DOCSLIB.ORG

Loss-Of-Function Mutation in the Dioxygenase-Encoding FTO Gene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Loss-Of-Function Mutation in the Dioxygenase-Encoding FTO Gene Loss-of-Function Mutation in the Dioxygenase-Encoding FTO Gene Causes Severe Growth Retardation and Multiple Malformations Sarah Boissel, Orit Reish, Karine Proulx, Hiroko Kawagoe-Takaki, Barbara Sedgwick, Giles Yeo, David Meyre, Christelle Golzio, Florence Molinari, Noman Kadhom, et al. To cite this version: Sarah Boissel, Orit Reish, Karine Proulx, Hiroko Kawagoe-Takaki, Barbara Sedgwick, et al.. Loss-of- Function Mutation in the Dioxygenase-Encoding FTO Gene Causes Severe Growth Retardation and Multiple Malformations. American Journal of Human Genetics, Elsevier (Cell Press), 2009, 85 (1), pp.106-111. 10.1016/j.ajhg.2009.06.002. hal-02044723 HAL Id: hal-02044723 https://hal.archives-ouvertes.fr/hal-02044723 Submitted on 21 Feb 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. REPORT Loss-of-Function Mutation in the Dioxygenase-Encoding FTO Gene Causes Severe Growth Retardation and Multiple Malformations Sarah Boissel,1,7 Orit Reish,2,7 Karine Proulx,3,7 Hiroko Kawagoe-Takaki,4 Barbara Sedgwick,4 Giles S.H. Yeo,3 David Meyre,5 Christelle Golzio,1 Florence Molinari,1 Noman Kadhom,1 Heather C. Etchevers,1 Vladimir Saudek,3 I. Sadaf Farooqi,3 Philippe Froguel,5,6 Tomas Lindahl,4 Stephen O’Rahilly,3 Arnold Munnich,1 and Laurence Colleaux1,* FTO is a nuclear protein belonging to the AlkB-related non-haem iron- and 2-oxoglutarate-dependent dioxygenase family. Although polymorphisms within the first intron of the FTO gene have been associated with obesity, the physiological role of FTO remains unknown. Here we show that a R316Q mutation, inactivating FTO enzymatic activity, is responsible for an autosomal-recessive lethal syndrome. Cultured skin fibroblasts from affected subjects showed impaired proliferation and accelerated senescence. These findings indicate that FTO is essential for normal development of the central nervous and cardiovascular systems in human and establish that a mutation in a human member of the AlkB-related dioxygenase family results in a severe polymalformation syndrome. Fto was originally identified in mice as one of the genes en- by oxidative demethylation.10–14 Fto-deficient mice have coded by the 1.6 Mb deletion causing the fused toes (Ft) been recently described.15 Homozygous mutant mice are mutant, an autosomal-dominant mouse mutation gener- viable but postnatal death occurs frequently and loss of ated by a transgene integration into region D of mouse Fto leads to postnatal growth retardation, significant Chr 8.1 In addition to Fto, the deleted segment also reduction in adipose tissue, and lean body mass. contains three members of the Iroquois gene family (Irx3, We ascertained a large Palestinian Arab consanguineous Irx5, and Irx6, also known as the IrxB complex) as well as multiplex family in which nine affected individuals pre- the Fts/Aktip and Ftm/Rpgrip1l genes. Mice heterozygous sented with a previously unreported polymalformation for the Ft mutation are characterized by partial syndactyly syndrome (Figure 1A). The study was approved by the of forelimbs and thymic hyperplasia.1 Ft/Ft embryos die in supreme Israeli Helsinki Review Board (33/07-08) and midgestation and present many abnormalities including informed consent was obtained from all family members. limb polydactyly and distal truncations, major brain and All affected individuals had postnatal growth retardation, heart defects, delay or absence of neural tube closure, microcephaly, severe psychomotor delay, functional brain and facial structure hypoplasia.2,3 deficits, and characteristic facial dysmorphism. In some Interestingly, a human genome-wide search for type 2 patients, structural brain malformations, cardiac defects, diabetes susceptibility genes identified the strong associa- genital anomalies, and cleft palate were also observed tion of a series of single nucleotide polymorphisms (Table 1). Early lethality resulting from intercurrent infec- (SNPs), in tight linkage disequilibrium with rs9939609 tion or unidentified cause occurred at 1–30 months of age. and located in the first intron of the FTO gene (MIM Extensive biochemical, metabolic, and genetic analyses 610966), with higher