DOCSLIB.ORG

A Brief History of Synthetic Biology

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Brief History of Synthetic Biology FOCUS ON sYnTHETIc BIoLoGY PERSPECTIVES circuits that underpin the response of a cell TIMELINE to its environment. The ability to assemble new regulatory systems from molecular A brief history of synthetic biology components was soon envisioned5, but it was not until the molecular details of transcrip- tional regulation in bacteria were uncovered D. Ewen Cameron, Caleb J. Bashor and James J. Collins in subsequent years6 that a more concrete Abstract | The ability to rationally engineer microorganisms has been a vision, based on programmed gene long-envisioned goal dating back more than a half-century. With the genomics expression, began to take shape. Following the development of molecular revolution and rise of systems biology in the 1990s came the development of a cloning and PCR in the 1970s and 1980s, rigorous engineering discipline to create, control and programme cellular genetic manipulation became widespread behaviour. The resulting field, known as synthetic biology, has undergone dramatic in microbiology research, ostensibly offer- growth throughout the past decade and is poised to transform biotechnology and ing a technical means to engineer artificial medicine. This Timeline article charts the technological and cultural lifetime of gene regulation. However, during this pre- genomic period, research approaches that synthetic biology, with an emphasis on key breakthroughs and future challenges. were categorized as genetic engineering were mostly restricted to cloning and recom- The founding of the field of synthetic biol- strategies. In this Timeline article, we focus binant gene expression. In short, genetic ogy near the turn of the millennium was on efforts in synthetic biology that deal with engineering was not yet equipped with based on the transformational assertion that microbial systems; work in mammalian the necessary knowledge or tools to create engineering approaches — then mostly for- synthetic biology has been recently reviewed biological systems that display the diversity eign to cell and molecular biology — could elsewhere2,3. and depth of regulatory behaviour found in be used both to study cellular systems and to In this Timeline article, a brief history of microorganisms. facilitate their manipulation to productive some of the major events that have shaped By the mid‑1990s, automated DNA ends. Now more than a decade old, synthetic synthetic biology since its inception are pre- sequencing and improved computational biology has undergone considerable growth sented. We begin by describing the unique tools enabled complete microbial genomes in scope, expectation and output, and has interdisciplinary dynamics of the 1990s to be sequenced, and high-throughput tech- become a widely recognized branch of bio- that, by the end of the decade, had enticed niques for measuring RNA, protein, lipids logical research1. In many aspects, the tra- engineers from disciplines outside biology and metabolites enabled scientists to gener- jectory of the field during its first decade of to enter the wet lab and begin tinkering with ate a vast catalogue of cellular components existence has been non-linear, with periods cellular networks. We divide a chronology and their interactions. This ‘scaling‑up’ of of meaningful progress matched by epi- of the field into three distinct periods and molecular biology generated the field of sodes of inertia as design efforts have been highlight scientific and cultural milestones systems biology, as biologists and computer forced to re-orient when confronted with the for each period (FIG. 1 (TIMELINE)): first, a scientists began to combine experimentation complexity and unpredictability of engineering foundational period, in which many of the and computation to reverse-engineer cellular inside living cells. characteristic experimental and cultural networks7–9. What emerged from this enor- Although a consensus has yet to be reached features of the field were established; second, mous and continuing basic research effort on a precise definition of synthetic biology, an intermediate period, which was charac- was a view that cellular networks, although the use of molecular biology tools and tech- terized by an expansion of the field but a lag vast and intricate, were organized as a hierar- niques to forward-engineer cellular behaviour in engineering advances; and third, a recent chy of clearly discernable functional modules, has emerged as a broad identity for the era of accelerated innovation and shifting similar to many engineered systems10. field, and a set of common engineering practices, in which new technologies and Gradually, it was recognized that the approaches and laboratory practices have engineering approaches have enabled us to rational manipulation of biological systems, developed, along with a vibrant community advance towards practical applications in either by systematically tuning or rearrang- culture. Much of the foundational work in the both biotechnology and medicine. ing their modular molecular constituents, field was carried out in the model microbial could form the basis of a formal biological species Escherichia coli and Saccharomyces 1961–1999: origins of the field engineering discipline11. As a complement to cerevisiae, and these microbial systems The roots of synthetic biology can be traced the top-down approach of systems biology, a remain central in several focal areas of the to a landmark publication by Francois Jacob bottom‑up approach was envisioned, which field, including complex circuit design, and Jacques Monod in 1961 (REF. 4). Insights could draw on an ever-expanding list of metabolic engineering, minimal genome from their study of the lac operon in E. coli molecular ‘parts’ to forward-engineer regu- construction and cell-based therapeutic led them to posit the existence of regulatory latory networks. Such an approach could be NATURE REVIEWS | MICROBIOLOGY VOLUME 12 | MAY 2014 | 381 © 2014 Macmillan Publishers Limited. All rights reserved PERSPECTIVES Timeline | A brief history of synthetic biology SB1.0: the first international Earliest combinatorial synthesis conference for synthetic biology First synthetic circuits of genetic networks25 held at MIT — toggle switch and Cellular regulation by (1980s–1990s) repressilator15,16 (2002–2003) First iGEM competition held at MIT molecular networks Rise of ‘omics’ era Synthetic circuits used to study postulated by Jacob of high-throughput Autoregulatory negative- transcriptional noise during this RNA devices for modular regulation and Monod4 biology feedback circuit21 period27–29 of gene expression35 1960s 1970s 1980s 1990s 2000 2001 2002 2003 2004 2005 (1970s–1980s) Widespread use of automated First cell–cell Artemisinin Light-sensing circuit engineered in Development of DNA sequencing communication precursor pathway E. coli — bacterial photography40 molecular cloning circuit based on engineered in techniques Complete genome sequence quorum sensing30 E. coli41 Programmable ligand-controlled of S. cerevisiae117 transcript regulation by RNA36 Complete genome sequence Circuits capable of multicellular of E. coli118 pattern formation are generated38 Key to coloured boxes: technical or cultural milestones (black); circuit engineering (red); synthetic biology in metabolic engineering (green); therapeutic applications (blue); whole genome engineering (purple). E. coli, Escherichia coli; iGEM, International Genetically Engineered Machine; MAGE, multiplex automated genome engineering; MIT, Massachusetts Institute of Technology; SB1.0, Synthetic Biology 1.0; S. cerevisiae, Saccharomyces cerevisiae. used both to study the functional organiza- states in response to external signals. In regulators to combinatorially assemble tion of natural systems and to create artificial another example, Elowitz and Leibler engi- genetic circuits that display diverse logic gate regulatory networks that have potential bio- neered an oscillatory circuit that consisted of behaviour25. Seminal work by Weiss and technology and health applications12. By the a triple negative-feedback loop of sequential colleagues established methods for engineer- end of the 1990s, a small group of engineers, repressor–promoter pairs16 (FIG. 2b). Activa- ing transcription-based logic gates and did physicists and computer scientists recog- tion of the circuit, termed the repressilator, much to formalize the language and practice nized the opportunity and began to migrate resulted in the ordered, periodic oscillation of circuit engineering26. Simple circuits that into molecular biology to try their hand at of repressor protein expression. explored the relationship between gene the bench. Both the toggle and repressilator were expression and molecular noise in both constructed from a similar set of parts prokaryotic and eukaryotic genes provided 2000–2003: the foundational years (for example, inducible promoter systems) an early glimpse into the role that synthetic A convenient starting point for early syn- and used GFP expression as an output to systems could have in clarifying and expanding thetic biologists was the creation of simple monitor circuit behaviour. Model-based our understanding of basic biology27–29. gene regulatory circuits that carry out func- design was used in each case, but agreement Although mostly focused on circuit tions in an analogous manner to electrical between the model and the experimental engineering, efforts during this early period circuits13,14. The dynamics of these simple output was reached only after ‘tuning’ the began to push
Load more

Recommended publications
  • Engineering a Circular Riboregulator in Escherichia Coli
    bioRxiv preprint doi: https://doi.org/10.1101/008987; this version posted September 25, 2014. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Engineering a circular riboregulator in Escherichia coli William Rostain1,2, Shensi Shen2, Teresa Cordero1, Guillermo Rodrigo2,3 and Alfonso Jaramillo1,2,* 1 School of Life Sciences, University of Warwick, Coventry, CV4 7AL, United Kingdom. 2 Institute of Systems and Synthetic Biology, CNRS - Université d’Evry val d’Essonne, 91000 Évry, France. 3 Instituto de Biologia Molecular y Celular de Plantas, CSIC – Universidad Politécnica de Valencia, 46022 Valencia, Spain. * Corresponding author. School of Life Sciences, University of Warwick. Gibbet Hill Road, Coventry, CV4 7AL, United Kingdom. Tel: +44 (0)24 765 73432, E-mail: [email protected] Type: Letter Running title: Circular Riboregulator. Keywords: Biotechnology, Riboregulators, Splicing, Synthetic Biology. 1 bioRxiv preprint doi: https://doi.org/10.1101/008987; this version posted September 25, 2014. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Circular RNAs have recently been shown to be important gene expression regulators in mammalian cells. However, their role in prokaryotes remains elusive. Here, we engineered a synthetic riboregulator that self-splice to produce a circular molecule, exploiting group I permuted intron-exon (PIE) sequences. We demonstrated that the resulting circular riboregulator can activate gene expression, showing increased dynamic range compared to the linear form. We characterized the system with a fluorescent reporter and with an antibiotic resistance marker.
