction of a higher-order system that can be used for a broad range synthetic pathways and enzyme scaffolds (9, 10). Adding to this of practical applications in synthetic biology and biotechnology. toolbox, the genetic switchboard is a well-defined, biological module that possesses the flexibility to aid different metabolic s synthetic biology matures, the drive for higher-order sys- engineering strategies. As proof of concept, we constructed Atems and larger DNA assemblies is intensifying (1, 2). Re- a metabolism switchboard that controls carbon flux through cent successes include a sensing array for the detection of heavy three Escherichia coli glucose-utilization pathways, the Embden– metals and pathogens and a wide range of logic computations Meyerhof (EMP), Entner–Doudoroff (EDP), and pentose using simple circuits and chemical wires (3, 4). However, this phosphate (PPP) pathways, via the regulation of four different push for complexity underscores the need for interoperable parts genes, pgi, zwf, edd, and gnd. The performance of the metabolism and expandable systems (5). Additional components that can be switchboard over multiple biological scales, namely, at the RNA, scaled up and operate orthogonally are needed for synthetic bi- protein, and metabolome levels, showcases the real-world po- ology to continue to produce innovative systems and capitalize on tential of our higher-order control system. its full potential in biotechnology (6). Previously, we introduced the synthetic riboregulator, an RNA-based gene-expression sys- Results and Discussion tem, and noted its orthogonal expression capabilities (7, 8). Here, Rational Design of Riboregulator Variants. In the initial synthetic we present a genetic switchboard, a higher-order device that in- riboregulator study, the RR10 variant was constructed success- dependently and tightly regulates multiple genes in parallel. fully, and, in an attempt to improve the dynamic range of the A switchboard is as an assembly of switches that is useful for system, the RR12 variant was built as a rationally designed re- controlling and linking electrical circuits. Here, we define a ge- finement (7). Here, RR42 and RR12y, the two riboregulator netic switchboard as an assembly of orthogonal, genetic switches variants required to create the genetic switchboard, also were that is useful for controlling and linking biological circuits and rationally designed, but via two unique strategies. RR42 was the pathways. The current iteration of our genetic switchboard result of RBS manipulation, and RR12y was the result of mu- combines four synthetic riboregulators serving as the orthogonal tating the crRNA–taRNA recognition sequence. In both cases, genetic switches for the platform. An individual riboregulator RR12 was the parent riboregulator variant, and we attempted to controls gene expression posttranscriptionally via two RNA minimize the changes to the successful RR12 blueprint while species, a cis-repressed mRNA (crRNA) and a trans-activating introducing enough mutations to generate orthogonal activity. RNA (taRNA) (Fig. 1A). Once transcribed, target-gene trans- Therefore, critical specifications of RR12, such as the Mfold- lation is blocked on the crRNA by the cis-repressive sequence predicted secondary structures and thermodynamic values, were forming a stem loop with the ribosome-binding site (RBS). preserved in the designs of RR42 and RR12y (11). Switching on target-gene expression requires the transcription of When constructing the RR42 