DOCSLIB.ORG

SUICIDE RESEARCH: SELECTED READINGS Volume 3 November 2009–April 2010

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SUICIDE RESEARCH: SELECTED READINGS Volume 3 November 2009–April 2010 SuicideResearchText-Vol3:SuicideResearchText-Vol3 1/12/10 4:13 PM Page i SUICIDE RESEARCH: SELECTED READINGS Volume 3 November 2009–April 2010 J. Sveticic, A. Milner, D. De Leo Australian Institute for Suicide Research and Prevention WHO Collaborating Centre for Research and Training in Suicide Prevention National Centre of Excellence in Suicide Prevention SuicideResearchText-Vol3:SuicideResearchText-Vol3 1/12/10 4:13 PM Page ii First published in 2010 Australian Academic Press 32 Jeays Street Bowen Hills Qld 4006 Australia www.australianacademicpress.com.au Copyright for the Introduction and Comments sections is held by the Australian Institute for Suicide Research and Prevention, 2010. Copyright in all abstracts is retained by the current rights holder. Apart from any use as permitted under the Copyright Act, 1968, no part may be reproduced without prior permission from the Australian Institute for Suicide Research and Prevention. ISBN: 9781921513251 SuicideResearchText-Vol3:SuicideResearchText-Vol3 1/12/10 4:13 PM Page iii Contents Foreword ................................................................................................vii Acknowledgments ..............................................................................viii Introduction Context ..................................................................................................1 Methodology ........................................................................................2 Key articles Andersen et al, 2010. Suicide in selected occupations in Queensland: evidence from the State suicide register ....................................................8 Bergen et al, 2009. A comparative study of non-fatal self-poisoning with antidepressants relative to prescribing in three centres in England ......10 Bergmans et al, 2009. Moving from full-time healing work to paid employment: Challenges and celebrations ..................................12 Burke et al, 2010. Effect of exposure to suicidal behavior on suicide attempt in a high-risk sample of offspring of depressed parents ............14 Corcoran et al, 2010. Use of analgesics in intentional drug overdose presentations to hospital before and after the withdrawal of distalgesic from the Irish market ..............................................................16 Currier et al, 2010. Mobile crisis team intervention to enhance linkage of discharged suicidal emergency department patients to outpatient psychiatric services: a randomized controlled trial ............19 Doessel et al, 2010. The trend in mental health-related mortality rates in Australia 1916-2004: Implications for policy ................................22 Fishbain et al, 2009. Risk for five forms of suicidality in acute pain patients and chronic pain patients vs pain-free community controls ......24 Gould et al, 2009. Service use by at-risk youths after school-based suicide screening ......................................................................................26 Gradus et al, 2010. Posttraumatic stress disorder and completed suicide........................................................................................................28 Hay et al, 2010. Bullying victimization and adolescent self-harm: testing hypotheses from general strain theory ........................................30 iii SuicideResearchText-Vol3:SuicideResearchText-Vol3 1/12/10 4:13 PM Page iv Hawton et al, 2009. How adolescents who cut themselves differ from those who take overdoses ................................................................32 Hegerl et al, 2009. Sustainable effects on suicidality were found for the Nuremberg alliance against depression........................................34 Hunt et al, 2010. Suicide amongst psychiatric in-patients who abscond from the ward: a national clinical survey ....................................36 King et al, 2010. One-year follow-up of suicidal adolescents: Parental history of mental health problems and time to post-hospitalization attempt......................................................................38 Lam et al, 2009. The association between internet addiction and self-injurious behaviour among adolescents......................................40 Lemstra et al, 2009. Suicidal ideation: the role of economic and Aboriginal cultural status after multivariate adjustment ....................42 Mauerhofer et al, 2009. GPs’ role in the detection of psychological problems of young people: A population-based study............................44 Price et al, 2009. Cannabis and suicide: longitudinal study ....................46 Reutfors et al, 2010. Suicide and hospitalization for mental disorders in Sweden: A population-based case-control study ................................48 Robertson et al, 2009. Drugs associated with more suicidal ideations are also associated with more suicide attempts ......................................50 Seemüller et al, 2009. Does early improvement in major depression protect against treatment emergent suicidal ideation? ............................52 Shemanski Aldrich et al, 2009. The development of effective message content for suicide intervention ................................................54 Swahn et al, 2010. Pre-teen alcohol use initiation and suicide attempts among middle and high school students: Findings from the 2006 Georgia Student Health Survey ........................................56 Vannoy et al, 2010. Suicide inquiry in primary care: creating