    [Show full text]
  • Improving Treatment of Genetic Diseases with Crispr-Cas9 Rna-Guided Genome Editing
    Sanchez 3:00 Team R06 Disclaimer: This paper partially fulfills a writing requirement for first-year (freshmen) engineering students at the University of Pittsburgh Swanson School of Engineering. This paper is a student paper, not a professional paper. This paper is not intended for publication or public circulation. This paper is based on publicly available information, and while this paper might contain the names of actual companies, products, and people, it cannot and does not contain all relevant information/data or analyses related to companies, products, and people named. All conclusions drawn by the authors are the opinions of the authors, first- year (freshmen) students completing this paper to fulfill a university writing requirement. If this paper or the information therein is used for any purpose other than the authors' partial fulfillment of a writing requirement for first-year (freshmen) engineering students at the University of Pittsburgh Swanson School of Engineering, the users are doing so at their own--not at the students', at the Swanson School's, or at the University of Pittsburgh's--risk. IMPROVING TREATMENT OF GENETIC DISEASES WITH CRISPR-CAS9 RNA-GUIDED GENOME EDITING Arijit Dutta [email protected] , Benjamin Ahlmark [email protected], Nate Majer [email protected] Abstract—Genetic illnesses are among the most difficult to treat as it is challenging to safely and effectively alter DNA. INTRODUCTION: THE WHAT, WHY, AND DNA is the basic code for all hereditary traits, so any HOW OF CRISPR-CAS9 alteration to DNA risks fundamentally altering the way someone’s genes are expressed. This change could lead to What Is CRISPR-Cas9? unintended consequences for both the individual whose DNA was altered and any offspring they may have in the future, CRISPR-Cas9 is an acronym that stands for “Clustered compounding the risk.
    [Show full text]
  • CRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing
    CRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing Fei Ann Ran Broad Institute Cambridge, Massachusetts [email protected] I will provide some background on the CRISPR/Cas9 technology, some of the rationale for how we came to develop and use this tool, and I will address immediate questions concerning the specificity of the technology. I will also discuss some of the more interest- ing applications. Figure 1 reflects how the cost of DNA sequencing has decreased dramatically over the past two decades due to technological progress. As a result, there has been an explo- sion of data, not only in the sequences of different species, but in sequence differences between individuals within species, between cell types and between diseased and healthy cells. It suffices to say that this is an exciting time to be working in the field of genome engineering. Genome Engineering Typically, genome engineering is achieved by leveraging the cell’s own repair machinery. This can come from the error-prone NHEJ pathway that leads to insertion/deletion (in- del) mutations, which can be used to knock out genes, or, alternatively, we can supply a repair template to overwrite the site of a double-stranded break (DSB) for more-precise genome engineering via the HDR pathway (Figure 2). Figure 1. Advances in DNA-sequencing technologies. (Stratton MR et al., 2009) When we started working on CRISPR/Cas technology1, several well developed tools were already being used—and still are being used—to achieve impressive results in bio- technology, medicine, agriculture, and other fields. At the outset, we were interested in developing an alternative technology to make cloning easier at lower cost with greater scalability.