body mass index (BMI) and obesity failed to diagnose any previously known inherited disor- risk in European cohorts.4,5 This association was replicated ders. Because the pedigree suggested an autosomal-reces- in various European cohorts and several studies have been sive mode of inheritance, we performed a genome-wide performed trying to identify association between the autozygosity screen with the Perkin Elmer Biosystems obesity risk allele and energy intake/expenditure or eating linkage mapping set (version 1) and identified a unique behavior trait.6–8 However, how FTO variants modulate region of shared homozygosity on chromosome 16q12 components of the energy balance remains elusive so far. (Figure S1 available online). Further genotype and haplo- FTO has been recognized as a member of the AlkB-related type analyses reduced the critical region to a 6.5 Mb interval family of non-haem iron- and 2-oxoglutarate-dependent between loci D16S411 and D16S3140 (maximum LOD dioxygenases.9 These non-heme iron enzymes, which score Zmax ¼ 4.16 at q ¼ 0 at the D16S3136 locus). No other require Fe2þ as a cofactor and 2-oxoglutarate and dioxygen genomic region showed consistent linkage. This genetic as cosubstrates, reverse alkylated DNA and RNA damages interval encompasses 28 genes that were all systematically 1INSERM U781 and De´partement de Ge´ne´tique, Universite´ Paris Descartes, Hoˆpital Necker-Enfants Malades, 75015 Paris, France; 2Department of Medical Genetics, Assaf Harofeh, Medical Center, Zerifin, The Sackler School of Medicine, Tel Aviv University, Tel Aviv 70300, Israel; 3Institute of Metabolic Science, University of Cambridge, Addenbrooke’s Hospital, Cambridge CB2 0QQ, UK; 4Cancer Research UK London Research Institute, Clare Hall Laboratories, South Mimms, Hertfordshire EN6 3LD, UK; 5CNRS 8090-Institute of Biology, Pasteur Institute, 59019 Lille, France; 6Section of Genomic Medicine, Ham- mersmith Hospital, Imperial College London, London W12 0NN, UK 7These authors contributed equally to this work *Correspondence: [email protected] DOI 10.1016/j.ajhg.2009.06.002. ª2009 by The American Society of Human Genetics. All rights reserved. 106 The American Journal of Human Genetics 85, 106–111, July 10, 2009 AB C Figure 1. Genetic Analysis of a Family with Ante- and Postnatal Growth Retardation and a Severe Polymalformative Syndrome (A) Pedigree of the family. Filled symbols and slashes indicate affected and deceased infants. (B) Electrophoregrams showing the variation of FTO gene sequence in an affected infant and a healthy control. (C) Part of the multiple sequence alignment of FTO representative orthologs (H.s, Homo sapiens; Ma.m, Macaca mulatta; R.n, Rattus nor- vegicus; Mu.m, Mus musculus; C.f, Canis familiaris; E.c, Equus caballus; Or.a, Ornithorhynchus anatinus; Ov.a, Ovis aries; B.t, Bos taurus; M.d, Monodelphis domestica; G.g, Gallus gallus; D.r, Danio rerio; X.t, Xenopus tropicalis; ABH2 H.s, human ABH2; ABH3 H.s, Human ABH3; AlkB E.c, E. coli AlkB). The conserved residues are highlighted and the amino acid highlighted in red is the absolutely conserved arginine involved in the R316Q mutation in patients (Ai, affected infant). Blue strands labeled with roman numerals identify three of the eight b strands that form the conserved double-stranded b-helix of the 2OG-oxygenases. analyzed at both DNA and/or RNA levels (Table S1). We dren with partially overlapping clinical features were tested identified a homozygous single-nucleotide variation at but no mutation in the FTO gene was identified, strength- cDNA position 947 (c.947G/A) within the FTO gene ening the idea that the new syndrome described here is (Figure 1B). The c.947G/A transition predicts a p.R316Q a very rare condition. substitution. Notably, this amino acid residue is absolutely FTO belongs to the AlkB-related protein family and was conserved across all known FTO paralogs and AlkB ortho- shown to localize in the nucleus.9 Immunofluorescence logs (Figure 1C) and is involved in 2-oxoglutarate coordina- experiments performed on patient and control fibroblasts tion by forming stabilizing salt bridges with the carboxyl- demonstrated that the mutation did not affect its nuclear ates of this cosubstrate.9 This variant cosegregated with localization (data not shown). Murine and human Fto the disease and was not found in 730 control chromosomes, have been shown to demethylate 3-methylthymine and including 378 chromosomes from individuals of Palesti- 3-methyluracil residues in single-stranded DNA and RNA nian Arab origin. We subsequently undertook to estimate in vitro, albeit with a relatively low efficiency. Fto was less the frequency of FTO sequence variants within the general active on the more common forms of methylated DNA base population. FTO coding exons and intron-exon boundaries damage, 1-methyladenine and 3-methylcytosine.9–14,16 sequence was determined in 1492 controls of European Moreover, the recombinant
