1 Pontificia Universidad Javeriana Facultad De Ciencias Doctorado En

Pontificia Universidad Javeriana Facultad de Ciencias Doctorado en Ciencias Biológicas

Potencial efecto del medio condicionado de células madre mesenquimales derivadas de tejido adiposo sobre astrocitos humanos en un modelo in vitro de scratch y privación de glucosa

Eliana María Báez Jurado Presentado como requisito parcial para otorgar el título de Doctora en Ciencias Biológicas

Director: George Emilio Sampaio Barreto, Ph.D Co-director (a): Janneth González Santos, Ph.D

Bogotá D.C., Colombia 2018

1 NOTA DE ADVERTENCIA

ARTÍCULO 23, RESOLUCIÓN #13 DE 1946.

“La Universidad no se hace responsable por los conceptos emitidos por sus alumnos en sus trabajos de tesis. Sólo velará porque no se publique nada contrario al dogma y a la moral católica y porque las tesis no contengan ataques personales contra persona alguna, antes bien se vean en ellas el anhelo de buscar la verdad y la justicia”

2 Potencial efecto del medio condicionado de células madre mesenquimales derivadas de tejido adiposo sobre astrocitos humanos en un modelo in vitro de scratch y privación de glucosa

Eliana María Báez Jurado

George Emilio Sampaio Barreto, Ph.D Director

Lisandro Giráldez, Ph.D Silvia Tapia, Ph.D

Liliana Francis Turner, PhD Marisol Lamprea, Ph.D

Franscisco Capani, Ph.D

3 Potencial efecto del medio condicionado de células madre mesenquimales derivadas de tejido adiposo sobre astrocitos humanos en un modelo in vitro de scratch y privación de glucosa

Eliana María Báez Jurado

Concepción Puerta ul Decana Facultad de Ciencias

Bogotá, D.C., 2019

Dedicatoria A mi mamá

Agradecimientos

Agradecimiento a la Vicerrectoría Académica de la Pontificia Universidad Javeriana por confiar en mí y por brindarme la oportunidad de recibir el apoyo financiero para realizar y culminar mi estudio.

Especial agradecimiento a mi Profesor George Barreto, por su exigencia, paciencia, por sus enseñanzas y por el ejemplo que me ha dado en muchos aspectos de mi vida. Profe muchas gracias por la disciplina, por enseñarme y orientarme no sólo en el ámbito académico sino también desde lo personal y para la vida. Por confiar en mí y por brindarme lo que necesitaba para el desarrollo de este proyecto.

Agradecimiento especial a la profesora Janet González, por toda la orientación y enseñanzas y por todas aquellas veces que me animó a seguir luchando a pesar que por momentos la vida se tornará un poco difícil.

Especial agradecimiento a Oscar Alejandro Hidalgo Lanussa, por el apoyo, la paciencia, por estar en los momentos difíciles y por siempre estar pendiente de mis cosas.

A Gina Paola Guio Vega por el apoyo en parte de los ensayos, por el ánimo y por ser mi compañía en momentos cruciales para la culminación de esta etapa.

A Paula Esquinas por el apoyo en el registro y análisis de las imágenes de microscopia electrónica.

A la Fundación Santa Fe, especialmente Adriana Plata por el apoyo en el registro de las fotos para la colocalización de la neuroglobina en los diferentes organelos.

Agradezco a mis compañeros de laboratorio Valeria Garzón, Tain, Felipe, Angélica Pinzón, Adriana, Sara, Juan Henao, Charles, Juan David Patiño, María Paula Lozano, Angélica Rincón, Jairo, Yeimy y Diego por el apoyo, sugerencias y porque de una u otra manera contribuyeron a mi formación académica y personal desde los espacios compartidos.

Agradezco a todos los profesores del programa, a lo largo del doctorado hicieron parte fundamental de mi formación personal y académica.

A mi mamá por toda su fortaleza, compañía, ejemplo y sobretodo paciencia y comprensión durante todos estos años cuando por diferentes circunstancias no me fue posible estar pendiente de ella y acompañarla.

A Dios por la fortaleza y sabiduría que me brindó para terminar esta etapa de mi vida.

A todos los que por olvido no quedaron en ésta lista pero que sin dudar contribuyeron para la finalización de este proyecto, mil gracias.

Tabla de Contenido

ABREVIATURAS ...... 8 RESUMEN ...... 9 INTRODUCCIÓN ...... 11 PLANTEAMIENTO DEL PROBLEMA DE INVESTIGACIÓN Y JUSTIFICACIÓN...... 11 MARCO TEÓRICO ...... 16 2.1. LESIÓN CEREBRAL TRAUMÁTICA COMO UN PROBLEMA DE SALUD PÚBLICA ...... 16 2.2. EL PAPEL DE LA GLUCOSA EN LA FUNCIÓN CEREBRAL FISIOLÓGICA Y PATOLÓGICA ...... 20 2.3. RESPUESTA DE LA CÉLULA A LA PRIVACIÓN DE GLUCOSA ...... 22 2.4. ASTROCITOS Y SU PAPEL EN EL SISTEMA NERVIOSO CENTRAL ...... 24 2.5. ASTROCITOS REACTIVOS Y SU PAPEL EN LA LESIÓN CEREBRAL TRAUMÁTICA ...... 26 2.5. FUNCIÓN Y DISFUNCIÓN MITOCONDRIAL EN ASTROCITOS ...... 27 2.6. CÉLULAS MESENQUIMALES Y SU APLICACIÓN TERAPÉUTICA...... 30 2.7. POTENCIAL NEUROPROTECTOR DE LA NEUROGLOBINA ...... 83 OBJETIVOS ...... 95 3.1. OBJETIVO GENERAL ...... 95 3.2. OBJETIVOS ESPECÍFICOS ...... 95 MATERIALES Y MÉTODOS ...... 95 RESULTADOS ...... 96 CAPÍTULO 1 ...... 97 CAPÍTULO 2 ...... 116 CAPÍTULO 3 ...... 154 DISCUSIÓN GENERAL ...... 172 CONCLUSIONES ...... 178 PUBLICACIONES Y PRESENTACIÓN EN CONGRESOS ...... 180 • LISTA DE PUBLICACIONES ...... 180 • PREMIOS Y DISTINCIONES ...... 181 • PARTICIPACIÓN EN CONGRESOS Y CURSOS INTERNACIONALES ...... 181 • PARTICIPACIÓN EN CONGRESOS Y CURSOS NACIONALES ...... 182 • POSTER Y PRESENTACIONES ORALES ...... 182 ANEXOS ...... 183 BIBLIOGRAFÍA ...... 190

Abreviaturas

AQP4 Aquaporina 4 BDNF Factor neurotrófico derivado del cerebro bFGF Factor de crecimiento de fibroblastos básico BSS0 Solución salina equilibrada CM-hMSCA Medio condicionado de células madre derivadas de adiposo humano CM-MSCBM Medio condicionado de células madre derivadas de médula ósea CM-hMSCAF Medio condicionado de células madre derivadas del líquido amniótico humano CM Medio condicionado EGF Factor de crecimiento epidérmico ELA Esclerosis lateral amiotrófica ERN Especies reactivas de nitrógeno ERO Especies reactivas del oxígeno FGF Factor de crecimiento de fibroblastos GAPDH Gliceraldehído 3-fosfato deshidrogensa GDNF Factor neurotrófico derivado de la glia GFAP Proteína ácida glial fibrilar hDPSCs Células madre de pulpa dental humana HGF Factor de crecimiento de hepatocitos hMSCA Células madre derivadas de tejido adiposo humanas HUCMSC Células madre mesenquimales del cordón umbilical humano HUCPVC Células perivasculares del cordón umbilical humano IGF-1 Factor de crecimiento tipo insulina 1 LCT Lesión cerebral traumática MCP-1 Proteína quimiotáctica de monocitos 1 MSCs Células madre mesenquimáticas Ngb Neuroglobina NGF Factor de crecimiento nervioso PDGF-BB Factor de crecimiento derivado de plaquetas-BB RE Retículo endoplásmico SDF-1 Factor-1 derivado de células estromales SNC Sistema nervioso central SOD2 Superóxido dismutasa mitocondrial VEGF Factor de crecimiento endotelial vascular ΔΨm Potencial de membrana mitocondrial

Resumen

Diferentes patologías y lesiones afectan el normal funcionamiento del sistema nervioso central (SNC). Patologías neurodegenerativas como Parkinson y Alzheimer o aquellas traumáticas como la isquemia, la lesión cerebral o la neuroinflamación representan una alta morbilidad en la población mundial. La mayoría de las lesiones alteran el correcto funcionamiento de las células cerebrales lo que implica la modificación del microambiente, respuestas alteradas o expresión de genes y proteínas frente al insulto. Los astrocitos son las células gliales más abundantes del sistema nervioso, dentro de sus funciones están: brindar un soporte metabólico y estructural a las neuronas, con lo cual contribuyen a su normal funcionamiento. Recientes estudios han evidenciado el papel fundamental que estas células tienen en la protección neuronal sobre todo en las lesiones traumáticas, patologías en las cuales se presentan cambios bioquímicos y moleculares que conllevan a un daño neuronal, seguido por la pérdida de funciones cognitivas y motoras. A pesar de considerar los astrocitos más resistentes que las neuronas a insultos cerebrales, pocos estudios ofrecen una idea de cómo los cambios en las funciones astrocíticas pueden llevar a la pérdida de la protección después de una lesión cerebral. En este punto y conociendo la importancia de los astrocitos, la hipótesis de esta investigación es que el daño mitocondrial causado en los astrocitos durante la lesión cerebral deteriora su funcionamiento y puede contribuir a la pérdida neuronal. Evidencias recientes muestran que el uso del medio condicionado de células madre mesenquimales derivadas de tejido adiposo humano (CM-hMSCA) pueden proporcionar un efecto protector que contrarresta el daño cerebral. Sin embargo, son muy pocos los estudios que han evaluado el efecto del CM-hMSCA en la protección de los astrocitos expuestos a scratch y privación de glucosa como posible alternativa terapéutica o de prevención en la lesión cerebral, así como en otras patologías.

Nuestros resultados indicaron que CM-hMSCA mejoró la viabilidad celular, redujo la fragmentación nuclear, atenuó la producción de especies reactivas de oxígeno (ERO) y preservó el potencial de membrana mitocondrial y los parámetros ultraestructurales. Adicionalmente, se demostró que el CM-hMSCA regula las citocinas IL-2, IL-6, IL-8, IL-10, GM-CSF, TNF-a y también regula negativamente el calcio a nivel citoplásmico y tiene un efecto sobre la regulación de la dinámica mitocondrial y cadena

9 respiratoria. Estas acciones están acompañadas por la regulación de la expresión de diferentes proteínas implicadas en vías de señalización como AKT/pAKT, ERK1/2/pERK, e incluso puede mediar la localización de Neuroglobina (Ngb) a nivel celular. Por otro lado, para caracterizar el mecanismo protector del CM-hMSCA, nuestros resultados revelan un aumento en la expresión de la neuroglobina y el silenciamiento genético de esta proteína reduce la acción protectora de CM-hMSCA en las células lesionadas. Por último, nosotros también realizamos una validación del modelo en astrocitos humanos, encontrando resultados similares en la protección y preservación de los astrocitos por el CM-hMSCA. Nuestros resultados sugieren que el tratamiento con CM-hMSCA podría ser una estrategia terapéutica prometedora para la protección de las células astrocíticas en las patologías cerebrales y que posiblemente la neuroglobina está mediando este efecto protector del CM-hMSCA.

Introducción Planteamiento del problema de investigación y justificación.

El cerebro tiene alrededor de 170 mil millones de células (Azevedo et al., 2009), que consumen en promedio 516 Kcal de energía por día, lo cual representa un 22% del total de la demanda energética de un organismo (Carmody & Wrangham, 2009). Esta demanda energética es requerida para el cumplimiento de funciones esenciales como la transmisión sináptica, la captación y metabolismo de los neurotransmisores y el mantenimiento de los gradientes iónicos (Magistretti & Ransom, 2002). Por lo tanto, es importante mantener en óptimas condiciones el ambiente intra y extracelular, así como los metabolitos requeridos por astrocitos y neuronas, principales células del tejido cerebral.

Al igual que otros tejidos, el tejido cerebral se ve afectado por diferentes patologías. En general, todas las patologías afectan considerablemente el funcionamiento del sistema nervioso central (SNC) pero existen algunas como la isquemia, la lesión cerebral traumática y la lesión de médula espinal, que ocasionan daños graves a nivel neuronal (Caballero Chacón, Sara; Nieto-Sampedro, 2005). En estas patologías ocurre un desbalance por la interrupción del flujo sanguíneo que posteriormente conduce a estrés metabólico, perturbación iónica y una compleja cascada de eventos bioquímicos y moleculares que causan la muerte neuronal (Bramlett & Dietrich, 2004) y una variedad de secuelas post-traumáticas. Es por esto, que tanto a nivel internacional como nacional, las patologías de lesión cerebral y de médula espinal se han considerado problemáticas de salud pública al convertirse en la principal causa de muerte en individuos menores de 45 años y, recurrente en personas jóvenes, adolescentes y de la tercera edad (Caballero Chacón, Sara; Nieto-Sampedro, 2005). Por ejemplo, en 2008 un estudio a nivel nacional reveló que un 70% de los pacientes atendidos presenta traumatismos en cabeza seguida por un 48% con lesiones en extremidades inferiores (Guzmán, Moreno, & Montoya, 2008). Sorprendentemente, esta incidencia se ha mantenido hasta el día de hoy como fue revelado en un estudio comparativo sobre la epidemiología de las lesiones en dos centros de traumas de primer nivel en Colombia en el cual se muestra una mayor incidencia de lesiones de cabeza y cuello cerca de un 18% frente a otras áreas corporales afectadas en los traumatismos (Ramachandran et al., 2017). En términos generales, la problemática de salud pública de este tipo de patologías está enmarcada por las funciones orientación, atención,

11 memoria, lenguaje, lectura y escritura que se ven afectadas, incluso tiempo después de presentarse la patología (Quijano, Cuervo, Aponte, & Arango, 2012).

En los últimos años, el estudio de la lesión cerebral ha tenido gran abordaje, con la necesidad primordial de entender su fisiopatología y así, desarrollar estrategias terapéuticas, enfocadas no sólo a tratar los daños colaterales sino también a prevenirlos o disminuir el grado de afectación. Así que con el tiempo se han desarrollado diferentes modelos experimentales in vivo e in vitro que han permitido avanzar desde diferentes puntos en el conocimiento de esta enfermedad (Prieto et al., 2009). Sin embargo, a pesar de estos avances, el estudio de estas patologías ha sido difícil porque aún no existen modelos experimentales completos y asequibles que permitan el estudio y el análisis de todas las alteraciones celulares, moleculares, morfológicas, cognitivas que se presentan. En primer lugar, están los modelos experimentales in vivo que, aunque proporcionan una representación cercana a la situación clínica de la patología desde el punto de vista anatómico y funcional, son modelos que requieren una alta inversión de recursos, el control de variables en los animales y tiempos más prologados para la obtención de resultados y el avance en el conocimiento de esta patología. En segundo lugar, existen los modelos in vitro que no sólo permiten probar con mayor rapidez los agentes terapéuticos (LaPlaca, Simon, Prado, & Cullen, 2007), sino también estudiar en detalle las alteraciones y respuestas celulares de manera individual, bajo parámetros específicos. Además, se facilita el control de variables, del medio ambiente extracelular y de eliminar factores de confusión que se pueden generar como la hipoxia o isquemia en modelos in vivo (Morrison, Saatman, Meaney, & Mcintosh, 1998), además del poco espacio y los bajos costos que genera su mantenimiento.

Es preciso resaltar que en la mayoría de modelos para el estudio de la fisiopatología de la lesión cerebral están enfocados en analizar y preservar la integridad neuronal porque son células que suelen ser afectadas en mayor medida durante las lesiones. Además, es común olvidar que gran parte del funcionamiento y bienestar de las neuronas está dado principalmente por los astrocitos y, que la protección y preservación de los mismos puede dar lugar a una neuroprotección (Tuttolomondo et al., 2009; Y. Wang et al., 2018). Los astrocitos cumplen funciones esenciales como sistemas antioxidantes, contribuyen a disminuir la excitotoxicidad, en la regulación de iones y el establecimiento de la barrera hematoencefálica

12 para el paso de nutrientes, entre otras funciones importantes para el correcto funcionamiento cerebral (Kimelberg, 2010). En condiciones patológicas, los astrocitos contribuyen a la formación de cicatrices a lo largo del área dañada, adquieren morfología reactiva y muestran una variedad de cambios funcionales, en parte para proteger el tejido (Eddleston & Mucke, 1993; Norenberg, 1994; Ridet, Malhotra, Privat, & Gage, 1997). Sin embargo, muchos de estos cambios, alteraciones en la morfología, en la expresión de genes, en la capacidad antioxidante, en la migración y en el apoyo a la supervivencia celular de los astrocitos frente a una lesión cerebral, son poco conocidos.

Diversas estrategias terapéuticas para el tratamiento o prevención de lesiones secundarias enmarcadas en las lesiones cerebrales han sido exploradas. Estos avances van desde craniectomía descompresiva (Sahuquillo, 2006), moderada hipotermia (Marion et al., 1997) y hasta manejo farmacológico como metilfenidato (Warden et al., 2006); sin embargo, en muchos de estos casos aún no han sido completamente efectivos o su efecto no es suficiente ni se mantiene en los daños y secuelas de esta patología. En la actualidad, las células madre mesenquimales (por sus siglas en inglés, MSC) comprenden una población diversa de progenitores multipotentes capaces de diferenciarse en diferentes linajes, que las convierte en candidatas para desarrollar nuevas estrategias terapéuticas basadas en células en una variedad de tejidos funcionales, que a menudo se ven afectados por diferentes enfermedades y lesiones (Gardner, Alini, & Stoddart, 2015; Mahmoudifar & Doran, 2015; Phelps, Sanati-Nezhad, Ungrin, Duncan, & Sen, 2018). Recientemente, se han analizado muchas fuentes de las que pueden ser aisladas, como por ejemplo, médula ósea, sangre del cordón, músculo, hueso, cartílago o tejido adiposo, que indican una amplia variedad funcional (Guadix, Zugaza, & Gálvez-Martín, 2017; Schäffler & Büchler, 2007).

Teniendo en cuenta lo anterior se han realizado esfuerzos para estudiar y aplicar terapia regenerativa de MSCs en algunas enfermedades y patologías respiratorias, hematopoyéticas, diabetes (Chagastelles, Nardi, & Camassola, 2010; Zheng et al., 2014), así como otras patologías que afectan drásticamente el SNC como la lesión traumática, stroke, lesión de medula espinal, entre otras (DiNunzio & Williams, 2008; Organization, 2006; Shoichet, Tate, Baumann, & LaPlaca, 2008). Este creciente interés se basa en la adquisición de conocimiento para comprender las señales que rigen la función de las MSC para el tratamiento,

13 especialmente de tejidos sin capacidades de regeneración (Kyryachenko et al., 2016). No obstante, aún no es claro el mecanismo a través del cual las MSC ejercen su efecto y recientemente se cree que el efecto es más por la acción de moléculas y factores paracrinos solubles que estas células producen y liberan a su ambiente extracelular (Phan et al., 2018; Shologu, Scully, Laffey, & O’Toole, 2018; Venugopal et al., 2018).

Estudios realizados en torno a las MSC han revelado un secretoma completo conformado por diversidad de moléculas con funciones que van desde un efecto anti-apoptótico (Y.-X. Chen et al., 2015), anti-inflamatorio (Zagoura et al., 2012), en la reparación de tejidos y cierre de las heridas (Toma, Pittenger, Cahill, Byrne, & Kessler, 2002), con efecto antimicrobiano (Vizoso, Eiro, Cid, Schneider, & Perez-Fernandez, 2017). También se han encontrado otros factores como VEGF, bFGF, EGF (Kilroy et al., 2007; Linero & Chaparro, 2014), BDNF, NGF (Hao et al., 2014; Kupcova Skalnikova, 2013), IGF-1 (Wei et al., 2009) y GDNF (Kupcova Skalnikova, 2013), los cuales tienen un efecto protector específicamente sobre el tejido cerebral (Cirillo et al., 2011; Deng et al., 2011). Así, con el uso de los factores y moléculas bioactivas producidas por las MSC se minimiza al máximo efectos adversos que han generado preocupación en el campo de la medicina regenerativa con terapia celular, como son la capacidad de las MSC para promover el crecimiento tumoral y la metástasis (Volarevic et al., 2018). Además, las MSC administradas sistémicamente se pueden reclutar y migrar hacia los tumores (H.-Y. Lee & Hong, 2017; Ridge, Sullivan, & Glynn, 2017; Yagi & Kitagawa, 2013) e incluso que células trasplantadas no pueden llegar a funcionar normalmente en los órganos o pueden presentar un rechazo inmunológico (Park, Lerou, Zhao, Huo, & Daley, 2008; Tani, 2015).

Tomando en conjunto todo lo anterior, para el caso particular de esta investigación, se eligió trabajar con un modelo in vitro de células astrocíticas (T98G) sujetas a scratch y privación de glucosa, así como la validación del modelo en astrocitos humanos. Esta investigación se enfocó en la búsqueda de nuevas alternativas de protección astrocitaria utilizando los factores y moléculas bioactivas producidas y secretadas por las MSC, que para esta investigación se reconoce como el medio condicionado de células madre derivadas de tejido adiposo humano (CM-hMSCA). Igualmente, se aportó nuevo conocimiento sobre los mecanismos de protección brindados por el CM-hMSCA para los astrocitos, de tal forma que a futuro se

14 potencie el diseño de estrategias terapéuticas que reduzcan el daño mitocondrial, la supervivencia y funcionamiento integral de los astrocitos en patologías relacionadas con fallos metabólicos como isquemias y daño mecánico como la lesión cerebral traumática.

Marco Teórico

2.1. Lesión cerebral traumática como un problema de salud pública

En 2018 se reportó que cada año aproximadamente 5,48 millones de personas sufren lesiones cerebrales traumáticas graves y la Organización Mundial de la Salud estima que un 90% de las muertes por este tipo de lesión ocurren en países de ingresos bajos y medios (Andreev et al., 2015). Sin embargo, un estudio reportado por Bonow, RH y colaboradores (2018) reportó que la lesión cerebral traumática está afectando desproporcionadamente a los países de ingresos bajos y medios con una mortalidad alta en América Latina, pero en los casos de posible recuperación se encontró que ocurre favorablemente y de forma similar a la de los países de ingresos altos (Bonow et al., 2018). No obstante, el estudio epidemiológico de la lesión cerebral a nivel mundial ha sido difícil debido a falta de estandarización de los estudios internacionales (Petgrave-Pérez et al., 2016). Por ejemplo, un estudio reporta que los accidentes automovilísticos con un 45,8% son la principal causa de lesión cerebral traumática afectando frecuentemente pacientes entre 24 a 45 años (Petgrave-Pérez et al., 2016); sin embargo, esta información está en controversia con lo reportado en otro análisis epidemiológico realizado por Chicote Á. y colaboradores (2018) en el cual se encontró que el porcentaje de lesión traumática cerebral debido a accidentes de tráfico disminuyó de un 26 a un 4% en los últimos 25 años a diferencia de un aumento del 70% en las lesiones causadas por caídas desde su propia altura que afecta sobre todo a pacientes de edad avanzada mayores de 65 años (Chicote Álvarez et al., 2018). A pesar de las controversias en los estudios epidemiológicos de esta patología queda claro que la lesión cerebral traumática está afectando un gran porcentaje de la población a nivel mundial y no sólo causando la muerte, sino también ocasionando secuelas y daños a nivel cognitivo, motor que conllevan a un deterioro a nivel emocional y social (Gil, Gómez, & Gómez, 2008).

En la lesión cerebral traumática ocurre una mortalidad y secuelas graves que se relacionan en gran medida por la complejidad del tejido lesionado, por el daño celular así como por el desbalance de iones y moléculas que se presenta, entre otras alteraciones que afectan por completo la fisiología cerebral (Faul & Coronado, 2015; Risdall & Menon, 2011). El proceso fisiopatológico de la lesión cerebral traumática se enmarca en dos fases: la primera fase que

16 ocurre en el momento del impacto, no es reversible y es considerada como la lesión primaria (Estrada-Rojo et al., 2018). En la segunda fase, que junto con un deterioro cerebrovascular, ocasiona la disminución del flujo sanguíneo que conlleva al aumento de ERO y a una disminución en los niveles de glucosa y oxígeno (Gil et al., 2008).

En la lesión primaria, debido al daño mecánico que sucede en el tejido por el impacto, penetración o movimiento rápido del cerebro dentro del cráneo (Prins, Greco, Alexander, & Giza, 2013a) ocurre una pérdida de la conexión neuronal, vital para la transmisión del impulso nervioso, que se convierte en la principal causa de deterioro funcional del tejido cerebral (Estrada-Rojo et al., 2018; Prins et al., 2013a). Por su parte, en la lesión secundaria se presentan una serie de cambios estructurales, celulares y moleculares que no sólo provocan daño neuronal, sino también afectan otras células como los astrocitos, que son primordiales para mantener la homeostasis cerebral y evitar la muerte neuronal por excitotoxicidad (Corps, Roth, & McGavern, 2015; Levin & Diaz-Arrastia, 2015; Rodriguez-Rodriguez, Jose Egea- Guerrero, Murillo-Cabezas, & Carrillo-Vico, 2014). Los cambios y alteraciones que se presentan en el tejido durante una lesión cerebral traumática están asociados a cambios neuroquímicos, cambios en el metabolismo de la glucosa, crisis energética, radicales libres y un papel fundamental de las mitocondrias. Por un lado, los cambios neuroquímicos están directamente asociados a la liberación de neurotrasmisores excitatorios como glutamato (Corps et al., 2015), y la presencia del glutamato en el espacio presináptico causa un desequilibrio iónico empezando por un aumento de potasio (K+) y cuyos niveles cambian de acuerdo a la gravedad de la lesión (Katayama, Becker, Tamura, & Hovda, 1990; Kawamata, Katayama, Hovda, Yoshino, & Becker, 1992b). Asimismo es evidente un aumento en la concentración de Ca2+ intracelular (Osteen, Moore, Prins, & Hovda, 2001), y los cambios en los niveles de este ion están asociados a déficits cognitivos (Deshpande et al., 2008; Osteen et al., 2001).

Con la perdida de flujo sanguíneo se presenta deficiencia de nutrientes y oxígeno, sustratos vitales para el metabolismo cerebral (Estrada-Rojo et al., 2018; Prins et al., 2013a). Estudios revelan que hay una depresión metabólica que depende de la gravedad de la lesión (Yoshino, Hovda, Kawamata, Katayama, & Becker, 1991) y es causada por ausencia del sustrato principal como la glucosa. La glucosa puede estar disminuida en la lesión cerebral traumática

17 por diferentes factores como son el daño en los transportadores de glucosa, daño en los capilares sanguíneos por ruptura o simplemente porque los niveles de glucosa se encuentran disminuidos a nivel sistémico (Prins et al., 2013a). Además existen estudios que evidencian que el fallo metabólico afecta considerablemente muchas funciones dependendientes de energía lo cual trae consigo efectos negativos posteriores, sobre todo cuando la recuperación recuperación de los niveles de glucosa ocurre sobre los 3 o 5 días luego de sufrir la lesión (Prins et al., 2013a).

Entre los efectos negativos posteriores está la aparición de una crisis energética. Esta crisis tiene varios factores como son: a) el daño de la lesión traumática cerebral puede afectar considerablemente la disminución del NAD+ (Satchell et al., 2003; Vagnozzi et al., 1999); b) pueden darse cambios en el metabolismo, por ejemplo, se evidenció que después del trauma el metabolismo de la glucosa se dirige a la vía pentosas fosfato para la recuperación de ácidos nucleicos (Bartnik et al., 2005); c) aumenta la actividad de la enzima reparadora de ADN (Prins et al., 2013a) y d) se ve afectada la entrada de carbonos provenientes de la glucólisis por la fosforilación del complejo piruvato deshidrogenasa (Xing, Ren, Watson, O’Neil, & Verma, 2009). Por otro lado, la crisis energética afecta también la disponibilidad de equivalentes - reductores y la producción de O2 aumenta. En este sentido, un aumento en la producción de ERO junto con un aumento en los niveles de Ca2+ constante, conlleva a un deterioro mitocondrial afectando el potencial de membrana mitocondrial y en términos generales afecta también la función mitocondrial (Brennan et al., 2009; Vergun, Keelan, Khodorov, & Duchen, 1999). Estos cambios alteran la supervivencia de una gran variedad de células nerviosas y la búsqueda de estrategias y mecanismos que contribuyan a prevenir el progreso de la lesión secundaria o apoyar la recuperación de la fisiología y funcionalidad celular tras una lesión cerebral traumática se ha convertido en el objeto de estudio de muchas investigaciones. Como posible tratamiento para esta patología ha sido evaluado en un ensayo clínico aleatorizado Fase I el antioxidante N-acetilcisteína combinado con un adyuvante probenecid sin presentar reacciones adversas para el tratamiento de la lesión traumática grave en niños (Clark et al., 2017). Además, se ha observado que la atorvastatina, que fue más efectiva en la reducción de la expansión de la contusión, está asociada a mejores resultados funcionales a los tres (3) meses después de la lesión cerebral de moderada a grave (Farzanegan, Derakhshan, Khalili, Ghaffarpasand, & Paydar, 2017).

También han sido evaluados otros tratamientos en los cuales el control de la temperatura junto con un manejo farmacológico puede ser una opción terapéutica (Farzanegan et al., 2017) o que la efectividad del tratamiento depende de una interacción entre dos tratamientos. Estudios llevados a cabo por Szczygielski y colaboradores sugieren que la aquaporina (AQP4) está involucrada en las primeras etapas de la formación del edema cerebral y que el cambio en la respuesta que el tejido tenga a una craneotomía descompresiva puede estar relacionado con la actividad de la AQP4 (Szczygielski et al., 2018), asimismo se ha evaluado una mezcla de 3% de solución salina hipertónica y un 20% de manitol que por lo menos no aumenta el riesgo de nuevas hemorragias intracraneales (H. Wang, Cao, Zhang, Ge, & Bie, 2017). Por el lado de la autofagia, estudios recientes han revelado que la inducción farmacológica de autofagia en modelos de lesión cerebral traumática in vivo puede jugar un papel neuroprotector (Sarkar et al., 2014). Esto se correlaciona en ensayos in vivo para el estudio de patologías isquémicas donde se encontró que cuando se bloquea la autofagia las neuronas pasan a un estado apoptótico o necrótico a diferencia que cuando se induce autofagia las células se pueden recuperar (Balduini, Carloni, & Buonocore, 2009). Recientemente, incluso se ha estudiado la utilidad pronóstica de perfiles de miRNA que pueden llegar a ser usados para determinar el tipo y la gravedad de las lesiones e incluso los miRNA pueden constituir terapias neurorestaurativas innovadoras (Regner, Meirelles, Ikuta, Cecchini, & Simon, 2018). Todo el avance en los tratamientos realizado hasta ahora en este campo, se convierte en un aspecto fundamental no sólo para reducir el impacto, sino también facilitar la recuperación del tejido nervioso. Aunque muchos de estos estudios aún no han sido llevados a la fase clínica, otros tantos tienen controversias porque el efecto protector que puede tener sobre el tejido depende del área lesionada, y de la etapa en la cual se aplique el tratamiento. Es decir, algunos son efectivos en las primeras etapas, otros causan la muerte cuando son suministrados en etapas posteriores y también puede influir la condición de salud de los pacientes porque es mucho más compleja la recuperación de pacientes con diabetes, Parkinson entre otras enfermedades que en pacientes completamente sanos.

2.2. El papel de la glucosa en la función cerebral fisiológica y patológica

Para el cerebro de los mamíferos, la glucosa es el principal recurso energético y su regulación proporciona un ambiente fisiológico para su funcionamiento. En los seres humanos, el cerebro representa sólo un 2% de la masa corporal pero consume alrededor del 20% de energía derivada de la glucosa, convirtiéndose así en el sustrato fundamental para la obtención de energía (Harris, Jolivet, & Attwell, 2012; Philipp Mergenthaler, Lindauer, Dienel, & Meisel, 2013). Por tal razón, metabólicamente la glucosa tiene diversas implicaciones entre las cuales están proporcionar los precursores para la síntesis de neurotransmisores (Dienel, 2012), favorecer las demandas de energía básicas de las células cerebrales, el mantenimiento de gradientes iónicos y el potencial de reposo neuronal (Ivannikov, Sugimori, & Llinás, 2010).

Algunos estudios han revelado que la glucosa no puede ser sustituida como fuente de energía, simplemente se puede complementar en casos especiales de inanición por los cuerpos cetónicos (Lutas & Yellen, 2013) y en el caso del ejercicio prolongado con los niveles de lactato elevados (Suzuki et al., 2011). Además, se sabe que un metabolismo alterado de la glucosa está involucrado en enfermedades como diabetes y Alzheimer, en las cuales los pacientes presentan cambios en la expresión y función de los transportadores de glucosa en el cerebro que a su vez conlleva a cambios en los niveles de glucosa, generando la fisiopatología que identifica estas enfermedades (Shah, DeSilva, & Abbruscato, 2012). Otros estudios han revelado que inyecciones sistémicas de glucosa favorecen el aprendizaje y la memoria y en cuanto al aprendizaje, se encontró que la regulación de acetilcolina potencia el aprendizaje en ratas (Korol & Gold, 1998). Por otro lado, en lo relacionado con la memoria algunos estudios revelan que cambios en la fisiología de la glucosa tanto periférica como central contribuye a alteraciones en la memoria relacionadas con la edad (Paul E. Gold, 2005) o que pacientes con Alzheimer y Síndrome de Down presentan mejora en las funciones cognitivas tras el aumento en los niveles de glucosa en la circulación (P E Gold, 1995).

Tomando en contexto lo anterior, existen otras patologías como la lesión cerebral traumática o isquémica en las cuales ocurre la interrupción del flujo sanguíneo en el tejido cerebral, que afecta considerablemente el desempeño cognitivo y motor de los pacientes debido a la falta de

20 nutrientes y oxígeno (Jha, Kochanek, & Simard, 2018; Sulhan, Lyon, Shapiro, & Huang, 2018). Particularmente, en este tipo de patologías la glucosa se relaciona directamente con vías de muerte celular. La relación con la muerte celular que se tiene en estas patologías, parte del conocimiento que el cerebro es el órgano con mayor requerimiento energético y depende del suministro adecuado y constante de glucosa desde la sangre para cumplir con sus funciones. Sin embargo, en patologías como la lesión cerebral e isquemias severas, este transporte y suministro se ve perturbado (Magnoni et al., 2012), presentándose un agotamiento de la glucosa en el espacio extracelular asociado comúnmente con la pérdida de flujo sanguíneo y el aumento de la glucólisis anaerobia.

Existen otras respuestas patofisiológicas que son características tanto de la lesión cerebral como de la liberación de neurotransmisores excitatorios como el glutamato. Entre las cuales están, en primer lugar, la generación de una hiperglicólisis (Kawamata, Katayama, Hovda, Yoshino, & Becker, 1992a) que conlleva posteriormente acidosis láctica, alteraciones electrolíticas e inflamación (Musen et al., 2012; Shi et al., 2016). En segundo lugar, se presenta que en este tipo de pacientes los niveles de glucosa cerebral parecen estar estrechamente relacionados con las concentraciones sistémicas de glucosa aunque también puede ocurrir que se utilice la glucosa presente en los tejidos (Schlenk, Nagel, Graetz, & Sarrafzadeh, 2008) o que se active el metabolismo energético del cerebro con la cooperación entre astrocitos y neuronas dentro de un contexto del metabolismo del glucógeno (Falkowska et al., 2015). De acuerdo a lo anterior y, dada la importancia de la glucosa para el normal funcionamiento cerebral, se han adelantado estudios acerca del metabolismo energético, pero aspectos como el consumo del sustrato, la utilización por el tejido cerebral y la dificultad en monitorizar en clínica y cuidar la disminución de los niveles de glucosa en pacientes con lesiones (Magnoni et al., 2012) aún siguen siendo controvertidos y poco claros.

2.3. Respuesta de la célula a la privación de glucosa

Como se mencionó anteriormente tanto la privación de glucosa como la falta de oxígeno son factores que contribuyen al deterioro y muerte celular, debido principalmente al agotamiento energético y al aumento del estrés oxidativo (Gerónimo-Olvera, Montiel, Rincon- Heredia, Castro-Obregón, & Massieu, 2017; Mavroeidi et al., 2017). Por otro lado, la ausencia o disminución de estos metabolitos es una característica representativa de enfermedades tales como la isquemia y la lesión cerebral traumática (Vavilis et al., 2015) y, particularmente, la glucosa se ha considerado como uno de los factores limitantes para la recuperación o la efectividad de tratamientos evaluados para estas patologías cerebrales.

Según King & Gottlieb en 2009, el metabolismo de la glucosa está evolutivamente vinculado a la regulación de muerte celular (King & Gottlieb, 2009). Es conocido que enzimas glucolíticas pueden regular la muerte celular neuronal de una manera dependiente del contexto, ejerciendo efectos que pueden ser pro o anti-apoptóticos. Entre las enzimas reconocidas con este papel están la hexoquinasa II, que ha sido reportada por actuar como un interruptor de supervivencia neuronal en estados metabólicos específicos (P Mergenthaler et al., 2012) y dependiendo si está unido o no a mitocondrias o a la interacción molecular con otras proteínas como la PEA15/PED (fosfoproteína enriquecida en astrocitos/fosfoproteína enriquecida en diabetes) (P. Mergenthaler et al., 2012). Otra de las enzimas es la gliceraldehído 3-fosfato deshidrogensa (GAPDH) que tiene la propiedad de inhibir la muerte celular bajo ciertas condiciones o promover la apoptosis neuronal después de que ocurre el daño en el ADN (Colell et al., 2007). En términos generales, se sabe que el metabolismo de la glucosa está estrechamente relacionado con la fisiología y función cerebral y un desequilibrio entre el consumo y la oferta de recursos energéticos trae consigo una variedad de consecuencias y secuelas que pueden ser visibles a corto, mediano y largo plazo.

Son varios los cambios y daño celular que se presenta a nivel del tejido cerebral frente a condiciones libres de glucosa y oxígeno. Por ejemplo, se ha encontrado que las células que crecen en un medio libre de glucosa muestran una disminución gradual de la viabilidad celular durante el tratamiento de re-oxigenación usado para la lesión cerebral o isquemias (Alluri, Anasooya Shaji, Davis, & Tharakan, 2015; Gao et al., 2015; Singh et al., 2009). Por otro lado,

22 bajo condiciones de estrés, como disminución de metabolitos y excitotoxicidad, se activan proteínas reguladas por glucosa como las GRP78, GRP75 y proteínas de choque térmico como la HSC70 involucradas en la preservación de la actividad respiratoria, el potencial de membrana mitocondrial, el mantenimiento homeostático del Ca2+ y la protección de la muerte celular por necrosis y apoptosis (Ouyang, Xu, Emery, Lee, & Giffard, 2011). Asimismo, otros estudios han revelado que las células que sufren hipoxia tienen respuesta a proteínas mal plegadas (por su sigla en inglés UPR) (Vavilis et al., 2016) y que un mal plegamiento de proteínas y estrés del retículo endoplásmico (RE) posteriormente, puede ocasionar otro tipo de patologías asociadas de tipo neurodegenerativo como Parkinson, Alzheimer y esclerosis lateral amiotrófica (ELA) (Vavilis et al., 2015).

En patologías como la lesión cerebral traumática y episodios isquémicos, las células cerebrales presentan diferentes respuestas a la ausencia de glucosa y oxígeno. Una de estas respuestas está relacionada con la liberación excesiva de neurotransmisores y la elevación en las concentraciones de [Ca2+] (F. Liu, Lu, Manaenko, Tang, & Hu, 2018; Takano, Oberheim, Cotrina, & Nedergaard, 2009), así como la liberación de citocromo c y la activación de caspasas (Kim, Han, Gallan, & Hayes, 2017; Sullivan, Keller, Bussen, & Scheff, 2002). Por consiguiente, al presentarse un aumento de [Ca2+] a nivel intracelular ocurre una compensación en otros organelos como la mitocondria. Sin embargo, la captación de [Ca2+] mitocondrial puede generar otras respuestas como un estímulo la producción de ERO, la liberación de citocromo c, la inhibición respiratoria, la liberación de nucleótidos de piridina y la pérdida de glutatión intramitocondrial necesaria para la desintoxicación de peróxidos (Starkov, Chinopoulos, & Fiskum, 2004).

Particularmente, los astrocitos tienen la función de liberar el Ca2+ intracelular, que en condiciones fisiológicas le permiten al tejido nervioso mantener coordinada y sincronizada la transmisión sináptica (R. Jiang, Diaz-Castro, Looger, & Khakh, 2016; Mola et al., 2016). No obstante, en estudios realizados en astrocitos isquémicos, se encontró un aumento de los niveles de Ca2+ en el RE durante la privación de glucosa y oxígeno con la liberación abrupta de este ion durante los 90 y 160 min de re-oxigenación. Además, se evidencia la perdida en la homeostasis de Ca2+ a nivel citoplasmático así como el incremento de Ca2+ mitocondrial y la liberación mitocondrial y translocación en RE del citocromo c mediada por IP3R relacionado

23 con muerte celular apoptótica (Y. Liu et al., 2010). Con lo anterior, no sólo se hace evidente que la señalización de Ca2+ dada en RE y también la disfunción mitocondrial juegan un papel fundamental en el daño astrocitario después de una lesión cerebral. Por otra parte, a nivel neuronal también ha sido reportado que bajo condiciones de privación de glucosa y oxígeno es evidente un estrés en la bioenergética celular y función mitocondrial, así como una alteración en la respuesta inmediata de expresión de genes, indiscutible por reportarse una alteración significativa sobre la quinta parte de los genes expresados luego de transcurridos 20 min de ausencia de glucosa y oxígeno (Andreev et al., 2015).