context, inquiring, and following up ......................................................................58 Voracek et al, 2009. Consistency of immigrant suicide rates in Austria with country-of-birth suicide rates: A role for genetic risk factors for suicide? ............................................................................60 Wiktorsson et al, 2010. Attempted suicide in the elderly: characteristics of suicide attempters 70 years and older and a general population comparison group ..................................................62 Zhao et al, 2010. Suicidal ideation and attempt among adolescents reporting ‘unsure’ sexual identity or heterosexual identity plus same-sex attraction or behavior: forgotten groups?............64 iv SuicideResearchText-Vol3:SuicideResearchText-Vol3 1/12/10 4:13 PM Page v Recommended readings ..................................................................67 Citation list Fatal suicidal behaviour: Epidemiology ..............................................................................148 Risk and protective factors ..........................................................153 Prevention ....................................................................................161 Postvention and bereavement ....................................................163 Non-fatal suicidal behaviour: Epidemiology ..............................................................................164 Risk and protective factors ..........................................................166 Care and support ........................................................................185 Prevention ....................................................................................187 Case reports ......................................................................................189 Miscellaneous.....................................................................................194 v SuicideResearchText-Vol3:SuicideResearchText-Vol3 1/12/10 4:13 PM Page vi SuicideResearchText-Vol3:SuicideResearchText-Vol3 1/12/10 4:13 PM Page vii Foreword This volume contains quotations from internationally peer-reviewed suicide research published during the semester November 2009 to April 2010; it is the third of a series produced biannually by our Institute with the aim of assisting the Commonwealth Department of Health and Ageing in being constantly updated on new evidences from the scientific community. The initial section of the volume collects a number of publications that could have particular relevance for the Australian people in terms of potential applicability. These researches are accompanied by a short comment from us, and an explanation of the motives that justify why we have considered of interest the implementation of studies’ findings in the Australian context. An introductory part provides the ration- ale and the methodology followed in the identification of papers. The central part of the volume represents a selection of research articles of par- ticular significance that represent a remarkable advancement of suicide research knowledge; their abstracts are reported in extenso, underlining our invitation at reading those papers in full text. The last section reports all items retrievable from major electronic databases. We have catalogued them on the basis of their prevailing reference to fatal and non-fatal suicidal behaviours, with various sub-headings (e.g. epidemiology, risk factors, and so on). The derived list guarantees a level of completeness superior to any individual system; it can constitute a useful tool for all those interested in a quick update of what has been most recently published on the topic. Our intent is to make suicide research more approachable to non-specialists, and in the meantime provide an opportunity for a vademecum of quotations credible also at the professional level. A compilation such as the one that we provide here is not easily obtainable from usual sources and can save a considerable amount of time to readers. We believe that our effort in this direction may
Load more

Recommended publications
  • Genetic Mutation Analysis of High and Low Igy Chickens by Capture Sequencing
    animals Article Genetic Mutation Analysis of High and Low IgY Chickens by Capture Sequencing 1,2, 1,2, 1,3 1,2 1,2 1,2 Qiao Wang y , Fei Wang y, Lu Liu , Qinghe Li , Ranran Liu , Maiqing Zheng , Huanxian Cui 1,2, Jie Wen 1,2 and Guiping Zhao 1,2,4,* 1 Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100193, China; [email protected] (Q.W.); [email protected] (F.W.); [email protected] (L.L.); [email protected] (Q.L.); [email protected] (R.L.); [email protected] (M.Z.); [email protected] (H.C.); [email protected] (J.W.) 2 State Key Laboratory of Animal Nutrition, Beijing 100193, China 3 College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China 4 School of Life Science and Engineering, Foshan University, Foshan 528225, China * Correspondence: [email protected] These authors contributed equally to this work. y Received: 6 March 2019; Accepted: 20 May 2019; Published: 23 May 2019 Simple Summary: Immunoglobulin Y (IgY) is the major antibody produced by hens and it endows their offspring with effective humoral immunity against the pathogens. In previous research, we identified 13 genomic regions that were significantly associated with the serum IgY level or antibody responses to sheep red-blood-cells, but the specific mutations in these regions have not been reported. Therefore, we screened for variations in these regions in White Leghorn and Beijing-You chickens with high and low IgY. Our study identified 35,154 mutations and 829 Indels which were associated with IgY levels in both lines.