Load more

Recommended publications
  • Genetic Mutation Analysis of High and Low Igy Chickens by Capture Sequencing
    animals Article Genetic Mutation Analysis of High and Low IgY Chickens by Capture Sequencing 1,2, 1,2, 1,3 1,2 1,2 1,2 Qiao Wang y , Fei Wang y, Lu Liu , Qinghe Li , Ranran Liu , Maiqing Zheng , Huanxian Cui 1,2, Jie Wen 1,2 and Guiping Zhao 1,2,4,* 1 Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100193, China; [email protected] (Q.W.); [email protected] (F.W.); [email protected] (L.L.); [email protected] (Q.L.); [email protected] (R.L.); [email protected] (M.Z.); [email protected] (H.C.); [email protected] (J.W.) 2 State Key Laboratory of Animal Nutrition, Beijing 100193, China 3 College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China 4 School of Life Science and Engineering, Foshan University, Foshan 528225, China * Correspondence: [email protected] These authors contributed equally to this work. y Received: 6 March 2019; Accepted: 20 May 2019; Published: 23 May 2019 Simple Summary: Immunoglobulin Y (IgY) is the major antibody produced by hens and it endows their offspring with effective humoral immunity against the pathogens. In previous research, we identified 13 genomic regions that were significantly associated with the serum IgY level or antibody responses to sheep red-blood-cells, but the specific mutations in these regions have not been reported. Therefore, we screened for variations in these regions in White Leghorn and Beijing-You chickens with high and low IgY. Our study identified 35,154 mutations and 829 Indels which were associated with IgY levels in both lines.
    [Show full text]
  • Prolyl Hydroxylase Domain Enzymes: Important Regulators of Cancer Metabolism
    Hypoxia Dovepress open access to scientific and medical research Open Access Full Text Article REVIEW Prolyl hydroxylase domain enzymes: important regulators of cancer metabolism Ming Yang1 Abstract: The hypoxia-inducible factor (HIF) prolyl hydroxylase domain enzymes (PHDs) Huizhong Su1 regulate the stability of HIF protein by post-translational hydroxylation of two conserved prolyl Tomoyoshi Soga2 residues in its α subunit in an oxygen-dependent manner. Trans-4-prolyl hydroxylation of HIFα 3 under normal oxygen (O ) availability enables its association with the von Hippel-Lindau (VHL) Kamil R Kranc 2 Patrick J Pollard1 tumor suppressor pVHL E3 ligase complex, leading to the degradation of HIFα via the ubiquitin- proteasome pathway. Due to the obligatory requirement of molecular O2 as a co-substrate, the 1Cancer Biology and Metabolism activity of PHDs is inhibited under hypoxic conditions, resulting in stabilized HIF , which Group, Institute of Genetics and α Molecular Medicine, University of dimerizes with HIFβ and, together with transcriptional co-activators CBP/p300, activates the Edinburgh, Edinburgh, UK; 2Institute transcription of its target genes. As a key molecular regulator of adaptive response to hypoxia, for Advanced Biosciences, Keio For personal use only. University, Mizukami, Tsuruoka, HIF plays important roles in multiple cellular processes and its overexpression has been detected Yamagata, Japan; 3MRC Centre for in various cancers. The HIF1α isoform in particular has a strong impact on cellular metabolism, Regenerative Medicine, University most notably by promoting anaerobic, whilst inhibiting O -dependent, metabolism of glucose. of Edinburgh, Edinburgh, UK 2 The PHD enzymes also seem to have HIF-independent functions and are subject to regulation by factors other than O2, such as by metabolic status, oxidative stress, and abnormal levels of endogenous metabolites (oncometabolites) that have been observed in some types of cancers.