riboregulator, we targeted the the taRNA, a small, noncoding RNA containing the trans-acti- RBS of the RR12 variant. Using the RBS Calculator (12), we vating sequence, which destabilizes the crRNA stem loop and frees the RBS. Features of synthetic riboregulation that make it an attractive choice for the foundation of a switchboard include Author contributions: J.M.C., C.R.C., and J.J.C. designed research; J.M.C. performed re- physiologically relevant protein production, component modu- search; J.M.C. analyzed data; and J.M.C., C.R.C., and J.J.C. wrote the paper. larity, leakage minimization, tunability, fast response times, easy The authors declare no conflict of interest. logic programmability, and negligible crosstalk between variants Freely available online through the PNAS open access option. with different cis-repressive and trans-activating sequences (8). 1To whom correspondence may be addressed. E-mail: [email protected] or jcollins@ Originally, only two synthetic riboregulator variants were bu.edu. engineered with acceptable dynamic ranges, the RR10 and This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. RR12 variants (7). In the present work, we first expanded the 1073/pnas.1203808109/-/DCSupplemental. 5850–5855 | PNAS | April 10, 2012 | vol. 109 | no. 15 www.pnas.org/cgi/doi/10.1073/pnas.1203808109 A A B Cis UU C C G -Repressed G UAA UACGC UAU UCCAU CUUAAG RR12 crR42 GFP Expression mRNA (crRNA) CR RBS Gene G AUU AUGAG AUA AGGUACC UU G AA GU A G A AUG G UAG UUCUCC CUU CCAU C U U A A G taR42 C C 70 Trans-activating G AG U G AUU AAGAGG GAA GGUA A U G taR12y A UAAUUGG UGGUGAUGG AUAGGCG GGUUAAACCCA GU AAA ncRNA (taRNA) TA A AUUAACU ACUA CUACC UAUUCGU CUAGA taR12 A U AG U A A no taRNA A G RR42 50 A U UU C GG U A G UAA UAC CCUAU UCCAUC U U A A G U A C C A U G AUU AUG GGAUA AGGUA A U G A U GU AA A 30 C G Trans-activated gene expression UU G A U RR12y C G 10 U G G UU G AA U U A A G AGAUCUUGCUUAUGACCAUCA U GAUGGA AUAGGCGUGGUUAAACCCA G UAG UUCUCC CUU CCAU C change Fluorescence Fold GAAUUCUAC CU UAUCCGCAUCAAUUUGGGUAUUAAUGAGGAUAAAGGUACCAUG G AUU AAGAGG GAA GGUAC C G GU A U G 0 1 2 3 AAA Time (h) B C crR12y GFP Expression D crR12 GFP Expression Input 1 200 taR12y 200 taR12 Input 2 Promoter 2 TA1 Promoter 1 CR1 RBS Gene A A taR42 taR12y 160 taR12 160 taR42 Input 3 no taRNA no taRNA Input 4 Promoter 4 TA2 Promoter 3 CR2 RBS Gene B B 120 120 Input 5 80 80 Input 6 Promoter 6 TA3 Promoter 5 CR3 RBS Gene C C 40 40 Input 7 Fold change Fluorescence Fold change Fluorescence Fold Promoter 8 TA4 Promoter 7 CR4 RBS Gene D D Input 8 031 2 031 2 Time (h) Time (h) Input N-1 Fig. 2. Characterization of riboregulators RR42 and RR12y. (A) Mfold-pre- X Input N Prom. N TAN Prom. N-1 CRN RBS Gene X dicted secondary structures of crR12, crR42, and crR12y. Mutations in var- iants crR42 and crR12y, relative to the parent crR12 variant, are outlined in Fig. 1. Engineered riboregulation and the genetic switchboard. (A) Over- purple. Important features are color-coded: cis-repressive sequence (orange), view of engineered riboregulation. Mfold-predicted secondary structures of RBS (blue), target gene start codon (red), and taRNA recognition bases – a crRNA and taRNA, along with the proposed structure of the crRNA–taRNA (gray). (B D) Fold changes in GFP expression from fully induced crRNA complex that promotes gene expression. Important features are color- cotranscribed with cognate and noncognate taRNA. (B) crR42. (C) crR12y. (D) coded: the cis-repressive sequence (orange), RBS (blue), target gene (red), crR12.