Teniendo en cuenta lo anterior, un fallo energético no solamente causa una afectación a nivel neuronal, sino que también la función neuroprotectora de otras células como los astrocitos se ve afectada, así como su viabilidad en diferentes patologías y alteraciones fisiológicas del SNC. Por lo tanto, es importante impulsar el conocimiento de las funciones que tienen los astrocitos en condiciones normales, además de reconocer la respuesta que tienen frente a múltiples trastornos del cerebro. Con esto, se estimula el desarrollo de estrategias terapéuticas o posibles tratamientos, así como de investigaciones acerca del papel del metabolismo energético, el papel de la glucosa y la implicación que tiene un metabolismo defectuoso en enfermedades del SNC (Herrero-Mendez et al., 2009).

2.4. Astrocitos y su papel en el sistema nervioso central

Los astrocitos son células consideradas de soporte estructural y metabólico para el tejido cerebral (Maragakis & Rothstein, 2006). Estas células cumplen funciones importantes dentro del tejido nervioso. Entre las funciones más conocidas están: propiedades electrofisiológicas, acoplamiento intercelular a través de canales GAP Junction, reciclaje de neurotransmisores, señalización de calcio, gliotransmisión (Ricci, Volpi, Pasquali, Petrozzi, & Siciliano, 2009; Steele & Robinson, 2012). Con relación a propiedades electrofisiológicas de los astrocitos se ha reportado específicamente que los astrocitos humanos tienen un potencial de membrana de entre −63.9 mV a −70 mV y una resistencia de la membrana que es altamente aumentada en comparación con los astrocitos de roedores (288MΩ vs. ~4–20MΩ), probablemente relacionado con una adaptación evolutiva al tamaño (Dallérac, Chever, & Rouach, 2013). Por su parte, con relación a un acoplamiento intercelular a través de las GAP

24 junction, permite el paso de iones, neuromoduladores, metabolitos que median una señalización en red fundamental para los procesos neuronales (Pannasch & Rouach, 2013).

A nivel metabólico los astrocitos son los responsables de múltiples funciones. Dentro de éstas incluye la captación de glucosa, porque además de contar con una estructura celular única que les permite no solo percibir cualquier cambio en el entorno y responder dinámicamente a los cambios extracelulares también pueden responder o contribuir a requerimientos metabólicos, proporcionando fuentes de energía a partir de la glucosa captada desde el flujo sanguíneo (Bélanger, Allaman, & Magistretti, 2011). Los astrocitos también tienen otras funciones que son consideradas neuroprotectoras porque producen y liberan lactato que es importante para las neuronas (Dringen & Hirrlinger, 2003) y también convierten el glutamato, el principal neurotransmisor excitatorio, en glutamina para la función neuronal (M.-C. Lee, Yasuda, & Ehlers, 2010). Esta propiedad se cumple por la presencia específica de los transportadores EAAT1 y EAAT2 y se encuentran en la membrana plasmática de los astrocitos y células Bergman (cerebelo) (Medina-Ceja, Guerrero-cazares, Canales-aguirre, Morales-Villagrán, & Feria-Velasco, 2007). Además, el EAAT2 (GLT1) actúa con el 90% de la captación glutamato, ya que se encuentra en los pies de los astrocitos que hacen contacto directo con las sinápsis (Haugeto et al., 1996).

Otras de las funciones que cumplen los astrocitos tienen que ver con la reserva energética para el tejido al sintetizar y almacenar glucógeno en el compartimento celular (Pellerin & Magistretti, 2012). Además, estas células cuentan con sistemas antioxidantes especiales entre los cuales están la glutatión peroxidasa, la hemo oxigenasa I y la catalasa, enzimas encargadas de desintoxicar el tejido nervioso de las ERO (Bélanger & Magistretti, 2009; Shih et al., 2003). Asimismo, se han reportado los astrocitos como las células que apoyan considerablemente la manutención de la barrera hematoencefálica (Schousboe & Waagepetersen, 2006) y la producción de factores de crecimiento (Y. Chen & Swanson, 2003). En conjunto estas funciones son consideradas esenciales para el mantenimiento funcional del sistema nervioso central y para su reparación durante los episodios de lesión o injuria.

2.5. Astrocitos reactivos y su papel en la lesión cerebral traumática

Frente a un insulto o lesión patológica, los astrocitos adoptan un fenotipo metabólico reactivo. Esta propiedad es reconocida como un efecto benéfico de este tipo de células para la preservación del tejido neural (Myer, 2006). Morfológicamente, la reactividad astrocitaria se traduce en la formación de una cicatriz glial, que bajo diversas condiciones se convierte en un mecanismo para restringir la inflamación focal moderada (Barreto, White, Xu, Palm, & Giffard, 2012; Dugan & Kim-Han, 2004b). No obstante, si la condición de reactividad se mantiene y se generaliza en el tejido, esto puede llegar a ser contraproducente porque el esfuerzo de los astrocitos está dirigido únicamente a funciones defensivas y de reparación sin proporcionar un adecuado soporte metabólico para las neuronas (Steele & Robinson, 2012). Además, simplemente porque en determinadas condiciones, la cicatriz glial puede resultar en una estructura que compromete la comunicación neuronal (Anderson et al., 2016). Por otro lado, la formación de astrogliosis reactiva se conoce como el proceso que muestra un tejido enfermo o con algún grado de deterioro dentro del sistema nervioso central. La astrogliosis abarca cuatro características fundamentales: 1- Cambios moleculares, celulares y funcionales; 2- Los cambios varían de acuerdo a la gravedad del daño y el perjuicio de la lesión sobre el sistema; 3- Los cambios son regulados al contexto específico de moléculas de señalización inter e intracelular y 4- la astrogliosis puede alterar actividades de astrocitos con ganancia o pérdida de funciones que a su vez pueden llevar a favorecer o perjudicar las células neuronales y no neuronales que las rodean (Sofroniew & Vinters, 2010).

En gran medida los cambios reactivos que sufren los astrocitos durante la astrogliosis están relacionados con la disminución del ATP. Para el caso de la lesión cerebral traumática, la disminución en los niveles de ATP se presenta por dos aspectos fundamentales: el primero relacionado con la disminución del flujo sanguíneo cerebral al rango de 100 g-1 (5-8.5 ml min-1) lo cual conduce a daño irreversible en los tejidos por la escasa cantidad de glucosa y oxigeno disponible (Werner & Engelhard, 2007); por otro lado, el aumento en el calcio intracelular conlleva a elevar los niveles de calcio mitocondrial (Prins, Greco, Alexander, & Giza, 2013b), causando a nivel mitocondrial daños irreversibles. En este sentido, cuando ocurren cambios en el ambiente celular y un desequilibrio iónico se producen daños en las membranas celulares (LaPlaca, Prado, Kacy Cullen, & Simon, 2009), que afectan a las

26 uniones comunicantes de los astrocitos. En ese sentido, las GAP junction de los astrocitos formadas por conexinas 30 y 43, pueden permanecer abiertas después de una lesión cerebral (Ohsumi et al., 2010) y permitir el ingreso de factores pro-apoptóticos que agravan la lesión celular (Lin et al., 1998). Sin embargo, este mecanismo de captación y transporte de glutamato se ve afectado en patologías cerebrales en las cuales el aumento en los niveles de glutamato en el espacio extracelular, se convierte en el causante de excitotoxidad y por ende con el aumento en la gravedad de la lesión cerebral (Yi & Hazell, 2006).

Con todo lo anterior y, teniendo en cuenta que estas células pueden llegar a disminuir la inflamación y proporcionar la protección de neuronas y oligodendrocitos (Sofroniew & Vinters, 2010), los convierte en una esperanza como dianas terapéuticas potenciales para neuroprotección que ayudarán a conservar el entorno favorable para la protección, la disminución de la degeneración del tejido y la preservación de las funciones del sistema nervioso central después de una lesión. Recientemente, son muchos los estudios que han surgido, tanto in vivo como in vitro, para el estudio de los astrocitos, así como para probar estrategias terapéuticas que promuevan su supervivencia y por ende una neuroprotección. Dentro de estos modelos están tanto las células primarias de astrocitos humanos como los modelos astrocitarios como las células T98G. Las T98G (ATCC CRL-1690) son una línea celular humana positiva para GFAP (Avila-Rodriguez et al., 2016). Esta línea se ha utilizado y validado ampliamente como modelo de células astrocíticas (Avila-Rodriguez et al., 2016; Cabezas, Avila, González, El-Bachá, & Barreto, 2015; Mimura et al., 2011; Sasaki, Futagi, Kobayashi, Ogura, & Iseki, 2015). Además, en nuestro grupo se ha observado que estas células tienen características morfológicas y funcionales similares en comparación con los astrocitos humanos, así que su uso e implementación ha permito el avance en el estudio de los astrocitos desde una aproximación para evaluar el efecto de agentes terapéuticos así como su respuesta en diferentes patologías cerebrales.

2.5. Función y disfunción mitocondrial en astrocitos

Las mitocondrias son organelos fundamentales para la regulación de las vías apoptóticas y de supervivencia celular. También son reconocidas como el centro para la obtención de energía, para la señalización y modulación de los niveles de calcio (Ca2+) y como

27 responsables de la liberación de ERO, que modulan aspectos fisiológicos incluida la muerte celular (Duchen & Szabadkai, 2010). No obstante, estos organelos son el principal blanco para el estrés oxidativo (Cabezas, El-Bachá, González, & Barreto, 2012). Cualquier alteración o desbalance en el sistema de óxido-reducción causa una afectación en el metabolismo cerebral (Sokoloff, 2008). El principal daño por estrés oxidativo ocurre por un desbalance entre la producción de moléculas oxidativas como peróxido de hidrógeno (H2O2), radical superóxido

- • (O2 ) y el radical hidroxilo (OH ) y la capacidad de la célula para defenderse del daño ocasionado por estas moléculas (LeDoux, Druzhyna, Hollensworth, Harrison, & Wilson, 2007). También existe una estrecha relación entre las patologías cerebrales y la disfunción mitocondrial, y esto ha llevado a que actualmente el interés de varias investigaciones esté centrado en proteger y preservar la mitocondria como una posible diana terapéutica para múltiples enfermedades, especialmente de tipo neurodegenerativo como Parkinson, Alzheimer, esclerosis lateral amiotrófica (Patel & Chu, 2011) o las de tipo traumático o isquémico.

Según lo revisado por Kubik and Philbert en 2015, de un total de 12.614 investigaciones sobre mitocondria en células del sistema nervioso sólo 1.214 fueron dirigidas a mitocondrias astrocíticas, donde el restante de investigaciones fueron realizadas en mitocondrias neuronales (Kubik & Philbert, 2015). Es probable que los estudios en mitocondrias neuronales superen en número los realizados en astrocitos, primero porque existe evidencia que las mitocondrias se concentran en las sinapsis neuronales y segundo, porque la disfunción en la sinapsis o el mal funcionamiento mitocondrial puede perjudicar, no sólo la transmisión del impulso nervioso sino también agravar las enfermedades neurológicas (Cavallucci, Nobili, & D’Amelio, 2013). Por lo tanto, cualquier avance que se realice enfocado en la protección astrocítica es fundamental para el mantenimiento y funcionalidad del tejido nervioso.

En los últimos años, también ha surgido el interés por conocer los mecanismos asociados a la protección de los astrocitos y sus mitocondrias. Este interés radica en el papel que cumplen los astrocitos dentro del tejido nervioso, brindando sustratos metabólicos necesarios para la función neural, manteniendo el equilibrio energético del cerebro y la eliminación de ERO, al expresar enzimas antioxidantes que contribuyen a la protección neuronal (Dienel, 2012; Dugan & Kim-Han, 2004a; Greenamyre, Betarbet, & Sherer, 2003). Además, ha sido

28 reportado que la protección mitocondrial en los astrocitos es fundamental para mantener el equilibrio energético del cerebro y la producción de otros antioxidantes que contribuye a la protección neuronal (Dugan & Kim-Han, 2004a; Greenamyre et al., 2003).

Otros estudios que han evaluado la importancia de la mitocondria astrocítica se encuentra el reportado por Voloboueva y colaboradores, quienes demostraron que la inhibición mitocondrial en condiciones libres de glucosa induce cambios funcionales en los astrocitos relacionados con una disminución en los niveles de ATP, despolarización de la membrana plasmática y una reducción en la captación de glutamato y posterior a esto, hay pérdida significativa de la viabilidad celular (Voloboueva, Suh, Swanson, & Giffard, 2007). Además, existe una fuerte evidencia que los astrocitos protegen las neuronas en una lesión cerebral y que un daño en la función mitocondrial astrocítica puede ser el inicio y complicación de las lesiones cerebrales (Dugan & Kim-Han, 2004a). Por otra parte, otros estudios revelan que en modelos animales de enfermedad de Parkinson inducidos por neurotoxicidad se presenta una sobreexpresión del VEGF y GDNF con una correlación positiva en la expresión de genes mitocondriales con codificación nuclear (Yue et al., 2014), que potencia la importancia terapéutica de las mitocondrias de astrocitos en regiones vulnerables del cerebro. Asimismo, otro estudio evidencia la colocalización de una proteína quinasa específica de tirosina transmembrana TrkB, que es un receptor para BDNF, en la mitocondria de los astrocitos (Wiedemann, Siemen, Mawrin, Horn, & Dietzmann, 2006), con lo cual es evidente que la sobreexpresión específica de factores de crecimiento y tróficos en los astrocitos es localizada y efectiva.

Tomando en conjunto los reportes anteriores, han surgido estudios dirigidos a buscar moléculas que protejan y potencien las mitocondrias con el fin de mantener las funciones neuroprotectoras de los astrocitos. Entre las sustancias que están siendo estudiadas está la CoQ10 asociada con su capacidad para disminuir la producción de ERO, estabilizar potencial de membrana mitocondrial, mejorar la respiración mitocondrial, inhibir las mitocondrias mediada por vía de la muerte celular, y para activar la biogénesis mitocondrial (Jing et al., 2015). Por otro lado, se encuentra el estudio del medio condicionado derivado de células mesenquimales humanas por contener factores pro-angiogénicos, anti-apoptóticos,

29 inmunomoduladores, de diferenciación neuronal, de modulación de la actividad neuronal, de supervivencia y metabolismo celular, entre otros (Cantinieaux et al., 2013).

2.6. Células mesenquimales y su aplicación terapéutica.

Hoy en día uno de los campos más sólidos en terapia regenerativa para reemplazo de tejidos, reparación, efecto inmunomodulador y antiinflamatorio es el uso de células madre mesenquimales (por sus siglas en inglés, MSC) (Lavoie & Rosu-Myles, 2013; Uccelli, Pistoia, & Moretta, 2007). Las MSC integran todo el concepto de células madre, por su capacidad de producir células con potencial proliferativo además de ser células especializadas en diferenciación (Laird, von Andrian, & Wagers, 2008; Martello & Smith, 2014). Tanto la capacidad para renovarse indefinidamente como su potencial para diferenciarse en diferentes linajes celulares adultos (como osteocitos, condrocitos y adipocitos, entre otros), se han convertido en las principales razones por las cuales ha aumentado el interés en el estudio de las MSC (Azouna et al., 2012; Chang et al., 2013). Otra razón por la cual frecuentemente se están realizando estudios en MSC se relaciona con la variedad de fuentes de las que se pueden aislar. Por ejemplo, la médula ósea, sangre del cordón, músculo, hueso, cartílago o tejido adiposo, que indica a su vez una amplia variedad funcional (Guadix et al., 2017; Schäffler & Büchler, 2007).

Un gran número de investigaciones soporta el papel fundamental que tienen las MSC para reparar los tejidos dañados, para autorenovarse y diferenciarse (Lavoie & Rosu-Myles, 2013; Martello & Smith, 2014). Además, gracias a sus características y efectos sobre diferentes tejidos, proporcionan una aproximación a tratamientos efectivos para una amplia gama de enfermedades y pueden ser usadas en medicina regenerativa (Semedo, Burgos-Silva, Donizetti-Oliveira, & Camara, 2011). Sin embargo, aún no es claro el mecanismo a través del cual las MSC ejercen su efecto y recientemente se ha propuesto que el efecto de las MSC en la reparación, protección y renovación de tejidos dañados ocurre por la acción de moléculas y factores paracrinos solubles que estas células producen y liberan a su ambiente extracelular (Phan et al., 2018; Shologu et al., 2018; Venugopal et al., 2018). Dentro de las moléculas y factores que secretan y han sido reportados en el secretoma y proteoma de éstas células están HGF, BDNF, VEGF (Y.-X. Chen et al., 2015; Vizoso et al., 2017), FGF, MCP-1, IGF-I, SDF-

1 y trombopoietina (Lai, Chen, & Lim, 2011) entre otros. Así mismo, Cantinieaux, D. y colaboradores (2013) encontró factores angiogénicos, pro-angiogénicos, anti-apoptóticos, inmunomoduladores, de diferenciación neuronal, de modulación de la actividad neuronal, de supervivencia y metabolismo celular, entre otros, cuando analizó el medio condicionado de células mesenquimales derivadas de médula ósea (Cantinieaux et al., 2013; Khalili et al., 2012).

Recientemente se ha centrado el interés de diferentes investigaciones en evaluar el efecto de CM-MSCA, CM-MSCBM o el CM de otro tipo de MSC en la protección o estabilidad de células gliales como la microglía y los astrocitos. Por ejemplo, Torrente y colaboradores, quienes utilizando un modelo de privación de glucosa y lesión mecánica (scratch), reportan que el CM-MSCA protege la viabilidad, reduce la producción de ERO, influye en cambios morfológicos y aumenta el cierre de la herida en un modelo astrocitario (T98G) (Torrente et al., 2014). Estos hallazgos probablemente están relacionados con estudios que reportan los beneficios del CM-hMSCAF y del CM-MSCA en la curación de heridas (Yoon et al., 2009) y la migración celular (J. Chen et al., 2015; Frese, Dijkman, & Hoerstrup, 2016; Shen et al., 2015). Además, este efecto en la migración celular también puede estar relacionado con la producción y secreción de moléculas como crecimiento básico de fibroblastos factor (bFGF) (Linero & Chaparro, 2014), factor de crecimiento epidérmico (EGF) (Yoon et al., 2009), laminina, fibronectina (Johnson, Milner, & Crocker, 2015) y algunos proteoglicanos de sulfato de heparano (HSPG), por parte de las MSC (Walter et al., 2015). Estas moléculas se han identificado en el secretoma de diferentes MSC (J. Chen et al., 2015; D. E. Lee, Ayoub, & Agrawal, 2016; Shen et al., 2015) y se han descrito como factores fundamentales para mantener la migración de los astrocitos y otras células como los fibroblastos (Faber-Elman, Lavie, Schvartz, Shaltiel, & Schwartz, 1995; Johnson et al., 2015; D. E. Lee et al., 2016).

Otras investigaciones también sugieren que el CM de las células perivasculares del cordón umbilical pueden regular la viabilidad e incluso la proliferación de células gliales en cultivos primarios de células del hipocampo (Salgado et al., 2009; Teixeira et al., 2015). Asimismo, se ha encontrado que el CM-hDPSCs bloquea la producción de ERO en astrocitos en un modelo de isquemia in vitro con privación de glucosa y oxígeno (Song, Jue, Cho, & Kim, 2015) y que el CM-HUCPVC influyó en un mayor número de células de cultivos de hipocampo que son

31 positivas para GFAP (Salgado et al., 2009; Teixeira et al., 2015). Sin embargo, el mecanismo por el cual estos factores y/o moléculas presentes en los CM-MSC ejercen protección o cambios sobre las células gliales no se ha dilucidado por completo y aún se necesita más estudios.

Teniendo en cuenta lo anterior y la importancia que tienen las MSC en el tratamiento o la prevención de diversas patologías cerebrales, se realizó la revisión que se presenta a continuación para ampliar los avances más significativos en las propiedades regenerativas y protectoras del secretoma y exosomas derivados de diferentes MSC. Además, se discute los posibles mecanismos de acción de estos factores que subyacen a estos efectos protectores sobre diferentes células del sistema nervioso central. Por último, también se evidencia el efecto de los factores derivados de las células madre mesenquimales adiposas y su impacto sobre patologías cerebrales, así como los avances significativos en el estudio del secretoma de MSC sobre células gliales. Esta revisión ya se encuentra sometida: “Baez-Jurado E, Hidalgo- Lanussa O, Barrera-Bailón B, Sahebkar A, Ashraf GM, Echeverria V, Barreto GE. Secretome of mesenchymal stem cells and its potential protective effects on brain pathologies. Submitted (October 2018) - Molecular Neurobiology Journal”

Secretome of mesenchymal stem cells and its potential protective effects on brain pathologies

Eliana Baez-Juradoa, Oscar Hidalgo-Lanussaa, Biviana Barrera-Bailóna, Amirhossein Sahebkarb,c,d, Ghulam Md Ashraf e, Valentina Echeverriaf,g, George E. Barretoa*

a. Departamento de Nutrición y Bioquímica, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogotá D.C., Colombia. b. Neurogenic Inflammation Research Center, Mashhad University of Medical Sciences, Mashhad, Iran c. Biotechnology Research Center, Pharmaceutical Technology Institute, Mashhad University of Medical Sciences, Mashhad, Iran d. School of Pharmacy, Mashhad University of Medical Sciences, Mashhad, Iran e. King Fahd Medical Research Center, King Abdulaziz University, Jeddah, Saudi Arabia f. Facultad de Ciencias de la Salud, Universidad San Sebastian, Lientur 1457, 4080871, Concepción, Chile g. Research & Development Service, Bay Pines VA Healthcare System, Bay Pines, FL

33744,

USA.

*Corresponding author: George E. Barreto, M.Sc., Ph.D. Departamento de Nutrición y Bioquímica, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogotá D.C., Colombia. Phone: +57 1 320 8320 (ext 4096); email: [email protected]; [email protected]

Abstract

Mesenchymal stem cells (MSCs) have a fundamental role in the repair and regeneration of damaged tissues. A large number of research has shown the ability of MSC to differentiate into several cell and to secrete bioactive molecules with anti-inflammatory, immunoregulatory, angiogenic, trophic factors, microRNA, hormones, and neurotrophins. These factors have a protective effect on nervous tissue and multiple therapeutic applications. Due to the beneficial effects of the secretome from MSCs, the number of investigations to evaluate its effects on different cerebral pathologies has been increasing. In this review, we have described the sources of MSCs with their main characteristics and application in regenerative medicine, as well as the risks associated with the use of transplants and localized administration. In addition, we have also discussed the most significant advances in the regenerative and protective properties of the secretome and exosomes derived from different MSCs as well as the possible mechanisms of action of these factors that underlie these protective and beneficial effects on different cells of the central nervous system. Finally, we have specifically reviewed the effect of the factors derived from adipose mesenchymal stem cells and its impact on brain pathologies, as well as the significant advances in MSC secretome studies on glial cells.

Keywords: Mesenchymal stem cells; paracrine factors; pathologies; therapeutics; secretome; nervous system.

Introduction Studies on mesenchymal stem cells (MSCs) is one of the most promising fields in regenerative therapy for tissue replacement, repair, immunomodulatory and anti- inflammatory effect [1]. The MSCs integrate the whole concept of stem cells for their ability to give rise to cells with proliferative and differentiation potentials [2,3]. Their ability to renew indefinitely and potential to differentiate into different adult cell lineages such as osteocytes, chondrocytes and adipocytes are the reasons of the growing interest in MSCs [4,5]. Another reason why lot of studies are performed in MSCs is related to the variety of sources from which they can be isolated, and these include bone marrow, cord blood, muscle, bone, cartilage or adipose tissue [6,7]. Recent studies have demonstrated the ability of MSCs to differentiate into a variety of functional tissues, which are often affected by different diseases and injuries [8-10]. On this account, efforts have been made to study and apply regenerative therapy with MSCs in some diseases and respiratory pathologies, hematopoietic diseases, and diabetes [11,12], as well as other pathologies that drastically affect the central nervous system (CNS) such as traumatic injury, stroke, spinal cord injury, among others [13,14]. This growing interest is based on the acquisition of knowledge to understand the signals that govern the function of stem cells for treatment, especially of tissues without regenerative capacities [15]. However, the mechanism through which MSCs may exert their effect is still not clear. Recently, it is believed that their protective effects are due to the presence of molecules and soluble paracrine factors that these cells produce and release to their extracellular environment [16- 18]. Previous works on MSCs have revealed a complete secretome consisting of a diversity of molecules with broad functions. These include the anti-apoptotic factors vascular endothelial growth factor (VEGF), β fibroblast growth factor (FGF), Platelet-derived growth factor (PDGF), Insulin-like growth factor (IGF-1) and Sphingosine-1-phosphate (S1P) [19], anti- inflammatory factors such as Tumor Necrosis Factor β1 (TGFβ1), interleukin (IL-10) [20], and antimicrobial chemokines (The chemokine (C-X-C motif) ligand (CXCL)10, CXCL8, CXCL1, CXCL6, Chemokine (C-C motif) ligand (CCL)20 and CCL5) [21], which also are involved in tissue repair and wound closure [22,23]. Furthermore, it have been found that VEGF, FGF, CCL2 (MCP1), the Hepatocyte growth factor (HGF), and IGF-1 have protective functions in different tissues. Specifically, the Platelet-derived growth factor (PDGF)-BB, bFGF, Endothelial growth factor (EGF) [24,23], Brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF) [25-27], IGF-1 [27] and glia-derived nerve growth factor (GDNF) [25] have been reported with a protective effect specifically on the brain tissue [28,29]. Therefore, these factors might have important therapeutic implications in the clinic. The objective of this review is to present a general and integrated view of current knowledge about MSCs, the paracrine action of their factors and molecules and the recent progress in

the investigation of their potential regenerative and protective action on different pathologies of the CNS.

Stem Cell Sources MSCs can be found in a variety of tissues in the body, and they are the source of a natural response to traumatic onset and cell tissue regeneration. It is important to separate the Embryonic Stem Cells (ESC) from Fetal Stem Cells (FSC) and Adult Stem Cells (ASC), since they differ in the degree of cellular fate [30]. ESC are pluripotent, and FSC and ASC are multipotent. The pluripotent state implies that it can give rise to more than one type of differentiated cell line and multipotent cells have a restrictive potency due to the acquired cell ability to form a type of tissue depending on the germ layer from which they originated [31,32]. ESC come from lineages of blast cells and gastric (blastocyst, trophectoderm and internal cell mass) [33-36]. On the other hand, it was initially thought that all the cell lineage of the ASC came from the mesoderm embryonic tissue [33], but later it was observed that ASC cells after became infected, differentiated into functional cells of tissues that originate from the ectoderm and the endoderm [37]. This revealed that ASCs originally formed from the three embryonic germ layers (mesoderm, ectoderm and endoderm). ASC have been found in almost all tissues, whether the tissue has a great regenerative capacity or not, denoting the important role as progenitors [15]. In adult individuals, the stem cells are located in niches in the perivascular zone of all organs which are microenvironments that provide protection for different stimuli, like differentiation and apoptosis, in addition to allowing them to maintain a balance between self-renewal and differentiation [38-41]. Even if all niches share the same expression of key molecules in different tissues, each niche has a molecular identity associated with the tissue to which it is related. They even share characteristics of pericytes in terms of phenotype, marker expression and differentiation capacity [42,38]. This identity is mainly reflected in the presence of membrane receptors that are specific to each tissue for extracellular matrix proteins and associated growth factors of the surrounding tissues [38,39,43]. The common molecules between niches can play in a different way, and often with diverse roles according to the embryonic origin and the specific functions of the tissues [39]. According to Bieback et al [44], MSCs comprise a diverse population of multipotent parents capable of differentiating into an osteogenic, adipogenic or chondrogenic lineage, that makes them candidates to develop new therapeutic strategies based on the cell types, such as the treatment of mesenchymal tissue injury or support in the transplantation of hematopoietic stem cells (HSC) [45]. It has been known that MSCs are traditionally obtained from bone marrow, but they have now been isolated from adipose tissues through lipoaspirates and in higher volumes with respect to the bone marrow and umbilical cord blood (UCB) [46].

Among the advantages of using MSCs are the ease of obtaining them, their rapid proliferation and their ability to migrate to the site of inflammation [47]. In addition, MSCs can be isolated, cultured, and differentiated to different cell types. Some time ago, the use of mesenchymal cells was focused on differentiation and transplant in different areas with some type of injury such as bone, tendon, heart, among others [48-50]. However, this type of transplant treatments began to have adverse effects due to the ability to promote tumor growth, and metastasis continues to generate concerns in the field of regenerative medicine [51]. For example, it has been reported that MSCs administered systemically can be recruited and migrated to tumors [52], and that can contribute to tumor pathogenesis through the support of tumor microenvironments [53]. It has even been recently shown that mesenchymal cells increase metastatic potential at various stages of growth progression of the primary tumor [54].

Embryonic Stem Cells (ESC) The discovery of embryonic mesenchymal stem cells as a tool for regenerative tissue engineering was through the study of teratocarcinomas. Teratocarcinomas are tumors that present differentiated tissues, sometimes totally differentiated (mainly teeth or hair). Once they were isolated and cultured, they were found to have blastocyst properties since they were pluripotent [2]. Therefore, this opens up the possibility of considering the use of ESC as a tool for transgenesis and proliferation treatments. Depending on where ESC are obtained, they would have different characteristics of commitment. ESC are obtained from the blastocyst period at the time of pre-implantation, until the end of the gastrulation period during in vitro fertilization procedures [55]. As the first cells of the embryo break down, they have a greater commitment and their power varieties depend on the location within the embryo. Despite the controversy due to the ethics involved in working with human embryos [56,57], the in vitro problem of low embryo generation rate [58] and differentiation directed to obtain a heterogeneous population [58], the ESC are currently being evaluated for several purposes. These include development of a population of cardiac progenitor cells [59,60], sub-retinal transplant of retinal pigment epithelium (EPI) derived from hESC in patients with macular dystrophy of Stargardt and age-related macular degeneration [61,62]. As reported with other stem cells, there are reports of the generation of tumors in transplants of ESC that constitute an obstacle to its clinical use [57,2,56]. This negative outcome is considered to be related to the capacity of pluripotency of the ESC, and the fact that the blastocyte cytoplasm is full of proteins promoting cell division and proliferation. In addition, other difficulty to work with the ESCs is that the transplanted cells do not function and integrate properly in the organs, inducing immune rejection [56,63]. For example, these difficulties have prevented the use of human embryonic cell lines and the fulfillment of their therapeutic potential [58].

Induced Pluripotent Stem Cell Induced pluripotent stem cells (IPSC) are another type of stem cells. These cells are derived from adult somatic stem cells by a pluripotent state transformation similar to an embryo [2,64]. This reprogramming is done by introducing specific transcription factors that are known to increase pluripotency (SRY (sex determining region Y)-box 2 (Sox2), octamer- binding transcription factor 4 (Oct4), Kruppel-like factor 4 (Klf4) and c-Myc) [56,65,66] and has appeared as a key advance in cell therapy due to its ability to differentiate into cells of any of the three germ layers, and the non-immune rejection of cells in transplant therapies through the development of patient-specific cell therapy protocols [31,67]. Another advantage of pluripotent cells is that they are not subject to special regulation like MSCs, but it has a high similarity at the molecular and functional level with these embryonic cells [31,68]. However, among these similarities with ESC are the problems associated with the capacity of pluripotency, as in some cases the formation of teratomas by the uncontrolled proliferation [67,69,70] do not have a uniform characteristic related to the gradient of the induced pluripotency factors and genetic heterogeneity of the donor [2]. IPSC are cells that go through a genetic modification in the conversion of pluripotency, related to the appearance of mutations or reactivation of the embryonic gene program and have a residual epigenetic memory related to the donor's imprint, age, immunogenic specificity and somatic as well as variations related particularly with the extraction tissue [67,71-73]. Although pluripotent stem cells (PSC) offer the possibility of studying a model based on human cells, more importantly they allow the study of the mechanisms of the disease in a cell that has a relevant genetic background when extracting the somatic cells of patients with diseases of unknown molecular origin or unknown pathological pathways [57,67,74]. For example, some research has focused on the evaluation of genetic factors and the epigenetic changes that occur during the reprogramming of IPSC to improve the effectiveness of cell replacement therapies for the treatment of neurodegenerative diseases such as Alzheimer’s disease (AD), Huntington’s disease (HD) and Parkinson’s disease (PD) [75,76]. Interestingly, it has been found that human IPSC use the same transcription network to generate neuroepithelial and functional neuronal types in the same evolutionary course that ESCs do but with reduced efficacy and some variability [77]. On the other hand, it has been found that the neurospheres derived from PSC induced by humans promote motor functional recovery in a spinal cord injury in mice [78] and that a modeling of human cortical development in vitro using this type of cells has facilitated the study of the development of the human brain as well as disorders of the human cerebral cortex [79]. This contributes to the study of the early stages of a human neurodevelopmental disease and a cellular tool in the detection of drugs, diagnosis and probably with the objective of getting a personalized treatment [80].

Fetal and Adult Stem Cells FSC are a unique group of stem cells that are also considered multipotent. They originated from the trophectoderm and partly from the mesoderm. The usual fetal tissues used are the Wharton Gelatin Stem Cells (WJSC) of the placenta, the Perivascular Umbilical Cord Stem Cells (UCPVC) and the Amniotic Fluid Stem Cells (AFSC). Perivascular Umbilical Cord Stem Cells (UCPVC) are cells extracted from the inner layer of the umbilical cord. Originally, they form the extra-embryonic allantois layer that differs from the mesoderm. In adults, MSCs can be isolated from a large number of sources such as bone marrow, spleen, muscle cells, pancreas and dermis [81,7,6]. The MSC cells derived from bone marrow (BM-MSC) and the MSC derived from adipose tissue (A-MSC) are the most studied stem cells, but they can also be found in dental plug stem cells (DPSCs), hematopoietic stem cells (HSC) and MSC derived from peripheral blood. There is little or no difference between BM-MSC and A-MSC niches [82,83]. The bone marrow niche comprises: osteoblasts, hematopoietic stem cells (HSC), ESC and their progeny [40], and they clearly differ from the niches of stem cells of hair follicles and teeth [39]. The expression of proteins and molecules of A-MSC has been described as similar with BM-MSC, but it has been observed to have more similarities with WJSC of placental tissue [84,85]. From the origin of the endoderm and the ectoderm, some of the stem cells are used for research and therapeutic processes. Among them we can highlight the Epithelial Stem Cells (EpSC) and the Neural Stem Cells (NSC) of ectoderm origin, and the Hepatic Stem Cells (HSC) [86] of endoderm origin. In the case of epithelial stem cells, the vast majority of studies refer to what are the intrinsic molecular mechanisms to maintain the state of pluripotency, niche-dependent differentiation and induction/maintenance of the resting state [87-90]. NSCs are cells located in the subventricular zone and brain regions of the hippocampus of the mammalian brain [91]. Knowledge of the existence of ASC and their various usage have developed a variety of treatment possibilities, but one of the biggest problems experienced is the difficulty of obtaining any of the tissues with stem cells because they all involve invasive procedures for extraction [92]. Also, not all the extraction provides the volume needed to work. For example, extracting MSCs from the bone marrow is not profitable due to the low percentage obtained from MSCs (0.001-0.01%), and this has limited its application and research [93,94]. On the other hand, adipose tissue is abundant and the frequency of MSCs in adipose tissue is 100 times higher than that found in the bone marrow [83]. Recent studies have shown that MSCs isolated from adipose tissue provide a greater number of cells and a greater viability of the culture (98-100% of the cells of weaves are viable after the extraction) [94-96], and they are obtained from a simple and safe therapeutic treatment or cosmetology procedures [95,96], obtaining up to 500 ml of adipose mass per patient. Other adipose MSCs are obtained in smaller quantities and their extraction volume is less than 10% of the original tissue and their therapeutic usage will depend on the intrinsic individual characteristics of the cells, that is to

say, difficulty of isolation, cellular power, crop management, immune response to transplants and tumor induction capacity, among others [31].

Secretome of MSCs Initially, self-regeneration and tissue replacement capacity by MSCs was the focus of action in regenerative medicine. The ability to generate differentiated cells of a wounded tissue was the main research interest focused on the use of MSCs. In this regard, one of the main lines of study of the MSCs is based on transplants and in differentiation studies of grafts of these cells in co-cultures in vitro [33,97-100]. This line of research has given promising results in most cases, differentiation in vivo, but is uncommon partly because the lifetime of the MSCs in the transplanted tissue is between 48 hours and 3 months [1,101]. In addition, the transplanted cells cannot function normally in the organs, because immune rejection may occur [56,63] or they may promote tumor growth and metastasis [51,102,103]. Recently, another research course has emerged in which the type of rescue and repair of MSCs is given by the paracrine activity of secreted factors (growth factors, cytokines and hormones), cell-to-cell interactions, and the release of extracellular vesicles that include proteins, mRNA and microRNA [31,33,104]. MSCs in vivo go through a pre-differentiation stage in which they begin to express target tissue molecules. This pre-differentiation is also related to the microenvironment where the MSCs are transplanted into the target organ. There MSCs begin to respond to environmental signals that impose regulatory action [105], that in most cases is related to specific tissue pathology, generating an immune/inflammatory suppression most likely by paracrine activity [1]. This main action of MSCs to the injury or response to the disease is the secretion of different functional biomolecules, molecules of paracrine secretion and molecules stored in extracellular vesicles, that generate important actions in homeostasis, immune response, development, angiogenesis, trophic action, anti- inflammatory action, pro-regenerative action, proteolysis, adhesion and organization of the extracellular matrix [38,40,106-108]. The MSCs secretome dynamically changes its composition depending on the stimuli and microenvironment. Therefore, depending on the environment or the pathology they face, once they are in an affected tissue activates different pathways to generate a particular molecular expression response [107]. Generally, the MSCs secretome has also been reported in regulating inflammatory responses. The modulation of the immune system also has regenerative effects promoting proliferation and inhibiting the apoptosis of damaged target cells, among other benefits that can serve as a therapeutic alternative in various diseases of both the CNS and other tissues [103,109]. As mentioned, these effects may be directly or indirectly related to the presence of bioactive molecules, including proteins, mRNA and miRNAs, cytokines, chemokines, growth factors, hormones, extracellular matrix proteins, matrix remodeling enzymes, and vesicle proteins produced by the cell comprise the secretome [107,25]. These molecules can be involved in the communication from one cell to

another, that leads to the exchange of genetic information and reprogramming of recipient cells or even the presence of for example, of miRNA-133b involved in the recovery of brain tissue [110-112].

Exosomes of MSCs: A new cell-free therapeutic option. The exosomes, together with microsomes, constitute the extracellular vesicles. The study of exosomes as signal transmitters is recent, and has gained attention in recent days. For example, they can be permeable to biological barriers, have lower immunogenicity, and absence of cytotoxicity and non-mutagenic characteristics [113], in addition to their small size with a diameter of 40-100 nm [102]. On the other hand, it is known that the type of molecules stored in the exosome is carefully classified by different membrane protein complexes, of which the main protagonists are ESCRT-0, ESCRT-III associated with p53 and the ubiquitinated major histocompatibility complex [114]. Exosomes are also known as molecular transporters, and show a superior transport system that allows the supply of small proteins and different RNA (mRNA, miRNA, tRNA and other non-coding RNAs), that intervene in the immunoregulatory response of MSCs [115-117]. In addition, the use of exosomes has a safety profile superior to the use of cells because they are structures that can store and transport molecules safely without losing their function and conserving its properties and benefits in cellular protection with the activation of pathways where they are really necessary [102]. Exosomes have been reported in different types of cells or substrates among which are cancer cells [118], serum of cancer patients [119], serous ovarian carcinoma [120] as well as in the MSCs derived from adipose tissue (A-MSC) and bone marrow (BM-MSC) [121,102,122]. Other investigations report that MSCs exosomes are mediators of inflammation by having anti-inflammatory cytokines present and influencing the apoptosis of activated T cells [123,114] as well as can participate in the healing of cutaneous wounds by the action of Wnt Family Member 4 (Wnt4) administered in extracellular vesicles [124]. On the other hand, it have been shown that extracellular vesicles obtained from human umbilical cord Wharton's Jelly MSCs (hWJMSCs) reduced the growth of T24 bladder carcinoma cells in vitro and in vivo [125], reduced apoptosis induced by liver disease [126], and heart attack induced by cardiovascular diseases[127], and have beneficial effects in pulmonary diseases [128]. In this regard, C. Randall Harrell et al., 2018., found that exosomes derived from MSCs were as efficient as transplanted cells in limiting the extent of injury and ocular inflammation [129]. In this regard, other studies have shown that exosomes derived from MSCs have similar functions like repairing tissue damage, suppressing inflammatory responses and modulating the immune system without the risks of aneuploidy or immune rejection after allogeneic administration [130]. However, the mechanisms by which protection is given are not yet fully known and some results remain controversial.

Alternatively, studies of the effects of extracellular vesicles on pathologies of the CNS have been also advanced. No too long ago, Y. Zhang et al., (2015) demonstrated for the first time that exosomes from MSCs can improve brain´s functional recovery, promoting angiogenesis, neurogenesis and decreasing neuroinflammation in rats subject to traumatic brain injury (TBI) [131]. The positive effects of exosome has been attributed to the action of proteins, lipids and RNA present in these vesicles and that may have a specific therapeutic role [132]. With these first findings, the evaluation of the effect of nanovesicles and exosomes derived from MSCs on brain pathologies has continued to advance with promising results, and that may potentially be used in the future as therapeutic alternatives. First, exosomes of BM-MSCs that are transferred to neurons and astrocytes have not only been reported to improve cognitive deterioration, induced by diabetes [133], but when administered intravenously to target M2-type macrophages in spinal cord injury [134]. On top of that, it has been reported that stem cells derived from multipotent mesenchymal stromal cells overexpress different microRNAs considered potentially effective for the treatment of brain pathologies. The first is the microRNA 133b that contributes to the increase in neuronal plasticity and the improvement of neurological function in a rat model of stroke [135] and another is the miR-26a, present in exosomes. It has also been related to axonal regeneration, neurogenesis, synaptic development and plasticity, synaptic transmission and the morphology of neurons [136]. Similarly, ASC nanovesicles reduce the movement of T lymphocytes and improve chronic experimental autoimmune encephalomyelitis [137]. According to Zhang et al [131], functional recovery has been demonstrated, possibly promoting angiogenesis that allows renewal of the endogenous endothelium as well as neurogenesis after the use of exosomes derived from MSCs. The authors report that together these effects significantly improve the neurological function of spatial learning and motor recovery in rats with experimental intracerebral hemorrhage [138]. Taking into account the benefits of exosomes for the treatment of different pathologies, nowadays different types of culture have been established that allow obtaining exosomes with more protective power. For example, a previous study [139] determined that 2D and 3D cultures of BM-MSCs allow obtaining exosomes for the treatment of TBI. However, the exosomes obtained in 3D scaffolds gave better results in spatial learning than exosomes grown in 2D and in general terms the exosomes significantly improved functional recovery in rats after a TBI promoting angiogenesis and endogenous neurogenesis, and in this particular case also reduced neuroinflammation [139]. It seems to expand the study of MSCs exosomes and the analysis of the possible mechanism of action on the pathologies is considered as a primary objective in the search for effective therapeutic alternatives, low demanding and fast-acting for the treatment of CNS diseases or else at least provide an approximation preventing progression of the injuries.