    [Show full text]
  • Identification of Micrornas Controlling Hepatic Mrna Levels for Metabolic
    Hicks et al. BMC Genomics (2017) 18:687 DOI 10.1186/s12864-017-4096-5 RESEARCHARTICLE Open Access Identification of microRNAs controlling hepatic mRNA levels for metabolic genes during the metabolic transition from embryonic to posthatch development in the chicken Julie A. Hicks1, Tom E. Porter2 and Hsiao-Ching Liu1* Abstract Background: The transition from embryonic to posthatch development in the chicken represents a massive metabolic switch from primarily lipolytic to primarily lipogenic metabolism. This metabolic switch is essential for the chick to successfully transition from the metabolism of stored egg yolk to the utilization of carbohydrate-based feed. However, regulation of this metabolic switch is not well understood. We hypothesized that microRNAs (miRNAs) play an important role in the metabolic switch that is essential to efficient growth of chickens. We used high-throughput RNA sequencing to characterize expression profiles of mRNA and miRNA in liver during late embryonic and early posthatch development of the chicken. This extensive data set was used to define the contributions of microRNAs to the metabolic switch during development that is critical to growth and nutrient utilization in chickens. Results: We found that expression of over 800 mRNAs and 30 miRNAs was altered in the embryonic liver between embryonic day 18 and posthatch day 3, and many of these differentially expressed mRNAs and miRNAs are associated with metabolic processes. We confirmed the regulation of some of these mRNAs by miRNAs expressed in a reciprocal pattern using luciferase reporter assays. Finally, through the use of yeast one-hybrid screens, we identified several proteins that likely regulate expression of one of these important miRNAs.
    [Show full text]
  • Transcriptome Sequencing and Genome-Wide Association Analyses Reveal Lysosomal Function and Actin Cytoskeleton Remodeling in Schizophrenia and Bipolar Disorder
    Molecular Psychiatry (2015) 20, 563–572 © 2015 Macmillan Publishers Limited All rights reserved 1359-4184/15 www.nature.com/mp ORIGINAL ARTICLE Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder Z Zhao1,6,JXu2,6, J Chen3,6, S Kim4, M Reimers3, S-A Bacanu3,HYu1, C Liu5, J Sun1, Q Wang1, P Jia1,FXu2, Y Zhang2, KS Kendler3, Z Peng2 and X Chen3 Schizophrenia (SCZ) and bipolar disorder (BPD) are severe mental disorders with high heritability. Clinicians have long noticed the similarities of clinic symptoms between these disorders. In recent years, accumulating evidence indicates some shared genetic liabilities. However, what is shared remains elusive. In this study, we conducted whole transcriptome analysis of post-mortem brain tissues (cingulate cortex) from SCZ, BPD and control subjects, and identified differentially expressed genes in these disorders. We found 105 and 153 genes differentially expressed in SCZ and BPD, respectively. By comparing the t-test scores, we found that many of the genes differentially expressed in SCZ and BPD are concordant in their expression level (q ⩽ 0.01, 53 genes; q ⩽ 0.05, 213 genes; q ⩽ 0.1, 885 genes). Using genome-wide association data from the Psychiatric Genomics Consortium, we found that these differentially and concordantly expressed genes were enriched in association signals for both SCZ (Po10 − 7) and BPD (P = 0.029). To our knowledge, this is the first time that a substantially large number of genes show concordant expression and association for both SCZ and BPD. Pathway analyses of these genes indicated that they are involved in the lysosome, Fc gamma receptor-mediated phagocytosis, regulation of actin cytoskeleton pathways, along with several cancer pathways.