Load more

Recommended publications
  • Engineering a Circular Riboregulator in Escherichia Coli
    bioRxiv preprint doi: https://doi.org/10.1101/008987; this version posted September 25, 2014. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Engineering a circular riboregulator in Escherichia coli William Rostain1,2, Shensi Shen2, Teresa Cordero1, Guillermo Rodrigo2,3 and Alfonso Jaramillo1,2,* 1 School of Life Sciences, University of Warwick, Coventry, CV4 7AL, United Kingdom. 2 Institute of Systems and Synthetic Biology, CNRS - Université d’Evry val d’Essonne, 91000 Évry, France. 3 Instituto de Biologia Molecular y Celular de Plantas, CSIC – Universidad Politécnica de Valencia, 46022 Valencia, Spain. * Corresponding author. School of Life Sciences, University of Warwick. Gibbet Hill Road, Coventry, CV4 7AL, United Kingdom. Tel: +44 (0)24 765 73432, E-mail: [email protected] Type: Letter Running title: Circular Riboregulator. Keywords: Biotechnology, Riboregulators, Splicing, Synthetic Biology. 1 bioRxiv preprint doi: https://doi.org/10.1101/008987; this version posted September 25, 2014. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Circular RNAs have recently been shown to be important gene expression regulators in mammalian cells. However, their role in prokaryotes remains elusive. Here, we engineered a synthetic riboregulator that self-splice to produce a circular molecule, exploiting group I permuted intron-exon (PIE) sequences. We demonstrated that the resulting circular riboregulator can activate gene expression, showing increased dynamic range compared to the linear form. We characterized the system with a fluorescent reporter and with an antibiotic resistance marker.
    [Show full text]
  • Dynamic Signal Processing by Ribozyme-Mediated RNA Circuits to Control Gene Expression
    bioRxiv preprint doi: https://doi.org/10.1101/016915; this version posted March 23, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Dynamic signal processing by ribozyme- mediated RNA circuits to control gene expression Shensi Shen1,†, Guillermo Rodrigo1,†, Satya Prakash3, Eszter Majer2, Thomas E. Landrain1, Boris Kirov1, José-Antonio Daròs2, and Alfonso 1,3,* Jaramillo 1 Institute of Systems and Synthetic Biology, Université d’Évry Val d’Essonne, CNRS, F-91000 Évry, France 2 Instituto de Biología Molecular y Celular de Plantas, CSIC - Universidad Politécnica de Valencia, 46022 Valencia, Spain 3 School of Life Sciences, University of Warwick, Coventry CV4 7AL, United Kingdom † Equal contribution to the work. * Correspondence: School of Life Sciences, University of Warwick, Coventry CV4 7AL, United Kingdom. E-mail: Alfonso.Jaramillo at warwick.ac.uk Manuscript information Type: Article. Subject category: RNA -- Synthetic Biology & Chemistry. Manuscript size: about 8,100 words (total). Abstract size: 144 words. Number of Figures: 6 (color). With Supplementary Information. 1" bioRxiv preprint doi: https://doi.org/10.1101/016915; this version posted March 23, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Organisms have different circuitries that allow converting signal molecule levels to changes in gene expression.
    [Show full text]
  • Signal Integration: Applications of RNA Riboregulator Capabilities Kyliah Clarkson, Natasha Tuskovich, Derek Jacoby, Chris Tuttle, Layne Woodfin
    Signal Integration: Applications of RNA Riboregulator Capabilities Kyliah Clarkson, Natasha Tuskovich, Derek Jacoby, Chris Tuttle, Layne Woodfin Department of Biochemistry and Microbiology, University of Victoria, Victoria, BC Introduction Background – Biothermometer Background - Ribolock and Ribokey Self-complementary messenger RNA has a high potential for tunable repression An RNA hairpin will also unfold when exposed to a sequence of higher of translation. A self-complementary hairpin which includes the Shine-Dalgarno site An RNA hairpin will unfold when exposed to temperatures past the melting point for the sequence. This permits the temperature-sensitive expression of the specificity. When the expression of such a complementary sequence is controlled by in the stem will greatly reduce protein expression until the necessary conditions are a separate promoter, this permits a condition-sensitive expression of the downstream met for the hairpin to completely