Genetic switchboard for synthetic biology applications Jarred M. Calluraa,b,c, Charles R. Cantorb,1, and James J. Collinsa,b,c,d,1 aHoward Hughes Medical Institute, bDepartment of Biomedical Engineering, and cCenter for BioDynamics, Boston University, Boston, MA 02215; and dWyss Institute for Biologically Inspired Engineering, Harvard University, Boston, MA 02215 Contributed by Charles R. Cantor, March 5, 2012 (sent for review February 6, 2012) A key next step in synthetic biology is to combine simple circuits into number of riboregulator variants; this expansion was needed to higher-order systems. In this work, we expanded our synthetic complete a genetic switchboard. We used two distinct rational riboregulation platform into a genetic switchboard that indepen- design strategies that focused on different components of dently controls the expression of multiple genes in parallel. First, we riboregulation. Using RR12 as the prototype, we replaced its designed and characterized riboregulator variants to complete the RBS with an engineered RBS of similar strength and mutated foundation of the genetic switchboard; then we constructed the the bases involved in the initial crRNA–taRNA recognition switchboard sensor, a testing platform that reported on quorum- complex. After obtaining a set of four orthogonal variants, we signaling molecules, DNA damage, iron starvation, and extracellular assembled the riboregulators onto two plasmids in single cells to magnesium concentration in single cells. As a demonstration of the create the genetic switchboard and tested the performance of the biotechnological potential of our synthetic device, we built a metab- switchboard in a biosensing setup with easily detectable outputs. The switchboard sensor simultaneously regulates four differen- olism switchboard that regulated four metabolic genes, pgi, zwf, β edd,andgnd, to control carbon flow through three Escherichia coli tiable reporters, GFP, mCherry, -galactosidase, and luciferase, glucose-utilization pathways: the Embden–Meyerhof, Entner–Dou- with four environmentally sensitive promoters, pLuxI, PLlexO, P , and pMgrB, respectively. Measured reporter levels doroff, and pentose phosphate pathways. We provide direct evi- LfurO showcase the tight and powerful regulation, with minimal dence for switchboard-mediated shunting of metabolic flux by crosstalk, provided by the genetic switchboard. measuring mRNA levels of the riboregulated genes, shifts in the Biological circuitry that regulates many genes in parallel lends activities of the relevant enzymes and pathways, and targeted itself to a variety of biotechnological applications and particu- changes to the E. coli metabolome. The design, testing, and imple- larly to metabolic engineering. Synthetic biology has a history of mentation of the genetic switchboard illustrate the successful con- providing components for metabolic engineering, such as bio- struction of a higher-order system that can be used for a broad range synthetic pathways and enzyme scaffolds (9, 10). Adding to this of practical applications in synthetic biology and biotechnology. toolbox, the genetic switchboard is a well-defined, biological module that possesses the flexibility to aid different metabolic s synthetic biology matures, the drive for higher-order sys- engineering strategies. As proof of concept, we constructed Atems and larger DNA assemblies is intensifying (1, 2). Re- a metabolism switchboard that controls carbon flux through cent successes include a sensing array for the detection of heavy three Escherichia coli glucose-utilization pathways, the Embden– metals and pathogens and a wide range of logic computations Meyerhof (EMP), Entner–Doudoroff (EDP), and pentose using simple circuits and chemical wires (3, 4). However, this phosphate (PPP) pathways, via the regulation of four different push for complexity underscores the need for interoperable parts genes, pgi, zwf, edd, and gnd. The performance of the metabolism and expandable systems (5). Additional components that can be switchboard over multiple biological scales, namely, at the RNA, scaled up and operate orthogonally are needed for synthetic bi- protein, and metabolome levels, showcases the real-world po- ology to continue to produce innovative systems and capitalize on tential of our higher-order control system. its full potential in biotechnology (6). Previously, we introduced the synthetic riboregulator, an RNA-based gene-expression sys- Results and Discussion tem, and noted its orthogonal expression capabilities (7, 8). Here, Rational Design of Riboregulator Variants. In the initial synthetic we present a genetic switchboard, a higher-order device that in- riboregulator study, the RR10 variant was constructed success- dependently and tightly regulates multiple genes in parallel. fully, and, in an attempt to improve the dynamic range of the A switchboard is as an assembly of switches that is useful for system, the RR12 variant was built as a rationally