    [Show full text]
  • Mouse Aktip Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Aktip Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Aktip conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Aktip gene (NCBI Reference Sequence: NM_001302267 ; Ensembl: ENSMUSG00000031667 ) is located on Mouse chromosome 8. 11 exons are identified, with the ATG start codon in exon 3 and the TAA stop codon in exon 11 (Transcript: ENSMUST00000120213). Exon 4 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Aktip gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-149I24 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a hypomorphic allele exhibit impaired growth, skeletal and skin defects, abnormal heart tissue, and sterility. Exon 4 starts from about 4.91% of the coding region. The knockout of Exon 4 will result in frameshift of the gene. The size of intron 3 for 5'-loxP site insertion: 1235 bp, and the size of intron 4 for 3'-loxP site insertion: 2670 bp. The size of effective cKO region: ~706 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 3 4 11 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Aktip Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Probabilistic Models for Collecting, Analyzing, and Modeling Expression Data
    Probabilistic Models for Collecting, Analyzing, and Modeling Expression Data Hai-Son Phuoc Le May 2013 CMU-ML-13-101 Probabilistic Models for Collecting, Analyzing, and Modeling Expression Data Hai-Son Phuoc Le May 2013 CMU-ML-13-101 Machine Learning Department School of Computer Science Carnegie Mellon University Thesis Committee Ziv Bar-Joseph, Chair Christopher Langmead Roni Rosenfeld Quaid Morris Submitted in partial fulfillment of the requirements for the Degree of Doctor of Philosophy. Copyright @ 2013 Hai-Son Le This research was sponsored by the National Institutes of Health under grant numbers 5U01HL108642 and 1R01GM085022, the National Science Foundation under grant num- bers DBI0448453 and DBI0965316, and the Pittsburgh Life Sciences Greenhouse. The views and conclusions contained in this document are those of the author and should not be interpreted as representing the official policies, either expressed or implied, of any sponsoring institution, the U.S. government or any other entity. Keywords: genomics, gene expression, gene regulation, microarray, RNA-Seq, transcriptomics, error correction, comparative genomics, regulatory networks, cross-species, expression database, Gene Expression Omnibus, GEO, orthologs, microRNA, target prediction, Dirichlet Process, Indian Buffet Process, hidden Markov model, immune response, cancer. To Mom and Dad. i Abstract Advances in genomics allow researchers to measure the complete set of transcripts in cells. These transcripts include messenger RNAs (which encode for proteins) and microRNAs, short RNAs that play an important regulatory role in cellular networks. While this data is a great resource for reconstructing the activity of networks in cells, it also presents several computational challenges. These challenges include the data collection stage which often results in incomplete and noisy measurement, developing methods to integrate several experiments within and across species, and designing methods that can use this data to map the interactions and networks that are activated in specific conditions.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • FTS (AKTIP) (NM 022476) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC112492 FTS (AKTIP) (NM_022476) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: FTS (AKTIP) (NM_022476) Human Untagged Clone Tag: Tag Free Symbol: AKTIP Synonyms: FT1; FTS Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_022476, the custom clone sequence may differ by one or more nucleotides ATGAACCCTTTCTGGAGCATGTCTACAAGCTCTGTACGCAAACGATCTGAAGGTGAAGAGAAGACATTAA CAGGGGACGTGAAAACCAGTCCTCCACGAACTGCACCAAAGAAACAGCTGCCTTCTATTCCCAAAAATGC TTTGCCCATAACTAAGCCTACATCTCCTGCCCCAGCAGCACAGTCAACAAATGGCACGCATGCGTCCTAT GGACCCTTCTACCTGGAATACTCTCTTCTTGCAGAATTTACCTTGGTTGTGAAGCAGAAGCTACCAGGCG