    [Show full text]
  • Loss-Of-Function Mutation in the Dioxygenase-Encoding FTO Gene
    Loss-of-Function Mutation in the Dioxygenase-Encoding FTO Gene Causes Severe Growth Retardation and Multiple Malformations Sarah Boissel, Orit Reish, Karine Proulx, Hiroko Kawagoe-Takaki, Barbara Sedgwick, Giles Yeo, David Meyre, Christelle Golzio, Florence Molinari, Noman Kadhom, et al. To cite this version: Sarah Boissel, Orit Reish, Karine Proulx, Hiroko Kawagoe-Takaki, Barbara Sedgwick, et al.. Loss-of- Function Mutation in the Dioxygenase-Encoding FTO Gene Causes Severe Growth Retardation and Multiple Malformations. American Journal of Human Genetics, Elsevier (Cell Press), 2009, 85 (1), pp.106-111. 10.1016/j.ajhg.2009.06.002. hal-02044723 HAL Id: hal-02044723 https://hal.archives-ouvertes.fr/hal-02044723 Submitted on 21 Feb 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. REPORT Loss-of-Function Mutation in the Dioxygenase-Encoding FTO Gene Causes Severe Growth Retardation and Multiple Malformations Sarah Boissel,1,7 Orit Reish,2,7 Karine Proulx,3,7 Hiroko Kawagoe-Takaki,4 Barbara Sedgwick,4 Giles S.H. Yeo,3 David Meyre,5 Christelle Golzio,1 Florence Molinari,1 Noman Kadhom,1 Heather C. Etchevers,1 Vladimir Saudek,3 I. Sadaf Farooqi,3 Philippe Froguel,5,6 Tomas Lindahl,4 Stephen O’Rahilly,3 Arnold Munnich,1 and Laurence Colleaux1,* FTO is a nuclear protein belonging to the AlkB-related non-haem iron- and 2-oxoglutarate-dependent dioxygenase family.
    [Show full text]
  • Prison Suicide: an Overview and Guide to Prevention National Institute of Corrections
    U.S. Department of Justice National Institute of Corrections Prison Suicide: An Overview and Guide to Prevention National Institute of Corrections Morris L. Thigpen, Director Susan M. Hunter, Chief Prisons Division John E. Moore, Project Manager Prison Suicide: An Overview and Guide to Prevention By Lindsay M. Hayes Project Director National Center on Institutions and Alternatives Mansfield, Massachusetts June 1995 This document was prepared under grant number 93P01GHU1 from the National Institute of Corrections, U.S. Department of Justice. Points of view or opinions stated in this document are those of the author(s) and do not necessarily represent the official position or policies of the U.S. Department of Justice. Copyright © 1995 by the National Center on Institutions and Alternatives The National Institute of Corrections reserves the right to reproduce, publish, translate, or otherwise use, and to authorize others to publish and use all or any part of the copyrighted material contained in this publication. ii TABLE OF CONTENTS FOREWORD .......................................................................................................................................v PREFACE AND ACKNOWLEDGMENTS ..................................................................................vi 1. INTRODUCTION AND LITERATURE REVIEW ..............................................................1 2. NATIONAL AND STATE STANDARDS FOR PRISON SUICIDE PREVENTION ...........................................................................................................8
    [Show full text]
  • Suicide Research: Selected Readings. Volume 2