designed re- controlling and linking electrical circuits. Here, we define a ge- finement (7). Here, RR42 and RR12y, the two riboregulator netic switchboard as an assembly of orthogonal, genetic switches variants required to create the genetic switchboard, also were that is useful for controlling and linking biological circuits and rationally designed, but via two unique strategies. RR42 was the pathways. The current iteration of our genetic switchboard result of RBS manipulation, and RR12y was the result of mu- combines four synthetic riboregulators serving as the orthogonal tating the crRNA–taRNA recognition sequence. In both cases, genetic switches for the platform. An individual riboregulator RR12 was the parent riboregulator variant, and we attempted to controls gene expression posttranscriptionally via two RNA minimize the changes to the successful RR12 blueprint while species, a cis-repressed mRNA (crRNA) and a trans-activating introducing enough mutations to generate orthogonal activity. RNA (taRNA) (Fig. 1A). Once transcribed, target-gene trans- Therefore, critical specifications of RR12, such as the Mfold- lation is blocked on the crRNA by the cis-repressive sequence predicted secondary structures and thermodynamic values, were forming a stem loop with the ribosome-binding site (RBS). preserved in the designs of RR42 and RR12y (11). Switching on target-gene expression requires the transcription of When constructing the RR42 riboregulator, we targeted the the taRNA, a small, noncoding RNA containing the trans-acti- RBS of the RR12 variant. Using the RBS Calculator (12), we vating sequence, which destabilizes the crRNA stem loop and frees the RBS. Features of synthetic riboregulation that make it an attractive choice for the foundation of a switchboard include Author contributions: J.M.C., C.R.C., and J.J.C. designed research; J.M.C. performed re- physiologically relevant protein production, component modu- search; J.M.C. analyzed data; and J.M.C., C.R.C., and J.J.C. wrote the paper. larity, leakage minimization, tunability, fast response times, easy The authors declare no conflict of interest. logic programmability, and negligible crosstalk between variants Freely available online through the PNAS open access option. with different cis-repressive and trans-activating sequences (8). 1To whom correspondence may be addressed. E-mail: [email protected] or jcollins@ Originally, only two synthetic riboregulator variants were bu.edu. engineered with acceptable dynamic ranges, the RR10 and This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. RR12 variants (7). In the present work, we first expanded the 1073/pnas.1203808109/-/DCSupplemental. 5850–5855 | PNAS | April 10, 2012 | vol. 109 | no. 15 www.pnas.org/cgi/doi/10.1073/pnas.1203808109 A A B Cis UU C C G -Repressed G UAA UACGC UAU UCCAU CUUAAG RR12 crR42 GFP Expression mRNA (crRNA) CR RBS Gene G AUU AUGAG AUA AGGUACC UU G AA GU A G A AUG G UAG UUCUCC CUU CCAU C U U A A G taR42 C C 70 Trans-activating G AG U G AUU AAGAGG GAA GGUA A U G taR12y A UAAUUGG UGGUGAUGG AUAGGCG GGUUAAACCCA GU AAA ncRNA (taRNA) TA A AUUAACU ACUA CUACC UAUUCGU CUAGA taR12 A U AG U A A no taRNA A G RR42 50 A U UU C GG U A G UAA UAC CCUAU UCCAUC U U A A G U A C C A U G AUU AUG GGAUA AGGUA A U G A U GU AA A 30 C G Trans-activated gene expression UU G A U RR12y C G 10 U G G UU G AA U U A A G AGAUCUUGCUUAUGACCAUCA U GAUGGA AUAGGCGUGGUUAAACCCA G UAG UUCUCC CUU CCAU C change Fluorescence Fold GAAUUCUAC CU UAUCCGCAUCAAUUUGGGUAUUAAUGAGGAUAAAGGUACCAUG G AUU AAGAGG GAA GGUAC C G GU A U G 0 1 2 3 AAA Time (h) B C crR12y GFP Expression D crR12 GFP Expression Input 1 200 taR12y 200 taR12 Input 2 Promoter 2 TA1 Promoter 1 CR1 RBS Gene A A taR42 taR12y 160 taR12 160 taR42 Input 3 no taRNA no taRNA Input 4 Promoter 4 TA2 Promoter 3 CR2 RBS Gene B B 120 120 Input 5 80 80 Input 6 Promoter 6 TA3 Promoter 5 CR3 RBS Gene C C 40 40 Input 7 Fold change Fluorescence Fold change Fluorescence Fold Promoter 8 TA4 Promoter 7 CR4 RBS Gene D D Input 8 031 2 031 2 Time (h) Time (h) Input N-1 Fig. 2. Characterization of riboregulators RR42 and RR12y. (A) Mfold-pre- X Input N Prom. N TAN Prom. N-1 CRN RBS Gene X dicted secondary structures of crR12, crR42, and crR12y. Mutations in var- iants crR42 and crR12y, relative to the parent crR12 variant, are outlined in Fig. 1. Engineered riboregulation and the genetic switchboard. (A) Over- purple. Important features are color-coded: cis-repressive sequence (orange), view of engineered riboregulation. Mfold-predicted secondary structures of RBS (blue), target gene start codon (red), and taRNA recognition bases – a crRNA and taRNA, along with the proposed structure of the crRNA–taRNA (gray). (B D) Fold changes in GFP expression from fully induced crRNA complex that promotes gene expression. Important features are color- cotranscribed with cognate and noncognate taRNA. (B) crR42. (C) crR12y. (D) coded: the cis-repressive sequence (orange), RBS (blue), target gene (red), crR12.