TCTATGTGCAGCCATCTTATCGCTCTGCATTAATGTGGTTTGGAGTAATATTCATACGGCATGGACTTTA CCAAGATGGCGTATTTAAGTTTACAGTTTACATCCCTGATAACTATCCAGATGGTGACTGTCCACGCTTG GTGTTCGATATTCCTGTCTTTCACCCGCTAGTTGATCCCACCTCAGGTGAGCTGGATGTGAAGAGAGCAT TTGCAAAATGGAGGCGGAACCATAATCATATTTGGCAGGTATTAATGTATGCAAGGAGAGTTTTCTACAA GATTGATACAGCAAGCCCCCTGAACCCAGAGGCTGCAGTACTGTATGAAAAAGATATTCAGCTTTTTAAA AGTAAAGTTGTTGACAGTGTTAAGGTGTGCACTGCTCGTTTGTTTGACCAACCTAAAATAGAAGACCCCT ATGCAATTAGCTTTTCTCCATGGAATCCTTCTGTACATGATGAAGCCAGAGAAAAGATGCTGACTCAGAA AAAGCCTGAAGAACAGCACAATAAAAGTGTTCATGTTGCTGGCCTGTCATGGGTAAAGCCTGGCTCAGTA CAGCCTTTCAGTAAAGAAGAGAAAACAGTGGCGACTTAA This product is to be used for laboratory only. Not for
    [Show full text]
  • Genomics of Body Fat Distribution
    Journal of Genetics (2021)100:32 Ó Indian Academy of Sciences https://doi.org/10.1007/s12041-021-01281-7 (0123456789().,-volV)(0123456789().,-volV) REVIEW ARTICLE Genomics of body fat distribution SIMMI SAINI1, GAGANDEEP KAUR WALIA2, MOHINDER PAL SACHDEVA1 and VIPIN GUPTA1* 1Department of Anthropology, University of Delhi, Delhi 110 007, India 2Public Health Foundation of India, Gurugram 122 002, India *For correspondence. E-mail: [email protected]. Received 1 May 2020; revised 10 November 2020; accepted 4 January 2021 Abstract. Central obesity and body fat distribution measured by waist circumference (WC) and waist hip ratio (WHR) are good predictors of cardio metabolic adversities independent of overall adiposity. There are substantial evidence that body fat distribution is controlled by genetic factors. Even after accounting for body mass index (BMI), individual variation in body fat distribution is heritable, with estimates ranging from 31–76%. Individuals genetically predisposed to store more fat in visceral depots are at higher risk of developing metabolic complications. Several linkage and genomewide association studies (GWAS) for measures of body fat distribution uncovered numerous loci harbouring genes potentially regulating body fat distribution. Additionally, genes with fat depot specific expression patterns (especially, subcutaneous adipose tissue (SAT) and visceral adipose tissue (VAT)) have provided plausible candidate genes involved in body fat regulation. Further, sexual dimorphism have revealed a remarkable heterogeneity in the genetic regulation of body fat distribution. More than hundred loci have been identified through GWAS, displaying more pronounced effect in females than males, suggesting that both sexes share potentially different biological architecture in traits related to body fat distribution.
    [Show full text]
  • Aprioritized Panel of Candidate Genes
    In: Advances in Genetics Research. Volume 9 ISBN: 978-1- 62081-466-6 Editor: Kevin V. Urbano © 2012 Nova Science Publishers, Inc No part of this digital document may be reproduced, stored in a retrieval system or transmitted commercially in any form or by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in rendering legal, medical or any other professional services. Chapter 1 A PRIORITIZED PANEL OF CANDIDATE GENES TO BE EXPLORED FOR ASSOCIATIONS WITH THE BLOOD PRESSURE RESPONSE TO EXERCISE Garrett I. Ash,1,Amanda L. Augeri,2John D. Eicher,3 Michael L. Bruneau, Jr.1 and Linda S. Pescatello1 1University of Connecticut, Storrs, CT, US 2Hartford Hospital, Hartford, CT, US 3Yale University School of Medicine, New Haven, CT, US ABSTRACT Introduction. Identifying genetic variants associated with the blood pressure (BP) response to exercise is hindered by the lack of standard criteria for candidate gene selection, underpowered samples, and a limited number of conclusive whole genome studies. We developed a prioritized panel of candidate genetic variants that may increase the likelihood of finding genotype associations with the BP response to exercise when used alone or in conjunction with high throughput genotyping studies. Methods. We searched for candidate genetic variants meeting preestablished criteria using PubMed and published systematic reviews.