    [Show full text]
  • Dynamic Signal Processing by Ribozyme-Mediated RNA Circuits to Control Gene Expression
    bioRxiv preprint doi: https://doi.org/10.1101/016915; this version posted March 23, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Dynamic signal processing by ribozyme- mediated RNA circuits to control gene expression Shensi Shen1,†, Guillermo Rodrigo1,†, Satya Prakash3, Eszter Majer2, Thomas E. Landrain1, Boris Kirov1, José-Antonio Daròs2, and Alfonso 1,3,* Jaramillo 1 Institute of Systems and Synthetic Biology, Université d’Évry Val d’Essonne, CNRS, F-91000 Évry, France 2 Instituto de Biología Molecular y Celular de Plantas, CSIC - Universidad Politécnica de Valencia, 46022 Valencia, Spain 3 School of Life Sciences, University of Warwick, Coventry CV4 7AL, United Kingdom † Equal contribution to the work. * Correspondence: School of Life Sciences, University of Warwick, Coventry CV4 7AL, United Kingdom. E-mail: Alfonso.Jaramillo at warwick.ac.uk Manuscript information Type: Article. Subject category: RNA -- Synthetic Biology & Chemistry. Manuscript size: about 8,100 words (total). Abstract size: 144 words. Number of Figures: 6 (color). With Supplementary Information. 1" bioRxiv preprint doi: https://doi.org/10.1101/016915; this version posted March 23, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Organisms have different circuitries that allow converting signal molecule levels to changes in gene expression.
    [Show full text]
  • Development and Applications of CRISPR-Cas9 for Genome Engineering
    Leading Edge Review Development and Applications of CRISPR-Cas9 for Genome Engineering Patrick D. Hsu,1,2,3 Eric S. Lander,1 and Feng Zhang1,2,* 1Broad Institute of MIT and Harvard, 7 Cambridge Center, Cambridge, MA 02141, USA 2McGovern Institute for Brain Research, Department of Brain and Cognitive Sciences, Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139, USA 3Department of Molecular and Cellular Biology, Harvard University, Cambridge, MA 02138, USA *Correspondence: [email protected] http://dx.doi.org/10.1016/j.cell.2014.05.010 Recent advances in genome engineering technologies based on the CRISPR-associated RNA- guided endonuclease Cas9 are enabling the systematic interrogation of mammalian genome function. Analogous to the search function in modern word processors, Cas9 can be guided to specific locations within complex genomes by a short RNA search string. Using this system, DNA sequences within the endogenous genome and their functional outputs are now easily edited or modulated in virtually any organism of choice. Cas9-mediated genetic perturbation is simple and scalable, empowering researchers to elucidate the functional organization of the genome at the systems level and establish causal linkages between genetic variations and biological phenotypes. In this Review, we describe the development and applications of Cas9 for a variety of research or translational applications while highlighting challenges as well as future directions. Derived from a remarkable microbial defense system, Cas9 is driving innovative applications from basic biology to biotechnology and medicine. Introduction of the genome and its functions. In biotechnology, precise The development of recombinant DNA technology in the 1970s manipulation of genetic building blocks and regulatory machin- marked the beginning of a new era for biology.
    [Show full text]
  • Signal Integration: Applications of RNA Riboregulator Capabilities Kyliah Clarkson, Natasha Tuskovich, Derek Jacoby, Chris Tuttle, Layne Woodfin
    Signal Integration: Applications of RNA Riboregulator Capabilities Kyliah Clarkson, Natasha Tuskovich, Derek Jacoby, Chris Tuttle, Layne Woodfin Department of Biochemistry and Microbiology, University of Victoria, Victoria, BC Introduction Background – Biothermometer Background - Ribolock and Ribokey Self-complementary messenger RNA has a high potential for tunable repression An RNA hairpin will also unfold when exposed to a sequence of higher of translation. A self-complementary hairpin which includes the Shine-Dalgarno site An RNA hairpin will unfold when exposed to temperatures past the melting point for the sequence. This permits the temperature-sensitive expression of the specificity. When the expression of such a complementary sequence is controlled by in the stem will greatly reduce protein expression until the necessary conditions are a separate promoter, this permits a condition-sensitive expression of the downstream met for the hairpin to completely unfold. downstream gene. The TUDelft 2008 iGEM team retrieved natural RNA thermometers from three species, then sequenced and redesigned them to test for a gene. The condition may be the presence or absence of a metabolite, of an antibiotic modified temperature range. We worked with their 32°C thermometer as it was or toxin, or of various wavelengths of light. The Berkeley 2006 iGEM team began found to be their most effective. with the ribosome binding site hairpin (the "ribolock") and the highly specific complementary sequence (the "ribokey") produced by Collins et al., then redesigned the lock and key sequences to reduce background transcription and increase activated transcription. Figure 1. Temperature sensitive hairpin loop Figure 2. The 32°C temperature sensitive hairpin part of TUDelft Figure 3.