Action of the secretome of mesenchymal stem cells on pathologies. Nowadays it is a well-known fact that the paracrine action of MSCs is based on the secretion of trophic factors and cytokines [140]. Therefore, proteomic studies of MSCs have been developed, mainly derived from bone marrow, adipose tissue, fetal and embryonic as well as their secretomes or paracrine factors, in order to detect prospective biomarkers, identify molecules in response to the injury, select objectives for the treatment and study cell signaling [107,141,142]. In addition to advancing studies on the effect of paracrine factors in different tissues and seeking different strategies for the treatment of diseases, including those that affect the CNS [143-146] (Figure 1).

An explicit example is that for some time the conditioned medium of mesenchymal stem cells (CM-MSCs) derived from different sources has been evaluated in cardiac, renal, bone regeneration or inflammatory processes, among others [147]. Particularly, for cardiac tissue as reviewed by Gnecchi M et al., 2012 [148], the mesenchymal ones that are grafted release a wide range of soluble factors that can be used to prevent and reverse the remodeling in the ventricle with ischemic injury [149]. It is possible that the protective effect is given by immunomodulators and antioxidants, the presence of extracellular superoxide dismutase (SOD3) [150], the increase of anti-inflammatory proteins such as TSG-6 [151,152] or due to the effect of exosomes derived from MSCs that increased the levels of ATP, NADH, AKT and phosphorylated β-GSK-3, in addition to reducing oxidative stress [153].

On the other hand, at the muscular level CM-MSCs can reduce apoptosis and fibrosis intramuscularly [106] and the factors present in the CM-MSCs may favor the treatment of immune diseases, the rejection of transplants [154] and in the treatment of acute kidney injury through an anti-apoptotic protective effect [155,156]. To this long list of beneficial effects of the trophic factors produced and secreted by MSCs, they help to improve the proliferation of endothelial cells and angiogenesis in a model of ischemia of the hind limbs in rats [157], accelerate the formation of bony scars [158-160], recovery of rheumatoid arthritis [161], regeneration of jaws in rabbits [24,162] and they have a therapeutic effect in the treatment of diabetes mellitus [163], among other diseases [164]. Indeed, these secreted factors from MSCs decrease pro-apoptotic markers (caspase-3, α-smooth muscle actin (α- SMA) and proliferating cell nuclear antigen (PCNA)) in rats subjected to unilateral ureteral obstruction [165]. In addition, it has been demonstrated using in vivo paracrine models that exosomes decrease apoptosis and the formation of pulmonary fibrosis mediated by an anti- inflammatory mechanism provided by the MSCs [166], and with similar results [167] reported in the rats with periodontal defects, a periodontal tissue regeneration linked with cytokines present in the CM-MSCs.

The secretome of MSCs as a therapeutic alternative for CNS pathologies The brain tissue is formed by complex and integrated relationships between different types of cells. The neurons are responsible for neurotransmission, and the glia, mainly astroglia, function as the cerebral administration system playing a leading role in neuronal survival by maintaining cerebral homeostasis, controlling secreted trophic factors, buffering extracellular K+ concentrations, recycling glutamate, metabolizing glucose into lactate, and forming the blood-brain barrier. The physiology of these cell types are strongly altered during cerebral pathologies, causing the loss of their functions and the protection they provide to the tissue. Brain pathologies have common characteristics of cell damage. For example, they increase the production and accumulation of reactive oxygen species (ROS) and reactive nitrogen species (RNS), denaturation and protein aggregation, besides secreting apoptotic factors, generally related to the mitochondrial malfunction and alterations in the metabolism. Because of the sequelae and cell death left by physiological changes at the cellular level, cerebral pathologies have had an impact on the quality of life of the world population and given its complexity it has been difficult to establish effective therapies or treatments for some pathologies, that prevent the progress of the injury with cognitive and motor sequelae [13,14]. In this regard, CM-MSCs has also been evaluated in the search for therapeutic alternatives towards a protective or restorative role in different cerebral pathologies.

Traumatic Brain Injury (TBI) TBI is often caused by accidents [168,169]. It is known as an impairment of brain function caused by stroke, laceration or rapid and strong movement of the brain inside the skull, that produces neurological disorders [170]. The initial manifestations of TBI include an altered level of consciousness, convulsions, coma and confusion. The final result of the injury are disorders affecting memory, attention, language, reading and writing as well as spatial orientation tasks [171]. There are different physiopathological levels that compromise the changes in different types of brain cells. The first phase includes mechanical damage causing the rupture of the blood-brain barrier and a diffused axonal injury [172], and the second phase is a cascade of events caused by mitochondrial breakdown and free radical release [173-175]. In addition, the functions of neurons are affected by the loss of other brain cells such as astrocytes [176,177]. The complexity of TBI have sought different therapeutic alternatives for the treatment or prevention of progression of injury. One of these therapeutic alternatives is the use of MSCs from different sources. To mention, studies have revealed that endothelial progenitor cells migrate from the bone marrow into the bloodstream in response to injury or inflammation [178,179]. In other studies, it was found that medullary stromal cells applied intravenously [180] and the transplantation of fetal neural stem cells [181,182] help in improving the

functional cognitive outcome after acute brain injury. Recently, Otsuka et al [183] reported that transplantation of MSCs derived from human cranial bone, cultured under microgravity conditions, had exceptional neuroprotective effects in mice with TBI. A topic that is often debated nowadays is the nature of metabolites secreted by MSCs that can be used for the treatment of TBI. The mesenchymal stem cells derived from the bone marrow (BM-MSCs) have been widely studied and the results showed beneficial effects for various brain diseases [21,184]. For example, intravenous injection of BM-MSCs secretome reduced neuronal loss and apoptosis, promoted the production of VEGF, and induced functional improvements in a rat model of TBI [185]. More importantly, they found that the factors secreted by BM-MSCs modulated the inflammatory response by decreasing the profile of cytokines expression on the brain tissue. Also, in a model of experimental TBI, the secretome from BM-MSCs promoted the survival and proliferation of neural stem cells and the subsequent repair of the injured tissue [186] whereby suggesting that they could be a promising strategy for recovery from TBI. It is noteworthy that not only the factors of the BM-MSCs are related to the protection against TBI, but also other CM-MSCs have shown encouraging beneficial effects in this neurological condition. Firstly, several studies have reported the presence of bioactive factors and cytokines with powerful long-lasting antinociceptive effect on neuropathic pain developed after a nerve injury [187] as well as other compounds such as HGF and VEGF have been reported to be present in the CM-MSCs. Nevertheless, when pre-conditioning of MSCs with hypoxia was performed before the isolation of exosomes, the rats with TBI treated with these specific secretomes showed better results in the motor and cognitive function tests and enhanced neurogenesis and less brain damage after injury [5]. The potential benefits of using CM-MSCs for treating neurological disorders have encouraged the use of the new genetics technologies to design MSCs with enhanced tropism and paracrine secretion of cytokines and growth factors for localization and recovery of TBI, including the use of the chemokine receptor interaction involving the CXC 4 (CXCR4) - SDF1α (factor 1α derived from stromal cells) factors [103]. Several studies with different experimental approaches, but related to the TBI, have also shown an effect of MSC on restoration of tissue structure and function. One of these cases is the crush injury of the optic nerve. In this study, they showed that MSCs therapy was associated with an increase in the expression of FGF-2 in the ganglion cell layer of the retina, suggesting a beneficial result mediated by trophic factors from mesenchymal stem cells [188]. Other studies also showed that the CM-MSC is involved in the protection of neurons against glutamate excitotoxicity as the reduction of NMDA-Triggered Calcium Responses and Surface GluR1, and these results suggest that the CM-MSCs involves reduced activity of the NMDAR and GluR1-containing AMPAR , and TNF-mediated neuroprotection [189].

Neurodegenerative diseases Neurodegenerative diseases such as Alzheimer´s (AD), Parkinson´s (PD), and Huntington’s (HD) diseases are another type of brain pathologies that have higher incidence in the world's population [190,191] and for which the CM-MSCs has also been evaluated as alternative for treatment [143,192]. These therapies will take advantage of the innate trophic support of the MSCs by using genetically engineered MSCs as delivery vehicles of growth factors, such as BDNF and GDNF to support injured neurons [146].. Clinical trials for the injection of MSCs and application of their secretome in the CNS to treat different nerve pathologies are currently underway. In the search for alternative treatments for neurodegenerative diseases, it has been evaluated the differentiation capacity of MSCs into functional dopaminergic neurons [193]) and also the anti-apoptotic effect on dopaminergic neurons of factors secreted by MSCs [194]. However, although the mechanisms of action of MSCs factors are not clear, recent studies support the hypothesis that the therapeutic effect of MSCs is mediated by the receptors MAPK-1 and PDGFRB [195]. There is evidence compelling that monoaminergic fibers are affected in PD [196,197]. Interestingly, BM- MSCs have shown to protect both catecholaminergic and serotonergic neuronal perikarya structure and transporter function from oxidative stress by the secretion of GDNF [198]. New perspectives for therapeutic strategies have led to carrying out tests with genetic modifications on MSCs in such a way that they overexpressed GDNF, finding protection and budding of the dopaminergic terminals induced by secreted GDNF [199]. With all this evidence, it is reasonable to postulate that MSCs therapy can reduce the risk of PD, based on the fact that MSCs can act as a ROS detoxification system and as a provider of neurotrophic factors as reported previously [200]. In spite of the progress, further investigation and broader approaches to investigate the scientific scope of these potential therapeutic alternatives are still needed. Another neurodegenerative pathology that has attracted great interest in the search for therapeutic alternatives is the multiple sclerosis. Also, in this condition, BM-MSCs and the CM-MSC have been evaluated for therapy. In a first study by Dahbour et al, it was found a correlation between a lower number of lesions and a higher content of molecules such as IL-6, IL-8 and VEGF present in the CM-MSCs at the beginning of the study [201]. This correlation may explain the magnitude of improvement in the state of disability [201]. Alternatively, it was reported in in vivo murine demyelinating model that intraventricular injections of MSCs provide paracrine effects on the oligodendrogenesis of the subventricular zone, suggesting that MSC secreted factors may be an effective method to promote oligodendrogenesis and functional remyelination [202]. To date, phases 1, 2, and 2a pre-clinical trials conducted to assess the safety and efficacy of MSCs in humans showed that an intravenous and/or intramuscular injection of MSC and neurotrophic factors have synergistic clinical benefits in amyotrophic lateral sclerosis [203,204].

AD has a high prevalence in the elderly [205,206] and abundant research have been done about its pathophysiology and possible treatments for the disease including the use of factors secreted by the MSC of the human umbilical cord (hUCB-MSC) such as the GDF-15 factor, that promotes endogenous neurogenesis of the adult hippocampus and synaptic activity in a model of AD [207]. In addition, the use of these cells reduced β-amyloid (Aβx-42) plaques in the hippocampus and other regions. These data suggest that sICAM-1 derived from hUCB- MSC decreases Aβ plaques by inducing NEP expression in microglia via the sICAM-1/LFA- 1 signaling pathway [208]. At the same time, clinical trials have shown that the cerebral stereotactic injection of hUCB-MSC in patients with dementia due to mild to moderate AD was feasible, safe and well tolerated [209], however still more studies are needed to evaluate their efficacy to be used in the treatment of AD. Finally, a previous study [210] showed that several transplants of MSCs in the striatal zone regulated factors such as FGF-2, and significantly reduced the number of degenerating neurons in the striatum. This effect was probably mediated by factors secreted by MSCs since these were visible up to 60 days after transplantation, that may be involved in the reduction in brain damage under neurodegenerative conditions [210].

Spinal Cord Injury In comparison to other pathologies, the effect of CM-MSCs on spinal cord injury (SCI) showed greater progress in the discovery of possible mechanisms of neuroprotection. In this regard, studies at the neuronal level in an excitotoxicity model revealed that the expression of GAP-43, an essential protein for axonal and dendritic growth, increased considerably in parallel to an increase in the levels of ATP, NAD(+) and NADH after the treatment of neurons with CM-A-MSCs. These results can be relevant since excitotoxicity occurs in many neurological condition including after SCI or TBI. Previous studies have shown that trophic factors and bioactive molecules present in the CM- MSCs are regulating survival signaling pathways. A first study [211] pointed out that BDNF and GDNF found in the CM-BM-MSCs are involved in the growth of neurons of the spinal cord and that the protection exercised by BDNF is mediated in part by the activation of Akt. These findings correlate with studies in cerebellar neurons where they show that BM-MSCs are able to protect cerebellar neurons from cultured rodents, by modulating the phosphatidylinositol 3-kinase(PI3K)/Akt and MAPK pathways, and the antioxidant effect of superoxide dismutase 3, a protein synthesized and secreted by the BM-MSCs [150]. Similar results in axonal growth of neurons mediated by BDNF from hUCB-MSCs was reported previously [212]. Another of the signaling mechanism of action of CM-MSCs is the activation of the Jak/STAT3 pathway to maintain the well-being of the embryonic dorsal root ganglia [213]. As previously reported [213], neurogenesis and neurite growth are not only mediated by BDNF but also influenced by interleukin-6 (IL-6) and the leukemia inhibitory factor (LIF)

produced by PSC [213]. The above suggests that this signaling pathways stimulated by the CM-MSCs can be targeted by alternative therapies against peripheral nerve injury. Interestingly, the characterization of the CM-BM-MSCs revealed a series of molecules such as cytokines and trophic factors such as IGF-1, HGF, VEGF and TGF-β1 that contribute to neuronal survival and the growth of neurites in vitro and that can probably be used for the treatment of SCI, as previously demonstrated in rats [214]. Impressively, current evidence from studies using secretomes from A-MSC, BM-MSC and HUCPVCs highlight the fact that these cells induce the same degree of differentiation of human neural progenitor cells, and neurite growth in dorsal root ganglion explants [215]. These new perspectives in regenerative medicine research have encouraged the testing of new forms of application of trophic factors from MSCs. One of the new approaches includes the intrathecal administration of trophic factors secreted by mesenchymal stromal cells. The results showed that these factors improved the functional recovery and decreased the expression of IL-2, IL-6 and TNFα in a rat model of SCI [216]. On top of that, recent research shows that a new 3D biomimetic hydrogel designed to administer the factors secreted by the MSCs significantly immunomodulated the proinflammatory environment in an SCI mouse model, increasing the M2 macrophage population and promoting a pro-regenerative environment in situ [217].

Ischemia and Stroke Ischemia and stroke are another type of pathologies that are often affecting the well-being of human beings as TBI affects the family, social and professional life of patients who suffer from cognitive sequelae and other long-term negative effects after the traumatic event [218,219]. In vivo models of cerebral ischemia induced by hypoxia and ischemic stroke models have been used to evaluate the effects of the trophic factors of the BM-MSCs and A- MSCs, finding for both cases that these factors have a neuroprotective effect in stroke/induced injury [220,221]. Similar results were found when using MSCs, which have shown in organotypic cortical brain slices subject to oxygen-glucose deprivation to release human amniotic factors that may protect the brain from acute injury. Surprisingly, in this study they also found that fractions rich in metabolites of less than 700 kDa were protective, but this fraction did not contain protein or ribonucleic molecules. Interestingly, another study reported an equal effectiveness of CM-BM-MSCs derived from ischemic animals or from a normal population increasing neurogenesis and attenuating the infiltration of microglia/macrophages in brains [222]. All these results have reported an improvement in functional recovery in different models in vivo with ischemic stroke, which opens a plethora of possibilities and new alternatives for the treatment of this type of pathologies.

About the mechanism of action by which the CM-MSCs is exercising its neuroprotective effects in stroke, factors such as BDNF and HGF have been reported to have protective effects on damaged neonatal cortical neurons in a model of oxygen and glucose deprivation (a cellular model of stroke-related conditions), decreasing the signs of apoptosis/necrosis [223]. However, the presence of these two factors does not discard the possibility that there are other paracrine molecules with great neurotrophic potential. In this regard, the secretome analysis of mesenchymal stromal cells derived from the limbus (L-MSCs) showed that molecules such as human growth factor, neuroprotective cytokines and other factors such as VEGF, VEGFR3, BDNF, IGF-2 and HGF, are present which not only stimulate the growth of neurites, but also protect the hypoxic neurons in vitro and models of focal cerebral ischemia of rats in vivo [224]. To date, several studies support reports of the presence of BDNF secreted by transplanted MSCs. A first study showed how BDNF was one of the critical paracrine factors that played a fundamental role in the attenuation of severe brain lesions induced by intraventricular hemorrhage in newborn rats [225,226]. A second study showed that treatment with UC- MSCs attenuated the cerebral reactive gliosis and hypomyelination, and elevated BDNF and HGF levels in the cerebrospinal fluid, serum and brain tissue of a mouse model of neonatal intraventricular hemorrhage [227]. Ultimately, it is important to note that paracrine factors secreted by MSCs protect neurons from apoptotic cell death in the cerebral ischemia model by glucose deprivation and oxygen by activating and increasing the phosphorylation of STAT3 and Akt in neuronal cultures after treatment with CM-MSCs [228].

Effect of the secretome of mesenchymal cells derived from adipose tissue in brain pathologies. Adipose tissue is a vascularized connective tissue with important functions in protection, as an insulator, as an energy reservoir it can even act as an endocrine organ. When it is enzymatically disintegrated the adipose tissue can produce adipose MSCs (A-MSCs) [229]. Secretory studies have revealed that A-MSCs release molecules that can mediate processes of repair in different tissues including the nervous system (Table 1). For example, although the cytokines factor stimulating colonies of granulocytes and macrophages, IL-6, IL-7, IL- 8, IL-11 and TNFα are proinflammatory cytokines, they play a fundamental role in attracting phagocytic cells for the cleaning of waste in the injured area [23]. Also, it has been reported that trophic factors such as VEGF [230], HGF, TGF-β, FGF-2 [231-233] and other immunosuppressive molecules that contribute to controlling inflammation (PGE2 [234,235] and IL-10 [236]) are essential for wound healing. In addition, extracellular matrix molecules, hormones and some lipid mediators have been also reported to have beneficial neuroprotective effects [237,233]. A comparative study of the effects of CM-A-MSCs and CM-HUCPVC indicated that the latter promoted the strongest effect on neuronal survival [85]. The trophic factors in the CM

of these two cell types were bFGF, NGF, SCF, HGF, and VEGF with only bFGF absent in the CM-A-MSCs and a small expression of NGF in CM-HUCPVC [85]. In another study, BDNF and adipokines have been reported inside A-MSC secretome [235]. Furthermore, some studies have concluded that A-MSCs show similar cytokine secretory abilities than BM-MSCs [23]. On the other hand, there is evidence that CM-A-MSC/derived factors are responsible for protecting neurons from excitotoxicity due to an increased expression of GAP-43, an inhibition of neuronal damage and apoptosis, the stimulation of the regeneration and repair of nerves and the tissue bioenergetics, by increasing the levels of ATP, NAD(+) and NADH and the ratio of NAD+/NADH [26]. Currently, several studies evaluated the effect of CM-A-MSCs as a possible therapeutic alternative in various pathologies. For example, in a rat model of hypoxic-ischemic brain injury (HI) it was found that the CM-A-MSCs prevented the loss of cortical and hippocampal volume [27]. After two months of ischemia, the behavioral and learning tests showed that the subjects treated with CM-A-MSCs presented significantly better results in the functional maze water tests than controls [27]. A previous study [27] found, after a comparative evaluation of the secretome of MSCs from different sources such as adipose tissue, bone marrow cells and umbilical cord cells, that the A-MSCs secretome showed a greater potential to promote axonal growth versus the secretome of the other sources [215]. However, previous work compared the property of different MSCs to migrate to tumor sites, as a way to be used as tumor vectors. One of these studies [238] reported that UC-MSCs were more efficient than A-MSC for the induction of apoptosis but being unable to distinguish differences in their capacity of inducing differentiation [238]. Additionally, similar to other CM-MSCs, it has been reported the presence of angiogenic cytokines in CM-A-MSCs in vitro and in vivo. Among the reported factors are VEGF, HGF and FGF2, which increase neovascularization and improve wound healing in injured tissues [239]. This data suggests that therapy with A-MSCs and/or CM-A-MSCs could accelerate the healing of wounds through differentiation and vasculogenesis and other repair processes. The effects of CM-A-MSCs were evaluated in pathologies such as SCI, ischemia and stroke. An in vitro model of inflammation of SCI, the exposure to CM-A-MSCs stabilized the neuronal population but with no effect on astrogliosis, which suggests that it was due to neuroprotective and trophic factors [240]. Similar results were found in the recovery of neurological deficits in a stroke model in rats with a faster and more pronounced improvement compared to A-MSC injection [241]. While there are very few studies in relation to neurodegenerative diseases, the secretome of the CM-A-MSCs also showed an effect when they were associated with neprilysin. This association gives the exosomes the characteristic of being enzymatically active, with the property of acting on N2 cells decreasing the levels of the intracellular and secreted forms of Aβ peptide [242]. These results suggests that this approach can be expanded in other studies as a possible treatment for AD.

The evidence presented so far has shown the beneficial effect of CM-A-MSCs on different pathologies is probably due to different bioactive molecules synthesized and released by the MSCs. This has encouraged the obtention of CM-A-MSC after some pre-conditioning of the MSCs. For example, it is known that MSCs that were pre-conditioned with deferoxamine, increases the production of pro-angiogenic, neuroprotective and anti- inflammatory factors and the antioxidant capacity of the A-MSC secretome, and is considered as a possible treatment for diabetic neuropathy [243]. Another approach used to enhance the beneficial effects of secretomes from A-MSCs was the pre-stimulation of MSC with TNFα and IFNγ. This pre-stimulus caused the cells to release TSG-6, a protein that may be mitigating the visual deficits induced by a blast lesion through its anti- inflammatory properties on activated microglia and endothelial cells [244]. On top of that, it was recently found that the neuroprotective effect of CM-A-MSCs is affected by N-acetylcysteine supplementation. The study suggests that neuronal restorative effect of CM- AMSCs is associated with not only the release of essential neurotrophic factors, but also the maintenance of an appropriate redox state to preserve neuronal function [245]. Finally, other study described an additional mechanism of action by which the CM-A- MSCs exerts its protective effect [246]. In this study, it was found that the activation of the AMP-activated kinase pathway (AMPK) was induced by the presence of NGF, which has been reported in the A-MSCs secretome and involved in the neuritogenesis of PC12 cells [246]. In correlation with these findings [247], the authors found that CM-A-MSCs protected PC12 cells from apoptosis caused by glutamate excitotoxicity. However, in this case other factors were found such as VEGF, HGF and BDNF that are believed to be related to the activation of pathways such as PI3K/Akt and MAPK or in the reduction of caspase- 3 levels [247]. Taken together, these results may be useful for the treatment of stroke or neurodegenerative diseases.

Effect of the secretome of mesenchymal stem cells on glial cells and their involvement in cerebral pathologies. After brain injury, astrocytes are the first to respond generating a physiological action, either producing proinflammatory and/or anti-inflammatory actions that regulate the entry of particular signals for each case [248]. Despite these and other benefits that astrocytes have for nervous tissue and that have been mentioned, therapeutic alternatives as well as the search for possible treatments for various brain pathologies have been focused mainly at the neuronal level, forgetting other cells and their protective properties [249]. In this sense, some studies have recently focused their interest in evaluating the effect of CM- A-MSCs, CM-BM-MSCs or CM of another type of MSCs in the protection or stability of glial cells such as microglia and astrocytes. In relation to microglia, it was found that glial cells treated with CM-MSCs showed a significant decrease in the expression of mRNA and proinflammatory cytokine proteins (IL-6 and TNF-α) and the protein expression of NF-kB,

JNK, and c-Jun in a lipopolysaccharide (LPS) toxicity cell model [250]. It was also found that MSCs can release CX3CL1 and induce phenotypic and functional changes in microglia changing them from a proinflammatory to a neuroprotective phenotype [251]. These changes were similar to those induced by mesenchymal cells [252] and they could partly explain the reduction in mRNA of different cytokines. Torrente and colleagues using a model of glucose deprivation and mechanical injury (scratch) reported that the CM-A-MSCs protects the viability of an astrocytic model (T98G) [253], consistent with the decrease in the percentage of fragmented and condensed nuclei found using the same model reported by [254]. Also, in the case of astrocytes, some studies have reported additional effects of CM-MSCs on viability, morphology, mitochondrial protection, ROS regulation, among others (Table 2). Other investigations also reported that the CM of perivascular cells of the umbilical cord can regulate the viability and even the proliferation of glial cells and in primary cultures of hippocampal cells [255,256]. It is a well-known fact that mitochondria are one of the main organelles that are affected in the face of any change in the environment or cerebral pathological alteration [257]. Considering this evidence, several studies have evaluated the effect of CM-MSCs on the protection of the mitochondria and their functions. This investigation have revealed that bioactive factors and molecules secreted by different MSCs are capable of reducing the production of reactive oxygen species (ROS). Specifically, the CM-A-MSCs had an effect in decreasing the production of superoxide (O2-) [253]. In another study they authors found that the CM-A-MSCs also protected against oxidative stress damage, reducing DNA oxidation, lipoperoxidation and nitration of proteins caused by glucose deprivation and mechanical injury (scratch) in an astrocyte cell model (T98G) o [254]. In agreement with the previous findings, CM-hDPSCs blocked the production of ROS in astrocytes in an ischemia model by in vitro glucose and oxygen deprivation [258]. It has been found in astrocytes subject to glucose deprivation and mechanical damage (scratch) a protection of mitochondrial membrane potential [254,259], conservation of the ultrastructure preserving not only the number of mitochondria, but also the integrity of their crests [254]. Other studies showed that CM-HUCPVC influenced a greater number of cells from hippocampal cultures to be GFAP positive [255,256], and for the case of CM-A-MSCs, it showed the property of exercising changes in the cell morphology and the polarity index of an astrocytic model T98G [254] and in a model of human astrocytes subjected to glucose deprivation and mechanical injury (scratch) [259]. Morphological changes such as the polarity index are considered a parameter related to cell migration. Abundant evidence show that the protective effect of the MSCs can be through the regulation of the oxidative stress, improvement of cell migration, and mitochondrial protection mediated by the factors and/or bioactive neuroregulatory molecules. However, the mechanism by which these factors and/or molecules present in the CM-MSCs exert protection over glial cells has not been fully elucidated and still needs further studies. Some

progress in this respect has been done in a previous study [258] that showed a positive regulation of interleukin-1 (IL-1) as a cytoprotective factor against cell death. On the other hand, in an astrocytic model (T98G) subject to glucose deprivation and mechanical injury (scratch), the genetic silencing of neuroglobin, a protein considered to have neuroprotective effects, prevented the protective action of CM-A-MSCs [254]. Finally, other study [260] demonstrated that the paracrine factors of MSCs promote the survival of astrocytes by a mechanism associated with p38 MAPK and JNK inhibition, and the regulation of p53 and STAT1 and the downregulation of GFAP after ischemic stroke in vitro [260] (Figure 2).

Differences of the secretome of the mesenchymal stem cells depend on cell type, location and methodology used in the analysis For the study of MSCs, different techniques have been developed. Some studies are based on the approach of shotgun proteomics and on the proteomic approach based on candidate proteins. Other methodologies have focused on changes of protein expression in models of response to the disease, in models of cellular differentiation or undifferentiated cell states, as well as performing analysis using MSCs cells, their conditioned medium, or only from extracellular vesicles [1,32]. Considering the above, the great variety of approaches in proteomics studies and MSC secretome analysis does not yet provide a clear, complete and reliable knowledge of the molecules secreted from MSCs. One instance could be the study conducted by Kapur and Kats (2013) [233] and Makridakis et al. (2013) [32], whom assessed a compilation of the proteins observed in the shotgun proteomics of the CM-A-MSCs and CM-BM-MSCs studies. The authors point out how the characterization and detection of the secretome protein differ with respect to the type of cells that are analyzed, secretome preparation method and detection method [32,233].

Most proteomics studies are based on the analysis of different stages of differentiation (e.g from the adipose stem cell to a fully differentiated adipocyte), and then the comparison of the up or downregulation of genes. Nevertheless, each study is circumstantial and shows only a few proteins similarly expressed. Altogether, this evidence implies a great need for a more biological-related data. The increasing number of proteins that are identified in different environments (pathological or not) is creating a great understanding of proteins functions by placing them in different locations at different levels of expression. However, some precautious must be taken care of, because some of these proteins may be misplaced and represent artifacts, while others may be misinterpreted [1,32,107,233]. For example, differences that can be found between the proteomic analysis between CM-MSCs and MSCs, depending on the location of the protein in the cell, it could represent different related functions with the moment depending on its subcellular location (peri/extracellular) [107]. This represents a key obstacle in what is the function of each molecule in response to a pathological event and therefore will be related to the potential action upon a therapeutic use.

However, it is essential to perform a thorough and careful characterization of the secreted molecules, as well as to establish complete and uniform guidelines and criteria for obtaining them so that it can be applied and produced for clinical use.

Conclusions It is a fact that, not only the MSCs but also the paracrine factors and/or bioactive molecules synthesized and secreted by these cells, have great benefits on the nervous system by relieving and reducing the impact of the lesions on brain functions. MSCs secretome provides a light of hope for the regeneration of neurites, neuronal protection, preservation of astrocytic functions, repair of cell bioenergetics, reduction of excitotoxicity and ROS generation, and promotion of axon growth and. New research reveals different mechanisms of action induced by MSCs secretome, including inhibition of pathways related to cell death and activation of cell survival and protection signals. It is essential to increase the research on the effect MSCs secretome on glial cells, since previous studies focused exclusively on neurons. It is also important to extend the studies on the mechanism of action of the factors and/or bioactive molecules present in the MSCs secretome on pathologies such as TBI, ischemia and stroke, scaling at the level of research proving the effectiveness of CM-MSCs in biomodels, making them more robust and reliable. Pre-clinical and clinical studies may allow advances in the knowledge of their effectiveness; therefore, they may become a promising treatment in neurological conditions for which there are not still effective therapies. This approach may solve the problems of differentiation and migration of the MSCs in the site of the injury and it would add the advantages that the use of exosomes or specific biological factors secreted by from MSCs will facilitate the transport, storage and management of the therapeutic preparations at the clinical stage.

Acknowledgments This work was in part funded by PUJ grant (ID #7115) to GEB. We also acknowledge scholarships for doctoral studies granted by the Vicerrectoría Académica of PUJ to Baez- Jurado E and Hidalgo-Lanussa O. Conflict of Interests The authors declare no conflicts of interest. References

1. Lavoie JR, Rosu-Myles M (2013) Uncovering the secretes of mesenchymal stem cells. Biochimie 95 (12):2212-2221. doi:10.1016/j.biochi.2013.06.017 2. Martello G, Smith A (2014) The nature of embryonic stem cells. Annual review of cell and developmental biology 30:647-675. doi:10.1146/annurev-cellbio-100913-013116

3. Laird DJ, von Andrian UH, Wagers AJ (2008) Stem cell trafficking in tissue development, growth, and disease. Cell 132 (4):612-630. doi:10.1016/j.cell.2008.01.041 4. Ben Azouna N, Jenhani F, Regaya Z, Berraeis L, Ben Othman T, Ducrocq E, Domenech J (2012) Phenotypical and functional characteristics of mesenchymal stem cells from bone marrow: comparison of culture using different media supplemented with human platelet lysate or fetal bovine serum. Stem cell research & therapy 3 (1):6. doi:10.1186/scrt97 5. Chang CP, Chio CC, Cheong CU, Chao CM, Cheng BC, Lin MT (2013) Hypoxic preconditioning enhances the therapeutic potential of the secretome from cultured human mesenchymal stem cells in experimental traumatic brain injury. Clin Sci (Lond) 124 (3):165- 176. doi:10.1042/CS20120226 6. Guadix JA, Zugaza JL, Galvez-Martin P (2017) Characteristics, applications and prospects of mesenchymal stem cells in cell therapy. Medicina clinica 148 (9):408-414. doi:10.1016/j.medcli.2016.11.033 7. Schaffler A, Buchler C (2007) Concise review: adipose tissue-derived stromal cells--basic and clinical implications for novel cell-based therapies. Stem Cells 25 (4):818-827. doi:10.1634/stemcells.2006-0589 8. Mahmoudifar N, Doran PM (2015) Mesenchymal Stem Cells Derived from Human Adipose Tissue. Methods Mol Biol 1340:53-64. doi:10.1007/978-1-4939-2938-2_4 9. Gardner OF, Alini M, Stoddart MJ (2015) Mesenchymal Stem Cells Derived from Human Bone Marrow. Methods Mol Biol 1340:41-52. doi:10.1007/978-1-4939-2938-2_3 10. Phelps J, Sanati-Nezhad A, Ungrin M, Duncan NA, Sen A (2018) Bioprocessing of Mesenchymal Stem Cells and Their Derivatives: Toward Cell-Free Therapeutics. Stem cells international 2018:9415367. doi:10.1155/2018/9415367 11. Chagastelles PC, Nardi NB, Camassola M (2010) Biology and applications of mesenchymal stem cells. Science progress 93 (Pt 2):113-127 12. Zheng G, Huang L, Tong H, Shu Q, Hu Y, Ge M, Deng K, Zhang L, Zou B, Cheng B, Xu J (2014) Treatment of acute respiratory distress syndrome with allogeneic adipose- derived mesenchymal stem cells: a randomized, placebo-controlled pilot study. Respiratory research 15:39. doi:10.1186/1465-9921-15-39 13. DiNunzio JC, Williams RO, 3rd (2008) CNS disorders--current treatment options and the prospects for advanced therapies. Drug development and industrial pharmacy 34 (11):1141- 1167. doi:10.1080/03639040802020536 14. Shoichet MS, Tate CC, Baumann MD, LaPlaca MC (2008) Strategies for Regeneration and Repair in the Injured Central Nervous System. In: Reichert WM (ed) Indwelling Neural Implants: Strategies for Contending with the In Vivo Environment. Frontiers in Neuroengineering. Boca Raton (FL), 15. Zhu Y, Chen X, Yang X, Ei-Hashash A (2018) Stem cells in lung repair and regeneration: Current applications and future promise. Journal of cellular physiology 233 (10):6414-6424. doi:10.1002/jcp.26414 16. Shologu N, Scully M, Laffey JG, O'Toole D (2018) Human Mesenchymal Stem Cell Secretome from Bone Marrow or Adipose-Derived Tissue Sources for Treatment of Hypoxia-Induced Pulmonary Epithelial Injury. International journal of molecular sciences 19 (10). doi:10.3390/ijms19102996 17. Phan J, Kumar P, Hao D, Gao K, Farmer D, Wang A (2018) Engineering mesenchymal stem cells to improve their exosome efficacy and yield for cell-free therapy. Journal of extracellular vesicles 7 (1):1522236. doi:10.1080/20013078.2018.1522236

18. Venugopal C, Shobha K, Rai KS, Pinnelli VB, Kutty BM, Dhanushkodi A (2018) Neuroprotection by Human Dental Pulp Mesenchymal Stem Cells: From Billions to Nano. Current gene therapy. doi:10.2174/1566523218666180913152615 19. Chen YX, Zeng ZC, Sun J, Zeng HY, Huang Y, Zhang ZY (2015) Mesenchymal stem cell-conditioned medium prevents radiation-induced liver injury by inhibiting inflammation and protecting sinusoidal endothelial cells. Journal of radiation research 56 (4):700-708. doi:10.1093/jrr/rrv026 20. Zagoura DS, Roubelakis MG, Bitsika V, Trohatou O, Pappa KI, Kapelouzou A, Antsaklis A, Anagnou NP (2012) Therapeutic potential of a distinct population of human amniotic fluid mesenchymal stem cells and their secreted molecules in mice with acute hepatic failure. Gut 61 (6):894-906. doi:10.1136/gutjnl-2011-300908 21. Vizoso FJ, Eiro N, Cid S, Schneider J, Perez-Fernandez R (2017) Mesenchymal Stem Cell Secretome: Toward Cell-Free Therapeutic Strategies in Regenerative Medicine. International journal of molecular sciences 18 (9). doi:10.3390/ijms18091852 22. Toma C, Pittenger MF, Cahill KS, Byrne BJ, Kessler PD (2002) Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 105 (1):93-98 23. Kilroy GE, Foster SJ, Wu X, Ruiz J, Sherwood S, Heifetz A, Ludlow JW, Stricker DM, Potiny S, Green P, Halvorsen YD, Cheatham B, Storms RW, Gimble JM (2007) Cytokine profile of human adipose-derived stem cells: expression of angiogenic, hematopoietic, and pro-inflammatory factors. Journal of cellular physiology 212 (3):702-709. doi:10.1002/jcp.21068 24. Linero I, Chaparro O (2014) Paracrine effect of mesenchymal stem cells derived from human adipose tissue in bone regeneration. PloS one 9 (9):e107001. doi:10.1371/journal.pone.0107001 25. Kupcova Skalnikova H (2013) Proteomic techniques for characterisation of mesenchymal stem cell secretome. Biochimie 95 (12):2196-2211. doi:10.1016/j.biochi.2013.07.015 26. Hao P, Liang Z, Piao H, Ji X, Wang Y, Liu Y, Liu R, Liu J (2014) Conditioned medium of human adipose-derived mesenchymal stem cells mediates protection in neurons following glutamate excitotoxicity by regulating energy metabolism and GAP-43 expression. Metabolic brain disease 29 (1):193-205. doi:10.1007/s11011-014-9490-y 27. Wei X, Du Z, Zhao L, Feng D, Wei G, He Y, Tan J, Lee WH, Hampel H, Dodel R, Johnstone BH, March KL, Farlow MR, Du Y (2009) IFATS collection: The conditioned media of adipose stromal cells protect against hypoxia-ischemia-induced brain damage in neonatal rats. Stem Cells 27 (2):478-488. doi:10.1634/stemcells.2008-0333 28. Cirillo G, Bianco MR, Colangelo AM, Cavaliere C, Daniele de L, Zaccaro L, Alberghina L, Papa M (2011) Reactive astrocytosis-induced perturbation of synaptic homeostasis is restored by nerve growth factor. Neurobiology of disease 41 (3):630-639. doi:10.1016/j.nbd.2010.11.012 29. Deng LX, Hu J, Liu N, Wang X, Smith GM, Wen X, Xu XM (2011) GDNF modifies reactive astrogliosis allowing robust axonal regeneration through Schwann cell-seeded guidance channels after spinal cord injury. Experimental neurology 229 (2):238-250. doi:10.1016/j.expneurol.2011.02.001 30. Bongso AAL, Eng Hin%A Brenner, Sydney%A Yeo, Philip Stem Cells. Stem Cells. doi:10.1142/5729

31. Liras A (2010) Future research and therapeutic applications of human stem cells: general, regulatory, and bioethical aspects. Journal of translational medicine 8:131. doi:10.1186/1479-5876-8-131 32. Makridakis M, Roubelakis MG, Vlahou A (2013) Stem cells: insights into the secretome. Biochimica et biophysica acta 1834 (11):2380-2384. doi:10.1016/j.bbapap.2013.01.032 33. Spees JL, Lee RH, Gregory CA (2016) Mechanisms of mesenchymal stem/stromal cell function. Stem cell research & therapy 7 (1):125. doi:10.1186/s13287-016-0363-7 34. Lee TH, Yoon JG (2008) Intracerebral transplantation of human adipose tissue stromal cells after middle cerebral artery occlusion in rats. Journal of clinical neuroscience : official journal of the Neurosurgical Society of Australasia 15 (8):907-912. doi:10.1016/j.jocn.2007.03.016 35. De Miguel MP, Arnalich Montiel F, Lopez Iglesias P, Blazquez Martinez A, Nistal M (2009) Epiblast-derived stem cells in embryonic and adult tissues. The International journal of developmental biology 53 (8-10):1529-1540. doi:10.1387/ijdb.072413md 36. Savatier P, Osteil P, Tam PP (2017) Pluripotency of embryo-derived stem cells from rodents, lagomorphs, and primates: Slippery slope, terrace and cliff. Stem cell research 19:104-112. doi:10.1016/j.scr.2017.01.008 37. Gimble J, Guilak F (2003) Adipose-derived adult stem cells: isolation, characterization, and differentiation potential. Cytotherapy 5 (5):362-369. doi:10.1080/14653240310003026 38. Paul G, Anisimov SV (2013) The secretome of mesenchymal stem cells: potential implications for neuroregeneration. Biochimie 95 (12):2246-2256. doi:10.1016/j.biochi.2013.07.013 39. Mitsiadis TA, Barrandon O, Rochat A, Barrandon Y, De Bari C (2007) Stem cell niches in mammals. Experimental cell research 313 (16):3377-3385. doi:10.1016/j.yexcr.2007.07.027 40. Maumus M, Jorgensen C, Noel D (2013) Mesenchymal stem cells in regenerative medicine applied to rheumatic diseases: role of secretome and exosomes. Biochimie 95 (12):2229-2234. doi:10.1016/j.biochi.2013.04.017 41. Li L, Xie T (2005) Stem cell niche: structure and function. Annual review of cell and developmental biology 21:605-631. doi:10.1146/annurev.cellbio.21.012704.131525 42. Caplan AI, Hariri R (2015) Body Management: Mesenchymal Stem Cells Control the Internal Regenerator. Stem cells translational medicine 4 (7):695-701. doi:10.5966/sctm.2014-0291 43. Marinkovic M, Block TJ, Rakian R, Li Q, Wang E, Reilly MA, Dean DD, Chen XD (2016) One size does not fit all: developing a cell-specific niche for in vitro study of cell behavior. Matrix biology : journal of the International Society for Matrix Biology 52-54:426- 441. doi:10.1016/j.matbio.2016.01.004 44. Bieback K, Kern S, Kluter H, Eichler H (2004) Critical parameters for the isolation of mesenchymal stem cells from umbilical cord blood. Stem Cells 22 (4):625-634. doi:10.1634/stemcells.22-4-625 45. Koc ON, Gerson SL, Cooper BW, Dyhouse SM, Haynesworth SE, Caplan AI, Lazarus HM (2000) Rapid hematopoietic recovery after coinfusion of autologous-blood stem cells and culture-expanded marrow mesenchymal stem cells in advanced breast cancer patients receiving high-dose chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 18 (2):307-316. doi:10.1200/JCO.2000.18.2.307