unfold. downstream gene. The TUDelft 2008 iGEM team retrieved natural RNA thermometers from three species, then sequenced and redesigned them to test for a gene. The condition may be the presence or absence of a metabolite, of an antibiotic modified temperature range. We worked with their 32°C thermometer as it was or toxin, or of various wavelengths of light. The Berkeley 2006 iGEM team began found to be their most effective. with the ribosome binding site hairpin (the "ribolock") and the highly specific complementary sequence (the "ribokey") produced by Collins et al., then redesigned the lock and key sequences to reduce background transcription and increase activated transcription. Figure 1. Temperature sensitive hairpin loop Figure 2. The 32°C temperature sensitive hairpin part of TUDelft Figure 3.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2007/0136827 A1 Collins Et Al
    US 2007013 6827A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2007/0136827 A1 Collins et al. (43) Pub. Date: Jun. 14, 2007 (54) CSFTRANS RIBOREGULATORS Publication Classification (51) Int. Cl. (75) Inventors: James J. Collins, Newton, MA (US); AOIK 67/027 (2006.01) Farren J. Isaacs, Brookline, MA (US); C7H 2L/04 (2006.01) Charles R. Cantor, Del Mar, CA (US); CI2N 15/09 (2006.01) Daniel J. Dwyer, Brookline, MA (US) CI2N 5/06 (2006.01) (52) U.S. Cl. ............................ 800/14; 435/325; 435/455; 536/23.2 Correspondence Address: CHOATE, HALL & STEWART LLP (57) ABSTRACT TWO INTERNATIONAL PLACE BOSTON, MA 02110 (US) The present invention provides nucleic acid molecules, DNA constructs, plasmids, and methods for post-transcrip tional regulation of gene expression using RNA molecules to (73) Assignee: TRUSTEES OF BOSTON UNIVER both repress and activate translation of an open reading SITY, Boston, MA (US) frame. Repression of gene expression is achieved through the presence of a regulatory nucleic acid element (the cis-repressive RNA or crRNA) within the 5' untranslated (21) Appl. No.: 10/535,128 region (5' UTR) of an mRNA molecule. The nucleic acid element forms a hairpin (stem/loop) structure through complementary base pairing. The hairpin blocks access to (22) PCT Fed: Nov. 14, 2003 the mRNA transcript by the ribosome, thereby preventing translation. In particular, in embodiments of the invention PCT No.: PCT/USO3A36506 designed to operate in prokaryotic cells, the stem of the (86) hairpin secondary structure sequesters the ribosome binding S 371(c)(1), site (RBS).
    [Show full text]
  • A Ph-Responsive Riboregulator
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press A pH-responsive riboregulator Gal Nechooshtan,1 Maya Elgrably-Weiss,1 Abigail Sheaffer,1 Eric Westhof,2 and Shoshy Altuvia1,3 1Department of Microbiology and Molecular Genetics, IMRIC, The Hebrew University-Hadassah Medical School, Jerusalem 91120, Israel; 2Architecture et Re´activite´ de l’ARN, Universite´ de Strasbourg, Institut de Biologie Mole´culaire et Cellulaire, CNRS, 67084 Strasbourg Cedex, France The locus alx, which encodes a putative transporter, was discovered previously in a screen for genes induced under extreme alkaline conditions. Here we show that the RNA region preceding the alx ORF acts as a pH-responsive element, which, in response to high pH, leads to an increase in alx expression. Under normal growth conditions this RNA region forms a translationally inactive structure, but when exposed to high pH, a translationally active structure is formed to produce Alx. Formation of the active structure occurs while transcription is in progress under alkaline conditions and involves pausing of RNA polymerase at two distinct sites. Alkali increases the longevity of pausing at these sites and thereby interferes with formation of the inactive structure and promotes folding of the active one. The alx locus represents the first example of a pH-responsive riboregulator of gene expression, introducing a novel regulatory mechanism that involves RNA folding dynamics driven by pH. [Keywords: RNA regulator; transcriptional pausing; alkaline conditions; translation control] Supplemental material is available at http://www.genesdev.org. Received August 6, 2009; revised version accepted September 22, 2009. RNA regulators of gene expression have become a focus of terminator structures.