    SuicideResearchText-Vol2:SuicideResearchText-Vol2 8/6/10 11:00 AM Page i SUICIDE RESEARCH: SELECTED READINGS Volume 2 May 2009–October 2009 J. Sveticic, K. Andersen, D. De Leo Australian Institute for Suicide Research and Prevention WHO Collaborating Centre for Research and Training in Suicide Prevention National Centre of Excellence in Suicide Prevention SuicideResearchText-Vol2:SuicideResearchText-Vol2 8/6/10 11:00 AM Page ii First published in 2009 Australian Academic Press 32 Jeays Street Bowen Hills Qld 4006 Australia www.australianacademicpress.com.au Reprinted in 2010 Copyright for the Introduction and Comments sections is held by the Australian Institute for Suicide Research and Prevention, 2009. Copyright in all abstracts is retained by the current rights holder. Apart from any use as permitted under the Copyright Act, 1968, no part may be reproduced without prior permission from the Australian Institute for Suicide Research and Prevention. ISBN: 978-1-921513-53-4 SuicideResearchText-Vol2:SuicideResearchText-Vol2 8/6/10 11:00 AM Page iii Contents Foreword ................................................................................................vii Acknowledgments ..............................................................................viii Introduction Context ..................................................................................................1 Methodology ........................................................................................2 Key articles Alexopoulos et al, 2009. Reducing suicidal ideation
    [Show full text]
  • Transcriptome Sequencing and Genome-Wide Association Analyses Reveal Lysosomal Function and Actin Cytoskeleton Remodeling in Schizophrenia and Bipolar Disorder
    Molecular Psychiatry (2015) 20, 563–572 © 2015 Macmillan Publishers Limited All rights reserved 1359-4184/15 www.nature.com/mp ORIGINAL ARTICLE Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder Z Zhao1,6,JXu2,6, J Chen3,6, S Kim4, M Reimers3, S-A Bacanu3,HYu1, C Liu5, J Sun1, Q Wang1, P Jia1,FXu2, Y Zhang2, KS Kendler3, Z Peng2 and X Chen3 Schizophrenia (SCZ) and bipolar disorder (BPD) are severe mental disorders with high heritability. Clinicians have long noticed the similarities of clinic symptoms between these disorders. In recent years, accumulating evidence indicates some shared genetic liabilities. However, what is shared remains elusive. In this study, we conducted whole transcriptome analysis of post-mortem brain tissues (cingulate cortex) from SCZ, BPD and control subjects, and identified differentially expressed genes in these disorders. We found 105 and 153 genes differentially expressed in SCZ and BPD, respectively. By comparing the t-test scores, we found that many of the genes differentially expressed in SCZ and BPD are concordant in their expression level (q ⩽ 0.01, 53 genes; q ⩽ 0.05, 213 genes; q ⩽ 0.1, 885 genes). Using genome-wide association data from the Psychiatric Genomics Consortium, we found that these differentially and concordantly expressed genes were enriched in association signals for both SCZ (Po10 − 7) and BPD (P = 0.029). To our knowledge, this is the first time that a substantially large number of genes show concordant expression and association for both SCZ and BPD. Pathway analyses of these genes indicated that they are involved in the lysosome, Fc gamma receptor-mediated phagocytosis, regulation of actin cytoskeleton pathways, along with several cancer pathways.