46. Deus GC, Normanton M, Hamerschlak N, Kondo AT, Ribeiro AA, Goldberg AC, Marti LC (2012) Isolation and characterization of mesenchymal stem cells obtained from reusable and disposable bone marrow collection filters. Einstein (Sao Paulo) 10 (3):296-301 47. Uccelli A, Moretta L, Pistoia V (2006) Immunoregulatory function of mesenchymal stem cells. European journal of immunology 36 (10):2566-2573. doi:10.1002/eji.200636416 48. Ma L, Aijima R, Hoshino Y, Yamaza H, Tomoda E, Tanaka Y, Sonoda S, Song G, Zhao W, Nonaka K, Shi S, Yamaza T (2015) Transplantation of mesenchymal stem cells ameliorates secondary osteoporosis through interleukin-17-impaired functions of recipient bone marrow mesenchymal stem cells in MRL/lpr mice. Stem cell research & therapy 6:104. doi:10.1186/s13287-015-0091-4 49. Sun S, Chen G, Xu M, Qiao Y, Zheng S (2013) Differentiation and migration of bone marrow mesenchymal stem cells transplanted through the spleen in rats with portal hypertension. PloS one 8 (12):e83523. doi:10.1371/journal.pone.0083523 50. de Aro AA, Carneiro GD, Teodoro LFR, da Veiga FC, Ferrucci DL, Simoes GF, Simoes PW, Alvares LE, de Oliveira ALR, Vicente CP, Gomes CP, Pesquero JB, Esquisatto MAM, de Campos Vidal B, Pimentel ER (2018) Injured Achilles Tendons Treated with Adipose- Derived Stem Cells Transplantation and GDF-5. Cells 7 (9). doi:10.3390/cells7090127 51. Volarevic V, Markovic BS, Gazdic M, Volarevic A, Jovicic N, Arsenijevic N, Armstrong L, Djonov V, Lako M, Stojkovic M (2018) Ethical and Safety Issues of Stem Cell-Based Therapy. International journal of medical sciences 15 (1):36-45. doi:10.7150/ijms.21666 52. Yagi H, Kitagawa Y (2013) The role of mesenchymal stem cells in cancer development. Frontiers in genetics 4:261. doi:10.3389/fgene.2013.00261 53. Lee HY, Hong IS (2017) Double-edged sword of mesenchymal stem cells: Cancer- promoting versus therapeutic potential. Cancer science 108 (10):1939-1946. doi:10.1111/cas.13334 54. Ridge SM, Sullivan FJ, Glynn SA (2017) Mesenchymal stem cells: key players in cancer progression. Molecular cancer 16 (1):31. doi:10.1186/s12943-017-0597-8 55. Keller G (2005) Embryonic stem cell differentiation: emergence of a new era in biology and medicine. Genes & development 19 (10):1129-1155. doi:10.1101/gad.1303605 56. Park IH, Lerou PH, Zhao R, Huo H, Daley GQ (2008) Generation of human-induced pluripotent stem cells. Nature protocols 3 (7):1180-1186. doi:10.1038/nprot.2008.92 57. Mochizuki H, Choong CJ, Yasuda T (2014) The promises of stem cells: stem cell therapy for movement disorders. Parkinsonism & related disorders 20 Suppl 1:S128-131. doi:10.1016/S1353-8020(13)70031-2 58. Wobus AM, Boheler KR (2005) Embryonic stem cells: prospects for developmental biology and cell therapy. Physiological reviews 85 (2):635-678. doi:10.1152/physrev.00054.2003 59. Menasche P, Vanneaux V, Hagege A, Bel A, Cholley B, Cacciapuoti I, Parouchev A, Benhamouda N, Tachdjian G, Tosca L, Trouvin JH, Fabreguettes JR, Bellamy V, Guillemain R, Suberbielle Boissel C, Tartour E, Desnos M, Larghero J (2015) Human embryonic stem cell-derived cardiac progenitors for severe heart failure treatment: first clinical case report. European heart journal 36 (30):2011-2017. doi:10.1093/eurheartj/ehv189 60. Liu YW, Chen B, Yang X, Fugate JA, Kalucki FA, Futakuchi-Tsuchida A, Couture L, Vogel KW, Astley CA, Baldessari A, Ogle J, Don CW, Steinberg ZL, Seslar SP, Tuck SA, Tsuchida H, Naumova AV, Dupras SK, Lyu MS, Lee J, Hailey DW, Reinecke H, Pabon L, Fryer BH, MacLellan WR, Thies RS, Murry CE (2018) Human embryonic stem cell-derived

cardiomyocytes restore function in infarcted hearts of non-human primates. Nature biotechnology 36 (7):597-605. doi:10.1038/nbt.4162 61. Schwartz SD, Hubschman JP, Heilwell G, Franco-Cardenas V, Pan CK, Ostrick RM, Mickunas E, Gay R, Klimanskaya I, Lanza R (2012) Embryonic stem cell trials for macular degeneration: a preliminary report. Lancet 379 (9817):713-720. doi:10.1016/S0140- 6736(12)60028-2 62. Schwartz SD, Regillo CD, Lam BL, Eliott D, Rosenfeld PJ, Gregori NZ, Hubschman JP, Davis JL, Heilwell G, Spirn M, Maguire J, Gay R, Bateman J, Ostrick RM, Morris D, Vincent M, Anglade E, Del Priore LV, Lanza R (2015) Human embryonic stem cell-derived retinal pigment epithelium in patients with age-related macular degeneration and Stargardt's macular dystrophy: follow-up of two open-label phase 1/2 studies. Lancet 385 (9967):509-516. doi:10.1016/S0140-6736(14)61376-3 63. Tani K (2015) Towards the safer clinical translation of human induced pluripotent stem cell-derived cells to regenerative medicine. Molecular therapy Methods & clinical development 2:15032. doi:10.1038/mtm.2015.32 64. Kim N, Cho SG (2013) Clinical applications of mesenchymal stem cells. The Korean journal of internal medicine 28 (4):387-402. doi:10.3904/kjim.2013.28.4.387 65. Rojas M, Meruane M (2012) Potential evolutionary cell and regenerative medicine. INTERNATIONAL JOURNAL OF MORPHOLOGY 30 (4):1243-1251 66. Yu KR, Yang SR, Jung JW, Kim H, Ko K, Han DW, Park SB, Choi SW, Kang SK, Scholer H, Kang KS (2012) CD49f enhances multipotency and maintains stemness through the direct regulation of OCT4 and SOX2. Stem Cells 30 (5):876-887. doi:10.1002/stem.1052 67. Ali F, Stott SR, Barker RA (2014) Stem cells and the treatment of Parkinson's disease. Experimental neurology 260:3-11. doi:10.1016/j.expneurol.2012.12.017 68. Hassan WU, Greiser U, Wang W (2014) Role of adipose-derived stem cells in wound healing. Wound repair and regeneration : official publication of the Wound Healing Society [and] the European Tissue Repair Society 22 (3):313-325. doi:10.1111/wrr.12173 69. Katsuda T, Kosaka N, Takeshita F, Ochiya T (2013) The therapeutic potential of mesenchymal stem cell-derived extracellular vesicles. Proteomics 13 (10-11):1637-1653. doi:10.1002/pmic.201200373Submitted 70. De Feo D, Merlini A, Laterza C, Martino G (2012) Neural stem cell transplantation in central nervous system disorders: from cell replacement to neuroprotection. Current opinion in neurology 25 (3):322-333. doi:10.1097/WCO.0b013e328352ec45 71. Brunt KR, Weisel RD, Li RK (2012) Stem cells and regenerative medicine - future perspectives. Canadian journal of physiology and pharmacology 90 (3):327-335. doi:10.1139/y2012-007 72. Doege CA, Inoue K, Yamashita T, Rhee DB, Travis S, Fujita R, Guarnieri P, Bhagat G, Vanti WB, Shih A, Levine RL, Nik S, Chen EI, Abeliovich A (2012) Early-stage epigenetic modification during somatic cell reprogramming by Parp1 and Tet2. Nature 488 (7413):652- 655. doi:10.1038/nature11333 73. Inestrosa NC, Varela-Nallar L (2014) Wnt signaling in the nervous system and in Alzheimer's disease. Journal of molecular cell biology 6 (1):64-74 74. Forostyak S, Jendelova P, Sykova E (2013) The role of mesenchymal stromal cells in spinal cord injury, regenerative medicine and possible clinical applications. Biochimie 95 (12):2257-2270. doi:10.1016/j.biochi.2013.08.004

75. Srinageshwar B, Maiti P, Dunbar GL, Rossignol J (2016) Role of Epigenetics in Stem Cell Proliferation and Differentiation: Implications for Treating Neurodegenerative Diseases. International journal of molecular sciences 17 (2). doi:10.3390/ijms17020199 76. Soldner F, Hockemeyer D, Beard C, Gao Q, Bell GW, Cook EG, Hargus G, Blak A, Cooper O, Mitalipova M, Isacson O, Jaenisch R (2009) Parkinson's disease patient-derived induced pluripotent stem cells free of viral reprogramming factors. Cell 136 (5):964-977. doi:10.1016/j.cell.2009.02.013 77. Hu BY, Weick JP, Yu J, Ma LX, Zhang XQ, Thomson JA, Zhang SC (2010) Neural differentiation of human induced pluripotent stem cells follows developmental principles but with variable potency. Proceedings of the National Academy of Sciences of the United States of America 107 (9):4335-4340. doi:10.1073/pnas.0910012107 78. Nori S, Okada Y, Yasuda A, Tsuji O, Takahashi Y, Kobayashi Y, Fujiyoshi K, Koike M, Uchiyama Y, Ikeda E, Toyama Y, Yamanaka S, Nakamura M, Okano H (2011) Grafted human-induced pluripotent stem-cell-derived neurospheres promote motor functional recovery after spinal cord injury in mice. Proceedings of the National Academy of Sciences of the United States of America 108 (40):16825-16830. doi:10.1073/pnas.1108077108 79. Mariani J, Simonini MV, Palejev D, Tomasini L, Coppola G, Szekely AM, Horvath TL, Vaccarino FM (2012) Modeling human cortical development in vitro using induced pluripotent stem cells. Proceedings of the National Academy of Sciences of the United States of America 109 (31):12770-12775. doi:10.1073/pnas.1202944109 80. Marchetto MC, Carromeu C, Acab A, Yu D, Yeo GW, Mu Y, Chen G, Gage FH, Muotri AR (2010) A model for neural development and treatment of Rett syndrome using human induced pluripotent stem cells. Cell 143 (4):527-539. doi:10.1016/j.cell.2010.10.016 81. Kassem M (2004) Mesenchymal stem cells: biological characteristics and potential clinical applications. Cloning and stem cells 6 (4):369-374. doi:10.1089/clo.2004.6.369 82. De Ugarte DA, Morizono K, Elbarbary A, Alfonso Z, Zuk PA, Zhu M, Dragoo JL, Ashjian P, Thomas B, Benhaim P, Chen I, Fraser J, Hedrick MH (2003) Comparison of multi- lineage cells from human adipose tissue and bone marrow. Cells, tissues, organs 174 (3):101- 109. doi:10.1159/000071150 83. Kern S, Eichler H, Stoeve J, Kluter H, Bieback K (2006) Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells 24 (5):1294-1301. doi:10.1634/stemcells.2005-0342 84. Hsieh JY, Wang HW, Chang SJ, Liao KH, Lee IH, Lin WS, Wu CH, Lin WY, Cheng SM (2013) Mesenchymal stem cells from human umbilical cord express preferentially secreted factors related to neuroprotection, neurogenesis, and angiogenesis. PloS one 8 (8):e72604. doi:10.1371/journal.pone.0072604 85. Ribeiro CA, Fraga JS, Graos M, Neves NM, Reis RL, Gimble JM, Sousa N, Salgado AJ (2012) The secretome of stem cells isolated from the adipose tissue and Wharton jelly acts differently on central nervous system derived cell populations. Stem cell research & therapy 3 (3):18. doi:10.1186/scrt109 86. Vessey CJ, de la Hall PM (2001) Hepatic stem cells: a review. Pathology 33 (2):130-141 87. Knoblich JA (2008) Mechanisms of asymmetric stem cell division. Cell 132 (4):583-597. doi:10.1016/j.cell.2008.02.007 88. Blanpain C, Lowry WE, Geoghegan A, Polak L, Fuchs E (2004) Self-renewal, multipotency, and the existence of two cell populations within an epithelial stem cell niche. Cell 118 (5):635-648. doi:10.1016/j.cell.2004.08.012

89. Christiano AM (2004) Epithelial stem cells: stepping out of their niche. Cell 118 (5):530- 532. doi:10.1016/j.cell.2004.08.024 90. Fuchs E, Tumbar T, Guasch G (2004) Socializing with the neighbors: stem cells and their niche. Cell 116 (6):769-778 91. Behrstock S, Svendsen C (2001) Neural Stem Cells. e LS 92. Herberts CA, Kwa MS, Hermsen HP (2011) Risk factors in the development of stem cell therapy. Journal of translational medicine 9:29. doi:10.1186/1479-5876-9-29 93. Mitsiadis TA, Barrandon O, Rochat A, Barrandon Y, De Bari C (2007) Stem cell niches in mammals. Experimental cell research 313 (16):3377-3385 94. Chamberlain G, Fox J, Ashton B, Middleton J (2007) Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells 25 (11):2739-2749. doi:10.1634/stemcells.2007-0197 95. Rigotti G, Marchi A, Sbarbati A (2009) Adipose-derived mesenchymal stem cells: past, present, and future. Aesthetic plastic surgery 33 (3):271-273. doi:10.1007/s00266-009-9339- 7 96. Locke M, Windsor J, Dunbar PR (2009) Human adipose-derived stem cells: isolation, characterization and applications in surgery. ANZ journal of surgery 79 (4):235-244. doi:10.1111/j.1445-2197.2009.04852.x 97. Li L, Xie T (2005) Stem cell niche: structure and function. Annu Rev Cell Dev Biol 21:605-631 98. Sadat S, Gehmert S, Song Y-H, Yen Y, Bai X, Gaiser S, Klein H, Alt E (2007) The cardioprotective effect of mesenchymal stem cells is mediated by IGF-I and VEGF. Biochemical and biophysical research communications 363 (3):674-679 99. Lim JS, Yoo G (2010) Effects of adipose-derived stromal cells and of their extract on wound healing in a mouse model. Journal of Korean medical science 25 (5):746-751 100. Sharma RR, Pollock K, Hubel A, McKenna D (2014) Mesenchymal stem or stromal cells: a review of clinical applications and manufacturing practices. Transfusion 54 (5):1418- 1437 101. Silva NA, Gimble JM, Sousa N, Reis RL, Salgado AJ (2013) Combining adult stem cells and olfactory ensheathing cells: the secretome effect. Stem cells and development 22 (8):1232-1240. doi:10.1089/scd.2012.0524 102. Rani S, Ryan AE, Griffin MD, Ritter T (2015) Mesenchymal Stem Cell-derived Extracellular Vesicles: Toward Cell-free Therapeutic Applications. Molecular therapy : the journal of the American Society of Gene Therapy 23 (5):812-823. doi:10.1038/mt.2015.44 103. Wang Z, Wang Y, Gutkind JS, Wang F, Lu J, Niu G, Teng G, Chen X (2015) Engineered mesenchymal stem cells with enhanced tropism and paracrine secretion of cytokines and growth factors to treat traumatic brain injury. Stem Cells 33 (2):456-467. doi:10.1002/stem.1878 104. Rani S, Ritter T (2016) The Exosome - A Naturally Secreted Nanoparticle and its Application to Wound Healing. Adv Mater 28 (27):5542-5552. doi:10.1002/adma.201504009 105. Wu L, Wang T, Ge Y, Cai X, Wang J, Lin Y (2012) Secreted factors from adipose tissue increase adipogenic differentiation of mesenchymal stem cells. Cell proliferation 45 (4):311- 319. doi:10.1111/j.1365-2184.2012.00823.x 106. Shabbir A, Zisa D, Suzuki G, Lee T (2009) Heart failure therapy mediated by the trophic activities of bone marrow mesenchymal stem cells: a noninvasive therapeutic regimen.

American journal of physiology Heart and circulatory physiology 296 (6):H1888-1897. doi:10.1152/ajpheart.00186.2009 107. Caccia D, Dugo M, Callari M, Bongarzone I (2013) Bioinformatics tools for secretome analysis. Biochimica et biophysica acta 1834 (11):2442-2453. doi:10.1016/j.bbapap.2013.01.039 108. Madrigal M, Rao KS, Riordan NH (2014) A review of therapeutic effects of mesenchymal stem cell secretions and induction of secretory modification by different culture methods. Journal of translational medicine 12:260. doi:10.1186/s12967-014-0260-8 109. Golchin A, Hosseinzadeh S, Ardeshirylajimi A (2018) The exosomes released from different cell types and their effects in wound healing. Journal of cellular biochemistry 119 (7):5043-5052. doi:10.1002/jcb.26706 110. Wu P, Zhang B, Shi H, Qian H, Xu W (2018) MSC-exosome: A novel cell-free therapy for cutaneous regeneration. Cytotherapy 20 (3):291-301. doi:10.1016/j.jcyt.2017.11.002 111. Lunyak VV, Amaro-Ortiz A, Gaur M (2017) Mesenchymal Stem Cells Secretory Responses: Senescence Messaging Secretome and Immunomodulation Perspective. Frontiers in genetics 8:220. doi:10.3389/fgene.2017.00220 112. Seo M, Kim JC, Kim HK, Choi EW, Jeong S, Nam KC, Jang M (2018) A Novel Secretory Vesicle from Deer Antlerogenic Mesenchymal Stem Cell-Conditioned Media (DaMSC-CM) Promotes Tissue Regeneration. Stem cells international 2018:3891404. doi:10.1155/2018/3891404 113. Xitong D, Xiaorong Z (2016) Targeted therapeutic delivery using engineered exosomes and its applications in cardiovascular diseases. Gene 575 (2 Pt 2):377-384. doi:10.1016/j.gene.2015.08.067 114. Yanez-Mo M, Siljander PR, Andreu Z, Zavec AB, Borras FE, Buzas EI, Buzas K, Casal E, Cappello F, Carvalho J, Colas E, Cordeiro-da Silva A, Fais S, Falcon-Perez JM, Ghobrial IM, Giebel B, Gimona M, Graner M, Gursel I, Gursel M, Heegaard NH, Hendrix A, Kierulf P, Kokubun K, Kosanovic M, Kralj-Iglic V, Kramer-Albers EM, Laitinen S, Lasser C, Lener T, Ligeti E, Line A, Lipps G, Llorente A, Lotvall J, Mancek-Keber M, Marcilla A, Mittelbrunn M, Nazarenko I, Nolte-'t Hoen EN, Nyman TA, O'Driscoll L, Olivan M, Oliveira C, Pallinger E, Del Portillo HA, Reventos J, Rigau M, Rohde E, Sammar M, Sanchez-Madrid F, Santarem N, Schallmoser K, Ostenfeld MS, Stoorvogel W, Stukelj R, Van der Grein SG, Vasconcelos MH, Wauben MH, De Wever O (2015) Biological properties of extracellular vesicles and their physiological functions. Journal of extracellular vesicles 4:27066. doi:10.3402/jev.v4.27066 115. Castro-Manrreza ME, Montesinos JJ (2015) Immunoregulation by mesenchymal stem cells: biological aspects and clinical applications. Journal of immunology research 2015:394917. doi:10.1155/2015/394917 116. Cao W, Cao K, Cao J, Wang Y, Shi Y (2015) Mesenchymal stem cells and adaptive immune responses. Immunology letters 168 (2):147-153. doi:10.1016/j.imlet.2015.06.003 117. Burrello J, Monticone S, Gai C, Gomez Y, Kholia S, Camussi G (2016) Stem Cell- Derived Extracellular Vesicles and Immune-Modulation. Frontiers in cell and developmental biology 4:83. doi:10.3389/fcell.2016.00083 118. Skog J, Wurdinger T, van Rijn S, Meijer DH, Gainche L, Sena-Esteves M, Curry WT, Jr., Carter BS, Krichevsky AM, Breakefield XO (2008) Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nature cell biology 10 (12):1470-1476. doi:10.1038/ncb1800

119. Taylor DD, Gercel-Taylor C (2008) MicroRNA signatures of tumor-derived exosomes as diagnostic biomarkers of ovarian cancer. Gynecologic oncology 110 (1):13-21. doi:10.1016/j.ygyno.2008.04.033 120. Nam EJ, Yoon H, Kim SW, Kim H, Kim YT, Kim JH, Kim JW, Kim S (2008) MicroRNA expression profiles in serous ovarian carcinoma. Clinical cancer research : an official journal of the American Association for Cancer Research 14 (9):2690-2695. doi:10.1158/1078-0432.CCR-07-1731 121. Lai RC, Yeo RW, Lim SK (2015) Mesenchymal stem cell exosomes. Seminars in cell & developmental biology 40:82-88. doi:10.1016/j.semcdb.2015.03.001 122. Nakamura Y, Miyaki S, Ishitobi H, Matsuyama S, Nakasa T, Kamei N, Akimoto T, Higashi Y, Ochi M (2015) Mesenchymal-stem-cell-derived exosomes accelerate skeletal muscle regeneration. FEBS letters 589 (11):1257-1265. doi:10.1016/j.febslet.2015.03.031 123. Mokarizadeh A, Delirezh N, Morshedi A, Mosayebi G, Farshid AA, Mardani K (2012) Microvesicles derived from mesenchymal stem cells: potent organelles for induction of tolerogenic signaling. Immunology letters 147 (1-2):47-54. doi:10.1016/j.imlet.2012.06.001 124. Zhang B, Wang M, Gong A, Zhang X, Wu X, Zhu Y, Shi H, Wu L, Zhu W, Qian H, Xu W (2015) HucMSC-Exosome Mediated-Wnt4 Signaling Is Required for Cutaneous Wound Healing. Stem Cells 33 (7):2158-2168. doi:10.1002/stem.1771 125. Wu S, Ju GQ, Du T, Zhu YJ, Liu GH (2013) Microvesicles derived from human umbilical cord Wharton's jelly mesenchymal stem cells attenuate bladder tumor cell growth in vitro and in vivo. PloS one 8 (4):e61366. doi:10.1371/journal.pone.0061366 126. Li T, Yan Y, Wang B, Qian H, Zhang X, Shen L, Wang M, Zhou Y, Zhu W, Li W, Xu W (2013) Exosomes derived from human umbilical cord mesenchymal stem cells alleviate liver fibrosis. Stem cells and development 22 (6):845-854. doi:10.1089/scd.2012.0395 127. Lai RC, Arslan F, Lee MM, Sze NS, Choo A, Chen TS, Salto-Tellez M, Timmers L, Lee CN, El Oakley RM, Pasterkamp G, de Kleijn DP, Lim SK (2010) Exosome secreted by MSC reduces myocardial ischemia/reperfusion injury. Stem cell research 4 (3):214-222. doi:10.1016/j.scr.2009.12.003 128. Zhu YG, Feng XM, Abbott J, Fang XH, Hao Q, Monsel A, Qu JM, Matthay MA, Lee JW (2014) Human mesenchymal stem cell microvesicles for treatment of Escherichia coli endotoxin-induced acute lung injury in mice. Stem Cells 32 (1):116-125. doi:10.1002/stem.1504 129. Harrell CR, Simovic Markovic B, Fellabaum C, Arsenijevic A, Djonov V, Arsenijevic N, Volarevic V (2018) Therapeutic Potential of Mesenchymal Stem Cell-Derived Exosomes in the Treatment of Eye Diseases. Advances in experimental medicine and biology. doi:10.1007/5584_2018_219 130. Yu B, Zhang X, Li X (2014) Exosomes derived from mesenchymal stem cells. International journal of molecular sciences 15 (3):4142-4157. doi:10.3390/ijms15034142 131. Zhang Y, Chopp M, Meng Y, Katakowski M, Xin H, Mahmood A, Xiong Y (2015) Effect of exosomes derived from multipluripotent mesenchymal stromal cells on functional recovery and neurovascular plasticity in rats after traumatic brain injury. Journal of neurosurgery 122 (4):856-867. doi:10.3171/2014.11.JNS14770 132. Koniusz S, Andrzejewska A, Muraca M, Srivastava AK, Janowski M, Lukomska B (2016) Extracellular Vesicles in Physiology, Pathology, and Therapy of the Immune and Central Nervous System, with Focus on Extracellular Vesicles Derived from Mesenchymal Stem Cells as Therapeutic Tools. Frontiers in cellular neuroscience 10:109. doi:10.3389/fncel.2016.00109

133. Nakano M, Nagaishi K, Konari N, Saito Y, Chikenji T, Mizue Y, Fujimiya M (2016) Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into damaged neurons and astrocytes. Scientific reports 6:24805. doi:10.1038/srep24805 134. Lankford KL, Arroyo EJ, Nazimek K, Bryniarski K, Askenase PW, Kocsis JD (2018) Intravenously delivered mesenchymal stem cell-derived exosomes target M2-type macrophages in the injured spinal cord. PloS one 13 (1):e0190358. doi:10.1371/journal.pone.0190358 135. Xin H, Wang F, Li Y, Lu QE, Cheung WL, Zhang Y, Zhang ZG, Chopp M (2017) Secondary Release of Exosomes From Astrocytes Contributes to the Increase in Neural Plasticity and Improvement of Functional Recovery After Stroke in Rats Treated With Exosomes Harvested From MicroRNA 133b-Overexpressing Multipotent Mesenchymal Stromal Cells. Cell transplantation 26 (2):243-257. doi:10.3727/096368916X693031 136. Lafourcade C, Ramirez JP, Luarte A, Fernandez A, Wyneken U (2016) MiRNAs in Astrocyte-Derived Exosomes as Possible Mediators of Neuronal Plasticity. Journal of experimental neuroscience 10 (Suppl 1):1-9. doi:10.4137/JEN.S39916 137. Farinazzo A, Angiari S, Turano E, Bistaffa E, Dusi S, Ruggieri S, Bonafede R, Mariotti R, Constantin G, Bonetti B (2018) Nanovesicles from adipose-derived mesenchymal stem cells inhibit T lymphocyte trafficking and ameliorate chronic experimental autoimmune encephalomyelitis. Scientific reports 8 (1):7473. doi:10.1038/s41598-018-25676-2 138. Han Y, Seyfried D, Meng Y, Yang D, Schultz L, Chopp M (2018) Multipotent mesenchymal stromal cell-derived exosomes improve functional recovery after experimental intracerebral hemorrhage in the rat. Journal of neurosurgery:1-11. doi:10.3171/2018.2.JNS171475 139. Zhang Y, Chopp M, Zhang ZG, Katakowski M, Xin H, Qu C, Ali M, Mahmood A, Xiong Y (2017) Systemic administration of cell-free exosomes generated by human bone marrow derived mesenchymal stem cells cultured under 2D and 3D conditions improves functional recovery in rats after traumatic brain injury. Neurochemistry international 111:69- 81. doi:10.1016/j.neuint.2016.08.003 140. Duan X, Lu L, Wang Y, Zhang F, Mao J, Cao M, Lin B, Zhang X, Shuai X, Shen J (2017) The long-term fate of mesenchymal stem cells labeled with magnetic resonance imaging-visible polymersomes in cerebral ischemia. International journal of nanomedicine 12:6705-6719. doi:10.2147/IJN.S146742 141. Chiellini C, Cochet O, Negroni L, Samson M, Poggi M, Ailhaud G, Alessi MC, Dani C, Amri EZ (2008) Characterization of human mesenchymal stem cell secretome at early steps of adipocyte and osteoblast differentiation. BMC molecular biology 9:26. doi:10.1186/1471-2199-9-26 142. DeLany JP, Floyd ZE, Zvonic S, Smith A, Gravois A, Reiners E, Wu X, Kilroy G, Lefevre M, Gimble JM (2005) Proteomic analysis of primary cultures of human adipose- derived stem cells: modulation by Adipogenesis. Molecular & cellular proteomics : MCP 4 (6):731-740. doi:10.1074/mcp.M400198-MCP200 143. Lo Furno D, Mannino G, Giuffrida R (2018) Functional role of mesenchymal stem cells in the treatment of chronic neurodegenerative diseases. Journal of cellular physiology 233 (5):3982-3999. doi:10.1002/jcp.26192 144. De la Rosa MB, Kozik EM, Sakaguchi DS (2018) Adult Stem Cell-Based Strategies for Peripheral Nerve Regeneration. Advances in experimental medicine and biology. doi:10.1007/5584_2018_254

145. Kim DH, Lee D, Lim H, Choi SJ, Oh W, Yang YS, Chang JH, Jeon HB (2018) Effect of growth differentiation factor-15 secreted by human umbilical cord blood-derived mesenchymal stem cells on amyloid beta levels in in vitro and in vivo models of Alzheimer's disease. Biochemical and biophysical research communications 504 (4):933-940. doi:10.1016/j.bbrc.2018.09.012 146. Joyce N, Annett G, Wirthlin L, Olson S, Bauer G, Nolta JA (2010) Mesenchymal stem cells for the treatment of neurodegenerative disease. Regenerative medicine 5 (6):933-946. doi:10.2217/rme.10.72 147. Barile L, Vassalli G (2017) Exosomes: Therapy delivery tools and biomarkers of diseases. Pharmacology & therapeutics 174:63-78. doi:10.1016/j.pharmthera.2017.02.020 148. Gnecchi M, Danieli P, Cervio E (2012) Mesenchymal stem cell therapy for heart disease. Vascular pharmacology 57 (1):48-55. doi:10.1016/j.vph.2012.04.002 149. Bartolucci J, Verdugo FJ, Gonzalez PL, Larrea RE, Abarzua E, Goset C, Rojo P, Palma I, Lamich R, Pedreros PA, Valdivia G, Lopez VM, Nazzal C, Alcayaga-Miranda F, Cuenca J, Brobeck MJ, Patel AN, Figueroa FE, Khoury M (2017) Safety and Efficacy of the Intravenous Infusion of Umbilical Cord Mesenchymal Stem Cells in Patients With Heart Failure: A Phase 1/2 Randomized Controlled Trial (RIMECARD Trial [Randomized Clinical Trial of Intravenous Infusion Umbilical Cord Mesenchymal Stem Cells on Cardiopathy]). Circulation research 121 (10):1192-1204. doi:10.1161/CIRCRESAHA.117.310712 150. Kemp K, Hares K, Mallam E, Heesom KJ, Scolding N, Wilkins A (2010) Mesenchymal stem cell-secreted superoxide dismutase promotes cerebellar neuronal survival. Journal of neurochemistry 114 (6):1569-1580. doi:10.1111/j.1471-4159.2009.06553.x 151. Um S, Kim HY, Lee JH, Song IS, Seo BM (2017) TSG-6 secreted by mesenchymal stem cells suppresses immune reactions influenced by BMP-2 through p38 and MEK mitogen-activated protein kinase pathway. Cell and tissue research 368 (3):551-561. doi:10.1007/s00441-017-2581-4 152. Day AJ, Milner CM (2018) TSG-6: A multifunctional protein with anti-inflammatory and tissue-protective properties. Matrix biology : journal of the International Society for Matrix Biology. doi:10.1016/j.matbio.2018.01.011 153. Arslan F, Lai RC, Smeets MB, Akeroyd L, Choo A, Aguor EN, Timmers L, van Rijen HV, Doevendans PA, PasterkampSubmitted G, Lim SK, de Kleijn DP (2013) Mesenchymal stem cell- derived exosomes increase ATP levels, decrease oxidative stress and activate PI3K/Akt pathway to enhance myocardial viability and prevent adverse remodeling after myocardial ischemia/reperfusion injury. Stem cell research 10 (3):301-312. doi:10.1016/j.scr.2013.01.002 154. Uccelli A, Pistoia V, Moretta L (2007) Mesenchymal stem cells: a new strategy for immunosuppression? Trends in immunology 28 (5):219-226. doi:10.1016/j.it.2007.03.001 155. Bruno S, Grange C, Deregibus MC, Calogero RA, Saviozzi S, Collino F, Morando L, Busca A, Falda M, Bussolati B, Tetta C, Camussi G (2009) Mesenchymal stem cell-derived microvesicles protect against acute tubular injury. Journal of the American Society of Nephrology : JASN 20 (5):1053-1067. doi:10.1681/ASN.2008070798 156. Cantaluppi V, Gatti S, Medica D, Figliolini F, Bruno S, Deregibus MC, Sordi A, Biancone L, Tetta C, Camussi G (2012) Microvesicles derived from endothelial progenitor cells protect the kidney from ischemia-reperfusion injury by microRNA-dependent reprogramming of resident renal cells. Kidney international 82 (4):412-427. doi:10.1038/ki.2012.105

157. Lai WH, Ho JC, Chan YC, Ng JH, Au KW, Wong LY, Siu CW, Tse HF (2013) Attenuation of hind-limb ischemia in mice with endothelial-like cells derived from different sources of human stem cells. PloS one 8 (3):e57876. doi:10.1371/journal.pone.0057876 158. Jackson WM, Nesti LJ, Tuan RS (2012) Mesenchymal stem cell therapy for attenuation of scar formation during wound healing. Stem cell research & therapy 3 (3):20. doi:10.1186/scrt111 159. Li M, Luan F, Zhao Y, Hao H, Liu J, Dong L, Fu X, Han W (2017) Mesenchymal stem cell-conditioned medium accelerates wound healing with fewer scars. International wound journal 14 (1):64-73. doi:10.1111/iwj.12551 160. Osugi M, Katagiri W, Yoshimi R, Inukai T, Hibi H, Ueda M (2012) Conditioned media from mesenchymal stem cells enhanced bone regeneration in rat calvarial bone defects. Tissue engineering Part A 18 (13-14):1479-1489. doi:10.1089/ten.TEA.2011.0325 161. Park EH, Lim HS, Lee S, Roh K, Seo KW, Kang KS, Shin K (2018) Intravenous Infusion of Umbilical Cord Blood-Derived Mesenchymal Stem Cells in Rheumatoid Arthritis: A Phase Ia Clinical Trial. Stem cells translational medicine 7 (9):636-642. doi:10.1002/sctm.18-0031 162. Maumus M, Manferdini C, Toupet K, Peyrafitte JA, Ferreira R, Facchini A, Gabusi E, Bourin P, Jorgensen C, Lisignoli G, Noel D (2013) Adipose mesenchymal stem cells protect chondrocytes from degeneration associated with osteoarthritis. Stem cell research 11 (2):834- 844. doi:10.1016/j.scr.2013.05.008 163. Kota DJ, Wiggins LL, Yoon N, Lee RH (2013) TSG-6 produced by hMSCs delays the onset of autoimmune diabetes by suppressing Th1 development and enhancing tolerogenicity. Diabetes 62 (6):2048-2058. doi:10.2337/db12-0931 164. Kim HS, Lee JH, Roh KH, Jun HJ, Kang KS, Kim TY (2017) Clinical Trial of Human Umbilical Cord Blood-Derived Stem Cells for the Treatment of Moderate-to-Severe Atopic Dermatitis: Phase I/IIa Studies. Stem Cells 35 (1):248-255. doi:10.1002/stem.2401 165. da Silva AF, Silva K, Reis LA, Teixeira VP, Schor N (2015) Bone Marrow-Derived Mesenchymal Stem Cells and Their Conditioned Medium Attenuate Fibrosis in an Irreversible Model of Unilateral Ureteral Obstruction. Cell transplantation 24 (12):2657- 2666. doi:10.3727/096368915X687534 166. Shen C, Lie P, Miao T, Yu M, Lu Q, Feng T, Li J, Zu T, Liu X, Li H (2015) Conditioned medium from umbilical cord mesenchymal stem cells induces migration and angiogenesis. Molecular medicine reports 12 (1):20-30. doi:10.3892/mmr.2015.3409 167. Kawai T, Katagiri W, Osugi M, Sugimura Y, Hibi H, Ueda M (2015) Secretomes from bone marrow-derived mesenchymal stromal cells enhance periodontal tissue regeneration. Cytotherapy 17 (4):369-381. doi:10.1016/j.jcyt.2014.11.009 168. McKee AC, Daneshvar DH (2015) The neuropathology of traumatic brain injury. Handbook of clinical neurology 127:45-66. doi:10.1016/B978-0-444-52892-6.00004-0 169. Ling H, Hardy J, Zetterberg H (2015) Neurological consequences of traumatic brain injuries in sports. Molecular and cellular neurosciences 66 (Pt B):114-122. doi:10.1016/j.mcn.2015.03.012 170. Prins M, Greco T, Alexander D, Giza CC (2013) The pathophysiology of traumatic brain injury at a glance. Disease models & mechanisms 6 (6):1307-1315. doi:10.1242/dmm.011585 171. Quijano MC, Cuervo MT, Aponte M, Arango JC (2012) Neuropsicología del trauma craneoencefálico en Cali, Colombia. 2012 10 (1):11