    [Show full text]
  • A Brief History of Synthetic Biology
    FOCUS ON sYnTHETIc BIoLoGY PERSPECTIVES circuits that underpin the response of a cell TIMELINE to its environment. The ability to assemble new regulatory systems from molecular A brief history of synthetic biology components was soon envisioned5, but it was not until the molecular details of transcrip- tional regulation in bacteria were uncovered D. Ewen Cameron, Caleb J. Bashor and James J. Collins in subsequent years6 that a more concrete Abstract | The ability to rationally engineer microorganisms has been a vision, based on programmed gene long-envisioned goal dating back more than a half-century. With the genomics expression, began to take shape. Following the development of molecular revolution and rise of systems biology in the 1990s came the development of a cloning and PCR in the 1970s and 1980s, rigorous engineering discipline to create, control and programme cellular genetic manipulation became widespread behaviour. The resulting field, known as synthetic biology, has undergone dramatic in microbiology research, ostensibly offer- growth throughout the past decade and is poised to transform biotechnology and ing a technical means to engineer artificial medicine. This Timeline article charts the technological and cultural lifetime of gene regulation. However, during this pre- genomic period, research approaches that synthetic biology, with an emphasis on key breakthroughs and future challenges. were categorized as genetic engineering were mostly restricted to cloning and recom- The founding of the field of synthetic biol- strategies. In this Timeline article, we focus binant gene expression. In short, genetic ogy near the turn of the millennium was on efforts in synthetic biology that deal with engineering was not yet equipped with based on the transformational assertion that microbial systems; work in mammalian the necessary knowledge or tools to create engineering approaches — then mostly for- synthetic biology has been recently reviewed biological systems that display the diversity eign to cell and molecular biology — could elsewhere2,3.
    [Show full text]
  • Multilevel Gene Regulation Using Switchable Transcription Terminator and Toehold Switch in Escherichia Coli
    applied sciences Article Multilevel Gene Regulation Using Switchable Transcription Terminator and Toehold Switch in Escherichia coli Seongho Hong †, Jeongwon Kim † and Jongmin Kim * Department of Life Sciences, Pohang University of Sciences and Technology, Pohang 37673, Korea; [email protected] (S.H.); [email protected] (J.K.) * Correspondence: [email protected] † These authors contributed equally: Seongho Hong, Jeongwon Kim. Abstract: Nucleic acid-based regulatory components provide a promising toolbox for constructing synthetic biological circuits due to their design flexibility and seamless integration towards complex systems. In particular, small-transcriptional activating RNA (STAR) and toehold switch as regulators of transcription and translation steps have shown a large library size and a wide dynamic range, meeting the criteria to scale up genetic circuit construction. Still, there are limited attempts to integrate the heterogeneous regulatory components for multilevel regulatory circuits in living cells. In this work, inspired by the design principle of STAR, we designed several switchable transcription terminators starting from natural and synthetic terminators. These switchable terminators could be designed to respond to specific RNA triggers with minimal sequence constraints. When combined with toehold switches, the switchable terminators allow simultaneous control of transcription and translation processes to minimize leakage in Escherichia coli. Further, we demonstrated a set of logic gates implementing 2-input AND circuits and multiplexing capabilities to control two different Citation: Hong, S.; Kim, J.; Kim, J. output proteins. This study shows the potential of novel switchable terminator designs that can be Multilevel Gene Regulation Using computationally designed and seamlessly integrated with other regulatory components, promising Switchable Transcription Terminator and to help scale up the complexity of synthetic gene circuits in living cells.