    [Show full text]
  • Recombinant S. Pyogenes CRISPR-Cas9 Catalog Number: 9957-C9
    Recombinant S. pyogenes CRISPR-Cas9 Catalog Number: 9957-C9 DESCRIPTION Source E. coli-derived s. pyogenes CRISPR-Cas9 protein S. pyogenes CRISPR-Cas9 KRPAATKKAGQAKK- APKKKRKVGIHGVPAA (Asp2-Asp1368) HHHHHH KKGYGRKKRRQRRRG Accession # Q99ZW2 N-terminus C-terminus N-terminal Sequence Ala Analysis Predicted Molecular 164 kDa Mass SPECIFICATIONS SDS-PAGE 133 kDa, reducing conditions Activity Measured by its ability to cleave a targeted DNA substrate. S. pyogenes CRISPR-Cas9 achieves >80% substrate cleavage, as measured under the described conditions. Endotoxin Level <0.10 EU per 1 μg of the protein by the LAL method. Purity >95%, by SDS-PAGE visualized with Silver Staining and quantitative densitometry by Coomassie® Blue Staining. Formulation Supplied as a 0.2 μm filtered solution in Tris, NaCl, EDTA, Glycerol and TCEP. See Certificate of Analysis for details. Activity Assay Protocol Materials Assay Buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg/mL BSA, pH 7.9 Recombinant Streptococcus pyogenes CRISPR-Cas9 (rS. pyogenes Cas9) (Catalog # 9957-C9) PBR322 vector (NEB, Catalog # N3033S) digested with EcoRI-HF (NEB, Catalog # R3101S)* Dharmacon synthetic sgRNA, targeting sequence: GAGGCAGACAAGGTATAGGG Ethidium Bromide, 10 mg/mL (Amresco, Catalog # X328) Ultrapure DNase/RNase-Free Distilled Water (Invitrogen, Catalog # 10977015), to prepare Assay Buffer DNA gel *Digest was gel purified using gel purification kit and eluted in EB buffer (10 mM Tris-HCl, pH 8.5). Assay 1. Prepare RNP Complex: a. 600 nM sgRNA (6 µL addition from 3 µM stock prepared in Assay Buffer) b. 0.25 μg rS. pyogenes Cas9 c. Add Assay Buffer for a final RNP Complex volume of 26.5 µL d.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2007/0136827 A1 Collins Et Al
    US 2007013 6827A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2007/0136827 A1 Collins et al. (43) Pub. Date: Jun. 14, 2007 (54) CSFTRANS RIBOREGULATORS Publication Classification (51) Int. Cl. (75) Inventors: James J. Collins, Newton, MA (US); AOIK 67/027 (2006.01) Farren J. Isaacs, Brookline, MA (US); C7H 2L/04 (2006.01) Charles R. Cantor, Del Mar, CA (US); CI2N 15/09 (2006.01) Daniel J. Dwyer, Brookline, MA (US) CI2N 5/06 (2006.01) (52) U.S. Cl. ............................ 800/14; 435/325; 435/455; 536/23.2 Correspondence Address: CHOATE, HALL & STEWART LLP (57) ABSTRACT TWO INTERNATIONAL PLACE BOSTON, MA 02110 (US) The present invention provides nucleic acid molecules, DNA constructs, plasmids, and methods for post-transcrip tional regulation of gene expression using RNA molecules to (73) Assignee: TRUSTEES OF BOSTON UNIVER both repress and activate translation of an open reading SITY, Boston, MA (US) frame. Repression of gene expression is achieved through the presence of a regulatory nucleic acid element (the cis-repressive RNA or crRNA) within the 5' untranslated (21) Appl. No.: 10/535,128 region (5' UTR) of an mRNA molecule. The nucleic acid element forms a hairpin (stem/loop) structure through complementary base pairing. The hairpin blocks access to (22) PCT Fed: Nov. 14, 2003 the mRNA transcript by the ribosome, thereby preventing translation. In particular, in embodiments of the invention PCT No.: PCT/USO3A36506 designed to operate in prokaryotic cells, the stem of the (86) hairpin secondary structure sequesters the ribosome binding S 371(c)(1), site (RBS).