    [Show full text]
  • Mouse Aktip Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Aktip Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Aktip conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Aktip gene (NCBI Reference Sequence: NM_001302267 ; Ensembl: ENSMUSG00000031667 ) is located on Mouse chromosome 8. 11 exons are identified, with the ATG start codon in exon 3 and the TAA stop codon in exon 11 (Transcript: ENSMUST00000120213). Exon 4 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Aktip gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-149I24 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a hypomorphic allele exhibit impaired growth, skeletal and skin defects, abnormal heart tissue, and sterility. Exon 4 starts from about 4.91% of the coding region. The knockout of Exon 4 will result in frameshift of the gene. The size of intron 3 for 5'-loxP site insertion: 1235 bp, and the size of intron 4 for 3'-loxP site insertion: 2670 bp. The size of effective cKO region: ~706 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 3 4 11 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Aktip Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Suicide in Correctional Facilities
    Suicide in Correctional Facilities Suicide in Correctional Facilities Albert De Amicis, MPPM University of Phoenix Faculty September 14, 2009 Suicide in a Correctional Facility Table of Contents ABSTRACT........................................................................................................................iii INTRODUCTION………………………………………………………………………....1 NCIA 1981 SUICIDE VICTIMS PROFILE – Table -1.......................................................3 DEFINE THE PROBLEM………………………………………………………………....8 GOALS AND OBJECTIVES……………………………………………………………..14 ESTABLISH THE EVALUATION CRITERIA……………………………………….....16 EVALUATING ALTERNATIVE POLICIES …………………………………………... 17 Alternative One - Elayn Hunt Correctional Center Suicide Prevention Plan.......... 17 Alternative Two - Jefferson County Corrections: Inmate Watch Program Helps Prevent Suicides..............................................................22 DISTINGUISHING AMONG ALTERNATIVES……………………………………….. 25 Alternative One - Elayn Hunt Correctional Center Suicide Prevention Plan.......... 25 Benefit Cost Analysis Salaries – Table-2....................................28 Alternative Two - Jefferson County Corrections: Inmate Watch Program Helps Prevent Suicides..............................................................30 DISTINGUISHING AMONG ALTERNATIVE POLICIES..............................................31 APPLICATION OF THE SATISFICING METHOD – Table-3.........................................31 MONITORING AND IMPLEMENTATION OF POLICIES ………………………........32 SUMMARY.........................................................................................................................33
    [Show full text]
  • Suicide Watch
    SUICIDE Anyone who cares about kids wants to know: Why are so many young people intent on destroying themselves? And what can schools do to save them? BY REBECCA JONES Reprinted with permission from American School Board Journal Photo: © JFB/Stone © May 2001 by the National School Boards Association n Dec. 1, 2000, a 17-year-old boy set up a video suicide does happen, that’s the worst possible [time] to try to camera in the parking lot of Granada Hills High fly by the seat of your pants.” School just outside Los Angeles. Then he Now is the time, he and other experts say, to identify vul- turned up his car radio and shot himself in the nerable children and protect them from themselves. But how? head. Several federal agencies are collaborating to develop suicide- Dozens, maybe hundreds, of students wit- prevention guidelines for school districts, based on guidelines nessed the shooting. It was the second suicide developed in New Zealand. Work has been slow because the among the school’s 3,700 students in three research in this area isn’t always clear and the experts don’t al- weeks. Another Granada Hills student had ways agree. But researchers, experts, and attorneys agree on weighted herself down and jumped into her family’s the importance of a few principles: swimming pool. OThousands of kids end it all, or try to, every year. The U.S. Centers for Disease Control and Prevention estimates 5,000 KNOW WHAT YOU’RE DEALING WITH young people kill themselves each year, but suicide experts say A Los Angeles principal calls Richard Lieberman—known as the true toll is probably two or three times higher.