    [Show full text]
  • Tracking, Tuning, and Terminating Microbial Physiology Using Synthetic Riboregulators
    Tracking, tuning, and terminating microbial physiology using synthetic riboregulators Jarred M. Calluraa,b,c,1, Daniel J. Dwyera,b,c,1, Farren J. Isaacsd, Charles R. Cantorb,2, and James J. Collinsa,b,c,e,2 aHoward Hughes Medical Institute, bDepartment of Biomedical Engineering and Center for Advanced Biotechnology, Boston University, Boston, MA 02215; cCenter for BioDynamics, Boston University, Boston, MA 02215; dDepartment of Genetics, Harvard Medical School, Boston, MA 02215; and eWyss Institute for Biologically Inspired Engineering, Harvard University, Boston, MA 02215 Contributed by Charles R. Cantor, July 13, 2010 (sent for review June 1, 2010) The development of biomolecular devices that interface with bi- In our riboregulator system (Fig. 1), distinct promoters in- ological systems to reveal new insights and produce novel functions dependently regulate the transcription of two RNA species—a cis- is one of the defining goals of synthetic biology. Our lab previously repressed mRNA (crRNA) and a noncoding, trans-activating RNA described a synthetic, riboregulator system that affords for modular, (taRNA). Initially, target gene translation of the crRNA is blocked tunable, and tight control of gene expression in vivo. Here we high- by a stem loop, which spontaneously forms in its 5′-untranslated light several experimental advantages unique to this RNA-based region (UTR), sequesters the ribosome binding site (RBS), and system, including physiologically relevant protein production, com- prevents ribosome docking; stem loop formation is mediated by ponent modularity, leakage minimization, rapid response time, tun- a short sequence (cis-repressive sequence, ≈25 nt) located within able gene expression, and independent regulation of multiple genes. the mRNA 5′-UTR that binds the RBS.
    [Show full text]
  • Systems Biology Approaches to Probe Gene Regulation in Bacteria
    The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 8-2012 Systems Biology Approaches to Probe Gene Regulation in Bacteria Diogo F. Troggian Veiga Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Bioinformatics Commons, Computational Biology Commons, Microbiology Commons, and the Systems Biology Commons Recommended Citation Troggian Veiga, Diogo F., "Systems Biology Approaches to Probe Gene Regulation in Bacteria" (2012). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 278. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/278 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. SYSTEMS BIOLOGY APPROACHES TO PROBE GENE REGULATION IN BACTERIA By Diogo Fernando Troggian Veiga, M.Sc. APPROVED ___________________________
    [Show full text]
  • Small RNA-Controlled Gene Regulatory Networks in Pseudomonas Putida
    Downloaded from orbit.dtu.dk on: Sep 23, 2021 Small RNA-Controlled Gene Regulatory Networks in Pseudomonas putida Bojanovic, Klara Publication date: 2016 Document Version Publisher's PDF, also known as Version of record Link back to DTU Orbit Citation (APA): Bojanovic, K. (2016). Small RNA-Controlled Gene Regulatory Networks in Pseudomonas putida. Novo Nordisk Foundation Center for Biosustainability. General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. Users may download and print one copy of any publication from the public portal for the purpose of private study or research. You may not further distribute the material or use it for any profit-making activity or commercial gain You may freely distribute the URL identifying the publication in the public portal If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Small RNA-Controlled Gene Regulatory Networks in Pseudomonas putida PhD Thesis Klara Bojanovič Novo Nordisk Foundation Center for Biosustainability Technical University of Denmark August 2016 Small RNA-Controlled Gene Regulatory Networks in Pseudomonas putida PhD thesis written by Klara Bojanovič Supervisor Katherine S. Long © PhD Thesis 2016 Klara Bojanovič Novo Nordisk Foundation Center for Biosustainability Technical University of Denmark Kemitorvet 220, 2800 Kgs. Lyngby Denmark When you tread your way, Always go to the end. In spring, to a flower so sweet, In summer, to a shower of wheat, In autumn, to pantries that glow, In winter, to the lady of snow, In life, to the truth that is thine, Until color leaks into your cheeks.