172. Albert-Weissenberger C, Siren AL, Kleinschnitz C (2013) Ischemic stroke and traumatic brain injury: the role of the kallikrein-kinin system. Progress in neurobiology 101- 102:65-82. doi:10.1016/j.pneurobio.2012.11.004 173. Oliva AA, Jr., Kang Y, Sanchez-Molano J, Furones C, Atkins CM (2012) STAT3 signaling after traumatic brain injury. Journal of neurochemistry 120 (5):710-720. doi:10.1111/j.1471-4159.2011.07610.x 174. Hinzman JM, Thomas TC, Quintero JE, Gerhardt GA, Lifshitz J (2012) Disruptions in the regulation of extracellular glutamate by neurons and glia in the rat striatum two days after diffuse brain injury. Journal of neurotrauma 29 (6):1197-1208. doi:10.1089/neu.2011.2261 175. Cao T, Thomas TC, Ziebell JM, Pauly JR, Lifshitz J (2012) Morphological and genetic activation of microglia after diffuse traumatic brain injury in the rat. Neuroscience 225:65- 75. doi:10.1016/j.neuroscience.2012.08.058 176. Chen Y, Swanson RA (2003) Astrocytes and brain injury. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism 23 (2):137-149. doi:10.1097/01.WCB.0000044631.80210.3C 177. Barreto GE, Gonzalez J, Torres Y, Morales L (2011) Astrocytic-neuronal crosstalk: implications for neuroprotection from brain injury. Neuroscience research 71 (2):107-113. doi:10.1016/j.neures.2011.06.004 178. Fan Y, Shen F, Frenzel T, Zhu W, Ye J, Liu J, Chen Y, Su H, Young WL, Yang GY (2010) Endothelial progenitor cell transplantation improves long-term stroke outcome in mice. Annals of neurology 67 (4):488-497. doi:10.1002/ana.21919 179. Wei H, Mao Q, Liu L, Xu Y, Chen J, Jiang R, Yin L, Fan Y, Chopp M, Dong J, Zhang J (2011) Changes and function of circulating endothelial progenitor cells in patients with cerebral aneurysm. Journal of neuroscience research 89 (11):1822-1828. doi:10.1002/jnr.22696 180. Harting MT, Jimenez F, Xue H, Fischer UM, Baumgartner J, Dash PK, Cox CS (2009) Intravenous mesenchymal stem cell therapy for traumatic brain injury. Journal of neurosurgery 110 (6):1189-1197. doi:10.3171/2008.9.JNS08158 181. Gao J, Prough DS, McAdoo DJ, Grady JJ, Parsley MO, Ma L, Tarensenko YI, Wu P (2006) Transplantation of primed human fetal neural stem cells improves cognitive function in rats after traumatic brain injury. Experimental neurology 201 (2):281-292. doi:10.1016/j.expneurol.2006.04.039 182. Thonhoff JR, Lou DI, Jordan PM, Zhao X, Wu P (2008) Compatibility of human fetal neural stem cells with hydrogel biomaterials in vitro. Brain research 1187:42-51. doi:10.1016/j.brainres.2007.10.046 183. Otsuka T, Imura T, Nakagawa K, Shrestha L, Takahashi S, Kawahara Y, Sueda T, Kurisu K, Yuge L (2018) Simulated Microgravity Culture Enhances the Neuroprotective Effects of Human Cranial Bone-Derived Mesenchymal Stem Cells in Traumatic Brain Injury. Stem cells and development 27 (18):1287-1297. doi:10.1089/scd.2017.0299 184. Ullah I, Subbarao RB, Rho GJ (2015) Human mesenchymal stem cells - current trends and future prospective. Bioscience reports 35 (2). doi:10.1042/BSR20150025 185. Chuang TJ, Lin KC, Chio CC, Wang CC, Chang CP, Kuo JR (2012) Effects of secretome obtained from normoxia-preconditioned human mesenchymal stem cells in traumatic brain injury rats. The journal of trauma and acute care surgery 73 (5):1161-1167. doi:10.1097/TA.0b013e318265d128 186. Galindo LT, Filippo TR, Semedo P, Ariza CB, Moreira CM, Camara NO, Porcionatto MA (2011) Mesenchymal stem cell therapy modulates the inflammatory response in

experimental traumatic brain injury. Neurology research international 2011:564089. doi:10.1155/2011/564089 187. Cohen SP, Mao J (2014) Neuropathic pain: mechanisms and their clinical implications. BMJ 348:f7656. doi:10.1136/bmj.f7656 188. Mesentier-Louro LA, Zaverucha-do-Valle C, da Silva-Junior AJ, Nascimento-Dos- Santos G, Gubert F, de Figueiredo AB, Torres AL, Paredes BD, Teixeira C, Tovar-Moll F, Mendez-Otero R, Santiago MF (2014) Distribution of mesenchymal stem cells and effects on neuronal survival and axon regeneration after optic nerve crush and cell therapy. PloS one 9 (10):e110722. doi:10.1371/journal.pone.0110722 189. Papazian I, Kyrargyri V, Evangelidou M, Voulgari-Kokota A, Probert L (2018) Mesenchymal Stem Cell Protection of Neurons against Glutamate Excitotoxicity Involves Reduction of NMDA-Triggered Calcium Responses and Surface GluR1, and Is Partly Mediated by TNF. International journal of molecular sciences 19 (3). doi:10.3390/ijms19030651 190. de Pedro-Cuesta J, Rabano A, Martinez-Martin P, Ruiz-Tovar M, Alcalde-Cabero E, Almazan-Isla J, Avellanal F, Calero M (2015) Comparative Incidence of Conformational, Neurodegenerative Disorders. PloS one 10 (9):e0137342. doi:10.1371/journal.pone.0137342 191. Cannon JR, Greenamyre JT (2011) The role of environmental exposures in neurodegeneration and neurodegenerative diseases. Toxicological sciences : an official journal of the Society of Toxicology 124 (2):225-250. doi:10.1093/toxsci/kfr239 192. Olson SD, Pollock K, Kambal A, Cary W, Mitchell GM, Tempkin J, Stewart H, McGee J, Bauer G, Kim HS, Tempkin T, Wheelock V, Annett G, Dunbar G, Nolta JA (2012) Genetically engineered mesenchymal stem cells as a proposed therapeutic for Huntington's disease. Molecular neurobiology 45 (1):87-98. doi:10.1007/s12035-011-8219-8 193. Drago D, Cossetti C, Iraci N, Gaude E, Musco G, Bachi A, Pluchino S (2013) The stem cell secretome and its role in brain repair. Biochimie 95 (12):2271-2285. doi:10.1016/j.biochi.2013.06.020 194. Wang F, Yasuhara T, Shingo T, Kameda M, Tajiri N, Yuan WJ, Kondo A, Kadota T, Baba T, Tayra JT, Kikuchi Y, Miyoshi Y, Date I (2010) Intravenous administration of mesenchymal stem cells exerts therapeutic effects on parkinsonian model of rats: focusing on neuroprotective effects of stromal cell-derived factor-1alpha. BMC neuroscience 11:52. doi:10.1186/1471-2202-11-52 195. Kim EK, Lim S, Park JM, Seo JK, Kim JH, Kim KT, Ryu SH, Suh PG (2012) Human mesenchymal stem cell differentiation to the osteogenic or adipogenic lineage is regulated by AMP-activated protein kinase. Journal of cellular physiology 227 (4):1680-1687. doi:10.1002/jcp.22892 196. Burke RE, O'Malley K (2013) Axon degeneration in Parkinson's disease. Experimental neurology 246:72-83. doi:10.1016/j.expneurol.2012.01.011 197. Tagliaferro P, Burke RE (2016) Retrograde Axonal Degeneration in Parkinson Disease. Journal of Parkinson's disease 6 (1):1-15. doi:10.3233/JPD-150769 198. Whone AL, Kemp K, Sun M, Wilkins A, Scolding NJ (2012) Human bone marrow mesenchymal stem cells protect catecholaminergic and serotonergic neuronal perikarya and transporter function from oxidative stress by the secretion of glial-derived neurotrophic factor. Brain research 1431:86-96. doi:10.1016/j.brainres.2011.10.038 199. Hoban DB, Howard L, Dowd E (2015) GDNF-secreting mesenchymal stem cells provide localized neuroprotection in an inflammation-driven rat model of Parkinson's disease. Neuroscience 303:402-411. doi:10.1016/j.neuroscience.2015.07.014

200. Datta I, Bhonde R (2012) Can mesenchymal stem cells reduce vulnerability of dopaminergic neurons in the substantia nigra to oxidative insult in individuals at risk to Parkinson's disease? Cell biology international 36 (7):617-624. doi:10.1042/CBI20110602 201. Dahbour S, Jamali F, Alhattab D, Al-Radaideh A, Ababneh O, Al-Ryalat N, Al-Bdour M, Hourani B, Msallam M, Rasheed M, Huneiti A, Bahou Y, Tarawneh E, Awidi A (2017) Mesenchymal stem cells and conditioned media in the treatment of multiple sclerosis patients: Clinical, ophthalmological and radiological assessments of safety and efficacy. CNS neuroscience & therapeutics 23 (11):866-874. doi:10.1111/cns.12759 202. Cruz-Martinez P, Gonzalez-Granero S, Molina-Navarro MM, Pacheco-Torres J, Garcia- Verdugo JM, Geijo-Barrientos E, Jones J, Martinez S (2016) Intraventricular injections of mesenchymal stem cells activate endogenous functional remyelination in a chronic demyelinating murine model. Cell death & disease 7:e2223. doi:10.1038/cddis.2016.130 203. Petrou P, Gothelf Y, Argov Z, Gotkine M, Levy YS, Kassis I, Vaknin-Dembinsky A, Ben-Hur T, Offen D, Abramsky O, Melamed E, Karussis D (2016) Safety and Clinical Effects of Mesenchymal Stem Cells Secreting Neurotrophic Factor Transplantation in Patients With Amyotrophic Lateral Sclerosis: Results of Phase 1/2 and 2a Clinical Trials. JAMA neurology 73 (3):337-344. doi:10.1001/jamaneurol.2015.4321 204. Kim HY, Kim H, Oh KW, Oh SI, Koh SH, Baik W, Noh MY, Kim KS, Kim SH (2014) Biological markers of mesenchymal stromal cells as predictors of response to autologous stem cell transplantation in patients with amyotrophic lateral sclerosis: an investigator- initiated trial and in vivo study. Stem Cells 32 (10):2724-2731. doi:10.1002/stem.1770 205. Mayeux R, Stern Y (2012) Epidemiology of Alzheimer disease. Cold Spring Harbor perspectives in medicine 2 (8). doi:10.1101/cshperspect.a006239 206. Qiu C, Kivipelto M, von Strauss E (2009) Epidemiology of Alzheimer's disease: occurrence, determinants, and strategies toward intervention. Dialogues in clinical neuroscience 11 (2):111-128 207. Kim DH, Lee D, Chang EH, Kim JH, Hwang JW, Kim JY, Kyung JW, Kim SH, Oh JS, Shim SM, Na DL, Oh W, Chang JW (2015) GDF-15 secreted from human umbilical cord blood mesenchymal stem cells delivered through the cerebrospinal fluid promotes hippocampal neurogenesis and synaptic activity in an Alzheimer's disease model. Stem cells and development 24 (20):2378-2390. doi:10.1089/scd.2014.0487 208. Kim JY, Kim DH, Kim JH, Lee D, Jeon HB, Kwon SJ, Kim SM, Yoo YJ, Lee EH, Choi SJ, Seo SW, Lee JI, Na DL, Yang YS, Oh W, Chang JW (2012) Soluble intracellular adhesion molecule-1 secreted by human umbilical cord blood-derived mesenchymal stem cell reduces amyloid-beta plaques. Cell death and differentiation 19 (4):680-691. doi:10.1038/cdd.2011.140 209. Kim HJ, Seo SW, Chang JW, Lee JI, Kim CH, Chin J, Choi SJ, Kwon H, Yun HJ, Lee JM, Kim ST, Choe YS, Lee KH, Na DL (2015) Stereotactic brain injection of human umbilical cord blood mesenchymal stem cells in patients with Alzheimer's disease dementia: A phase 1 clinical trial. Alzheimers Dement (N Y) 1 (2):95-102. doi:10.1016/j.trci.2015.06.007 210. Moraes L, Vasconcelos-dos-Santos A, Santana FC, Godoy MA, Rosado-de-Castro PH, Jasmin, Azevedo-Pereira RL, Cintra WM, Gasparetto EL, Santiago MF, Mendez-Otero R (2012) Neuroprotective effects and magnetic resonance imaging of mesenchymal stem cells labeled with SPION in a rat model of Huntington's disease. Stem cell research 9 (2):143-155. doi:10.1016/j.scr.2012.05.005

211. Wilkins A, Kemp K, Ginty M, Hares K, Mallam E, Scolding N (2009) Human bone marrow-derived mesenchymal stem cells secrete brain-derived neurotrophic factor which promotes neuronal survival in vitro. Stem cell research 3 (1):63-70. doi:10.1016/j.scr.2009.02.006 212. Martins LF, Costa RO, Pedro JR, Aguiar P, Serra SC, Teixeira FG, Sousa N, Salgado AJ, Almeida RD (2017) Mesenchymal stem cells secretome-induced axonal outgrowth is mediated by BDNF. Scientific reports 7 (1):4153. doi:10.1038/s41598-017-03592-1 213. Brick RM, Sun AX, Tuan RS (2018) Neurotrophically Induced Mesenchymal Progenitor Cells Derived from Induced Pluripotent Stem Cells Enhance Neuritogenesis via Neurotrophin and Cytokine Production. Stem cells translational medicine 7 (1):45-58. doi:10.1002/sctm.17-0108 214. Nakano N, Nakai Y, Seo TB, Yamada Y, Ohno T, Yamanaka A, Nagai Y, Fukushima M, Suzuki Y, Nakatani T, Ide C (2010) Characterization of conditioned medium of cultured bone marrow stromal cells. Neuroscience letters 483 (1):57-61. doi:10.1016/j.neulet.2010.07.062 215. Assuncao-Silva RC, Mendes-Pinheiro B, Patricio P, Behie LA, Teixeira FG, Pinto L, Salgado AJ (2018) Exploiting the impact of the secretome of MSCs isolated from different tissue sources on neuronal differentiation and axonal growth. Biochimie. doi:10.1016/j.biochi.2018.07.026 216. Cizkova D, Cubinkova V, Smolek T, Murgoci AN, Danko J, Vdoviakova K, Humenik F, Cizek M, Quanico J, Fournier I, Salzet M (2018) Localized Intrathecal Delivery of Mesenchymal Stromal Cells Conditioned Medium Improves Functional Recovery in a Rat Model of Spinal Cord Injury. International journal of molecular sciences 19 (3). doi:10.3390/ijms19030870 217. Caron I, Rossi F, Papa S, Aloe R, Sculco M, Mauri E, Sacchetti A, Erba E, Panini N, Parazzi V, Barilani M, Forloni G, Perale G, Lazzari L, Veglianese P (2016) A new three dimensional biomimetic hydrogel to deliver factors secreted by human mesenchymal stem cells in spinal cord injury. Biomaterials 75:135-147. doi:10.1016/j.biomaterials.2015.10.024 218. Endres M, Dirnagl U (2003) Ischemia and stroke. In: Molecular and Cellular Biology of Neuroprotection in the CNS. Springer, pp 455-473 219. Neymotin SA, Taxin Z, Mohan A, Lipton P (2015) Brain Ischemia and Stroke. Encyclopedia of Computational Neuroscience:437-441 220. Kemp K, Hares K, Mallam E, Heesom KJ, Scolding N, Wilkins A (2010) Mesenchymal stem cell-secreted superoxide dismutase promotes cerebellar neuronal survival. Journal of neurochemistry 114 (6):1569-1580 221. Tsai M-J, Tsai S-K, Hu B-R, Liou D-Y, Huang S-L, Huang M-C, Huang W-C, Cheng H, Huang S-S (2014) Recovery of neurological function of ischemic stroke by application of conditioned medium of bone marrow mesenchymal stem cells derived from normal and cerebral ischemia rats. Journal of biomedical science 21 (1):5 222. Tsai MJ, Tsai SK, Hu BR, Liou DY, Huang SL, Huang MC, Huang WC, Cheng H, Huang SS (2014) Recovery of neurological function of ischemic stroke by application of conditioned medium of bone marrow mesenchymal stem cells derived from normal and cerebral ischemia rats. Journal of biomedical science 21:5. doi:10.1186/1423-0127-21-5 223. Mukai T, Tojo A, Nagamura-Inoue T (2018) Umbilical Cord-Derived Mesenchymal Stromal Cells Contribute to Neuroprotection in Neonatal Cortical Neurons Damaged by Oxygen-Glucose Deprivation. Frontiers in neurology 9:466. doi:10.3389/fneur.2018.00466

224. Liang CM, Weng SJ, Tsai TH, Li IH, Lu PH, Ma KH, Tai MC, Chen JT, Cheng CY, Huang YS (2014) Neurotrophic and neuroprotective potential of human limbus-derived mesenchymal stromal cells. Cytotherapy 16 (10):1371-1383. doi:10.1016/j.jcyt.2014.05.015 225. Ahn SY, Chang YS, Sung DK, Sung SI, Ahn JY, Park WS (2017) Pivotal Role of Brain- Derived Neurotrophic Factor Secreted by Mesenchymal Stem Cells in Severe Intraventricular Hemorrhage in Newborn Rats. Cell transplantation 26 (1):145-156. doi:10.3727/096368916X692861 226. Zemel'ko VI, Kozhukharova IB, Alekseenko LL, Domnina AP, Reshetnikova GF, Puzanov MV, Dmitrieva RI, Grinchuk TM, Nikol'skii NN, Anisimov SV (2013) [Neurogenic potential of human mesenchymal stem cells isolated from bone marrow, adipose tissue and endometrium: a comparative study]. Tsitologiia 55 (2):101-110 227. Mukai T, Mori Y, Shimazu T, Takahashi A, Tsunoda H, Yamaguchi S, Kiryu S, Tojo A, Nagamura-Inoue T (2017) Intravenous injection of umbilical cord-derived mesenchymal stromal cells attenuates reactive gliosis and hypomyelination in a neonatal intraventricular hemorrhage model. Neuroscience 355:175-187. doi:10.1016/j.neuroscience.2017.05.006 228. Scheibe F, Klein O, Klose J, Priller J (2012) Mesenchymal stromal cells rescue cortical neurons from apoptotic cell death in an in vitro model of cerebral ischemia. Cellular and molecular neurobiology 32 (4):567-576. doi:10.1007/s10571-012-9798-2 229. Kokai LE, Marra K, Rubin JP (2014) Adipose stem cells: biology and clinical applications for tissue repair and regeneration. Translational research : the journal of laboratory and clinical medicine 163 (4):399-408. doi:10.1016/j.trsl.2013.11.009 230. Song SY, Chung HM, Sung JH (2010) The pivotal role of VEGF in adipose-derived- stem-cell-mediated regeneration. Expert opinion on biological therapy 10 (11):1529-1537. doi:10.1517/14712598.2010.522987 231. Hampel U, Klonisch T, Sel S, Schulze U, Garreis F, Seitmann H, Zouboulis CC, Paulsen FP (2013) Insulin-like factor 3 promotes wound healing at the ocular surface. Endocrinology 154 (6):2034-2045. doi:10.1210/en.2012-2201 232. Kim WS, Park BS, Sung JH (2009) The wound-healing and antioxidant effects of adipose-derived stem cells. Expert opinion on biological therapy 9 (7):879-887. doi:10.1517/14712590903039684 233. Kapur SK, Katz AJ (2013) Review of the adipose derived stem cell secretome. Biochimie 95 (12):2222-2228. doi:10.1016/j.biochi.2013.06.001 234. Cui L, Yin S, Liu W, Li N, Zhang W, Cao Y (2007) Expanded adipose-derived stem cells suppress mixed lymphocyte reaction by secretion of prostaglandin E2. Tissue engineering 13 (6):1185-1195. doi:10.1089/ten.2006.0315 235. Salgado AJ, Reis RL, Sousa NJ, Gimble JM (2010) Adipose tissue derived stem cells secretome: soluble factors and their roles in regenerative medicine. Current stem cell research & therapy 5 (2):103-110 236. Machado Cde V, Telles PD, Nascimento IL (2013) Immunological characteristics of mesenchymal stem cells. Revista brasileira de hematologia e hemoterapia 35 (1):62-67. doi:10.5581/1516-8484.20130017 237. Kiess W, Petzold S, Topfer M, Garten A, Bluher S, Kapellen T, Korner A, Kratzsch J (2008) Adipocytes and adipose tissue. Best practice & research Clinical endocrinology & metabolism 22 (1):135-153. doi:10.1016/j.beem.2007.10.002 238. Yang C, Lei D, Ouyang W, Ren J, Li H, Hu J, Huang S (2014) Conditioned media from human adipose tissue-derived mesenchymal stem cells and umbilical cord-derived mesenchymal stem cells efficiently induced the apoptosis and differentiation in human

glioma cell lines in vitro. BioMed research international 2014:109389. doi:10.1155/2014/109389 239. Nie C, Yang D, Xu J, Si Z, Jin X, Zhang J (2011) Locally administered adipose-derived stem cells accelerate wound healing through differentiation and vasculogenesis. Cell transplantation 20 (2):205-216. doi:10.3727/096368910X520065 240. Szekiova E, Slovinska L, Blasko J, Plsikova J, Cizkova D (2018) The neuroprotective effect of rat adipose tissue-derived mesenchymal stem cell-conditioned medium on cortical neurons using an in vitro model of SCI inflammation. Neurological research 40 (4):258-267. doi:10.1080/01616412.2018.1432266 241. Zhao K, Li R, Gu C, Liu L, Jia Y, Guo X, Zhang W, Pei C, Tian L, Li B, Jia J, Cheng H, Xu H, Li L (2017) Intravenous Administration of Adipose-Derived Stem Cell Protein Extracts Improves Neurological Deficits in a Rat Model of Stroke. Stem cells international 2017:2153629. doi:10.1155/2017/2153629 242. Katsuda T, Tsuchiya R, Kosaka N, Yoshioka Y, Takagaki K, Oki K, Takeshita F, Sakai Y, Kuroda M, Ochiya T (2013) Human adipose tissue-derived mesenchymal stem cells secrete functional neprilysin-bound exosomes. Scientific reports 3:1197. doi:10.1038/srep01197 243. Oses C, Olivares B, Ezquer M, Acosta C, Bosch P, Donoso M, Leniz P, Ezquer F (2017) Preconditioning of adipose tissue-derived mesenchymal stem cells with deferoxamine increases the production of pro-angiogenic, neuroprotective and anti-inflammatory factors: Potential application in the treatment of diabetic neuropathy. PloS one 12 (5):e0178011. doi:10.1371/journal.pone.0178011 244. Jha KA, Pentecost M, Lenin R, Klaic L, Elshaer SL, Gentry J, Russell JM, Beland A, Reiner A, Jotterand V, Sohl N, Gangaraju R (2018) Concentrated Conditioned Media from Adipose Tissue Derived Mesenchymal Stem Cells Mitigates Visual Deficits and Retinal Inflammation Following Mild Traumatic Brain Injury. International journal of molecular sciences 19 (7). doi:10.3390/ijms19072016 245. Palomares T, Cordero M, Bruzos-Cidon C, Torrecilla M, Ugedo L, Alonso-Varona A (2018) The Neuroprotective Effect of Conditioned Medium from Human Adipose-Derived Mesenchymal Stem Cells is Impaired by N-acetyl Cysteine Supplementation. Molecular neurobiology 55 (1):13-25 246. Tan B, Luan Z, Wei X, He Y, Wei G, Johnstone BH, Farlow M, Du Y (2011) AMP- activated kinase mediates adipose stem cell-stimulated neuritogenesis of PC12 cells. Neuroscience 181:40-47. doi:10.1016/j.neuroscience.2011.02.038 247. Lu S, Lu C, Han Q, Li J, Du Z, Liao L, Zhao RC (2011) Adipose-derived mesenchymal stem cells protect PC12 cells from glutamate excitotoxicity-induced apoptosis by upregulation of XIAP through PI3-K/Akt activation. Toxicology 279 (1-3):189-195. doi:10.1016/j.tox.2010.10.011 248. Sofroniew MV (2014) Astrogliosis. Cold Spring Harbor perspectives in biology 7 (2):a020420. doi:10.1101/cshperspect.a020420 249. Kimelberg HK (2010) Functions of mature mammalian astrocytes: a current view. The Neuroscientist : a review journal bringing neurobiology, neurology and psychiatry 16 (1):79- 106. doi:10.1177/1073858409342593 250. Ooi YY, Dheen ST, Tay SS (2015) Paracrine effects of mesenchymal stem cells- conditioned medium on microglial cytokines expression and nitric oxide production. Neuroimmunomodulation 22 (4):233-242. doi:10.1159/000365483

251. Giunti D, Parodi B, Usai C, Vergani L, Casazza S, Bruzzone S, Mancardi G, Uccelli A (2012) Mesenchymal stem cells shape microglia effector functions through the release of CX3CL1. Stem Cells 30 (9):2044-2053. doi:10.1002/stem.1174 252. Huang L, Xu G, Guo J, Xie M, Chen L, Xu W (2016) Mesenchymal Stem Cells Modulate Light-induced Activation of Retinal Microglia Through CX3CL1/CX3CR1 Signaling. Ocular immunology and inflammation 24 (6):684-692. doi:10.3109/09273948.2015.1071405 253. Torrente D, Avila MF, Cabezas R, Morales L, Gonzalez J, Samudio I, Barreto GE (2014) Paracrine factors of human mesenchymal stem cells increase wound closure and reduce reactive oxygen species production in a traumatic brain injury in vitro model. Human & experimental toxicology 33 (7):673-684. doi:10.1177/0960327113509659 254. Baez-Jurado E, Vega GG, Aliev G, Tarasov VV, Esquinas P, Echeverria V, Barreto GE (2018) Blockade of Neuroglobin Reduces Protection of Conditioned Medium from Human Mesenchymal Stem Cells in Human Astrocyte Model (T98G) Under a Scratch Assay. Molecular neurobiology 55 (3):2285-2300. doi:10.1007/s12035-017-0481-y 255. Salgado AJ, Fraga JS, Mesquita AR, Neves NM, Reis RL, Sousa N (2010) Role of human umbilical cord mesenchymal progenitors conditioned media in neuronal/glial cell densities, viability, and proliferation. Stem cells and development 19 (7):1067-1074. doi:10.1089/scd.2009.0279 256. Teixeira FG, Carvalho MM, Neves-Carvalho A, Panchalingam KM, Behie LA, Pinto L, Sousa N, Salgado AJ (2015) Secretome of mesenchymal progenitors from the umbilical cord acts as modulator of neural/glial proliferation and differentiation. Stem cell reviews 11 (2):288-297. doi:10.1007/s12015-014-9576-2 257. Anne Stetler R, Leak RK, Gao Y, Chen J (2013) The dynamics of the mitochondrial organelle as a potential therapeutic target. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism 33 (1):22-32. doi:10.1038/jcbfm.2012.158 258. Song M, Jue SS, Cho YA, Kim EC (2015) Comparison of the effects of human dental pulp stem cells and human bone marrow-derived mesenchymal stem cells on ischemic human astrocytes in vitro. Journal of neuroscience research 93 (6):973-983. doi:10.1002/jnr.23569 259. Baez-Jurado E, Hidalgo-Lanussa O, Guio-Vega G, Ashraf GM, Echeverria V, Aliev G, Barreto GE (2018) Conditioned Medium of Human Adipose Mesenchymal Stem Cells Increases Wound Closure and Protects Human Astrocytes Following Scratch Assay In Vitro. Molecular neurobiology 55 (6):5377-5392. doi:10.1007/s12035-017-0771-4 260. Huang W, Lv B, Zeng H, Shi D, Liu Y, Chen F, Li F, Liu X, Zhu R, Yu L, Jiang X (2015) Paracrine Factors Secreted by MSCs Promote Astrocyte Survival Associated With GFAP Downregulation After Ischemic Stroke via p38 MAPK and JNK. Journal of cellular physiology 230 (10):2461-2475. doi:10.1002/jcp.24981 261. Lopatina T, Kalinina N, Karagyaur M, Stambolsky D, Rubina K, Revischin A, Pavlova G, Parfyonova Y, Tkachuk V (2011) Adipose-derived stem cells stimulate regeneration of peripheral nerves: BDNF secreted by these cells promotes nerve healing and axon growth de novo. PloS one 6 (3):e17899 262. Hiwatashi N, Hirano S, Mizuta M, Tateya I, Kanemaru S, Nakamura T, Ito J (2014) Adipose-derived stem cells versus bone marrow-derived stem cells for vocal fold regeneration. The Laryngoscope 124 (12):E461-469. doi:10.1002/lary.24816 263. Kim WS, Park BS, Kim HK, Park JS, Kim KJ, Choi JS, Chung SJ, Kim DD, Sung JH (2008) Evidence supporting antioxidant action of adipose-derived stem cells: protection of

human dermal fibroblasts from oxidative stress. Journal of dermatological science 49 (2):133-142. doi:10.1016/j.jdermsci.2007.08.004 264. Zhou BR, Xu Y, Guo SL, Wang Y, Zhu F, Permatasari F, Wu D, Yin ZQ, Luo D (2013) The effect of conditioned media of adipose-derived stem cells on wound healing after ablative fractional carbon dioxide laser resurfacing. BioMed research international 2013:519126. doi:10.1155/2013/519126 265. Kim WS, Park BS, Park SH, Kim HK, Sung JH (2009) Antiwrinkle effect of adipose- derived stem cell: activation of dermal fibroblast by secretory factors. Journal of dermatological science 53 (2):96-102. doi:10.1016/j.jdermsci.2008.08.007 266. Hong SJ, Traktuev DO, March KL (2010) Therapeutic potential of adipose-derived stem cells in vascular growth and tissue repair. Current opinion in organ transplantation 15 (1):86- 91. doi:10.1097/MOT.0b013e328334f074 267. Dong L, Hao H, Liu J, Ti D, Tong C, Hou Q, Li M, Zheng J, Liu G, Fu X, Han W (2017) A Conditioned Medium of Umbilical Cord Mesenchymal Stem Cells Overexpressing Wnt7a Promotes Wound Repair and Regeneration of Hair Follicles in Mice. Stem cells international 2017:3738071. doi:10.1155/2017/3738071 268. Heo SJ, Thorpe SD, Driscoll TP, Duncan RL, Lee DA, Mauck RL (2015) Biophysical Regulation of Chromatin Architecture Instills a Mechanical Memory in Mesenchymal Stem Cells. Scientific reports 5:16895. doi:10.1038/srep16895 269. Sugitani S, Tsuruma K, Ohno Y, Kuse Y, Yamauchi M, Egashira Y, Yoshimura S, Shimazawa M, Iwama T, Hara H (2013) The potential neuroprotective effect of human adipose stem cells conditioned medium against light-induced retinal damage. Experimental eye research 116:254-264. doi:10.1016/j.exer.2013.09.013 270. Assunção-Silva RC, Mendes-Pinheiro B, Patrício P, Behie L, Teixeira F, Pinto L, Salgado A (2018) Exploiting the impact of the secretome of MSCs isolated from different tissue sources on neuronal differentiation and axonal growth. Biochimie 271. Tan B, Luan Z, Wei X, He Y, Wei G, Johnstone B, Farlow M, Du Y (2011) AMP- activated kinase mediates adipose stem cell-stimulated neuritogenesis of PC12 cells. Neuroscience 181:40-47

Table 1. Regenerative potential of the secretome from adipose-derived mesenchymal stem cells (CM-A-MSC).

Transplanted Cells Proteins and Secreted Effect References / Medium Factors Condition

Transplant Regeneration of tissues through BDNF growth of blood vessels, nerves [261] /Secretion and myelination

Transplant HGF -HA Vocal cord regeneration [262] /Secretion

Increase in the activity of SOD FGF, HGF, and Gpx protect human dermal Conditioned VEGF, SOD3, fibroblasts from oxidative [263] medium SOD2 damage, reducing cell death by apoptosis

Conditioned IGF, HGF, Angiogenesis, epithelization and [68] medium TGF-β1, VEGF remodeling

TGF-b1, VEGF, Decrease in the rate of erythema, Conditioned melanin and transepidermal [264] medium bFGF, KGF, PDGF-A, HGF water loss

HGF, G-CSF, Antioxidant and reparative effect GM-CSF, Conditioned mediated by the activation of IGFBPs, IL-12, [265] medium dermal fibroblasts and PDGF-AA, keratinocytes PEDF, SODs

TGF-b1, VEGF, Transplant Angiogenesis, anti-apoptosis, bFGF, KGF, increased vascular growth and [266] /Secretion PDGF-A, HGF immunomodulatory effects

Protection of cortical neurons against apoptosis and Conditioned No informed excitotoxicity of glutamate. [267] medium Increased GAP-43, ATP, NAD+ and NADH

Neuropathological recovery, Conditioned IGF-1, increased cognitive and motor [27] medium BDNF ability in the long term after a hypoxic-ischemic lesion

Accelerates wound closure, induces angiogenesis, Conditioned TNFα proliferation and infiltration of [268] medium immune cells in a cutaneous wound

bFGF, VEGF, Improve the metabolic viability Secretome NGF, SCF, of hippocampal cultures and [85] HGF neuronal cell density.

Neuroprotective effects against retinal damage. Use as a Conditioned TIMP-1, treatment for retinitis [269] medium SPARC pigmentosa and macular degeneration

IL-6, VEGF, Angiogenin, Induce bone regeneration in Trasplante MCP3, MCP1, lesions created surgically in the [24] IGF1, TGFß, /Secretion rabbit's jaws PDGF-BB, bFGF, EGF

Improve neurite / axonal growth PEDF , in an in vitro model of axonal Secretome CADH2, IL-6, [270] regeneration based on DRG SEM7A, GDN explants

Increase neovascularization and VEGF, HGF, Secretome improve wound healing in [239] FGF2 injured tissues

Neprilysin Reduction of secretion and Exosomes [242] protein, (NEP) intracellular levels of β-amyloid

Pro-angiogenic, Secretome / neuroprotective Preconditionin Treatment of diabetic and anti- [243] g with neuropathy inflammatory deferoxamine factors

Axonal morphological recovery, Conditioned BDNF, electrophysiological [245] medium TGFb characteristics and normal cell viability

Conditioned Increase neuritogenesis of PC12 NGF [271] medium cells

VEGF, Activation PI3-K/Akt y MAPK. Conditioned HGF. Reduction of caspase-3 levels [247] medium BDNF

Table 2. Effects of the secretome of mesenchymal stem cells on glial cells.

Cells Source Protective effect Reference

Decreases in mRNA expression (IL-6 and TNF-α) CM-MSC Reduction in expression of [250] Microglia proteins NFkB, JNK and c- Jun

Change of proinflammatory CM-MSC reactive phenotype to [251] neuroprotective phenotype

[253] Cell viability protection [259]

Nuclear fragmentation [253]

and condensation [259] Astrocyte s Preservation of [253] mitochondrial CM-A-MSC membrane potential [259]

Lipoperoxidation [254]

Nitration of proteins [254]

DNA damage [254]

Number of mitochondria and [254] mitochondrial crests

[254] GFAP [260]

Reactive Oxygen [254] Species [259]

CM- Proliferation of glial [255]

HUCPVC cells [256]

CM-A-MSC Polarity index [259]

CM-BM- MSC Interleukin - 1 (IL-1) [258] CM-DPSC- MSC

Positive regulation of [254] CM-A-MSC neuroglobin

Inhibition of p38 MAPK and JNK CM-MSC [260] Regulation of p53 and STAT1

Figure 1. Effects of the conditioned medium of mesenchymal stem cells (MSC) in brain cells. The conditioned medium (CM) of MSC can be obtained from adipose tissue (CM-A-MSC), bone marrow (CM-BM-MSC), dental pulp (CM-hDPSC), and umbilical cord blood (CM-HUCPVC). It contains bioactive molecules and / or trophic factors such as VEGF-FGF-HGF-EGF with anti-apoptotic properties, decreases neurodegeneration, increases the number of neurites and angiogenesis, promotes the recovery of the spinal cord, increases the levels of ATP-NADH and activates different survival pathways at the neuronal level, such as phosphorylation of Akt, Jak/STAT3. The conditioned medium also decreases the activation of microglia and promote the oligodendrogenesis and functional remyelination, making it as suitable therapeutic strategy to counteract different pathologies at the CNS.

Figure 2. Effect of conditioned medium of mesenchymal stem cells (CM-MSC) on glial cells. There are very few studies that have evaluated the effect of CM-MSC on glial cells. Among the reported findings are protection of cell viability, mitochondrial functions and ultrastructure, increased polarity index of cells related to migration capacity, reduced ROS and expression of GFAP, and modulation of p38 MAPK and JNK and regulated p53 and STAT1. Indeed, conditioned medium from adipose-derived mesenchymal stem cells upregulated neuroglobin.

Abbreviations

Adult Stem Cells (ASC), Amniotic Fluid Stem Cells (AFSC), Central Nervous System (CNS), Conditioned Medium Mesenchymal Cells Derived From Adipose Tissue (CM-A-MSC), Conditioned Medium Mesenchymal Stem Cells Derived From Bone Marrow (BM-MSC), Conditioned Medium Of Mesenchymal Stem Cells (CM-MSC), Dental Plug Stem Cells (DPSCs), Embryonic Stem Cell (ESC), Epithelial Stem Cells (EpSC), Fetal Stem Cells (FSC), Hematopoietic Stem Cells (HSC), Hematopoietic Stem Cells (HSC), Hepatic Stem Cells (HSC), Hypoxic-Ischemic (HI), Induced Pluripotent Stem Cells (IPSC), Mesenchymal Cells Derived From Adipose Tissue (A-MSC), Mesenchymal Stem Cells (MSCs), Mesenchymal Stem Cells Derived From Bone Marrow (BM-MSC), Mesenchymal Stem Cells Of The Human Umbilical Cord (hUCB-MSC), Mesenchymal Stromal Cells Derived From The Limbus (L-MSC), Neural Stem Cells (NSC), Oxygen Species (ROS), Pluripotent Stem Cells (PSC) Reactive Nitrogen Species (RNS), Spinal Cord Injury (SCI), Traumatic Brain Injury (TBI), Umbilical Cord Blood (UCB), Umbilical Cord Stem Cells (UCPVC), Umbilical Cord Stem Cells (UCPVC), Wharton Gelatin Stem Cells (WJSC).

82 2.7. Potencial neuroprotector de la neuroglobina Hasta hace poco, la hemoglobina (Hb) era la única globina representativa y con afinidad para el transporte del O2 en los vertebrados. Sin embargo, estudios recientes evidencian la expresión de otras globinas en eritrocitos de vertebrados, entre las cuales están la Mioglobina (Mb), Neuroglobina (Ngb), Citoglobina (Cygb), GlobinaE (GbE) y GlobinaY (GBY) (Gotting & Nikinmaa, 2015). Para el caso del sistema nervioso central, la importancia radica en la Neuroglobina (Ngb). La Ngb, una proteína monomérica de 17KDa, es miembro de la familia de globinas (Mammen et al., 2002). Su estructura muestra el pliegue clásico adaptado para albergar la estructura heme-hexa del tipo HisF8-Fe-HisE7 tanto en la forma férrica como en la forma ferrosa (V. Y. Lee, 2002). Es expresada predominantemente en las neuronas del sistema nervioso central y periférico (De Marinis, Fiocchetti, Acconcia, Ascenzi, & Marino, 2013). Además, también se han encontrado altos niveles de expresión en tejidos de vertebrados como ojos y cerebro, expresión baja en intestino, ovario, riñón y sin niveles de expresión en hígado, corazón, músculo esquelético (Fuchs, Burmester, & Hankeln, 2006) y glóbulos rojos (Gotting & Nikinmaa, 2015). En el cerebro, la Ngb ha sido encontrada en diferentes regiones entre las cuales se encuentran la corteza, tálamo, cerebelo, hipocampo e hipotálamo (Wystub et al., 2003), siendo estas zonas de importancia en el procesamiento de sensaciones, memoria y aprendizaje y que con frecuencia se ven afectadas en insultos de hipoxia y lesiones isquémicas o traumáticas.

Dentro de las funciones que se atribuyen a la Ngb se encuentran: a) regular la eliminación de óxido nítrico (ON) (Jayaraman et al., 2011); b) reducir el daño inducido por cualquiera de las especies reactivas de nitrógeno y oxígeno (Oliveira et al., 2015); c) actuar como un sensor de oxígeno y como mediadora para el transporte de éste elemento en las células. Por último, esta proteína se ha reportado como involucrada en la transducción de señales con la inhibición de la disociación de guanosin difosfato desde la proteína G-a (Burmester & Hankeln, 2009; Yu, Fan, Lo, & Wang, 2009) y por lo tanto se reconoce como implicada en procesos de protección celular. A pesar de los avances en el estudio de la Ngb en células del SNC, los mecanismos de neuroprotección de la Ngb aún no están del todo claros. Además, no se ha definido con precisión la relación de esta proteína con otros organelos, a pesar de que estudios actuales muestran una relación funcional directa entre Ngb y la integridad mitocondrial in vivo (Yu,

Poppe, & Wang, 2013) lo que estaría contribuyendo al papel protector de esta proteína dentro del tejido cerebral. Por otro lado, la protección del SNC mediada a través de la Ngb puede estar relacionada con su expresión no sólo a nivel neuronal sino también astrocítico. La expresión astrocítica de Ngb ha sido reportada en condiciones basales en procesos astrocíticos del nervio óptico (Lechauve, Augustin, Roussel, Sahel, & Corral-Debrinski, 2013) y en astrocitos corticales (X. Q. Chen et al., 2005), pero esta proteina también ha sido ampliamente reportada en astrocitos bajo condiciones patológicas como es el caso de astrocitos reactivos localizados cerca de una lesión cortical penetrante in vivo (De Marinis, Acaz-Fonseca, et al., 2013; De Marinis, Fiocchetti, et al., 2013), en células de Müller durante la gliosis reactiva (Lechauve et al., 2013) o localizados en regiones asociadas con la patología más grave y la cicatriz astroglial en modelos murinos (DellaValle, Hempel, Kurtzhals, & Penkowa, 2010). Estos datos pueden sugerir un posible papel protector de la expresión de Ngb en astrocitos especialmente en condiciones de injuria (X. Q. Chen et al., 2005).

Para complementar la información acerca del papel de la Ngb en el sistema nervioso central, su relación con diferentes patologías y el papel de diferentes factores que regulan su expresión en los astrocitos, se presenta a continuación la siguiente revisión: “Baez, E., Echeverria, V., Cabezas, R., Ávila-Rodriguez, M., Garcia-Segura, L. M., & Barreto, G. E. (2016). Protection by neuroglobin expression in brain pathologies. Frontiers in Neurology, 7, 146”

Review published: 12 September 2016 doi: 10.3389/fneur.2016.00146

Protection by Neuroglobin expression in Brain Pathologies

Eliana Baez1, Valentina Echeverria2, Ricardo Cabezas1, Marco Ávila-Rodriguez1, Luis Miguel Garcia-Segura3* and George E. Barreto1,4*

1 Departamento de Nutrición y Bioquimica, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogotá D.C., Colombia, 2 Facultad de Ciencias de la Salud, Universidad San Sebastián, Concepción, Chile, 3 Instituto Cajal, CSIC, Madrid, Spain, 4 Instituto de Ciencias Biomédicas, Universidad Autónoma de Chile, Santiago, Chile

Astrocytes play an important role in physiological, metabolic, and structural functions, and when impaired, they can be involved in various pathologies including Alzheimer, focal ischemic stroke, and traumatic brain injury. These disorders involve an imbalance in the blood flow and nutrients such as glucose and lactate, leading to biochemical and molecular changes that cause neuronal damage, which is followed by loss of cognitive and motor functions. Previous studies have shown that astrocytes are more resilient than neurons during brain insults as a consequence of their more effective antioxidant systems, transporters, and enzymes, which made them less susceptible to excitotox-

Edited by: icity. In addition, astrocytes synthesize and release different protective molecules for Firas H. Kobeissy, neurons, including neuroglobin, a member of the globin family of proteins. After brain University of Florida, USA injury, neuroglobin expression is induced in astrocytes. Since neuroglobin promotes Reviewed by: Bridgette D. Semple, neuronal survival, its increased expression in astrocytes after brain injury may represent University of Melbourne, Australia an endogenous neuroprotective mechanism. Here, we review the role of neuroglobin Hala Darwish, in the central nervous system, its relationship with different pathologies, and the role of American University of Beirut, Lebanon different factors that regulate its expression in astrocytes.