    [Show full text]
  • Probabilistic Models for Collecting, Analyzing, and Modeling Expression Data
    Probabilistic Models for Collecting, Analyzing, and Modeling Expression Data Hai-Son Phuoc Le May 2013 CMU-ML-13-101 Probabilistic Models for Collecting, Analyzing, and Modeling Expression Data Hai-Son Phuoc Le May 2013 CMU-ML-13-101 Machine Learning Department School of Computer Science Carnegie Mellon University Thesis Committee Ziv Bar-Joseph, Chair Christopher Langmead Roni Rosenfeld Quaid Morris Submitted in partial fulfillment of the requirements for the Degree of Doctor of Philosophy. Copyright @ 2013 Hai-Son Le This research was sponsored by the National Institutes of Health under grant numbers 5U01HL108642 and 1R01GM085022, the National Science Foundation under grant num- bers DBI0448453 and DBI0965316, and the Pittsburgh Life Sciences Greenhouse. The views and conclusions contained in this document are those of the author and should not be interpreted as representing the official policies, either expressed or implied, of any sponsoring institution, the U.S. government or any other entity. Keywords: genomics, gene expression, gene regulation, microarray, RNA-Seq, transcriptomics, error correction, comparative genomics, regulatory networks, cross-species, expression database, Gene Expression Omnibus, GEO, orthologs, microRNA, target prediction, Dirichlet Process, Indian Buffet Process, hidden Markov model, immune response, cancer. To Mom and Dad. i Abstract Advances in genomics allow researchers to measure the complete set of transcripts in cells. These transcripts include messenger RNAs (which encode for proteins) and microRNAs, short RNAs that play an important regulatory role in cellular networks. While this data is a great resource for reconstructing the activity of networks in cells, it also presents several computational challenges. These challenges include the data collection stage which often results in incomplete and noisy measurement, developing methods to integrate several experiments within and across species, and designing methods that can use this data to map the interactions and networks that are activated in specific conditions.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • National Guidelines: Responding to Grief, Trauma, and Distress After a Suicide
    Responding to Grief, Trauma, and Distress After a Suicide: U.S. National Guidelines Survivors of Suicide Loss Task Force April 2015 Blank page Responding to Grief, Trauma, and Distress After a Suicide: U.S. National Guidelines Table of Contents Front Matter Acknowledgements ...................................................................................................................................... i Task Force Co-Leads, Members .................................................................................................................. ii Reviewers .................................................................................................................................................... ii Preface ....................................................................................................................................................... iii National Guidelines Executive Summary ..................................................................................................................................... 1 Introduction ................................................................................................................................................ 4 Terminology: “Postvention” and “Loss Survivor” ....................................................................................... 4 Development and Purpose of the Guidelines ............................................................................................. 6 Audience of the Guidelines ........................................................................................................................
    [Show full text]
  • FTS (AKTIP) (NM 022476) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC112492 FTS (AKTIP) (NM_022476) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: FTS (AKTIP) (NM_022476) Human Untagged Clone Tag: Tag Free Symbol: AKTIP Synonyms: FT1; FTS Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_022476, the custom clone sequence may differ by one or more nucleotides ATGAACCCTTTCTGGAGCATGTCTACAAGCTCTGTACGCAAACGATCTGAAGGTGAAGAGAAGACATTAA CAGGGGACGTGAAAACCAGTCCTCCACGAACTGCACCAAAGAAACAGCTGCCTTCTATTCCCAAAAATGC TTTGCCCATAACTAAGCCTACATCTCCTGCCCCAGCAGCACAGTCAACAAATGGCACGCATGCGTCCTAT GGACCCTTCTACCTGGAATACTCTCTTCTTGCAGAATTTACCTTGGTTGTGAAGCAGAAGCTACCAGGCG TCTATGTGCAGCCATCTTATCGCTCTGCATTAATGTGGTTTGGAGTAATATTCATACGGCATGGACTTTA CCAAGATGGCGTATTTAAGTTTACAGTTTACATCCCTGATAACTATCCAGATGGTGACTGTCCACGCTTG GTGTTCGATATTCCTGTCTTTCACCCGCTAGTTGATCCCACCTCAGGTGAGCTGGATGTGAAGAGAGCAT TTGCAAAATGGAGGCGGAACCATAATCATATTTGGCAGGTATTAATGTATGCAAGGAGAGTTTTCTACAA GATTGATACAGCAAGCCCCCTGAACCCAGAGGCTGCAGTACTGTATGAAAAAGATATTCAGCTTTTTAAA AGTAAAGTTGTTGACAGTGTTAAGGTGTGCACTGCTCGTTTGTTTGACCAACCTAAAATAGAAGACCCCT ATGCAATTAGCTTTTCTCCATGGAATCCTTCTGTACATGATGAAGCCAGAGAAAAGATGCTGACTCAGAA AAAGCCTGAAGAACAGCACAATAAAAGTGTTCATGTTGCTGGCCTGTCATGGGTAAAGCCTGGCTCAGTA CAGCCTTTCAGTAAAGAAGAGAAAACAGTGGCGACTTAA This product is to be used for laboratory only. Not for
    [Show full text]