    [Show full text]
  • CRISPR/Cas9 System and Gene Editing Tools – on Patent Rights, Recent Disputes and Its Potential Commercial Applicability in Biotechnology and Medicine
    ISSN 2003-2382 CRISPR/Cas9 system and gene editing tools – On patent rights, recent disputes and its potential commercial applicability in biotechnology and medicine By Thomas Hedner and Jean Lycke ABSTRACT may also find a future use in “de-extinction” of various animals such as the woolly mammoth The CRISPR/Cas9 discovery has emerged as a and passenger pigeon. powerful technology tool to edit genomes, which The recent discoveries and developments have allows researchers, innovators and life science led to extensive patenting efforts, resulting in some entrepreneurs to alter DNA sequences and modify major patent disputes. The extensive patenting may gene function in a range of species. The simplicity, risk creating a scenario, which could hamper the high efficiency and seemingly broad use of the further development of this technology and ultima- CRISPR/Cas9 system has led to hopes that this tely limit full value creation of this technology for disruptive technology may have the potential to major societal and industrial stakeholders. transform important sectors of biotechnology and medicine. The technology will enable users to make changes in the sequence or expression of virtually 1. INTRODUCTION any gene, cell type or organism. The rapid progress The CRISPR technology, which allows researchers to easily in the development of CRISPR/Cas9-based techno- alter DNA sequences and modify gene function has over logies over the past years has been extraordinary. the past decade emerged a simple and powerful tool for In spite of that, many outstanding questions remain editing genomes1 The CRISPR/Cas9 is a system initially to be addressed, and potentially interesting applica- found in bacteria as a mechanism involved in immune tions as well as potential risks yet need to be explored.
    [Show full text]
  • CRISPR/Cas9 Genome Editing Brochure
    mirusbio.com Cas9 Target Sequence Guide RNA GENOME EDITING: CRISPR/CAS9 DELIVERY METHODS GENOME EDITING: CRISPR/CAS9 DELIVERY What is CRISPR/Cas9 Genome Editing? The CRISPR/Cas9 system is a powerful tool for genome editing in mammalian cells that allows researchers to generate genetic variants at lower cost and with higher throughput than alternative methods like zinc finger nuclease (ZFN) or transcription activator-like effector nuclease (TALEN) genome editing. Cas9 PAM Genomic DNA Target Sequence Guide RNA crRNA tracrRNA The CRISPR/Cas9 RNP Complex. The CRISPR associated protein 9 (Cas9) endonuclease (blue) is targeted to DNA by a guide RNA (gRNA), which can be supplied as a two-part system consisting of CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) or as a single guide RNA (sgRNA), where the crRNA and tracrRNA are connected by a linker (dotted line). Target recognition is facilitated by the protospacer-adjacent motif (PAM). A double strand break (DSB) occurs 3 bp upstream of the PAM. CRISPR Facilitates Multiple Types of Genome Modification Cleavage of Target DNA By Cas9 Deletion Modication Insertion Multiple Genomic Alterations are Possible Following Cleavage of Target DNA by Cas9. Variable length insertions and/ or deletions (indels) can result near the DNA break due to mistakes in DNA repair by the endogenous non-homologous end joining (NHEJ) pathway. These indels frequently result in disruption of gene function. Alternatively, by supplying a DNA repair template, researchers can leverage the homology-directed repair (HDR) pathway to create defined deletions, insertions or other modifications. 2 TO ORDER | Toll Free 888.530.0801 | Direct 608.441.2852 | www.mirusbio.com Glossary of CRISPR Terms Term Definition CRISPR Associated Protein 9 - Cas9 is an RNA-guided DNA endonuclease from the type Cas9 II CRISPR system of Streptococcus pyogenes that has been adapted for use in genome editing applications.