*Correspondence: Keywords: astrocytes, neuroglobin, mitochondria, neuroprotection, brain injury Luis Miguel Garcia-Segura [email protected]; George E. Barreto [email protected] INTRODUCTION

Specialty section: The brain has about 170 billion cells (1), which consume an average of 516 kcal of energy per day, This article was submitted representing 22% of total energy demand of an organism (2). This energy demand is required to carry to Neurotrauma, out essential functions such as synaptic transmission, uptake and metabolism of neurotransmitters, a section of the journal and maintenance of ion gradients (3). For this reason, it is of pivotal importance to maintain optimal Frontiers in Neurology conditions of the intra- and extracellular environment targeting nerve cells needs. However, in dis- Received: 09 June 2016 eases such as ischemic and traumatic brain injuries, an energy imbalance induced by the interruption Accepted: 29 August 2016 of blood flow leads to metabolic stress, ionic disturbance, and activation of a complex cascade of Published: 12 September 2016 biochemical and molecular events that can cause neuronal death (4). Moreover, there are other Citation: diseases such as hypoglycemia and diabetes, in which a misbalance in glucose levels can trigger brain Baez E, Echeverria V, Cabezas R, damage (5, 6). In this context, traumatic brain injury has become a global public health problem, and Ávila-Rodriguez M, Garcia-Segura LM it is the leading cause of death in individuals under 45 years of age and recurrent in young people, and Barreto GE (2016) Protection by Neuroglobin Expression in Brain adolescents, and elders (7). Brain trauma induces cognitive and motor dysfunction (8). In a study Pathologies. reported by Quijano et al., cognitive abilities were assessed in subjects who suffered moderate head Front. Neurol. 7:146. trauma and a control non-injured group. The results revealed significant differences in orientation, doi: 10.3389/fneur.2016.00146 attention, memory, language, reading, and writing abilities (9). Despite the enormous efforts and

Frontiers in Neurology | www.frontiersin.org 85 September 2016 | Volume 7 | Article 146 Baez et al. Astrocytes and Neuroglobin progress in research, treatment strategies for traumatic brain ASTROCYTES AND BRAIN PATHOLOGIES injury are still limited, and currently, there are no effective treatments against their consequences. It has been described that after Astrocytes are responsible for glucose uptake and release of injury, the first phase involves focal hematoma and diffuse edema lactate to neurons (16, 17, 30), which are involved in memory that results in white matter damage. The second phase involves and cognition, glutamate recycling, and synthesis of antioxidant additional pathological cellular and molecular events such as the glutathione (31). Furthermore, astrocytes have a unique cellular abnormal release of neurotransmitters, the generation of free structure that allows them to detect any change in the environ- radicals, Ca2+-signaling abnormalities, apoptotic factors activa- ment and dynamically respond to extracellular changes or tion, and mitochondrial dysfunction leading to neuronal dam- metabolic requirements, providing sources of energy from the age, neuroinflammation, and brain dysfunction (10). Moreover, glucose taken from blood flow (32) or from energy reserves such changes that occur in this second phase trigger the death of as glycogen (33). In addition to glutathione, astrocytes have a neurons and astrocytic reactivity. Therefore, it is necessary to special antioxidant system that includes glutathione peroxidase, search for therapeutic alternatives to prevent further neurological heme oxygenase I, and catalase, which are able to detoxify ROS in damage and restore CNS homeostasis upon injury. the brain (32, 34). Astrocytes are also considered polyfunctional Neurons are usually affected to a greater extent during injuries, cells because they also contribute to the elimination of glutamate since they have less antioxidant mechanisms than astrocytes (Glu), the major excitatory neurotransmitter in the CNS (35). being more affected by increased excitotoxicity than glial cells Moreover, Bergmann glia from the cerebellum express the EAAT1 (11). Astrocytes have an active and critical role in the nervous and EAAT2 transporters (36). In this respect, the EAAT2 (GLT1) system under normal and pathological conditions. During brain is responsible for 90% of glutamate uptake through the astrocyte injury and neurodegenerative conditions, astrocytes participate endfeet that make direct contact with the synapses (37). However, in the removal of toxic molecules and promote neuronal survival this mechanism of Glu uptake and transport becomes affected throughout the release of trophic factors and antioxidant mol- during brain pathologies, and the increased levels of Glu in the ecules (12). For example, astrocytes produce various antioxidant extracellular space might induce excitotoxicity and the severity molecules, such as glutathione transferase (GSH), superoxide of brain injury (38, 39). Other astrocytic functions include the synthase (SOD), and catalase, providing further antioxidant remodeling of the blood brain barrier (14) and production of protection to neurons (13). Also, astrocytes integrate the blood– growth factors (18, 40, 41), which in turn promote cell repair brain barrier (BBB) (13, 14), thus providing active support in the during episodes of injury. Faced with an insult or injury, astro- formation of neural connections and brain activity (15). These cytes adopt a reactive metabolic phenotype (16, 17, 42–44). This cells are key regulators of neuronal energy by providing them with phenotype has a beneficial effect on the preservation of neural lactate (16–18). For all these reasons, astrocytes are vital to restore tissue and in the restriction of moderate focal inflammation (17, brain function after injury. In different neurodegenerative condi- 45, 46). However, when this response is maintained and general- tions such as ischemia–reperfusion injury, a key role is played by ized, it can become counterproductive because astrocytic efforts mitochondria in the generation of reactive oxygen species (ROS), are redirected toward defensive and repair tasks at the expense dysfunctional energy metabolism, and mitochondria-induced of providing adequate metabolic support to neurons and also apoptosis (19). Likewise, the disruption of synaptic regulation by by blocking axonal regeneration (47). Despite this controversial astroglia seems to play an important role in neurodegeneration harmful role of reactive astrocytes, a recent study indicated and brain damage (20). that astrocyte scar formation might help axon regeneration by It is considered that a transient or permanent impairment augmenting multiple axon-growth-supporting molecules (48), of astrocytic functions may negatively impact neurons during demonstrating that inhibiting glial scar might reduce axon pathological conditions. For this reason, it is important to expand regrowth and worsen CNS damage. the knowledge about the neuroprotective mechanisms mediated According to Sofroniew (49–51), reactive astrogliosis covers by astrocytes during brain injury to find alternatives to prevent some key characteristics: (1) molecular, cellular, and functional altered responses affecting neuroprotection and recovery (21). In changes in astrocytes related to the severity of injury in the CNS; this context, neuroglobin (Ngb), a protein expressed astrocytes (2) changes are regulated by specific context of moleculesvia and neurons, of the central nervous system (CNS) and the inter- and intracellular signaling; and (3) astrogliosis can exert an peripheral nervous system (PNS) (22, 23) has often been linked alteration in normal astrocytic activities, which in turn can lead to neuroprotection in different neuropathological conditions to positive or harmful effects in surrounding cells. Additionally, (24, 25) through antioxidant and antiapoptotic mechanisms astrocyte gap junctions can remain open after brain injury (52), (26, 27). The expression of Ngb is induced in human astrocytes allowing the entrance of pro-apoptotic factors and immune cells during brain injury, possibly as a neuroprotective mechanism that exacerbate cellular injury (53). (28). Interestingly, Ngb is expressed in astrocytes and neurons Astrocytes, as other CNS cells, are affected by decreased levels of whales and seals as a mechanism to withstand long periods of of ATP. This decrease in ATP levels is associated with two fun- hypoxia (29). However, more research is needed to completely damental aspects: (i) decreased cerebral blood flow to the range address the importance of Ngb protective mechanisms and its of 100 g−1 (5–8.5 ml min−1), which leads to irreversible tissue relationship with astrocyte functions. In the present review arti- damage by the small amount of glucose and oxygen available (8), cle, we explore the role of Ngb in the CNS, focusing on astrocytes and (ii) increased intracellular calcium that leads to damaging and its relationship with different pathologies. calcium levels in mitochondria (54). These facts suggest the

Frontiers in Neurology | www.frontiersin.org 86 September 2016 | Volume 7 | Article 146 Baez et al. Astrocytes and Neuroglobin importance of astrocytic protection as a potential therapeutic and antiapoptotic factors, immunomodulators, antioxidants, and target for neuroprotection and preservation of CNS functions neuronal differentiation factors among others, that improve the following injury. mitochondrial protection during injuries (68). However, further studies are necessary in order to find new methodologies for the protection of astrocytic mitochondria. Mitochondrial Function and Dysfunction in Astrocytes NEUROGLOBIN IN BRAIN PATHOLOGIES Mitochondria are essential organelles to sustain life and the physiological function of cells under normal conditions by main- Oxygen depletion is one of the more detrimental conditions for taining energy balance through substrate oxidation, modulation the CNS, inducing irreversible damage and as a result loss of of calcium levels, and redox balance (13, 30, 55). However, these cognitive functions. Oxygen depletion is underlying several CNS organelles are also the main target of oxidative stress (30) by an diseases such as ischemia or TBI. imbalance between the production of oxidative molecules, such As stated above, aquatic mammals such as whales and seals − as hydrogen peroxide (H2O2), superoxide radical ( O2 ), and the (29) withstand conditions of severe hypoxia without damage; they hydroxyl radical (OH), and the ability of the cell to defend against are unique models to investigate neuroprotective mechanisms. these radicals (56). Because there is a close relationship between The comparison of Ngb protein sequence between terrestrial and mitochondrial dysfunction and brain injury, mitochondrial aquatic mammals revealed minor differences in its sequence of protection has become a main therapeutic strategy for treating only two or three amino acids, which did not give rise to confer multiple neurodegenerative diseases, such as Parkinson’s disease functional differences between both groups. However, Ngb mRNA (PD), Alzheimer’s disease (AD), and amyotrophic lateral sclero- expression levels were 4–15 times higher in the brain of seals and sis, among others (13, 30, 40, 57–59). whales than in those from terrestrial mammals, suggesting that As reviewed by Kubik and Philbert (60), from a total of 12,614 higher Ngb levels in aquatic mammals can be a neuroprotective mitochondrial investigations in cells of the nervous system, only mechanism against brain hypoxia and ROS production (70). 1,214 were directed to astrocytic mitochondria. This fact over- Similarly, in a behavioral study in transgenic mice overexpress- shadows that mitochondria in astrocytes provide the metabolic ing Ngb under normoxia and hypoxia, it was shown that Ngb substrates necessary for neural function and are essential to promotes survival in vivo and may play an important role in maintain the energetic balance of the brain and the production of countering the adverse effects of a hypoxic ischemic stroke. No antioxidants (61, 62). For example, according to Voloboueva et al. significant behavioral differences were detected between control (63), the inhibition of mitochondria during glucose deprivation and Ngb overexpressing mice at 3 months of age, but transgenic conditions induces functional changes in astrocytes related to a mice showed a superior behavioral performance than control decrease in ATP levels, depolarization of the plasma membrane, mice at 1 year of age (71). and reduced glutamate uptake, without a significant loss of their Traumatic brain injury is another major pathology of the brain, viability. Therefore, this evidence strongly suggests that the dam- which affects world population. Basic features include bleeding, age to the astrocytic mitochondrial function may be the start of cell death, increased production of β-amyloid, basic fibroblast brain lesions and neuronal death (61). growth factor (FGF-2), and increased expression of Ngb that Studies in animal models of PD showed that the administra- remains upregulated until the sixth day post-injury (72). In this tion of 1 and 10 μg of either vascular endothelial growth factor respect, other studies have demonstrated an increased expression (VEGF) or glial-derived neurotrophic factor (GDNF) increased of Ngb with stroke, hypoxia, and ischemia (73, 74). In an experi- the expression of mitochondrial genes (64), suggesting that these mental model of TBI, overexpression of Ngb correlated with a growth factors may have a role in mitochondrial protection. significant reduction in sensorimotor deficits compared with a Similarly, in vitro administration of platelet-derived growth control group that did not overexpressed Ngb. The immunohis- factor BB (PDGF-BB) preserved mitochondrial function in tochemical analysis of injured cortex and hippocampus revealed astrocytes treated with rotenone (40). Furthermore, another that Ngb is mainly expressed in neurons and glial cells (75). study reported that the transmembrane protein TrkB (a receptor Human studies have correlated the genetic polymorphisms for BDNF) was co-localized with mitochondria in astrocytes of the Ngb with susceptibility to neurodegeneration. One of (63), suggesting that astrocytes’ mitochondria have the potential these studies showed that decreased expression of Ngb in the to directly interact with neurotrophic factors and other protec- elderly is associated with an increased risk of AD (76). In a tive proteins such as Ngb (65, 66). Finally, other substances preclinical study using transgenic AD mice, it was found studied in mitochondrial protection are CoQ10 (Coenzyme that intracerebroventricular injection of Ngb decreased the Q10) and conditioned medium from mesenchymal stem cells formation of Aβ peptides, and the mitochondrial dysfunction, (67–69). CoQ10 is a ubiquinone with multiple functions such apoptosis, and neuronal death in the AD brains. In addition, as decreasing the production of ROS, stabilizing mitochondrial other studies suggested that the neuroprotective effects of Ngb membrane potential, improving mitochondrial respiration, involved the inhibition of caspase-3 and 9, the activation of the inhibiting mitochondria-mediated pathway of cell death, and PI3K/Akt pathway (77), and the removal of proteins aggregates activating the mitochondrial biogenesis (69). On the other hand, (78). Finally, other study has demonstrated that Ngb is related conditioned medium from mesenchymal stem cells has been to the neurotoxic effect produced by CNS 1-bromopropane shown as a protective substance, which contains proangiogenic (1-BP), a volatile organic compound implicated in damage

Frontiers in Neurology | www.frontiersin.org 87 September 2016 | Volume 7 | Article 146 Baez et al. Astrocytes and Neuroglobin to both the ozone layer of the atmosphere and the CNS. This Ngb, with its molecular properties, has been characterized as a compound is used as cleaning agent for metal, electronics, and protein responsible for O2 transport and scavenging of ROS and as optical instruments, as well as a substrate for the synthesis O2-sensor and oxygen transporter (91). These functions suggest of pharmaceuticals and insecticides (79). The frequent use that the presence of Ngb is a key factor to brain homeostasis. At of this compound may cause health problems in mammals. present, there are several studies addressing the role of Ngb in dif- For example, a previous study showed that exposure to 1-BP ferent pathologies such as focal ischemia and hypoxic–ischemic resulted in cognitive deficits and increased levels of 4-HNE and injuries (92–95). These studies suggest that Ngb serves as a sensor MDA modified proteins in rats (80). Also, rats exposed to 1-BP to hypoxic stress and has a protective effect. For example, Tiso showed elongated astrocytic processes, a decreased number et al. (96) reported that a nitrite reductase activity of Ngb inhib- of oligodendrocytes, suggesting possible negative effects on ited mitochondrial respiration in presence of nitrite in vitro and myelination and degeneration of granular and Purkinje cells suppressed oxygen consumption and ROS production. Current in the cerebellum (81). Similarly, a previous study showed that studies have shown a direct functional relationship between occupational exposure to 1-BP resulted in CNS adverse effects mitochondrial integrity and Ngb in vivo (74). For example, Ngb is and peripheral neuropathy (82). Some evidence suggests that associated with reduced oxidative damage induced by either reac- Ngb dysfunction may be involved with the toxic effects of 1-BP tive nitrogen species (RNS) or ROS (97). Moreover, Ngb structure on CNS. For example, 1-BP correlated in a dose-dependent was found to be extremely stable, in which its holoprotein was manner with a decrease in Ngb, cognitive dysfunction in rats, able to support temperatures exceeding 100°C and low pH values and a significant loss of neurons in layer V of the prelimbic of up to 2.0 before denaturation (98). Finally, this protein may cortex. These results suggest that the decreased expression of be involved in enhancing G-protein signal transduction by Ngb probably plays an important role in CNS neurotoxicity inhibiting the dissociation of guanosine diphosphate from the induced by 1-BP (83). G-α subunit (73, 99, 100) and therefore involved in cell signaling It is important to highlight that the presence of Ngb in vivo or processes (66). in vitro depends on specific astrocytes (84) and the brain region Initially, Ngb was considered to be exclusively a cytoplasmic affected. For example, in one study, Ngb-positive astrocytes were protein (101), but recent confocal microscopy studies have mostly found in the rhinencephalon region severely damaged in shown that it is also located in mitochondria and nucleus (102, terms of hemorrhage (85, 86). However, Ngb was not detected in 103). In this respect, it was shown that Ngb is associated with astrocytes from healthy mouse brains, suggesting that Ngb may microdomains of lipid rafts andα -subunits of heterotrimeric have cytoprotective properties with the potential to be a therapeu- protein G and becomes activated during oxidative stress, under- tic agent for intervention. However, the potential neuroprotective going structural changes that lead to neuroprotection (103). On effect of Ngb in astrocytes (28) during ischemia (84) has neither the other hand, the mitochondrial expression of Ngb becomes been characterized nor the role of Ngb in neurogenesis and glial increased after oxygen-glucose deprivation (OGD) in primary scar (28). In addition, whether Ngb is secreted by astrocytes as cultures of mouse cortical neurons (104, 105). Furthermore, a neuroprotective agent has not been explored, and it requires mitochondrial Ngb has interactions with cytochrome c and further investigations. the voltage-dependent anion channel (VDAC), suggesting the importance of Ngb in mitochondrial function and neuroprotec- NEUROPROTECTIVE POTENTIAL OF tion (73, 106, 107). Additionally, it has been shown the influence NEUROGLOBIN of thyroid hormones on Ngb expression (97, 108). In one of these studies, the authors evaluated Ngb expression in different areas of Until recently, hemoglobin (Hb) was the most studied member of the rat brain after T3 (100 L/100 g) administration. The authors the globin family of proteins because of its oxygen-binding affin- found that T3 increased Ngb expression in the hippocampus and ity in blood. Nevertheless, recent studies have revealed expression cerebellum; however, in cerebellum, Ngb expression was only of other globin proteins in erythrocytes of vertebrates, including detected at 120 min, 6 h, 12 h, and 24 h after T3 injection (97). myoglobin (Mb), cytoglobin (CYGB), globin E (GbE), globin Y Other studies have shown that Ngb promoter is regulated (GBY), and Ngb (87). Ngb is a 17-kDa monomeric protein, which by the transcription factors NFκB, SP1, and CREB (109), the shows a classic folded structure adapted to hold the heme-hexa- hypoxia-inducible factor 1-α (HIF-1α), erythropoietin (EPO), Fe-type HisF8 HisE7 in both the ferric and ferrous forms (26). and the VEGF (84, 110). In this respect, it was observed that According to homology studies, it was found that Ngb sequence VEGF2 increased the expression of Ngb by stimulating the Flk1 is highly conserved between species, accounting for almost 76% receptor, which in turn induced the expression of HIF-α (111). of sequence conservation between humans and amphibians (88). The mechanisms of neuroprotection by Ngb have not been Ngb is not only expressed in the nervous system (22) but also in completely elucidated. Various stimuli can affect the expression the eyes, intestine, and ovary; however, no expression has been of Ngb in different tissues, including the CNS. For example, in the detected in kidney liver, heart, and skeletal muscle (89). In the cardiac tissue, which is also affected by ischemia, oxidative stress, brain, Ngb has been found in different regions including the and reperfusion, Ngb has been involved in the protection against cortex, thalamus, cerebellum, hippocampus, and hypothalamus cardiac hypertrophy induced by oxidation in cardiomyocytes, (90). These areas are important in the processing of sensations, preventing them from cell death by ROS and therefore can be a memory, and learning, and are often affected in hypoxic and clinical candidate for the treatment of heart diseases (112). On ischemic insult or traumatic injuries. the other hand, it has been shown that cochlear oxidative stress

Frontiers in Neurology | www.frontiersin.org 88 September 2016 | Volume 7 | Article 146 Baez et al. Astrocytes and Neuroglobin is the main cause of sensorineural hearing loss and for which so traumatic brain injury. Among the drugs studied are deferox- far there is no treatment. In this aspect, Ngb is highly expressed amine, an iron chelator, valproic acid, and cinnamic acid (121). in the cochlear nuclei and the superior olivary complex (SOC). Further in vivo studies are needed in order to determine both Moreover, it was reported that Ngb is colocalized with the anti- the induction levels of Ngb by these drugs and also if they have oxidant neuronal protein nitric oxide synthase (NOS) in the SOC, adverse effects in the sensorimotor or cognitive recovery after suggesting the importance of Ngb in oxygen homeostasis and traumatic brain injury or brain ischemic injury. energetic metabolism in the auditory nervous system (113) (see Table 1). Ngb has been also involved in calcium homeostasis (27), Antioxidant Effect ATP storage, inhibition of actin assembly, and response against Ngb has very little affinity for oxygen, and the oxygenated species increased hydrogen peroxide ion levels. This evidence suggests formed with Ngb are unstable; thus, it does not provide a stable that Ngb is also involved in the maintenance of the integrity of source of oxygen, due to the low concentration of Ngb in neurons the cytoskeleton, cell viability, neuroprotection, and glutamate (128). In fact, it is recognized that one of the roles of Ngb is basi- removal (114). cally its affinity for NO (26, 129), and this action can be related Recent studies have used different drugs to increase Ngb to the clearance of this gaseous ligand. Moreover, Ngb has been expression in neurons as a therapeutic neuroprotective agent in shown to act as a ROS and RNS scavenger in different models

TABLE 1 | Description of the fundamental aspects and biological effects of neuroglobin.

Aspect Description Reference

Expression of neuroglobin Cerebellum and hippocampus (97) in the CNS Cortex, thalamus, cerebellum, hippocampus, and hypothalamus (90)

Non-neuronal cells Cardiomyocytes (112) expressing neuroglobin Spiral ganglion cells and the superior olivary complex stem auditory (113) Retina cells (115)

Antioxidant role of Regular removal of nitric oxide (26, 116) neuroglobin Reduce the damage induced by reactive nitrogen species (97)

Antiapoptotic role of Survival in nerve cells overexpressing neuroglobin (24) neuroglobin Decrease apoptosome formation (25) Cytochrome c reduction (24) Decreased levels of calcium – upholding levels of ATP – mitochondrial membrane potential in cultured neuronal cells (27, 117) Modulation of metals such as iron, copper, and zinc in cultured neuronal cells (117) Increased ATP reservoirs in cultured human neuronal cells (114)

Signaling pathways Inhibits the dissociation of guanosine diphosphate from protein G-α (99, 100) involving neuroglobin It binds to the subunit Gβχ that activates PI3K and Akt in cultured human neuronal cells (114) Inhibits production of IP3 (118, 119) Inhibits actin assembly-mediated Rac-1 in neurons (120)

Factors that mediate HIF-1α (110) expression of neuroglobin NFκB–SP1–CREB (109) VEGF (84, 111) EPO (84)

Drugs that increase Deferoxamine–valproic acid–cinnamic acid in HN33 (mouse hippocampal neuron × N18TG2 neuroblastoma) cells (121) neuroglobin expression in neurons

Neuroglobin expression in Neuroglobin after a subacute and chronic traumatic brain injury (28) astrocytes Neuroglobin in microglia and astrocytes after traumatic brain injury (84, 122) Neuroglobin astrocytes through estrogen receptor ERβ (22) Co-localization of neuroglobin with GFAP in human brain after a stroke (28) Neuroglobin protection is mediated via Raf/MEK/ERK through 14-3-3r (123) Neuroglobin expression is dependent on the activation of estrogen receptor beta; tibolone induces the upregulation (65) of Ngb Testosterone upregulates Ngb expression in glucose deprived cells (124)

Related pathologies Cerebral hypoxia (70, 71, 125, 126) involving neuroglobin Focal cerebral ischemia (127) Alzheimer (76) Injury in the cerebral cortex (72) Stroke (73) Traumatic brain injury (74) Removal of proteins capable of forming aggregates deleterious (78) Neurotoxic effect of 1-bromopropane (83)

Frontiers in Neurology | www.frontiersin.org 89 September 2016 | Volume 7 | Article 146 Baez et al. Astrocytes and Neuroglobin

(84, 112, 122), although its antioxidant activity is lower than that funicles, hippocampal alveus, and cerebellar medulla of rodents of N-acetyl cysteine, glutathione, and vitamin C (115). Finally, (101). Until recently, only few studies have reported the expression Ngb has interactions with many antioxidant-related proteins and function of Ngb in astrocytes (28, 84, 122, 130). Previously, in such as Cyt c, Thio, AIF, Prdx3, 4, and 6, Thop1, and Dj1, among 2005, a study reported that Ngb mRNA was detected in primary others. However, further research is needed in order to address cultures of cortical astrocytes and transfection of these astrocytes the relevance of the antioxidant effects of Ngb in CNS diseases. with anti-sense for Ngb led to a 2.5-fold increase in apoptotic cells when compared to controls, suggesting a possible protective role Antiapoptotic Effect of Ngb of Ngb expression in astrocytes against insult (131). The process of apoptosis is complex, and few have investigated Consistently, Avivi et al. reported that the subterranean mole the action of Ngb. However, some studies used computational rat (Spalax) expresses Ngb in neurons and astrocytes isolated modeling to determine the mechanism of Ngb in cell death. For from the corpus callosum (125). More recently, Lechauve et al. example, data obtained using computational modeling suggest reported that Ngb was detected in astrocytes processes optic that Ngb reduces the formation of the apoptosome by a redox nerve under physiological conditions in vivo (132). Indeed, reaction with cytochrome c (24), causing the blocking of initia- it is important to mention that Ngb expression has been also tor pro-caspase 9 activation and thus significantly blocking the observed in astrocytes under pathological conditions (e.g., reac- triggering of apoptosis. In the same study, the authors simulated tive astrocytes). For example, the expression of Ngb was found the interaction between Ngb and cytochrome c and validated upregulated in reactive astrocytes located in the proximity of a their results using an in vitro approach. The authors found a penetrating cortical injury in vivo (22, 133), in Müller cells dur- very rapid reaction between reduced (ferrous) neuroglobin and ing reactive gliosis (132) or located in regions associated with the oxidized (ferric) cytochrome c (24), suggesting that Ngb might most severe pathology and the astroglial scar in murine models affect the initiation of apoptosis by interacting with cytochrome (134). Moreover, Ngb was also detected in astrocytic tumors c. Interestingly, under normal conditions, these molecules do such as rat astrocytoma cells (C6) and human astrocytoma not interact with each other, but under stress, Ngb prevents cells (U251) (135, 136), thus confirming the existence of Ngb in cytochrome c release from mitochondria, thus protecting the tumoral cell lines. cell from apoptosis (115). In this respect, it was reported that A previous study evaluated Ngb expression in astrocytes after reducing cytochrome c, Ngb, in the ferric form, binds to after brain trauma and reported that Ngb expression is present two receptors coupled to G protein subunits (GPCR). This fact in subacute and chronic injuries but not acute trauma (28). is interesting, as the G-α subunit can cause an inhibition in the Moreover, in other studies, it was found that Ngb is expressed production of IP3 (inosine triphosphate) and reduce cytosolic in microglia and astrocytes specifically during conditions such calcium release (118, 119). On the other hand, Ngb binds to the as traumatic brain injury (84, 122) and that estradiol regulates Gβχ subunit, activating PI3K and Akt and thus promoting cell the expression of Ngb in astrocytes (66) through the estrogen viability (114). Also, as mentioned before, Ngb inhibits Rac-1, receptor β (ERβ) (22), while ERα is involved in the regulation Pak1 kinase, and actin assembly, preventing cytoskeletal rear- of Ngb in neurons (137). Interestingly, tibolone, a synthetic rangement and avoiding the initiation of death signaling (120). hormone with estrogenic, progestogenic, and androgenic actions, Moreover, Ngb expression has been found to be higher in meta- has also been reported to induce Ngb expression in astrocytic- bolically active cells, such as neurons and retinal cells, which have like cells in vitro under glucose deprivation (65) (Figure 1). This some features in common such as high cytosolic calcium levels, expression was dependent on the activation of ERβ. Moreover, which can trigger apoptosis (115). This aspect has already been inhibition of Ngb by siRNA significantly affected the protective validated experimentally, showing that increased Ngb expression effects of tibolone in glucose-deprived cells, suggesting that its is directly linked to calcium homeostasis and maintenance of both actions might be mediated by ERβ and Ngb upregulation (65). mitochondrial membrane potential and ATP levels (27). Ngb Similarly, testosterone also induced the expression of Ngb in may be also important in the modulation of metallic ions such astrocytes subjected to glucose deprivation, indicating that as Fe, Cu, and Zn, which are increased in neurons under hypoxic estrogenic and androgenic compounds might play a protective conditions. These ions can induce inflammation, mitochondrial role via induction of Ngb (124). Furthermore, a previous report damage, ROS production, and the release of neurotransmitters, (130) showed co-localization of Ngb and GFAP in glia from leading to neuronal death excitotoxicity (117). All these findings human brains after stroke (28). It has been postulated that neu- support the role of Ngb in apoptotic regulation, a subject that roprotection by Ngb in astrocytes is mediated by Raf/MEK/ERK merits further research. pathway through 14-3-3r, which has the ability to bind to multiple signaling proteins as kinases, phosphatases, or transmembrane receptors (123). Controversially, Ngb has not been detected in NEUROGLOBIN EXPRESSION IN astrocytes by conventional immunohistochemistry or fluorescent ASTROCYTES immunostaining in normal mice brains (134). Indeed, a strong correlation between the cellular expression of Ngb and the The expression of Ngb is evident in neurons and the protective neuronal marker NeuN, but not the astroglial marker GFAP, has role of Ngb in neuronal cells has been well documented; however, been found (130). These results indicate that is debatable whether the function of Ngb in astrocytes is less well studied (84). In 2000, Ngb is expressed in astrocytes and others glial cells under non- a study reinforced the expression of Ngb mRNA in spinal cord pathological conditions (84). Nevertheless, Ngb is detected in

Frontiers in Neurology | www.frontiersin.org 90 September 2016 | Volume 7 | Article 146 Baez et al. Astrocytes and Neuroglobin

FIGURE 1 | Representative microphotographs of astrocyte-like cells (T98G cell line) expressing neuroglobin. Data generated in our group showed that in cells subjected to metabolic insult by adding a balanced salt solution devoid of glucose (BSS0), neuroglobin expression is enhanced and homogeneously distributed in the cytoplasm (left). The control condition (BSS5) was the same as BSS0, but adding 5-mM glucose; in this case, neuroglobin expression was decreased in comparison with BSS0 and located in proximity of the cell nucleus (center). Under basal culture conditions with DMEM medium, Ngb expression was similar to that of BSS5. hypoxic mice brains (138), brain tissues in stroke patients, and by pharmacological compounds, such as estrogenic molecules. specialized glial cells such as pituicytes (101). Therefore, it is clear Overexpressing Ngb by gene therapy or its pharmacological that further studies are necessary in order to determine the role induction may represent a potential therapeutic approach for the of Ngb in astrocyte-mediated neuroprotection. treatment of traumatic brain injury.

CONCLUSION AND PERSPECTIVES AUTHOR CONTRIBUTIONS

The studies reviewed here show that Ngb is a molecule with EB, GEB, VE, and LG-S wrote the manuscript; RC revised the antioxidant and antiapoptotic properties acting on mitochon- manuscript; and MA-R provided the figure. drial and cytosol mechanism of pathology. Therefore, Ngb can be considered as a potential target to decrease neural damage, ACKNOWLEDGMENTS and its enhanced expression after brain injury probably reflects endogenous mechanisms of neuroprotection. Ngb is upregulated GB’s work is supported by Pontificia Universidad Javeriana.

REFERENCES 11. Swanson RA, Ying W, Kauppinen TM. Astrocyte influences on ischemic neuronal death. Curr Mol Med (2004) 4:193–205. doi:10.2174/ 1. Azevedo FAC, Carvalho LRB, Grinberg LT, Farfel JM, Ferretti REL, 1566524043479185 Leite REP, et al. Equal numbers of neuronal and nonneuronal cells make the 12. Rappold PM, Tieu K. Astrocytes and therapeutics for Parkinson’s disease. human brain an isometrically scaled-up primate brain. J Comp Neurol (2009) Neurotherapeutics (2010) 7:413–23. doi:10.1016/j.nurt.2010.07.001 513:532–41. doi:10.1002/cne.21974 13. Cabezas R, Avila M, Gonzalez J, El-Bacha RS, Baez E, Garcia-Segura 2. Carmody RN, Wrangham RW. The energetic significance of cooking. J Hum LM, et al. Astrocytic modulation of blood brain barrier: perspectives on Evol (2009) 57:379–91. doi:10.1016/j.jhevol.2009.02.011 Parkinson’s disease. Front Cell Neurosci (2014) 8:211. doi:10.3389/fncel.2014. 3. Magistretti P, Ransom B. Astrocytes. In: Davis KL, Charney D, Coyle JT, 00211 Nemeroff C, editors. Neuropsychopharmacology: The Fifth Generation of 14. Posada-Duque RA, Barreto GE, Cardona-Gomez GP. Protection after stroke: Progress. American College of Neuropsychopharmacology (2002). cellular effectors of neurovascular unit integrity. Front Cell Neurosci (2014) 4. Bramlett HM, Dietrich WD. Pathophysiology of cerebral ischemia and 8:231. doi:10.3389/fncel.2014.00231 brain trauma: similarities and differences. J Cereb Blood Flow Metab (2004) 15. Nedergaard M, Ransom B, Goldman SA. New roles for astrocytes: redefining 24:133–50. doi:10.1097/01.WCB.0000111614.19196.04 the functional architecture of the brain. Trends Neurosci (2003) 26:523–30. 5. Bree AJ, Puente EC, Daphna-Iken D, Fisher SJ. Diabetes increases brain doi:10.1016/j.tins.2003.08.008 damage caused by severe hypoglycemia. Am J Physiol Endocrinol Metab 16. Barreto G, Gonzalez J, Torres Y, Morales L. Astrocytic-neuronal crosstalk: (2009) 297:E194–201. doi:10.1152/ajpendo.91041.2008 implications for neuroprotection from brain injury. Neurosci Res (2011) 6. Zhou D, Qian J, Liu CX, Chang H, Sun RP. Repetitive and profound 71:107–13. doi:10.1016/j.neures.2011.06.004 insulin-induced hypoglycemia results in brain damage in newborn rats: 17. Barreto G, White RE, Ouyang Y, Xu L, Giffard RG. Astrocytes: targets an approach to establish an animal model of brain injury induced by for neuroprotection in stroke. Cent Nerv Syst Agents Med Chem (2011) neonatal hypoglycemia. Eur J Pediatr (2008) 167:1169–74. doi:10.1007/ 11:164–73. doi:10.2174/187152411796011303 s00431-007-0653-2 18. Cabezas R, Avila-Rodriguez M, Vega-Vela NE, Echeverria V, Gonzalez J, 7. Bruns J, Hauser WA. The epidemiology of traumatic brain injury: a review. Hidalgo OA, et al. Growth factors and astrocytes metabolism: possible roles Epilepsia (2003) 44:2–10. doi:10.1046/j.1528-1157.44.s10.3.x for platelet derived growth factor. Med Chem (2016) 12:204–10. doi:10.2174/ 8. Werner C, Engelhard K. Pathophysiology of traumatic brain injury. 1573406411666151019120444 Br J Anaesth (2007) 99:4–9. doi:10.1093/bja/aem131 19. Hu Y, Deng H, Xu S, Zhang J. MicroRNAs regulate mitochondrial function 9. Quijano MC, Arango JC, Cuervo MT, Aponte M. Neuropsicología del trauma in cerebral ischemia-reperfusion injury. Int J Mol Sci (2015) 16:24895–917. craneoencefálico en Cali, Colombia. Rev Cienc Salud (2012) 10:21–31. doi:10.3390/ijms161024895 10. Maas AIR, Stocchetti N, Bullock R. Moderate and severe traumatic 20. Maragakis NJ, Rothstein JD. Mechanisms of disease: astrocytes in neuro- brain injury in adults. Lancet Neurol (2008) 7:728–41. doi:10.1016/ degenerative disease. Nat Clin Pract Neurol (2006) 2:679–89. doi:10.1038/ S1474-4422(08)70164-9 ncpneuro0355

Frontiers in Neurology | www.frontiersin.org 91 September 2016 | Volume 7 | Article 146 Baez et al. Astrocytes and Neuroglobin

21. Gouix E, Buisson A, Nieoullon A, Kerkerian-Le Goff L, Tauskela JS, 43. Barreto GE, Gonzalez J, Capani F, Morales L. Neuroprotective agents in brain Blondeau N, et al. Oxygen glucose deprivation-induced astrocyte dysfunc- injury: a partial failure? Int J Neurosci (2012) 122:223–6. doi:10.3109/00207 tion provokes neuronal death through oxidative stress. Pharmacol Res (2014) 454.2011.648292 87:8–17. doi:10.1016/j.phrs.2014.06.002 44. Iglesias J, Morales L, Barreto GE. Metabolic and inflammatory adaptation 22. De Marinis E, Fiocchetti M, Acconcia F, Ascenzi P, Marino M. Neuroglobin of reactive astrocytes: role of PPARs. Mol Neurobiol (2016). doi:10.1007/ upregulation induced by 17β-estradiol sequesters cytocrome c in the mito- s12035-016-9833-2 chondria preventing H2O2-induced apoptosis of neuroblastoma cells. Cell 45. Myer DJ, Gurkoff GG, Lee SM, Hovda DA, Sofroniew MV. Essential pro- Death Dis (2013) 4:e508–508. doi:10.1038/cddis.2013.30 tective roles of reactive astrocytes in traumatic brain injury. Brain (2006) 23. De Marinis E, Ascenzi P, Pellegrini M, Galluzzo P, Bulzomi P, Arevalo MA, 129:2761–72. doi:10.1093/brain/awl165 et al. 17beta-estradiol – a new modulator of neuroglobin levels in neurons: 46. Sofroniew MV. Astrocyte barriers to neurotoxic inflammation. Nat Rev role in neuroprotection against H(2)O(2)-induced toxicity. Neurosignals Neurosci (2015) 16:249–63. doi:10.1038/nrn3898 (2010) 18:223–35. doi:10.1159/000323906 47. Steele ML, Robinson SR. Reactive astrocytes give neurons less support: 24. Raychaudhuri S, Skommer J, Henty K, Birch N, Brittain T. Neuroglobin implications for Alzheimer’s disease. Neurobiol Aging (2012) 33:423.e1–e13. protects nerve cells from apoptosis by inhibiting the intrinsic pathway of cell doi:10.1016/j.neurobiolaging.2010.09.018 death. Apoptosis (2010) 15:401–11. doi:10.1007/s10495-009-0436-5 48. Anderson MA, Burda JE, Ren Y, Ao Y, O’Shea TM, Kawaguchi R, et al. 25. Raychaudhuri S, Willgohs E, Nguyen T-N, Khan EM, Goldkorn T. Monte Astrocyte scar formation aids central nervous system axon regeneration. Carlo simulation of cell death signaling predicts large cell-to-cell stochastic Nature (2016) 532:195–200. doi:10.1038/nature17623 fluctuations through the type 2 pathway of apoptosis. Biophys J (2008) 49. Sofroniew MV, Vinters HV. Astrocytes: biology and pathology. Acta 95:3559–62. doi:10.1529/biophysj.108.135483 Neuropathol (2010) 119:7–35. doi:10.1007/s00401-009-0619-8 26. Lee VY, McClintock DS, Santore MT, Budinger GR, Chandel NS. Hypoxia 50. Pekny M, Pekna M, Messing A, Steinhauser C, Lee JM, Parpura V, et al. sensitizes cells to nitric oxide-induced apoptosis. J Biol Chem (2002) Astrocytes: a central element in neurological diseases. Acta Neuropathol 277:16067–74. doi:10.1074/jbc.M111177200 (2016) 131:323–45. doi:10.1007/s00401-015-1513-1 27. Liu J, Yu Z, Guo S, Lee S-R, Xing C, Zhang C, et al. Effects of neuroglobin 51. Sofroniew MV. Astrogliosis. Cold Spring Harb Perspect Biol (2015) 7:a020420. overexpression on mitochondrial function and oxidative stress following doi:10.1101/cshperspect.a020420 hypoxia/reoxygenation in cultured neurons. J Neurosci Res (2009) 87:164–70. 52. Ohsumi A, Nawashiro H, Otani N, Ooigawa H, Toyooka T, Shima K. Temporal doi:10.1002/jnr.21826 and spatial profile of phosphorylated Connexin43 after traumatic brain 28. Chen X, Liu Y, Zhang L, Zhu P, Zhu H, Yang Y, et al. Long-term neuroglobin injury in rats. J Neurotrauma (2010) 27:1255–63. doi:10.1089/neu.2009.1234 expression of human astrocytes following brain trauma. Neurosci Lett (2015) 53. Lin JH, Weigel H, Cotrina ML, Liu S, Bueno E, Hansen AJ, et al. 606:194–9. doi:10.1016/j.neulet.2015.09.002 Gap-junction-mediated propagation and amplification of cell injury. Nat 29. Meir JU, Ponganis PJ. High-affinity hemoglobin and blood oxygen saturation Neurosci (1998) 1:494–500. doi:10.1038/2210 in diving emperor penguins. J Exp Biol (2009) 212:3330–8. doi:10.1242/ 54. Prins M, Greco T, Alexander D, Giza CC. The pathophysiology of traumatic jeb.033761 brain injury at a glance. Dis Model Mech (2013) 6:1307–15. doi:10.1242/ 30. Cabezas R, El-Bachá R, González J, Barreto G. Mitochondrial functions in dmm.011585 astrocytes: neuroprotective implications from oxidative damage by rotenone. 55. Duchen MR, Szabadkai G. Roles of mitochondria in human disease: Figure Neurosci Res (2012) 74:80–90. doi:10.1016/j.neures.2012.07.008 1. Essays Biochem (2010) 47:115–37. doi:10.1042/bse0470115 31. Dringen R, Hirrlinger J. Glutathione pathways in the brain. Biol Chem (2003) 56. LeDoux SP, Druzhyna NM, Hollensworth SB, Harrison JF, Wilson GL. 384:505–16. doi:10.1515/BC.2003.059 Mitochondrial DNA repair: a critical player in the response of cells of the 32. Bélanger M, Magistretti PJ. The role of astroglia in neuroprotection. Dialogues CNS to genotoxic insults. Neuroscience (2007) 145:1249–59. doi:10.1016/ Clin Neurosci (2009) 11:281–95. j.neuroscience.2006.10.002 33. Pellerin L, Magistretti PJ. Sweet sixteen for ANLS. J Cereb Blood Flow Metab 57. Avila Rodriguez M, Garcia-Segura LM, Cabezas R, Torrente D, Capani F, (2012) 32:1152–66. doi:10.1038/jcbfm.2011.149 Gonzalez J, et al. Tibolone protects T98G cells from glucose deprivation. 34. Shih AY, Johnson DA, Wong G, Kraft AD, Jiang L, Erb H, et al. Coordinate J Steroid Biochem Mol Biol (2014) 144(Pt B):294–303. doi:10.1016/ regulation of glutathione biosynthesis and release by Nrf2-expressing j.jsbmb.2014.07.009 glia potently protects neurons from oxidative stress. J Neurosci (2003) 58. Jurado-Coronel JC, Avila-Rodriguez M, Capani F, Gonzalez J, Moran VE, 23:3394–406. Barreto GE. Targeting the nicotinic acetylcholine receptors (nAChRs) in 35. Lee M-C, Yasuda R, Ehlers MD. Metaplasticity at single glutamatergic syn- astrocytes as a potential therapeutic target in Parkinson’s disease. Curr Pharm apses. Neuron (2010) 66:859–70. doi:10.1016/j.neuron.2010.05.015 Des (2016) 22:1305–11. doi:10.2174/138161282210160304112133 36. Medina-Ceja L, Guerrero-cazares H, Canales-aguirre A, Morales-Villagrán 59. Patel VP, Chu CT. Nuclear transport, oxidative stress, and neurodegenera- A, Feria-Velasco A. Características estructurales y funcionales de los trans- tion. Int J Clin Exp Pathol (2011) 4:215–29. portadores de glutamato: su relación con la epilepsia y el estrés oxidativo. 60. Kubik LL, Philbert MA. The role of astrocyte mitochondria in differential Rev Neurol (2007) 45:341–52. regional susceptibility to environmental neurotoxicants: tools for under- 37. Haugeto O, Ullensvang K, Levy LM, Chaudhry FA, Honore T, Nielsen M, standing neurodegeneration. Toxicol Sci (2015) 144:7–16. doi:10.1093/toxsci/ et al. Brain glutamate transporter proteins form homomultimers. J Biol Chem kfu254 (1996) 271:27715–22. doi:10.1074/jbc.271.44.27715 61. Dugan LL, Kim-Han J-S. Astrocyte mitochondria in in vitro models of ischemia. 38. Yi J-H, Hazell AS. Excitotoxic mechanisms and the role of astrocytic J Bioenerg Biomembr (2004) 36:317–21. doi:10.1023/B:JOBB.0000041761. glutamate transporters in traumatic brain injury. Neurochem Int (2006) 61554.44 48:394–403. doi:10.1016/j.neuint.2005.12.001 62. Greenamyre JT, Betarbet R, Sherer TB. The rotenone model of Parkinson’s 39. Zou J, Wang Y-X, Dou F-F, Lü H-Z, Ma Z-W, Lu P-H, et al. Glutamine disease: genes, environment and mitochondria. Parkinsonism Relat Disord synthetase down-regulation reduces astrocyte protection against glutamate (2003) 9(Suppl 2):S59–64. doi:10.1016/S1353-8020(03)00023-3 excitotoxicity to neurons. Neurochem Int (2010) 56:577–84. doi:10.1016/ 63. Voloboueva LA, Suh SW, Swanson RA, Giffard RG. Inhibition of mitochon- j.neuint.2009.12.021 drial function in astrocytes: implications for neuroprotection. J Neurochem 40. Cabezas R, Avila MF, Gonzalez J, El-Bacha RS, Barreto GE. PDGF-BB (2007) 102:1383–94. doi:10.1111/j.1471-4159.2007.04634.x protects mitochondria from rotenone in T98G cells. Neurotox Res (2015) 64. Yue X, Hariri DJ, Caballero B, Zhang S, Bartlett MJ, Kaut O, et al. Comparative 27:355–67. doi:10.1007/s12640-014-9509-5 study of the neurotrophic effects elicited by VEGF-B and GDNF in preclinical 41. Chen Y, Swanson RA. Astrocytes and brain injury. J Cereb Blood Flow Metab in vivo models of Parkinson’s disease. Neuroscience (2014) 258:385–400. (2003) 23:137–49. doi:10.1097/01.WCB.0000044631.80210.3C doi:10.1016/j.neuroscience.2013.11.038 42. Barreto GE, Santos-Galindo M, Garcia-Segura LM. Selective estrogen recep- 65. Avila-Rodriguez M, Garcia-Segura LM, Hidalgo-Lanussa O, Baez E, tor modulators regulate reactive microglia after penetrating brain injury. Gonzalez J, Barreto GE. Tibolone protects astrocytic cells from glucose Front Aging Neurosci (2014) 6:132. doi:10.3389/fnagi.2014.00132 deprivation through a mechanism involving estrogen receptor beta and