    [Show full text]
  • The Relationship Between Selected CNR1, MC4R, LEP, FTO and VDR
    Journal of Clinical Medicine Article The Relationship between Selected CNR1, MC4R, LEP, FTO and VDR Gene Polymorphisms and Several Basic Toxicological Parameters Among Persons Occupationally Exposed to Arsenic, Cadmium and Lead Tomasz Matys 1, Anna Szyma ´nska-Chabowska 1, Katarzyna Bogunia-Kubik 2, Beata Smyk 1, Małgorzata Kami ´nska 2, Grzegorz Mazur 1 , Rafał Por˛eba 1 and Paweł Ga´c 3,* 1 Department of Internal Medicine, Occupational Diseases, Hypertension and Clinical Oncology, Wroclaw Medical University, Borowska 213, PL 50-556 Wroclaw, Poland; [email protected] (T.M.); [email protected] (A.S.-C.); [email protected] (B.S.); [email protected] (G.M.); [email protected] (R.P.) 2 Laboratory of Clinical Immunogenetics and Pharmacogenetics, Hirszfeld Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, Weigla 12, PL 53-114 Wroclaw, Poland; [email protected] (K.B.-K.); [email protected] (M.K.) 3 Department of Hygiene, Wroclaw Medical University, Mikulicza-Radeckiego 7, PL 50-368 Wroclaw, Poland * Correspondence: [email protected]; Tel.: +48-71-784-1502; Fax.: +48-71-784-1503 Received: 24 February 2020; Accepted: 6 April 2020; Published: 7 April 2020 Abstract: The purpose of this work was to assess the influence of selected CNR1, MC4R, LEP, FTO and VDR FOKI gene polymorphisms on blood and urine concentration markers of lead, cadmium and arsenic in a population directly exposed to these metals. Eighty-five people exposed to lead, arsenic and cadmium were qualified to take part in the study. Standard urine samples and 25 mL of venous blood from each worker were collected to assay basic laboratory and toxicological markers as well as selected single nucleotide polymorphisms (SNPs) within CNR1—cannabinoid receptor 1 gene (rs806368, rs806381, rs1049353, rs12720071), MC4R—melanocortin 4 receptor gene (rs17782313), LEP—leptin promoter gene (rs7799039), FTO—alpha-ketoglutarate-dependent dioxygenase gene (rs9939609) and VDR—vitamin D receptor (rs10735810) genes.
    [Show full text]
  • Lack of Association Between Genetic Polymorphism of FTO
    J Pediatr (Rio J). 2016;92(5):521---527 www.jped.com.br ORIGINAL ARTICLE Lack of association between genetic polymorphism of FTO, AKT1 and AKTIP in childhood overweight ଝ and obesity a,1 a,∗,1 Patrícia de Araújo Pereira , António Marcos Alvim-Soares Jr. , d c Valéria Cristina Sandrim , Carla Márcia Moreira Lanna , b b Débora Cristine Souza-Costa , Vanessa de Almeida Belo , a b Jonas Jardim de Paula , José Eduardo Tanus-Santos , a a Marco Aurélio Romano-Silva , Débora Marques de Miranda a Universidade Federal de Minas Gerais (UFMG), INCT de Medicina Molecular, Belo Horizonte, MG, Brazil b Universidade de São Paulo (USP), Faculdade de Medicina de Ribeirão Preto (FMRP), Departamento de Farmacologia, Ribeirão Preto, SP, Brazil c Universidade Federal de Juiz de Fora (UFJF), Instituto de Ciências Biológicas, Departamento de Fisiologia, Juiz de Fora, MG, Brazil d Universidade Estadual Paulista (UNESP), São Paulo, SP, Brazil Received 15 July 2015; accepted 15 December 2015 Available online 21 June 2016 KEYWORDS Abstract Single-nucleotide Objective: Obesity is a chronic disease caused by both environmental and genetic factors. polymorphisms; Epidemiological studies have documented that increased energy intake and sedentary lifestyle, as well as a genetic contribution, are forces behind the obesity epidemic. Knowledge about the Childhood obesity; interaction between genetic and environmental components can facilitate the choice of the Fat mass and obesity associated; most effective and specific measures for the prevention of obesity. The aim of this study was Gene; to assess the association between the FTO, AKT1, and AKTIP genes and childhood obesity and AKT1; insulin resistance. AKTIP Methods: This was a case---control study in which SNPs in the FTO (rs99396096), AKT1, and AKTIP genes were genotyped in groups of controls and obese/overweight children.
    [Show full text]