    [Show full text]
  • Engineering of Primary Human B Cells with CRISPR/Cas9 Targeted Nuclease Received: 26 January 2018 Matthew J
    www.nature.com/scientificreports OPEN Engineering of Primary Human B cells with CRISPR/Cas9 Targeted Nuclease Received: 26 January 2018 Matthew J. Johnson1,2,3, Kanut Laoharawee1,2,3, Walker S. Lahr1,2,3, Beau R. Webber1,2,3 & Accepted: 23 July 2018 Branden S. Moriarity1,2,3 Published: xx xx xxxx B cells ofer unique opportunities for gene therapy because of their ability to secrete large amounts of protein in the form of antibody and persist for the life of the organism as plasma cells. Here, we report optimized CRISPR/Cas9 based genome engineering of primary human B cells. Our procedure involves enrichment of CD19+ B cells from PBMCs followed by activation, expansion, and electroporation of CRISPR/Cas9 reagents. We are able expand total B cells in culture 10-fold and outgrow the IgD+ IgM+ CD27− naïve subset from 35% to over 80% of the culture. B cells are receptive to nucleic acid delivery via electroporation 3 days after stimulation, peaking at Day 7 post stimulation. We tested chemically modifed sgRNAs and Alt-R gRNAs targeting CD19 with Cas9 mRNA or Cas9 protein. Using this system, we achieved genetic and protein knockout of CD19 at rates over 70%. Finally, we tested sgRNAs targeting the AAVS1 safe harbor site using Cas9 protein in combination with AAV6 to deliver donor template encoding a splice acceptor-EGFP cassette, which yielded site-specifc integration frequencies up to 25%. The development of methods for genetically engineered B cells opens the door to a myriad of applications in basic research, antibody production, and cellular therapeutics.
    [Show full text]
  • User Method: Alt-R CRISPR-Cas9 RNP Complexes for Microinjection Into B
    user method genome editing Microinjection of Bactrocera tryoni (Queensland fruit fly) embryos How to prepare Alt-R® CRISPR-Cas9 ribonucleoprotein complexes for microinjection Contributed by Amanda Choo, University of Adelaide, Adelaide, South Australia The method presented here is provided by customers who have used the Alt-R CRISPR-Cas9 System. This can serve as a starting point for using the Alt-R CRISPR-Cas9 System in similar biological systems, but may not be fully optimized for your gene or application. IDT does not guarantee these methods, and application specialists at IDT can only provide general guidance with limited troubleshooting and support. Materials Kits and reagents Ordering information Enzyme dilution reagents: Option 1: HEPES and KCl General laboratory supplier Option 2: 1X Phosphate buffered saline (PBS) General laboratory supplier Option 3: Opti-MEM® media Thermo Fisher (cat # 51985091) IDT predesigned and custom crRNA: Alt-R CRISPR-Cas9 crRNA www.idtdna.com/CRISPR-Cas9 Alt-R CRISPR-Cas9 tracrRNA IDT (cat # 1072532, 1072533, 1072534) or Alt-R CRISPR-Cas9 tracrRNA – ATTO™ 550 IDT (cat # 1075927, 1075928) Alt-R S.p. Cas9 Nuclease 3NLS IDT (cat # 1074181, 1074182) Nuclease-Free Duplex Buffer IDT (cat # 11-01-03-01) Reagents for 10X Injection buffer: Sodium phosphate General laboratory supplier KCl General laboratory supplier Nuclease-Free Water IDT (cat # 11-05-01-14) HDR template: Ultramer® DNA Oligonucleotides IDT (www.idtdna.com/Ultramer) See what more we can do for you at www.idtdna.com. user method genome editing Methods A. Prepare buffers and enzyme 1. Prepare the Cas9 enzyme working buffer as described in the following table: Component Amount Final concentration 1 M HEPES, pH 7.5 200 µL 20 mM 1 M KCl 1.5 mL 150 mM Nuclease-Free Water ~6.5 mL* — Final volume 10 mL — * Add 6.5 mL of water, verify pH 7.5, and add more water to reach final volume.
    [Show full text]