    [Show full text]
  • Translation Mechanism in Production of Cocksfoot Mottle Virus Proteins
    Recent Publications in this Series: MÄKELÄINEN KATRI MÄKELÄINEN KATRI View metadata, citation and similar papers at core.ac.uk brought to you by CORE 6/2005 Sanna Edelman provided by Helsingin yliopiston digitaalinen arkisto Mucosa-Adherent Lactobacilli: Commensal and Pathogenic Characteristics 7/2005 Leena Karhinen Glycosylation and Sorting Of Secretory Proteins in the Endoplasmic Reticulum of the Yeast Saccharomyces cerevisiae 8/2005 Saurabh Sen Functional Studies on alpha2-Adrenergic Receptor Subtypes Proteins Virus of Cocksfoot Mottle Mechanisms in Production Translation Translation: Lost in Proteins Virus of Cocksfoot Mottle Mechanisms in Production Translation Translation: Lost in 9/2005 Tiina E. Raevaara Functional Significance of Minor MLH1 Germline Alterations Found in Colon Cancer Patients 10/2005 Katja Pihlainen Liquid Chromatography and Atmospheric Pressure Ionisation Mass Spectrometry in Analysing Drug Seizures 11/2005 Pietri Puustinen Posttranslational Modifications of Potato Virus A Movement Related Proteins CP and VPg 12/2005 Irmgard Suominen Paenibacillus and Bacillus Related to Paper and Spruce Tree 13/2005 Heidi Hyytiäinen Regulatory Networks Controlling Virulence in the Plant Pathogen Erwinia Carotovora Ssp. Carotovora 14/2005 Sanna Janhunen Lost in Translation: Translation Mechanisms in Different Responses of the Nigrostriatal and Mesolimbic Dopaminergic Pathways to Nicotinic Receptor Agonists 15/2005 Denis Kainov Packaging Motors of Cystoviruses Production of Cocksfoot Mottle Virus Proteins 16/2005 Ivan Pavlov Heparin-Binding
    [Show full text]
  • Developments of Riboswitches and Toehold Switches for Molecular Detection—Biosensing and Molecular Diagnostics
    International Journal of Molecular Sciences Review Developments of Riboswitches and Toehold Switches for Molecular Detection—Biosensing and Molecular Diagnostics Tin Hoang Trung Chau, Dung Hoang Anh Mai, Diep Ngoc Pham, Hoa Thi Quynh Le and Eun Yeol Lee * Department of Chemical Engineering, Kyung Hee University, Yongin-si, Gyeonggi-do 17104, Korea; [email protected] (T.H.T.C.); [email protected] (D.H.A.M.); [email protected] (D.N.P.); [email protected] (H.T.Q.L.) * Correspondence: [email protected]; Tel.: +82-31-201-3839 Received: 16 March 2020; Accepted: 29 April 2020; Published: 30 April 2020 Abstract: Riboswitches and toehold switches are considered to have potential for implementation in various fields, i.e., biosensing, metabolic engineering, and molecular diagnostics. The specific binding, programmability, and manipulability of these RNA-based molecules enable their intensive deployments in molecular detection as biosensors for regulating gene expressions, tracking metabolites, or detecting RNA sequences of pathogenic microorganisms. In this review, we will focus on the development of riboswitches and toehold switches in biosensing and molecular diagnostics. This review introduces the operating principles and the notable design features of riboswitches as well as toehold switches. Moreover, we will describe the advances and future directions of riboswitches and toehold switches in biosensing and molecular diagnostics. Keywords: riboswitches; toehold switches; molecular detection; biosensors; molecular diagnostics 1. Introduction In addition to the regulatory applications, the RNA-based regulatory system, specifically riboswitches and toehold switches, has attracted scientific interest to develop systems for molecular detection applications as biosensing and molecular diagnostics [1,2].
    [Show full text]