Frontiers in Neurology | www.frontiersin.org 92 September 2016 | Volume 7 | Article 146 Baez et al. Astrocytes and Neuroglobin

the upregulation of neuroglobin expression. Mol Cell Endocrinol (2016). 84. Qiu XY, Chen XQ. Neuroglobin – recent developments. Biomol Concepts doi:10.1016/j.mce.2016.05.024 (2014) 5:195–208. doi:10.1515/bmc-2014-0011 66. Acaz-Fonseca E, Avila Rodriguez M, Garcia-Segura LM, Barreto GE. 85. Lackner P, Beer R, Heussler V, Goebel G, Rudzki D, Helbok R, et al. Behavioural Regulation of astroglia by gonadal steroid hormones under physiolog- and histopathological alterations in mice with cerebral malaria. Neuropathol ical and pathological conditions. Prog Neurobiol (2016). doi:10.1016/ Appl Neurobiol (2006) 32:177–88. doi:10.1111/j.1365-2990.2006.00706.x j.pneurobio.2016.06.002 86. Wiese L, Kurtzhals JA, Penkowa M. Neuronal apoptosis, metallothionein 67. Torrente D, Avila MF, Cabezas R, Morales L, Gonzalez J, Samudio I, et al. expression and proinflammatory responses during cerebral malaria Paracrine factors of human mesenchymal stem cells increase wound in mice. Exp Neurol (2006) 200:216–26. doi:10.1016/j.expneurol.2006. closure and reduce reactive oxygen species production in a traumatic 02.011 brain injury in vitro model. Hum Exp Toxicol (2014) 33(7):673–84. 87. Gotting M, Nikinmaa M. More than hemoglobin – the unexpected diversity doi:10.1177/0960327113509659 of globins in vertebrate red blood cells. Physiol Rep (2015) 3:e12284–12284. 68. Cantinieaux D, Quertainmont R, Blacher S, Rossi L, Wanet T, Noël A, et al. doi:10.14814/phy2.12284 Conditioned medium from bone marrow-derived mesenchymal stem cells 88. Hankeln T, Ebner B, Fuchs C, Gerlach F, Haberkamp M, Laufs TL, et al. improves recovery after spinal cord injury in rats: an original strategy to Neuroglobin and cytoglobin in search of their role in the vertebrate globin avoid cell transplantation. PLoS One (2013) 8:e69515. doi:10.1371/journal. family. J Inorg Biochem (2005) 99:110–9. doi:10.1016/j.jinorgbio.2004.11.009 pone.0069515 89. Fuchs C, Burmester T, Hankeln T. The amphibian globin gene repertoire as 69. Jing L, He MT, Chang Y, Mehta SL, He QP, Zhang JZ, et al. Coenzyme revealed by the Xenopus genome. Cytogenet Genome Res (2006) 112:296–306. Q10 protects astrocytes from ROS-induced damage through inhibition of doi:10.1159/000089884 mitochondria-mediated cell death pathway. Int J Biol Sci (2015) 11:59–66. 90. Wystub S, Laufs T, Schmidt M, Burmester T, Maas U, Saaler-Reinhardt S, doi:10.7150/ijbs.10174 et al. Localization of neuroglobin protein in the mouse brain. Neurosci Lett 70. Schneuer M, Flachsbarth S, Czech-Damal NU, Folkow LP, Siebert U, (2003) 346:114–6. doi:10.1016/S0304-3940(03)00563-9 Burmester T. Neuroglobin of seals and whales: evidence for a divergent 91. Simon R. Neuroglobin: neuroprotection and neurogenesis. Neurosci Lett role in the diving brain. Neuroscience (2012) 223:35–44. doi:10.1016/ (2013) 549:1–2. doi:10.1016/j.neulet.2013.05.016 j.neuroscience.2012.07.052 92. Shang A, Yang Y, Wang H, Wang J, Hang X, Wang Z, et al. Upregulation 71. Van Leuven W, Van Dam D, Moens L, De Deyn PP, Dewilde S. A behavioural of neuroglobin expression and changes in serum redox indices in a rat study of neuroglobin-overexpressing mice under normoxic and hypoxic model of middle cerebral artery occlusion. Mol Med Rep (2015) 12:1693–8. conditions. Biochim Biophys Acta (2013) 1834:1764–71. doi:10.1016/ doi:10.3892/mmr.2015.3593 j.bbapap.2013.04.015 93. Song X, Xu R, Xie F, Zhu H, Zhu J, Wang X. Hemin offers neuroprotection 72. Purushothuman S, Stone J. The reaction of cerebral cortex to a nearby lesion: through inducing exogenous neuroglobin in focal cerebral hypoxic-ischemia damage, survival, self-protection. Brain Res (2015) 1601:52–63. doi:10.1016/ in rats. Int J Clin Exp Pathol (2014) 7:2163–71. j.brainres.2015.01.003 94. Raida Z, Hundahl CA, Nyengaard JR, Hay-Schmidt A. Neuroglobin over 73. Yu Z, Liu N, Liu J, Yang K, Wang X. Neuroglobin, a novel target for endog- expressing mice: expression pattern and effect on brain ischemic infarct size. enous neuroprotection against stroke and neurodegenerative disorders. PLoS One (2013) 8:e76565. doi:10.1371/journal.pone.0076565 Int J Mol Sci (2012) 13:6995–7014. doi:10.3390/ijms13066995 95. Raida Z, Hundahl CA, Kelsen J, Nyengaard JR, Hay-Schmidt A. Reduced 74. Zhao S, Yu Z, Zhao G, Xing C, Hayakawa K, Whalen MJ, et al. Neuroglobin- infarct size in neuroglobin-null mice after experimental stroke in vivo. Exp overexpression reduces traumatic brain lesion size in mice. BMC Neurosci Transl Stroke Med (2012) 4:15. doi:10.1186/2040-7378-4-15 (2012) 13:67. doi:10.1186/1471-2202-13-67 96. Tiso M, Tejero J, Basu S, Azarov I, Wang X, Simplaceanu V, et al. Human 75. Taylor JM, Kelley B, Gregory EJ, Berman NEJ. Neuroglobin overexpression neuroglobin functions as a redox-regulated nitrite reductase. J Biol Chem improves sensorimotor outcomes in a mouse model of traumatic brain (2011) 286:18277–89. doi:10.1074/jbc.M110.159541 injury. Neurosci Lett (2014) 577:125–9. doi:10.1016/j.neulet.2014.03.012 97. Oliveira KC, da Conceição RR, Piedade GC, de Souza JS, Sato MA, 76. Lin Y, Fang L, Xue X-H, Murong S-X, Wang N, Wu Z-Y. Association between de Barros Maciel RM, et al. Thyroid hormone modulates neuroglobin and Ngb polymorphisms and ischemic stroke in the Southern Chinese Han popu- cytoglobin in rat brain. Metab Brain Dis (2015) 30(6):1401–8. doi:10.1007/ lation. BMC Med Genet (2008) 9:110. doi:10.1186/1471-2350-9-110 s11011-015-9718-5 77. Li Y, Dai Y-B, Sun J-Y, Xiang Y, Yang J, Dai S-Y, et al. Neuroglobin atten- 98. Picotti P, Dewilde S, Fago A, Hundahl C, De Filippis V, Moens L, uates beta amyloid-induced apoptosis through inhibiting caspases activity et al. Unusual stability of human neuroglobin at low pH – molecular by activating PI3K/Akt signaling pathway. J Mol Neurosci (2016) 58(1): mechanisms and biological significance. FEBS J (2009) 276:7027–39. 28–38. doi:10.1007/s12031-015-0645-z doi:10.1111/j.1742-4658.2009.07416.x 78. Lechauve C, Rezaei H, Celier C, Kiger L, Corral-Debrinski M, Noinville S, 99. Burmester T, Hankeln T. What is the function of neuroglobin? J Exp Biol et al. Neuroglobin and prion cellular localization: investigation of a (2009) 212:1423–8. doi:10.1242/jeb.000729 potential interaction. J Mol Biol (2009) 388:968–77. doi:10.1016/j.jmb. 100. Yu Z, Fan X, Lo EH, Wang X. Neuroprotective roles and mechanisms of 2009.03.047 neuroglobin. Neurol Res (2009) 31:122–7. doi:10.1179/174313209X389866 79. Shelby M, Portier C, Goldman L, Moore J, Iannucci A, Jahnke G, et al. 101. Reuss S, Saaler-Reinhardt S, Weich B, Wystub S, Reuss MH, Burmester T, et al. NTP-CERHR Expert Panel report on the reproductive and developmental Expression analysis of neuroglobin mRNA in rodent tissues. Neuroscience toxicity of 1-bromopropane. Reprod Toxicol (2004) 18:157–87. doi:10.1016/ (2002) 115:645–56. doi:10.1016/S0306-4522(02)00536-5 j.reprotox.2004.01.001 102. Hundahl CA, Allen GC, Hannibal J, Kjaer K, Rehfeld JF, Dewilde S, et al. 80. Zhong Z, Zeng T, Xie K, Zhang C, Chen J, Bi Y, et al. Elevation of Anatomical characterization of cytoglobin and neuroglobin mRNA and 4-hydroxynonenal and malondialdehyde modified protein levels in cerebral protein expression in the mouse brain. Brain Res (2010) 1331:58–73. cortex with cognitive dysfunction in rats exposed to 1-bromopropane. doi:10.1016/j.brainres.2010.03.056 Toxicology (2013) 306:16–23. doi:10.1016/j.tox.2013.01.022 103. Watanabe S, Takahashi N, Uchida H, Wakasugi K. Human neuroglobin 81. Mohideen SS, Ichihara S, Subramanian K, Huang Z, Naito H, Kitoh J, et al. functions as an oxidative stress-responsive sensor for neuroprotection. J Biol Effects of exposure to 1-bromopropane on astrocytes and oligodendrocytes Chem (2012) 287:30128–38. doi:10.1074/jbc.M112.373381 in rat brain. J Occup Health (2013) 55:29–38. doi:10.1539/joh.12-0118-OA 104. Yu Z, Liu J, Guo S, Xing C, Fan X, Ning M, et al. Neuroglobin-overexpression 82. Wang TH, Wu ML, Wu YH, Tsai WJ, Lin KP, Wang CL, et al. Neurotoxicity alters hypoxic response gene expression in primary neuron culture following associated with exposure to 1-bromopropane in golf-club cleansing workers. oxygen glucose deprivation. Neuroscience (2009) 162:396–403. doi:10.1016/ Clin Toxicol (Phila) (2015) 53:823–6. doi:10.3109/15563650.2015.1064939 j.neuroscience.2009.04.055 83. Guo Y, Yuan H, Jiang L, Yang J, Zeng T, Xie K, et al. Involvement of 105. Yu Z, Liu N, Li Y, Xu J, Wang X. Neuroglobin overexpression inhibits decreased neuroglobin protein level in cognitive dysfunction induced oxygen-glucose deprivation-induced mitochondrial permeability transition by 1-bromopropane in rats. Brain Res (2015) 1600:1–16. doi:10.1016/ pore opening in primary cultured mouse cortical neurons. Neurobiol Dis j.brainres.2014.12.046 (2013) 56:95–103. doi:10.1016/j.nbd.2013.04.015

Frontiers in Neurology | www.frontiersin.org 93 September 2016 | Volume 7 | Article 146 Baez et al. Astrocytes and Neuroglobin

106. Yu Z, Poppe JL, Wang X. Mitochondrial mechanisms of neuroglobin’s cells exposed to glucose deprivation. Front Aging Neurosci (2016) 8:152. neuroprotection. Oxid Med Cell Longev (2013) 2013:756989–756989. doi:10.3389/fnagi.2016.00152 doi:10.1155/2013/756989 125. Avivi A, Gerlach F, Joel A, Reuss S, Burmester T, Nevo E, et al. Neuroglobin, 107. Yu Z, Xu J, Liu N, Wang Y, Li X, Pallast S, et al. Mitochondrial distribu- cytoglobin, and myoglobin contribute to hypoxia adaptation of the sub- tion of neuroglobin and its response to oxygen–glucose deprivation in terranean mole rat Spalax. Proc Natl Acad Sci U S A (2010) 107:21570–5. primary-cultured mouse cortical neurons. Neuroscience (2012) 218:235–42. doi:10.1073/pnas.1015379107 doi:10.1016/j.neuroscience.2012.05.054 126. Greenberg DA, Jin K, Khan AA. Neuroglobin: an endogenous neuropro- 108. Sharlin DS, Gilbert ME, Taylor MA, Ferguson DC, Zoeller RT. The nature of tectant. Curr Opin Pharmacol (2008) 8:20–4. doi:10.1016/j.coph.2007.09.003 the compensatory response to low thyroid hormone in the developing brain. 127. Sun Y, Jin K, Peel A, Mao XO, Xie L, Greenberg DA. Neuroglobin protects J Neuroendocrinol (2010) 22:153–65. doi:10.1111/j.1365-2826.2009.01947.x the brain from experimental stroke in vivo. Proc Natl Acad Sci U S A (2003) 109. Liu N, Yu Z, Li Y, Yuan J, Zhang J, Xiang S, et al. Transcriptional regulation 100:3497–500. doi:10.1073/pnas.0637726100 of mouse neuroglobin gene by cyclic AMP responsive element binding 128. Fago A, Hundahl C, Dewilde S, Gilany K, Moens L, Weber RE. Allosteric protein (CREB) in N2a cells. Neurosci Lett (2013) 534:333–7. doi:10.1016/ regulation and temperature dependence of oxygen binding in human j.neulet.2012.11.025 neuroglobin and cytoglobin. Molecular mechanisms and physiological 110. Woo SK, Kwon MS, Geng Z, Chen Z, Ivanov A, Bhatta S, et al. Sequential significance.J Biol Chem (2004) 279:44417–26. doi:10.1074/jbc.M407126200 activation of hypoxia-inducible factor 1 and specificity protein 1 is required 129. Brunori M, Giuffrè A, Nienhaus K, Nienhaus GU, Scandurra FM, Vallone B. for hypoxia-induced transcriptional stimulation of Abcc8. J Cereb Blood Flow Neuroglobin, nitric oxide, and oxygen: functional pathways and conforma- Metab (2012) 32:525–36. doi:10.1038/jcbfm.2011.159 tional changes. Proc Natl Acad Sci U S A (2005) 102:8483–8. doi:10.1073/ 111. Jin K, Mao X, Xie L, Greenberg DA. Interactions between vascular endo- pnas.0408766102 thelial growth factor and neuroglobin. Neurosci Lett (2012) 519:47–50. 130. Jin K, Mao Y, Mao X, Xie L, Greenberg DA. Neuroglobin expression in doi:10.1016/j.neulet.2012.05.018 ischemic stroke. Stroke (2010) 41:557–9. doi:10.1161/STROKEAHA.109. 112. Liu Z-F, Zhang X, Qiao Y-X, Xu W-Q, Ma C-T, Gu H-L, et al. Neuroglobin 567149 protects cardiomyocytes against apoptosis and cardiac hypertrophy induced 131. Chen XQ, Qin LY, Zhang CG, Yang LT, Gao Z, Liu S, et al. Presence of neu- by isoproterenol in rats. Int J Clin Exp Med (2015) 8:5351–60. roglobin in cultured astrocytes. Glia (2005) 50:182–6. doi:10.1002/glia.20147 113. Reuss S, Banica O, Elgurt M, Mitz S, Disque-Kaiser U, Riemann R, et al. 132. Lechauve C, Augustin S, Roussel D, Sahel JA, Corral-Debrinski M. Neuroglobin expression in the mammalian auditory system. Mol Neurobiol Neuroglobin involvement in visual pathways through the optic nerve. (2015) 53(3):1461–77. doi:10.1007/s12035-014-9082-1 Biochim Biophys Acta (2013) 1834:1772–8. doi:10.1016/j.bbapap.2013. 114. Antao ST, Duong TTH, Aran R, Witting PK. Neuroglobin overexpression in 04.014 cultured human neuronal cells protects against hydrogen peroxide insult via 133. De Marinis E, Acaz-Fonseca E, Arevalo MA, Ascenzi P, Fiocchetti M, activating phosphoinositide-3 kinase and opening the mitochondrial K ATP Marino M, et al. 17beta-oestradiol anti-inflammatory effects in primary astro- channel. Antioxid Redox Signal (2010) 13:769–81. doi:10.1089/ars.2009.2977 cytes require oestrogen receptor beta-mediated neuroglobin up-regulation. 115. Brittain T, Skommer J, Henty K, Birch N, Raychaudhuri S. A role for human J Neuroendocrinol (2013) 25:260–70. doi:10.1111/jne.12007 neuroglobin in apoptosis. IUBMB Life (2010) 62:878–85. doi:10.1002/iub.405 134. DellaValle B, Hempel C, Kurtzhals JA, Penkowa M. In vivo expression of 116. Jayaraman T, Tejero J, Chen BB, Blood AB, Frizzell S, Shapiro C, et al. 14-3-3 neuroglobin in reactive astrocytes during neuropathology in murine models binding and phosphorylation of neuroglobin during hypoxia modulate six- of traumatic brain injury, cerebral malaria, and autoimmune encephalitis. to-five heme pocket coordination and rate of nitrite reduction to nitric oxide. Glia (2010) 58:1220–7. doi:10.1002/glia.21002 J Biol Chem (2011) 286:42679–89. doi:10.1074/jbc.M111.271973 135. Gorr TA, Wichmann D, Pilarsky C, Theurillat JP, Fabrizius A, Laufs T, et al. 117. Duong TTH, Witting PK, Antao ST, Parry SN, Kennerson M, Lai B, et al. Old proteins – new locations: myoglobin, haemoglobin, neuroglobin and Multiple protective activities of neuroglobin in cultured neuronal cells cytoglobin in solid tumours and cancer cells. Acta Physiol (Oxf) (2011) exposed to hypoxia re-oxygenation injury. J Neurochem (2009) 108:1143–54. 202:563–81. doi:10.1111/j.1748-1716.2010.02205.x doi:10.1111/j.1471-4159.2008.05846.x 136. Qin H, Guo Y, Zhang C, Zhang L, Li M, Guan P. The expression of neu- 118. Dewilde S, Kiger L, Burmester T, Hankeln T, Baudin-Creuza V, Aerts T, et al. roglobin in astrocytoma. Brain Tumor Pathol (2012) 29:10–6. doi:10.1007/ Biochemical characterization and ligand binding properties of neuroglobin, s10014-011-0066-9 a novel member of the globin family. J Biol Chem (2001) 276:38949–55. 137. Guglielmotto M, Reineri S, Iannello A, Ferrero G, Vanzan L, Miano V, doi:10.1074/jbc.M106438200 et al. E2 regulates epigenetic signature on neuroglobin enhancer-promoter 119. Fago A, Mathews AJ, Dewilde S, Moens L, Brittain T. The reactions of in neuronal cells. Front Cell Neurosci (2016) 10:147. doi:10.3389/fncel. neuroglobin with CO: evidence for two forms of the ferrous protein. J Inorg 2016.00147 Biochem (2006) 100:1339–43. doi:10.1016/j.jinorgbio.2006.03.009 138. Hundahl CA, Fahrenkrug J, Hay-Schmidt A, Georg B, Faltoft B, Hannibal J. 120. Khan AA, Mao XO, Banwait S, DerMardirossian CM, Bokoch GM, Jin K, Circadian behaviour in neuroglobin deficient mice. PLoS One (2012) et al. Regulation of hypoxic neuronal death signaling by neuroglobin. FASEB 7:e34462. doi:10.1371/journal.pone.0034462 J (2008) 22:1737–47. doi:10.1096/fj.07-100784 121. Jin K, Mao XO, Xie L, John V, Greenberg DA. Pharmacological Conflict of Interest Statement: The authors declare that the research was con- induction of neuroglobin expression. Pharmacology (2011) 87:81–4. ducted in the absence of any commercial or financial relationships that could be doi:10.1159/000322998 construed as a potential conflict of interest. 122. Yu ZL, Qiu S, Chen XC, Dai ZH, Huang YC, Li YN, et al. Neuroglobin – a potential biological marker of retinal damage induced by LED light. Copyright © 2016 Baez, Echeverria, Cabezas, Ávila-Rodriguez, Garcia-Segura and Neuroscience (2014) 270:158–67. doi:10.1016/j.neuroscience.2014.04.013 Barreto. This is an open-access article distributed under the terms of the Creative 123. Zhao J, Meyerkord CL, Du Y, Khuri FR, Fu H. 14-3-3 proteins as potential Commons Attribution License (CC BY). The use, distribution or reproduction in therapeutic targets. Semin Cell Dev Biol (2011) 22:705–12. doi:10.1016/ other forums is permitted, provided the original author(s) or licensor are credited j.semcdb.2011.09.012 and that the original publication in this journal is cited, in accordance with accepted 124. Toro N, Garcia-Segura LM, Echeverria V, Barreto GE. Testosterone protects academic practice. No use, distribution or reproduction is permitted which does not mitochondrial function and regulates neuroglobin expression in astrocytic comply with these terms.

Frontiers in Neurology | www.frontiersin.org 94 September 2016 | Volume 7 | Article 146 Objetivos 3.1. Objetivo General

Evaluar el potencial efecto del medio condicionado de células mesenquimales derivadas de tejido adiposo humano (CM-hMSCA) sobre astrocitos humanos en un modelo in vitro de scratch y privación de glucosa.

3.2. Objetivos Específicos

3.2.1. Identificar el efecto del CM-hMSCA sobre la viabilidad y cambios morfológicos de las células astrocíticas en modelo in vitro de scratch y privación de glucosa. 3.2.2. Determinar el efecto del CM-hMSCA en la función mitocondrial de células astrocíticas en modelo in vitro de scratch y privación de glucosa. 3.2.3. Investigar la importancia de la mitocondria y neuroglobina en mediar el efecto del CM- hMSCA sobre las células astrocíticas bajo un modelo in vitro de scratch y privación de glucosa. 3.2.4. Evaluar si el efecto del CM-hMSCA en la protección de las células astrocíticas en modelo in vitro de scratch y privación de glucosa está mediado por la neuroglobina.

Materiales y Métodos

Cada uno de los artículos presentados en la sección de resultados cuenta con la descripción de materiales y métodos correspondiente.

95 Resultados

Para una mejor comprensión, la sección de resultados está dividida en tres (3) capítulos. Cada capítulo corresponde a un artículo, algunos de estos artículos ya se encuentran publicados y otros a la fecha se encuentran sometidos para su publicación.

Capítulo 1: Protección de la viabilidad, función mitocondrial y ultraestructura de astrocitos tratados con medio condicionado de células madre mesenquimales derivadas de tejido adiposo humano en modelo in vitro de scratch y privación de glucosa. Los resultados se presentan en el artículo: Baez-Jurado, E., Vega, G. G., Aliev, G., Tarasov, V. V., Esquinas, P., Echeverría, V., & Barreto, G. E. (2018). Blockade of neuroglobin reduces protection of conditioned medium from human mesenchymal stem cells in human astrocyte model (T98G) under a scratch assay. Molecular Neurobiology, 55(3), 2285-2300. Factor de impacto: 6.19 Q1 ISI/SCOPUS.

Capítulo 2: Efecto del medio condicionado de células madre mesenquimales derivadas de tejido adiposo humano sobre astrocitos con inhibición mitocondrial en un modelo in vitro de scratch y privación de glucosa. Los resultados se presentan en el artículo:

Baez-Jurado, E., Guio-Vega, G., Hidalgo-Lanussa, O., González, J., Echeverría, V., Ashraf, G. M., Amirhossein, S. & Barreto, G. E. (2018). Mitochondrial neuroglobin is necessary for protection induced by conditioned medium from adipose-derived mesenchymal stem cells in astrocytic cells subjected to scratch and metabolic injury. Submitted in Molecular Neurobiology. October, 2018. Factor de impacto: 6.19 Q1 ISI/SCOPUS.

Capítulo 3: Confirmación del efecto del medio condicionado de células madre mesenquimales derivadas de tejido adiposo humano en astrocitos humanos sujetos scratch y privación de glucosa. Los resultados se presentan en el artículo:

Baez-Jurado, E., Hidalgo-Lanussa, O., Guio-Vega, G., Ashraf, G. M., Echeverría, V., Aliev, G., & Barreto, G. E. (2018). Conditioned medium of human adipose mesenchymal stem cells increases wound closure and protects human astrocytes following scratch assay in vitro. Molecular Neurobiology, 55(6), 5377-5392. Factor de impacto: 6.19 Q1 ISI/SCOPUS.

Capítulo 1 Protección de la viabilidad, función mitocondrial y ultraestructura de astrocitos tratados con medio condicionado de células madre mesenquimales derivadas de tejido adiposo humano en modelo in vitro de scratch y privación de glucosa.

Las células madre mesenquimales (MSC) desempeñan un papel clave en la restauración de tejidos dañados (Mammen et al., 2002). Investigaciones recientes han demostrado que la actividad benéfica de estas células también viene dada por los factores que secretan (Gnecchi, Danieli, Malpasso, & Ciuffreda, 2016; B. Huang et al., 2016) y que tienen efectos angiogénicos, tróficos, antiinflamatorios e inmunomoduladores, así como la liberación de hormonas y citoquinas (Skalnikova, 2013). Entre las moléculas secretadas por las MSC también se encuentran factores de crecimiento como VEGF, FGF, MCP-1, HGF, IGF-1 y algunos factores neurotróficos como PDGF-BB, bFGF, EGF (Linero & Chaparro, 2014), BDNF, NGF (Hao et al., 2014), IGF-1 (Wei et al., 2009) y GDNF (Skalnikova, 2013), con efecto protector sobre el tejido cerebral (Cirillo et al., 2011; Deng et al., 2011) y con importantes aplicaciones terapéuticas.

La acción benéfica del medio condicionado de células madre mesenquimales (CM- hMSC) en el tratamiento o la prevención de enfermedades del sistema nervioso central ha sido fuertemente documentada (Guo et al., 2015; Mita et al., 2015). Se han evidenciado diferentes efectos como la citoprotección de astrocitos isquémicos (Song et al., 2015), un aumento del cierre de la herida y la reducción de la producción de ERO en los astrocitos (Torrente et al., 2014). También, se encontró que factores presentes en el medio condicionado aumentaron la supervivencia de los astrocitos y preservaron el metabolismo celular después de la privación de oxígeno-glucosa (W. Huang et al., 2015). Además, se evidenció en otro estudio una modulación de la red neuronal y respuesta glial a la apoptosis e inflamación en un modelo de esclerosis lateral amiotrófica (H. Sun et al., 2013).

En este capítulo se presentan los resultados obtenidos luego de evaluar el efecto del CM-hMSCA sobre la viabilidad celular, la fragmentación nuclear, la producción de ERO de oxígeno y el potencial de membrana mitocondrial y parámetros ultraestructurales de un modelo astrocitario (T98G) sujeto a scratch y privación de glucosa. Este modelo celular es una línea celular ampliamente utilizada en investigaciones cerebrales y en el desarrollo de fármacos. Las T98G expresan marcadores específicos de astrocitos y una combinación única de aspectos normales y transformados del control de la proliferación celular que le permiten ser buen modelo astrocitario (Kiseleva, Kartashev, Vartanyan, Pinevich, & Samoilovich,

98 2016; Stein, 1979). Por último, en esta investigación se evidencia un aumento en la expresión de la proteína Neuroglobina (Ngb) y su papel mediador en el efecto protector del CM-hMSCA sobre células dañadas. A continuación, se presenta la publicación con resultados que sugieren que el uso de CM-hMSCA puede ser una estrategia terapéutica prometedora para la protección de células astrocíticas en patologías del sistema nervioso central.

Mol Neurobiol (2018) 55:2285–2300 DOI 10.1007/s12035-017-0481-y

Blockade of Neuroglobin Reduces Protection of Conditioned Medium from Human Mesenchymal Stem Cells in Human Astrocyte Model (T98G) Under a Scratch Assay

Eliana Baez-Jurado1 & Gina Guio Vega1 & Gjumrakch Aliev2,3,4 & Vadim V. Tarasov5 & Paula Esquinas6 & Valentina Echeverria 7 & George E. Barreto1,8

Received: 9 January 2017 /Accepted: 3 March 2017 /Published online: 22 March 2017 # Springer Science+Business Media New York 2017

Abstract Previous studies have indicated that paracrine fac- neuroglobin in T98G cells and the genetic silencing of this tors (conditioned medium) increase wound closure and reduce protein prevented the protective action of hMSCA-CM on reactive oxygen species in a traumatic brain injury in vitro damaged cells, suggesting that neuroglobin is mediating, at model. Although the beneficial effects of conditioned medium least in part, the protective effect of hMSCA-CM. Overall, from human adipose tissue-derived mesenchymal stem cells this evidence suggests that the use of hMSCA-CM is a prom- (hMSCA-CM) have been previously suggested for various ising therapeutic strategy for the protection of astrocytic cells neurological diseases, their actions on astrocytic cells are not in central nervous system (CNS) pathologies. well understood. In this study, we have explored the effect of hMSCA-CM on human astrocyte model (T98G cells) subject- Keywords Astrocytes . Scratch assay . Mesenchymal stem ed to scratch assay. Our results indicated that hMSCA-CM cells . Conditioned medium . Adipose tissue . Neuroglobin improved cell viability, reduced nuclear fragmentation, attenuated the production of reactive oxygen species, and preserved mitochondrial membrane potential and ultrastructural Introduction parameters. In addition, hMSCA-CM upregulated Mesenchymal stem cells (MSC) play a key role in restoring damaged tissues [1]. Recent studies have demonstrated the * George E. Barreto [email protected]; [email protected] ability of these cells to differentiate in tissues that are often affected by pathologies or lesions [2–4] but there are still 1 Departamento de Nutrición y Bioquímica, Facultad de Ciencias, difficulties in maintaining their differentiation and missing Pontificia Universidad Javeriana, Bogotá, DC, Colombia parameters for monitoring their clinical efficacy [1, 5]. 2 Institute of Physiologically Active Compounds Russian Academy of Therefore, recent research has shown that the beneficial activ- Sciences, Chernogolovka 142432, Russia ity of these cells is also given by the factors that they secrete – ’ 3 GALLY International Biomedical Research Consulting LLC, San [6 11].StudiesofMSCs secretome have revealed the pro- Antonio, TX 78229, USA duction of molecules with angiogenic, trophic, anti-inflamma- 4 School of Health Science and Healthcare Administration, University tory, and immunomodulatory effect as well as the release of of Atlanta, Johns Creek, GA 30097, USA hormones and cytokines [12]. These paracrine factors may 5 Institute of Pharmacy and Translational Medicine, Sechenov First include growth factors such as VEGF, FGF, MCP-1, HGF, Moscow State Medical University, 2-4 Bolshaya Pirogovskaya st., IGF-1, and some neurotrophic factors like PDGF-BB, bFGF, 119991 Moscow, Russia EGF [13, 14], BDNF, NGF [12, 15, 16], IGF-1 [16], and 6 Facultad Medicina Veterinaria y Zootecnia, Universidad Nacional de GDNF [12], which have a protective effect on brain tissue Colombia, Bogotá, Colombia [17, 18] with important therapeutic applications. 7 Facultad Ciencias de la Salud, Universidad San Sebastián, Lientur The beneficial action of MSC-CM for the treatment or 1457, 4030000 Concepción, Chile prevention of CNS diseases has been strongly documented 8 Instituto de Ciencias Biomédicas, Universidad Autónoma de Chile, [11, 19, 20]. For example, studies on glial cells report Santiago, Chile cytoprotection in astrocytes under ischemia after treatment

100 2286 Mol Neurobiol (2018) 55:2285–2300 with 10, 20, and 30% CM-hDPSC [21] and enhanced wound glucose free DMEM and the conditioned medium was collect- closure and reduced ROS production in astrocytes treated with ed after 48 h. The supernatants were centrifuged at 3000 rpm 2–5% hMSCA-CM (TBI) [22]. Indeed, 25–75% MSC-CM for 3 min and stored at −80 °C. hMSCA-CM was collected increased astrocytes survival and preserved cellular metabo- from hMSCA cultures between passage III and V. lism following oxygen-glucose-deprivation (OGD) [23]and modulated neuronal network and glial response to apoptosis and inflammation in a model of amyotrophic lateral sclerosis T98G Cell Culture (ALS) after treatment with MSC-CM derived from bone marrow with concentrations ranging from 20 to 100% [24]. T98G (ATCC CRL-1690) is a human cell line positive for Likewise, hUCPVC-CM has been shown to have a direct GFAP [33]. This line has been used and validated as a model impact on density, viability, and glial cell proliferation of the of astrocytic cells as reported previously [33, 41–45]. hippocampus [16, 25–29]. Additionally, our group has observed that these cells have It is possible that MSC conditioned medium might modu- similar morphological and functional characteristics in com- late protective signaling proteins upon cellular damage. For parison to other human astrocytes (data not shown). Cells example, our lab has previously shown that neuroglobin were maintained under exponential growth in DMEM (Ngb), an oxygen-related protein implicated in cerebral ho- (LONZA), containing 10% FBS (LONZA,), and 10 U peni- meostasis and responsible for the detection and elimination cillin/10 μg streptomycin/25 ng amphotericin (LONZA) and of ROS [30], is expressed by astrocytic cells and upregulated culture medium was changed three times a week. Cultures under glucose deprivation [31–33]. There is also strong evi- were incubated at 37 °C in a humidified atmosphere contain- dence for the upregulation of Ngb in astrocytes following ing 5% CO2. hypoxic-ischemic injuries and TBI [34–39]. These finding suggest that neuroglobin may play an important role in mediating protection under pathological conditions. In this study, Scratch Assay and hMSCA-CM Treatments we explored whether hMSCA-CM contributes to cellular rescue or protection of mitochondrial function in an astrocytic In this study, our in vitro model (scratch assay) was charac- model of scratch assay, in addition to investigating the role of terized by both mechanical injury and metabolic insult. As we Ngb in mediating the effects of hMSCA- CM. did not observe mitochondrial damage in cells subjected to mechanical injury only, we indeed performed a metabolic impairment (glucose deprivation, BSS0) to simulate a previously Materials and Methods described traumatic brain like-injury model [22]. Briefly, cells were allowed to reach confluence for 48 h and then were Primary Culture of Adipose-Derived Human serum deprived for 3 h. Later, a denuded area was produced Mesenchymal Stem Cells (hMSCA) by scratching the inside diameter of the well with the 10-μl pipette tip [22, 46]. Immediately after the scratch cells were Human mesenchymal stem cells from adipose tissue rinsed twice with phosphate-buffered saline (PBS) 1× buffer (hMSCA) were isolated as described elsewhere [40]. The pro- to remove debris and were co-treated according to the follow- cedures were performed according to a protocol approved by ing experimental groups: (1) 1) scratch ± BSS0: cells under the ethics committee of Pontificia Universidad Javeriana. scratch and glucose free conditions (BSS0); (2) Briefly, hMSCA were obtained from human adipose tissue scratch ±BSS5:scratch cells plus BSS0 supplemented with obtained by liposuction in patients between 24 and 28 years 5.5 mM glucose (BSS5, control cells); (3) of age. hMSCA were characterized by assessing the expres- scratch ± BSS0 ± CM2%: scratch cells plus BSS0 and treated sion of CD34(−), CD73(+), CD90(+), and CD105(+) follow- with 2% hMSCA-CM; and (4) scratch ± BSS5 ± CM2%: ing the criteria established by the International Society for Cell scratch cells plus BSS5 and treated with 2% hMSCA-CM. Therapy. hMSCA cells were cultivated in Dulbecco’smodi- Glucose deprivation assay was performed as previously re- fied Eagle’s medium (DMEM) (LONZA, Walkersville, USA) ported [33, 41, 47], and the composition of the Balanced supplemented with 10% fetal bovine serum (FBS) (LONZA, Salt Solution (BSS0) is: NaCl, 116; CaCl2,1.8;MgSO4, Walkersville, USA) and 1% penicillin, with incubation tem- (7.H2O) 0.8; KCl, 5.4; NaH2PO4, 1; NaHCO3, 14.7, and perature of 37 °C in an atmosphere of 5% CO2. 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 10; pH 7.4 to 37 °C. In this study, cells were sub- Preparation of hMSCA-CM mitted to scratch assay (mechanical injury + glucose deprivation) and received simultaneously, a treatment with 2% hMSCA were cultured until 80% confluency in DMEM sup- hMSCA-CM for 24 h, in which this concentration were cho- plemented with 10% FBS. Then, cells were cultured in serum- sen based on our previous study [22].

101 Mol Neurobiol (2018) 55:2285–2300 2287

Determination of Nuclear Fragmentation/Condensation minimum of four replicates for each condition. The experiments were repeated in three different cultures. We have previously determined the effect on cell viability For TMRM fluorescence imaging analysis, cells were [22]. In here, we further investigated apoptosis levels by in- seeded at a density of 30,000 cells per well into 48-well plates vestigating nuclear fragmentation using Hoechst 33,258. in DMEM culture medium containing 10% FBS and subject- Briefly, after treatments, cells were washed with PBS and ed to each experimental paradigm the second day. After treat- fixed for 20 min in 4% formaldehyde at room temperature. ments, cells were incubated with TMRM for 20 min. Finally, Subsequently, cells were washed and labeled with Hoechst cells were washed with PBS and photographed in a fluores- 33,258 (5 mg/ml; Invitrogen) for 15 min. Cell nuclei were cence microscope (Olympus IX-53). The images were proc- observed and photographed using an inverted fluorescence essed with ImageJ software, and the mean fluorescence inten- microscope Olympus IX-53 (UV excitation, filter CKX-NU sity of randomly selected cells was determined as described N1157600) (excitation 352 nm/emission 461 nm spectra) with below. The mean was calculated with a minimum of 20 cells an exposure time set between 80 and 100 ms to avoid the analyzed for each condition. The experiments were repeated saturation of the pixels. The number of fragmented/ in three different cultures. condensation nuclei was determined in at least eight randomly selected areas (0.03 mm2) from each experimental group. Data Determination of Mitochondrial Mass were expressed as a percentage of nuclear fragmented/ condensate relative to the value in control cultures. The exper- The evaluation of the mitochondrial mass was performed iments were repeated in three different cultures. using acridine orange 10-nonyl bromide (NAO) in cells treated, or not, with 2% hMSCA-CM. This probe is primarily used Determination of Reactive Oxygen Species (ROS) to determine non-peroxidated cardiolipin that is present mainly in active mitochondria [42, 48, 49]. Cells were seeded at a ROS production was evaluated by flow cytometry as previ- density of 30,000 cells per well in 48-well plates. After com- ously described [41–44]. Briefly, cells were seeded at a den- pletion of co-treatments, cells were incubated in the dark with sity of 75,000 cells per well into 24-well plates in DMEM NAO (Invitrogen) at 500 nM for 30 min at 37 °C. Thereafter, culture medium containing 10% FBS and after 48 h cells were cells were washed twice with PBS1X. Fluorescence was de- treated according to each experimental paradigm. To measure termined by microphotographs using Olympus IX-53 micro- the effect of hMSCA-CM on the production of hydrogen per- scope (excitation 495 nm/emission 520 nm). The images were oxide (H2O2), cells were treated with 10 μM diacetate of processed with the ImageJ software, and the mean fluores- dichlorofluorescein (DCFDA) in the dark at 37 °C for cence intensity of the randomly selected cells was determined 20 min. Then, cells were washed in PBS and detached with (see 2.12). trypsin (Trypsin/EDTA 500 mg/L: 200 mg/L; LONZA, In order to confirm mitochondrial mass, cells were seeded Walkersville, USA) for flow cytometry analysis. Cells were at a density of 75,000 cells per well in 24-well plates and were analyzed in a Guava EasyCyte™ cytometer (Millipore, subsequently treated accordingly after 48 h. Cells were incu- Billerica, Massachusetts, USA). Each assay was performed bated in the dark with NAO (Invitrogen) at 500 nM for 30 min with a minimum of four replicates for each condition. The at 37 °C. After washing twice with PBS1X, the relative inten- experiments were repeated in three different cultures. sity of the NAO signal in cells were detached and analyzed using flow cytometer GuavaR Easy CyteTM (Millipore). Determination of Mitochondrial Membrane Potential Immunocytochemistry Mitochondrial membrane potential was evaluated using tetramethylrhodamine methyl ester (TMRM) and assessed Cells were washed with 0.1 M phosphate buffer (PB) and by flow cytometry and fluorescence image analysis. For flow fixed in 4% paraformaldehyde for 30 min. Nonspecific bind- cytometry analysis, cells were seeded at a density of 75,000 ing sites were blocked with blocking buffer (3% bovine albu- cells per well into 24-well plates and then treated per each min and 0.3% Triton X-100) for 1 h. Subsequently, the cells experimental paradigm in the second day. After co-treatment are incubated overnight with the primary antibodies for Glial with hMSCA-CM for 24 h, cells were stained in the dark at Fibrillary Acidic Protein (GFAP) (mAb #3670), Vimentin 37 °C for 20 min. Thereafter, cells were washed with PBS, and (Sigma-Aldrich V6630), 4-hidroxynonenal (HNE) detached using trypsin. Then, cells were analyzed by flow (ab46545), Neuroglobin (Ngb) (ab37258), 3-Nitrotyrosine cytometry at 500 nM. As experimental control, valinomycin (ab61392) and Anti-8 Hydroxyguanosine (8-OGN) [15A3] (Sigma-Aldrich V0627; 100 nM) was used to dissipate the (ab62623). After incubation with primary antibody, cells were membrane potential and define the baseline for analysis of washed twice with PBS and incubated with the appropriate mitochondrial potential. Each assay was performed with a secondary antibody Goat anti-mouse IgG (H + L), DyLight

102 2288 Mol Neurobiol (2018) 55:2285–2300

488 conjugate or Goat anti-rabbit for 1 h and then analyzed and about 10 representative mitochondria from each of the using an inverted fluorescence microscope (Olympus IX-53). sections were selected for analysis [51–53]. GFAP and Vimentin were used as markers of astrocytic activation and their expression levels were measured by the ImageJ program and compared with the controls. The data Estimation of Cellular Mean Fluorescence Intensity obtained by immunocytochemistry for these markers were corroborated by western blot. The calculation of mean fluorescence intensity of the cells for the determination of mitochondrial membrane potential and Protein Extraction and Western Blotting immunocytochemistry was performed using ImageJ [54]. The microphotographs were loaded in the software and pre- T98G cells were lysed on ice with RIPA Lysis and Extraction processed eliminating the background. Subsequently, 20 cells Buffer Thermo Scientific™ supplemented with Halt™ were randomly selected using a numbered grid in each micro- Protease Inhibitor Cocktail, EDTA-free (100X) (Roche). photograph. The mean fluorescence value of the 20 cells was Protein content was estimated using the Pierce™ BCA determined in eight microphotographs for each treatment Protein Assay Kit. Equal amounts of protein were dissolved using the Measure algorithm of ImageJ and selecting each cell β manually via ROI’s Management. Cells were analyzed in an in sample buffer containing 5% -mercaptoethanol and 2 boiled. Then, proteins were separated by electrophoresis in area of 0.03 mm . There were no variations in the conditions SDS–PAGE, transferred onto a PVDF membranes and of the image processing. Each assay was performed with a blocked in 5% skim milk dissolved in Tris-buffered saline minimum of six replicate wells for each condition. The exper- containing 0.05% Tween 20 (TBS-T), at RT for 1 h. The mem- iments were repeated in three different cultures. branes were incubated at 4 °C overnight with antibodies against glial fibrillary acidic protein (GFAP) (cell signaling) Neuroglobin Silencing (1:2000), vimentin (Sigma-Aldrich) (1:1000), neuroglobin β (Ngb) (1:500) (Abcam), -actin (Thermo Fisher) (1:3000), Cells were transfected in a serum-free condition with either superoxide dismutase 2 (SOD2) (Thermo Fisher) (1:1000), Stealth RNAi™ Ngb1 siRNA (siNgb; Invitrogen, Carlsbad, Catalase (Thermo Fisher) (1:1000), GPX1 (Thermo Fisher) CA, USA) or a mismatch sequence in accordance with the (1:1500). The immunoreactivity was visualized by incubating manufacturer’s instructions, using oligofectamine the membrane with specific secondary antibody (IRDye® (Invitrogen) as the transfection reagent. The sequence used Antibodies) for 1 h and detected using Odyssey CLx for Ngb oligonucleotides was 5′ - Imaging System Specifications (LI-COR Biosciences). The CGUGAUUGAUGCUGCAGUGACCAAU-3′.Themis- intensity of each band was quantified using ImageJ software match sequence used as a control for Ngb1 siRNA (siNgb) (National Institutes of Health, Bethesda, MD, USA). All data was 5′-UGUGAUUUAUGGUGCAGUAACCAAC-3′. are normalized to control values on each gel. The experiments Briefly, oligofectamine and oligonucleotides (400 pM) were were repeated in three different cultures. mixed with Optimem, and the mixture was incubated for 20 min at RT, diluted with Optimem and added to the cell Ultrastructure Assessment medium for 4 h at 37 °C. The medium was added to cells to reach the growing conditions (i.e., 10% (v/v) serum). To eval- Cells were co-treated with hMSCA-CM and subjected to uate the effective silencing of Ngb, total proteins were extract- scratch assay for 24 h. Cells were digested, centrifuged, ed 48 h after transfection, and Ngb expression was assessed by washed with ice-cold PBS and fixed overnight at 4 °C in Western blot analysis. 2.5% glutaraldehyde. Then cells were post-fixed with 1% os- mium tetroxide for 2 h, followed by pellet incubation with 2% uranyl acetate. After ascending ethanol series dehydration and Statistical Analysis epoxy resin embedding, semi-thin sections of cells were stained with toluidine blue and examined using light micro- Data obtained from this study were tested for normal distribu- scope. Ultrathin sections were double stained with uranyl action by Kolmogorov–Smirnov test and homogeneity of vari- etate and lead citrate and examined and recorded with a Jeol ance by Levene’s test. Then, data were examined by analysis 1400 plus transmission electron microscope at 80 kV [50]. of variance (ANOVA), followed by Dunnet’s post hoc test for Mitochondrial area, number of mitochondria, vacuoles, and comparisons between controls and treatments and Tukey’s mitochondrial ridges were quantified using ImageJ software post hoc test for multiple comparisons between the means of by manually selecting mitochondria, measuring their area and treatments and time points. Data are presented as mean ± SEM normalizing against the scale bar. Ten representative sections of three independent experiments. A statistically significant of T98G cells were obtained from each experimental group difference was defined at P <0.05.

103 Mol Neurobiol (2018) 55:2285–2300 2289

Results condensation in T98G cells and 2% hMSCA-CM significantly reduced this damage by 11.3% (P <0.0001;Hoescht Two Percent hMSCA-CM Reduced Nuclear panel). Fragmentation and Chromatin Condensation in Cells Subjected to Scratch Assay Two Percent hMSCA-CM Protected Mitochondria by Reducing Reactive Oxygen Species Production In a previous work from our laboratory, we standardized the and Improving Mitochondrial Membrane Potential scratch assay model and observed that 24 h of co-treatment and Mass in Cells Subjected to Scratch Assay (see 2.4) with 2% hMSCA-CM exerted the best protective results [22]. In the present study, we aimed to assess further The increase of ROS leads to oxidative stress and mitochon- the protective mechanisms of 2% hMSCA-CM on cells sub- drial dysfunction in glucose deprived models [41, 45]. jected to scratch assay, which is characterized by both me- Considering this, ROS levels, mitochondrial membrane po- chanical injury and glucose deprivation. In this context, tential (Δψm), and mitochondrial mass were evaluated in T98G cells were co-treated with 2% hMSCA-CM and sub- our model. As shown in Fig. 1, scratch + BSS0 cells treated jected to scratch + BSS0 for 24 h. T98G cells exposed to with 2% hMSCA-CM maintained the Δψm above 120% scratch + BSS0 showed an increased nuclear fragmentation (P < 0.0001) while the group of scratch + BSS0 cells only and chromatin condensation of 60.5% (P < 0.0001; Fig. 1, showed a Δψm of 24.5% compared to control values Hoescht panel) compared to control (scratch + BSS5), which (P < 0.0001), demonstrating a recovery of Δψm of about hadonly7.5%(P < 0.0001; Fig. 1). Moreover, as shown in 102% relative to scratch + BSS0 group cells (Fig. 1, Fig. 1, scratch + BSS0 induced nuclear fragmentation and TMRM panel). Similarly, the assessment of the percentage

Fig. 1 Effect of 2% hMSCA-CM on fragmentation, nuclear condensation, nuclei (white arrows); for TMRM: scratch + BSS5 (2086 ± 100); scratch + and mitochondrial parameters in T98G cells subjected to scratch assay. The BSS0 (24.49 ± 1.032), scratch + BSS0 + CM2% (126.6 ± 1.522) scratch + panel shows representative images of T98G cells treated with scratch + BSS5 + CM2% (148.3 ± 2.659); for NAO: scratch + BSS5 (103.3 ± 3046); BSS5, scratch + BSS0, scratch + BSS0+ CM2% (BSS0+) and scratch + scratch + BSS0 (39.17 ± 2.166), scratch + BSS0 + CM2% (102.9 ± 4.127) BSS5 + CM2% (BSS5+). Data are presented as mean ± SEM of at least five and scratch + BSS5 + CM2% (90.59 ± 3.398) and for DCFA: scratch + visual fields and organized for Hoescht 33258: scratch + BSS5 (7.5 ± 1.360); BSS5 (92.67 ± 4.027); scratch + BSS0 (57.52 ± 1.422), scratch + BSS0 + scratch + BSS0 (60.5 ± 1.299), scratch + BSS0 + CM2% (11.4 ± 0.5762) CM2% (141.7 ± 2.989) and scratch + BSS5 + CM2% (134.8 ± 3.758). Scale and scratch + BSS5 + CM2% (6.98 ± 0.8975), fragmented and condensed bar 20 μm

104 2290 Mol Neurobiol (2018) 55:2285–2300 of mitochondrial mass showed a recovery of 63.7% and lipid peroxidation (P < 0.0001; Fig. 2, HNE panel) were (P < 0.0001), as expressed by an increase in NAO fluores- significantly decreased in cells treated with 2% hMSCA-CM, cence in scratch + BSS0 cells treated with 2% hMSCA-CM as opposed to scratch + BSS0, and similar results were ob- (Fig. 1, NAO panel). This value is similar to control (scratch + served for nitrotyrosine (P <0.0001;Fig.2). BSS5, 103.3%). In contrast, scratch + BSS0 cells presented a lower mitochondrial mass with 35.17% (P <0.0001;Fig.1, Two Percent hMSCA-CM Increased the Expression NAO panel). We also observed a significant increase of H2O2 of Antioxidant Proteins in T98G Cells Subjected after 24 h of co-treatment with 2% hMSCA-CM compared to to Scratch Assay scratch + BSS0 (P < 0.0001; DCFA panel). These results suggest that there is a close relationship between the reduction Twenty-four-hour co-treatment with 2% hMSCA-CM result- of superoxide ions reported [22]andtheincreaseofH2O2 ions ed in an upregulation of mitochondrial antioxidant enzymes. found in this study. We observed an increase of 47, 118.5, and 40.7% in the expression of glutathione peroxidase (GPX1; P = 0.0004, Two Percent hMSCA-CM Protected Astrocytes Fig. 3a), superoxide dismutase (SOD2, P < 0.0001; Fig. 3b), Against Oxidative Stress and catalase (CAT, P =0.0006,Fig.3c), respectively, in T98G cells subjected to scratch + BSS0 and treated with 2% To determine the effect of hMSCA-CM on DNA damage, hMSCA-CM in relation to scratch + BSS0 cells alone. The lipid peroxidation and nitrotyrosine formation, T98G cells expression of these enzymes in cells treated with 2% hMSCA- were subjected to scratch + BSS0 for 24 h and treated with CM was higher than those treated with scratch +BSS5. 2% hMSCA-CM. Scratch + BSS0 cells were associated with a marked increase in lipid peroxidation (P <0.0001;Fig.2, Two Percent hMSCA-CM Reduced Astroglial Activation HNE panel), DNA damage (P =0.0002;Figs.2, 8-OHG pan- in Cells Subjected to Scratch Assay el), and nitrotyrosine formation (P < 0.0001; Fig. 2, Nitrotyrosine panel) in T98G cells in comparison with Since expression of intermediate filament proteins can deter- scratch +BSS5(P < 0.0001; Fig. 2). Both the formation of mine the morphological and functional state of a cell [55], the 8-hydroxydeoxyguanosine (P = 0.0002; Fig. 2,8OHGpanel) expression of astrocytic protein markers, GFAP and vimentin

Fig. 2 Two percent hMSCA-CM reduces oxidative stress in astrocytes hydroxydeoxyguanosine (8-OHG) was observed in scratch +BSS0 under scratch assay injury. The scratch + BSS0 increased lipid cells treated with 2% hMSCA-CM (BSS0+; 27.00 ± 0.5774) compared peroxidation in cells (22.00 ± 0.8452) while scratch + BSS0 cells with scratch + BSS0 (35.00 ± 0.5774) (8-OHG panel). Likewise, treated with 2% hMSCA-CM (BSS0+) showed a significant decrease in Nitrotyrosine levels were found increased in cells treated with the production of aldehydes (14.40 ± 0.6782) (HNE panel). Similar scratch + BSS0 alone (24.22 ± 0.7778) and a significant decrease in results were observed in the evaluation of DNA damage and production scratch + BSS0 cells treated with 2% hMSCA-CM (BSS0+; of nitrotyrosine. A significant reduction of DNA damage (8- 16.86 ± 0.7047) (Nitrotyrosine panel). Scale bar 20 μm

105 Mol Neurobiol (2018) 55:2285–2300 2291

Fig. 3 Expression of mitochondrial enzymes of cells subjected to scratch CM2% (BSS5+) (1.171 ± 0.01858); for SOD: scratch +BSS5 assay. Western Blot analysis indicated that the expression of GPX1 (a), (1.124 ± 0.02000); scratch + BSS0 (0.9063 ± 0.04147), scratch + SOD (b), and catalase (c) was higher in scratch + BSS0 cells treated with BSS0 + CM2% (BSS0+) (1981 ± 0.07478) and scratch + BSS5 + 2% hMSCA-CM compared to untreated cells (scratch + BSS0). β-Actin CM2% (BSS5+) (1.775 ± 0.04000); and for Catalase: scratch +BSS5 was used as loading control. For GPX-1: scratch +BSS5 (1.241 ± 0.04202); scratch + BSS0 (1.165 ± 0.06249), scratch +BSS0+ (1.254 ± 0.07138); scratch + BSS0 (1.111 ± 0.07010), scratch + CM2% (BSS0+) (1.640 ± 0.04412) and scratch +BSS5+CM2% BSS0 + CM2% (BSS0+) (1.637 ± 0.03581) and scratch + BSS5 + (1.095 ± 0.04419). P < 0.05, compared with control

were evaluated (Fig. 4a–h). Our results revealed a reduction of (Fig. 5a; arrows) within the cytoplasm. On the other side, cells 46% in GFAP expression in T98G cells treated with scratch + treated with scratch + BSS0 alone showed an irregular con- BSS0 (P < 0.0001; Fig. 4c); in contrast, scratch +BSS0cells tour formed by pseudopods, irregular nucleus, and deeper treated with 2% hMSCA-CM had a higher expression of indentations with one or two nuclei (Fig. 5b) and multiple GFAP (106. 4%; P < 0.0001; Fig. 4i), and this value was vacuoles in the cytoplasm (Fig. 5b, asterisks). Mitochondria similar to that observed in scratch +BSS5(Fig.4i). In addi- were localized towards the periphery of the cytoplasm and tion, we observed an increase of 98% in the expression of showed loss of matrix density, swelling, disorganization and vimentin in T98G cells treated with scratch +BSS0 disruption, moderate to severe loss of cristae (Fig. 5b; (P <0.0001;Fig.4d, j) and a significant decrease of 43% in arrowhead) and vacuolated mitochondria (Fig. 5b; triangle). scratch + BSS0 cells treated with 2% hMSCA-CM In scratch + BSS0 cells treated with 2% hMSCA-CM, mito- (P < 0.0001; Fig. 4f, j). These results showed similarity with chondria were located towards the periphery of the cytoplasm the control group (scratch +BSS5,Fig.4j) and were corrob- in approximately the same number or accumulated near the orated by western blot for both proteins (Fig. 4k,l). nucleus (Fig. 5c). An increase in mitochondrial matrix electrodensity was noted (Fig. 5c, b), with some pleomorphic Ultrastructural Features and Filament Proteins in Cells mitochondria, while others acquired ring configuration Subjected to Scratch Assay (Fig. 5a; a) or autophagic bodies and others showed swelling or density loss but significantly presented more cristae and Twenty-four hours after scratch + BSS0 and treatments, abundant RER within the cytoplasm (Fig. 5c). Additionally, changes in cellular ultrastructure were assessed using electron in scratch + BSS0 cells treated with 2% hMSCA-CM transmission microscopy. Our results showed that scratch + exosomes were observed in the cytoplasm, a finding not ob- BSS5-treated cells had regular outline with some pseudopo- served in untreated cells (Fig. 5c–d square). dia, with an approximated nucleus/cytoplasm ratio of 1:1 and Mitochondria were numerous, with 10–20 per cell (Fig. 5e) the nucleus showed an irregular shape, sometimes indented and were present in a greater amount in scratch + BSS5 com- with one to two nucleoli (Fig. 5a). The rough endoplasmic pared to scratch + BSS0 cells (P = 0.0165). In scratch + reticulum (RER) had abundant presence of glycogen rosettes BSS0-treated cells, round mitochondria were also observed

106 2292 Mol Neurobiol (2018) 55:2285–2300

Fig. 4 Expression of GFAP and Vimentin in T98G cells under scratch assay. The figure shows representative images of T98G cells treated with scratch +BSS5, scratch +BSS0,scratch + BSS0 + CM2% (BSS0+) and scratch + CM2% (BSS5+), immunostained against GFAP and Vimentin (a–h). The bar graphs show the mean fluorescence intensity obtained for each of the proteins in cells subjected to scratch +BSS0after being co-treated for 24 h (i–j). GFAP: scratch +BSS5 (9.8 ± 0.096); scratch +BSS0 (6.9 ± 0.077), scratch +BSS0+ CM2% (BSS0+) (14.8 ± 0.091) and scratch + BSS5 + CM2% (BSS5+) (11.9 ± 0.112) and Vimentin: scratch +BSS5 (28.2 ± 0.240); scratch +BSS0 (49.4 ± 0.280), scratch +BSS0+ CM2% (BSS0+) (26.50 ± 0.331) and scratch + BSS5 + CM2% (27.7 ± 0.295). Scale bar 20 μm. Validation for both proteins by Western Blot are also shown (k–l)

107 Mol Neurobiol (2018) 55:2285–2300 2293

Fig. 5 Ultrastructural features in cells subjected to scratch assay. hMSCA-CM (c–d) presented exosomes (square) in the cytoplasm Micrographs obtained byelectronmicroscopyultrastructureof which were not observed in the other groups. The bar graphs show astrocytes under scratch assay. a Cultured astrocytes as a control group quantitative analysis of parameters analyzed from the micrographs. (scratch + BSS5) have preserved cristae and organized ultrastructure. In Number of mitochondria (e): scratch + BSS5 (15.18 ± 2.535); contrast, untreated cells (scratch + BSS0) showed some pleomorphic scratch + BSS0 (8.214 ± 1.183), scratch +BSS0+CM2% mitochondria, some shriveled, with a condensed configuration (b). (7.629 ± 0.9806) and scratch + BSS5 + CM2% (10.0 ± 1.369); for Several mitochondria of this group show signs of cristolisis (triangles) round mitochondria (f): scratch + BSS5 (11.65 ± 1.915); scratch + and present a disorganized ultrastructure, including perturbed cristae BSS0 (6.643 ± 1.124), scratch + BSS0 + CM2% (4.971 ± 0.7293) and (arrowheads) and vacuoles, loss of membrane integrity near the poles scratch + BSS5 + CM2% (6.694 ± 1.058); for number of vacuoles (g): increases (b; asterisks). Scratch + BSS0 cells treated with 2% hMSCA- scratch + BSS5 (9.765 ± 1.305); scratch + BSS0 (15.89 ± 2.828), CM (c) have focally swollen mitochondria, although they retain their scratch + BSS0 + CM2% (3.400 ± 0.6234) and scratch +BSS5+ morphology and several cristae, besides it showed an increased matrix CM2% (5.528 ± 0.8797) and for number of cristae (h): scratch +BSS5 density (c; b) and had few cytoplasmic vacuoles (c; asterisks). These (4.286 ± 0.1666); scratch + BSS0 (4.248 ± 0.1992), scratch +BSS0+ features were not observed in cells treated with scratch +BSS5or CM2% (5.046 ± 0.2548) and scratch + BSS5 + CM2% (5.265 ± 0.2008) scratch + BSS0 alone (a–b). Scratch + BSS0 cells treated with 2%

but in a smaller amount than in the control group (P =0.0369; increased Ngb expression by 251% in scratch + BSS0 cells Fig. 5f). Besides, significantly, more small vacuoles were not- treated with 2% hMSCA-CM for 24 h (P < 0.0001; Fig. 6f) ed in scratch + BSS0 cells compared to scratch +BSS0cells in relation to scratch + BSS0 only. treated with 2% hMSCA-CM (P = 0.0445; Fig. 5g). Furthermore, 2% hMSCA-CM induced more mitochondrial Blockade of Neuroglobin Reduced the Protection Exerted cristae (0.5–2 mM diameter) in scratch + BSS0 cells by 2% hMSCA-CM in T98G Cells Subjected to Scratch (P < 0.0001; Fig. 5h). Assay

Two Percent hMSCA-CM Upregulated Neuroglobin Since 2% hMSCA-CM augmented Ngb levels (Fig. 6), we Protein Levels in T98G Cells Subjected to Scratch Assay hypothesized that this protein might be playing a role in mediating the neuroprotective effects of the CM. To further de- Theeffectof2%hMSCA-CMonNgbexpressionwas termine the role of Ngb on mitochondrial protection in our evaluated in T98G cells. We performed immunofluores- model, Ngb gene expression was silenced using interference cence and observed that scratch + BSS5 treated cells RNA (RNAi). First, silencing was confirmed by Western blot, (Fig. 6a) presented an increased expression of Ngb com- where a decrease in the levels of Ngb expression was observed pared to scratch + BSS0 cells (P < 0.0001; Fig. 6b). (Fig. 7a). Moreover, the effect of Ngb silencing in Δψm, Furthermore, 2% hMSCA-CM increased Ngb protein mitochondrial mass, and ROS production was analyzed in levels by 222% in scratch + BSS0 cells (P < 0.0001; cells subjected to scratch + BSS0. Our results showed that Fig. 6c, d) and the percentage of Ngb expression was sim- Ngb silencing significantly reduced Δψmbyover72.2%in ilar to that found in scratch + BSS5 (Fig. 6e). These results scratch + BSS0 cells treated with 2% hMSCA-CM compared were in accordance with the western blot, showing an to non-transfected cells (P < 0.0001; Fig. 7b). Moreover,

108 2294 Mol Neurobiol (2018) 55:2285–2300

Fig. 6 Two percent hMSCA-CM upregulates neuroglobin protein levels on protein levels measured by Western blotting. Ngb expression for in cells subjected to scratch assay. Scratch assay plus BSS5 (a) and immunofluorescence in T98G cells are statistically represented as scratch +BSS0(b) alone showed significantly less expression of Ngb follows: scratch + BSS5 (5.234 ± 0.2252); scratch + BSS0 compared to cells scratch + BSS0 + CM2% (c–d). e hMSCA-CM on Ngb (2.365 ± 0.1408), scratch + BSS0 + CM2% (7.603 ± 0.2162), and levels determined by immunofluorescence and (F) hMSCA-CM effects scratch + BSS5 + CM2% (7.874 ± 0.2810). Scale bar 20 μm blockade of Ngb protein reduced by 32.8% the effect of 2% Discussion hMSCA-CM on mitochondrial mass in T98G cells under scratch +BSS0(P < 0.0010; Fig. 7). Furthermore, we ob- Secretome of MSC has been postulated as a therapeutic alter- served an increase of 49% in superoxide levels (P <0.0001; native [56, 57] for different pathologies cardiac [58–60], der- Fig. 7d) and 20.4% in hydrogen peroxide levels (P <0.0001; mal [58], bone [14], and even cerebral pathologies [61–64]. Fig. 7e) when cells are subjected to scratch + SiRNA BSS0 + However, this topic needs to be expanded from the experi- CM2%. mental point of view and at CNS level. In this study, by

Fig. 7 Effect of Ngb silencing in the protection of 2% hMSCA-CM on siRNA BSS0 + CM2% (25.83 ± 3.383); NAO: scratch + BSS5 astrocytic mitochondria in cells subjected to scratch assay. The effect of (2444 ± 116.4); scratch + BSS0 (1222 ± 57.03), scratch + BSS0 + Ngb silencing on some mitochondrial parameters. siNgb validation by CM2% (2123 ± 116.8); scratch + siRNA BSS0 + CM2% Western blot (a). The siNgb reduces mitochondrial membrane potential (1426 ± 111.5); for DHE: scratch + BSS5 (8980 ± 0.4093); scratch + (b) and mitochondrial mass (c)incellsscratch + BSS0 + CM2% and BSS0 (10.73 ± 0.2839), scratch + BSS0 + CM2% (8533 ± 0.2017); scratch + BSS0. Furthermore, the blockade of Ngb increased production siRNA scratch + siRNA BSS0 + CM2% (12.78 ± 0.3914) and for of reactive oxygen species such as superoxide (d) and hydrogen peroxide DFCA: scratch + BSS5 (235.3 ± 15.77); scratch + BSS0 (e). For TMRM: scratch + BSS5 (97.37 ± 1.345); scratch +BSS0 (142.9 ± 2.935), scratch + BSS0 + CM2% (431.6 ± 25.45); scratch + (34.88 ± 4.074), scratch + BSS + CM2% (92.84 ± 4.500); scratch + siRNA BSS0 + CM2% (519.7 ± 19.78)

109 Mol Neurobiol (2018) 55:2285–2300 2295 implementing a model previously established in neurons [65] Previously, we showed that hMSCA-CM reduced the pro- and later assessed in astrocytes [22], we aimed to make an duction of superoxide ion [22]and,inthisstudy,wefounda approximation to the problems involved in TBI as a mechan- significant decreased DNA damage, protein nitration, and lip- ical injury (scratch) and metabolic dysfunction (glucose dep- id peroxidation in cells subjected to scratch + BSS0 and treat- rivation) [66–70] and suggest a possible therapeutic scheme. ed with 2% hMSCA-CM (Fig. 2). These results highlight the The results of this study provide strong evidence of the pro- implications of 2% hMSCA-CM in the elimination of ROS tection of hMSCA-CM on T98G cells subjected to experi- and RNS, both of which are frequently altered in many brain mental cell injury. We observed that 2% hMSCA-CM reduced pathologies [79]. Similarly, decreased apoptosis and produc- nuclear fragmentation, chromatin condensation, ROS production of malondialdehyde (MDA) have been associated to treat- tion, and cell damage and preserved mitochondrial functions ments with genetically modified Ngb-BMSC in a model of and ultrastructure induced by scratch assay. These effects SCI [80] and to an augmented repair of DNA damage after were accompanied by increased expression of mitochondrial treatment with 250 μlofMSC-CMininvivomodelsof antioxidant enzymes, and augmented Ngb expression and that chronic renal disease [81, 82]. In order to validate the above, blockade of Ngb prevented the protective effect of 2% we evaluated some antioxidant enzymes such as GPX-1 hMSCA-CM in scratch injured cells. (Fig. 3a), SOD2 (Fig. 3b), and catalase (Fig. 3c) that may play Importantly, the protective effect observed in our study was antioxidant functions in astrocytes [83–85]. The increase in achieved with a low concentration of hMSCA-CM (2%). Our the expression of these proteins was found in scratch +BSS0 data are in accordance with previous reports showing that cells treated with 2% hMSCA-CM (Fig. 3). Our results are neuroprotection was obtained with a range of 0.25–5% CM consistent with previous findings showing that stem cells de- in a model of ischemia [62]. In contrast, other studies have rived from adipose tissue (ADSC) and their conditioned me- reported favorable concentrations of up to 25–75% CM to dium (ADSC-CM) are good candidates for the control and exert protection in rat cortical astrocytes after ischemic stroke prevention of damage caused by free radicals [86, 87]. [23], among 10–30% CM in ischemic astrocytes and in ALS We have also addressed the effect of 2% hMSCA-CM on [21, 24], 20–25% CM for granular neurons of cerebellum after two main astrocytic cytoskeletal proteins, GFAP and vimentin spinal cord injury (SCI) [71], and 50% CM for protection of [88–90], whose expression is affected in different cerebral cortical neurons after glutamate excitotoxicity [15]. [91–94]. Previous studies reveal that the interaction between One of the main objectives of the present study was to intermediate filaments is required for the formation of the glial determine the mechanisms of action of 2% hMSCA-CM on scar after CNS trauma [95, 96] and the overexpression of human astrocytic model subjected to scratch +BSS0[42, 45]. GFAP, vimentin and nestin is hallmark of reactive astrogliosis First, we found a recovery greater than 81.15% in nuclear [62, 89, 97]. These data support the findings of the present fragmentation and chromatin condensation upon 2% study, where cells subjected to scratch + BSS0 increased ex- hMSCA-CM treatment (Fig. 1), thereby demonstrating the pression of GFAP, but not vimentin (Fig. 4c, d), suggesting effect of 2% hMSCA-CM in scratch + BSS0 cells survival, that 2% hMSCA-CM might regulate reactive astrogliosis. which is consistent with our previous findings [22]. Moreover, This effect may be mediated by trophic factors released by a previous study of SCI found a decrease in neuronal apopto- MSC like PDGF-BB, bFGF, EGF [13, 14], BDNF, NGF sis after treatment with BMSC-CM [71]andareductionof [12, 15, 16], IGF-1 [16], and GDNF [12]thatexertaprotec- neuronal death by 30–35% after being treated with 20–25% tive effect on brain tissue, thereby reducing astrocytes reactiv- MSC-CM in a model of cerebral ischemia and OGD (oxygen ity [17, 18]. These results were corroborated by electron mi- glucose deprivation) [62]. We also found that 2% hMSCA- croscopy. For example, our results on electron microscopy CM maintained normal mitochondrial parameters [72–74]. In (Fig. 5) showed that 2% hMSCA-CM protected T98G cells this study, we analyzed Δψm and mitochondrial mass, since at the ultrastructural level, particularly the mitochondrial cris- these are parameters that allow an approximation of the mito- tae (Fig. 5h)[98, 99]. The cristae are compartments that house chondrial, energetic and apoptotic state [75–77] and we ob- the complexes of the respiratory chain and F1Fo-ATP syn- served that scratch + BSS0 cells treated with 2% hMSCA-CM thase [100], and any disturbance of it affects growth and cell maintained 100% of Δψm and recovered 63% of mitochon- metabolism [101]. Besides, we found a protective effect of 2% drial mass (Fig.1). Previous results showed that 50% hMSC- hMSCA-CM on the cell structure with a conservation of cy- CM increased ATP levels, NAD+ and NADH, prevented toskeleton and organized ultrastructure (Fig. 5c), which agrees Δψm loss and maintained mitochondrial functions [15], be- with previous studies showing the presence of extracellular sides increasing mRNA expression for mitochondrial biogen- matrix molecules and other substances in hMSC-CM esis [78]. Our findings suggest a significant interaction be- [102–104]. Additionally, we observed the presence of tween hMSCA-CM and mitochondria and it may be one of exosomes in the cytoplasm of both scratch + BSS0 + the underlying mechanisms of astrocytic protection, but more CM2% and scratch + BSS5 + CM2% (square; Fig. 5c–d), research in this regard is needed. with a greater presence in the latter group. Exosomes may

110 2296 Mol Neurobiol (2018) 55:2285–2300 contribute to paracrine signaling, and can be taken and inter- found that Ngb promoted neurite outgrowth [113] and atten- nalized with beneficial effects for the cell [105–108]. These uated beta amyloid-induced apoptosis through activating vesicles may contain miRNAs, which can control gene ex- PI3K/Akt signaling pathway [114]. Ngb, a key molecule in pression, and might modulate the survival and metabolic ac- the cerebral homeostasis [30], responsible for the detoxifica- tivities of targeted cells [60, 109, 110]. This could partly ex- tion of ROS/RNS, may improve mitochondrial functions and plain the recovery of scratch + BSS0 cells after being treated prevent cellular death by apoptosis [115]. Few studies have with 2% hMSCA-CM. However, it is necessary to advance confirmed Ngb expression in astrocytes in basal conditions the understanding on exosomes, their biology, composition, [31, 32], but a large body of research showed its expression mechanisms of action, and possible therapeutic use in the under pathological conditions such as stroke, hypoxia, ische- CNS. mia and TBI [37–39]. Ngb can regulate neuroprotection Given the importance of advances in the knowledge of the against hypoxic/ischemic brain damage after ischemic precon- mechanism of action of hMSCA-CM in the protection of CNS ditioning [116] and also protects against OGD-induced neu- cells [23, 24, 79, 102, 111, 112], we have focused our interest rotoxicity by suppressing complex III activity [36]. Moreover, in identifying whether Ngb was involved in the protective Ngb expression has been observed in peri-infarcted areas effect of 2% hMSCA-CM found in our model. Multiple func- [117, 118], as well as in astrocytes stimulated with lipopoly- tions have been assigned to Ngb. At neuronal level, it has been saccharide (LPS) or after lesions in vivo [119–121]. In this

Fig. 8 Proposed model of the effect of 2% hMSCA-CM on the expression of neuroglobin, and reduced nuclear damage and preserve protection of T98G cells subjected to scratch assay. Scratch assay, in cellular ultrastructure. Among the possible mechanisms, we suggest that association with glucose withdraw, impairs astrocyte function and may (i) 2% hMSCA-CM can have a protective effect directly on cells by lead to alterations in ROS scavenging, increased DNA damage, affect decreasing apoptosis (••), (ii) this response can adapt both to the mitochondria function (Δψm and decreased ATP) and ultimately molecular or metabolic level to the cells to withstand the damage, or (3) induces irreversible cell damage. On the other hand, in our study, we (§§) 2%hMSCA-CM can stimulate the cells to release factors that allow observed that 2% hMSCA-CM for 24 h attenuated ROS production them to self-protect, protect other cells (for example, astrocytes) during leading to recovery of mitochondrial function and nuclear activity. In the injury (**). It is noteworthy that all these mechanisms might be addition, T98G cells treated with 2% 2% hMSCA-CM showed dependent on neuroglobin expression, as blockade of this protein increased antioxidant protection (SOD1, Gpx-1 and catalase), increased reduced the mitochondrial protection exerted by conditioned medium

111 Mol Neurobiol (2018) 55:2285–2300 2297 study, we first determined whether Ngb was expressed in normal t cell expressed and secreted; (RER), Rough endoplas- T98G cells under scratch + BSS0 alone and/or treated with mic reticulum; (RNS), Reactive nitrogen species; (ROS), 2% hMSCA-CM. Our findings indicated that cells subjected Reactive oxygen species; (SHEDs), Stem cells from human to scratch + BSS0 expressed Ngb (Fig. 6)and,surprisingly, exfoliated deciduous teeth; (SOD), Superoxide dismutase; 2% hMSCA-CM upregulated this protein (Fig. 6c). These (SPARC), Secreted protein acidic and rich in cysteine; data are consistent with previous study showing Ngb expres- (TBI), Amyotrophic Lateral Sclerosisx; (TBI), Traumatic sion in human astrocytes following brain trauma [122]; how- Brain Injury; (TMRM), Tetramethyl rhodamine methyl ester. ever, our study is the first report showing that 2% hMSCA- CM upregulates Ngb in an astrocytic model. Further, to con- Acknowledgments The authors thank Dr. Jorge Andres Afanador and firm the role of this protein in our model, we blocked it by the staff of the cosmetic surgery Clinic DHARA in Bogotá - Colombia, for the adipose tissue samples. This work was supported by PUJ grant using siRNA and found that Ngb silencing reduced the pro- #6260 to GEB and scholarship for doctoral studies awarded by the tective effect of 2% hMSCA-CM by altering parameters such Vicerrectoria Académica of PUJ to Baez-Jurado E. as Δψm and mitochondrial mass and significantly increasing the production of ROS (Fig. 7b,c,d,e).Thesefindingssug- Compliance with Ethical Standards gest that 2% hMSCA-CM may favor mitochondria functioning through the direct relationship between mitochondrial in- Conflict of Interest The authors declare that they have no conflict of interest. tegrity and Ngb [38, 123], reduction of oxidative damage

[124] and as a glioprotective agent that prevents H2O2-induced oxidative stress and apoptotic astroglial cell death References [125], suggesting the importance of Ngb for mitochondrial function and the neuroprotection exerted by astrocytes 1. Wei X et al (2013) Mesenchymal stem cells: a new trend for cell (Fig. 8). However, we need to expand research to evaluate therapy. Acta Pharmacol Sin 34(6):747–754 the potential of hMSCA-CM in other cell types and in vivo 2. Toma C et al (2002) Human mesenchymal stem cells differentiate models that will confirm the importance of our findings and to a cardiomyocyte phenotype in the adult murine heart. – determine whether the protective mechanism of hMSCA-CM, Circulation 105(1):93 98 3. Guerit D et al (2014) FOXO3A regulation by miRNA-29a con- at least mediated by Ngb, is related to a survival signaling trols chondrogenic differentiation of mesenchymal stem cells and pathway or their action directly on the nucleus or cartilage formation. Stem Cells Dev 23(11):1195–1205 mitochondria. 4. Oswald J et al (2004) Mesenchymal stem cells can be differenti- (ADSC), Adipose-derived stem cells; (ADSC-CM) ated into endothelial cells in vitro. Stem Cells 22(3):377–384 5. Taniguchi H et al. (2016) An Efficient Method to Obtain Conditioned medium of Adipose-derived stem cells; (ASC), Dedifferentiated Fat Cells. J Vis Exp (113) Adipose- derived stem cells; (ASC-CM), Adipose- derived 6. Gnecchi M et al (2016) Paracrine mechanisms of mesenchymal stem cells-Conditioned Medium; (BDNF), Brain-derived neu- stem cells in tissue repair. Methods Mol Biol 1416:123–146 rotrophic factor; (bFGF), Basic fibroblast growth factor; 7. Huang B et al (2016) Mesenchymal stem cells and their secreted (BMSC-CM), Bone marrow mesenchymal stem cells; molecules predominantly ameliorate fulminant hepatic failure and chronic liver fibrosis in mice respectively. J Transl Med 14:45 (BSS0), Balanced salt solution; (CAT), Catalase; (CM) 8. Hwang B et al (2016) Pretreatment with bone marrow-derived Conditioned medium; (CNS), Central nervous system; mesenchymal stromal cell-conditioned media confers pulmonary (DFCA), (5(6)-Carboxy-2′,7′-dichlorofluorescein diacetate; ischemic tolerance. J Thorac Cardiovasc Surg 151(3):841–846 (DHE), Dihydroethidium; (EGF), Epidermal growth factor; 9. Lee JC et al (2016) Notice of retraction: therapeutic effects of umbilical cord blood derived mesenchymal stem cell- (FBS), Fetal bovine serum; (GDNF), Glial cell line-derived conditioned medium on pulmonary arterial hypertension in rats. neurotrophic factor; (GFAP), Acidic protein glial fibrillary; J Pathol Transl Med 50(4):325 (GPX1), Glutathione peroxidase; (hASC-CM), Human 10. Pires AO et al (2016) Unveiling the differences of secretome of adipose-derived stem cell-conditioned medium; (hDPSCs), human bone marrow mesenchymal stem cells, adipose tissue- derived stem cells, and human umbilical cord perivascular cells: Human dental pulp stem cells; (hMSCA-CM), Human mes- a proteomic analysis. Stem Cells Dev 25(14):1073–1083 enchymal stem cells adipose conditioned medium; 11. Pischiutta F et al (2016) Protection of brain injury by amniotic (hUCMSCs), Human umbilical cord mesenchymal stem cells; mesenchymal stromal cell-secreted metabolites. Crit Care Med (HUCPVCs), Human umbilical cord perivascular cells; (IGF- 44(11):e1118–e1131 12. Kupcova Skalnikova H (2013) Proteomic techniques for charac- 1), Insulin-like growth factor 1; (LPS), lipopolysaccharide; terisation of mesenchymal stem cell secretome. Biochimie 95(12): (MCP-1), Monocyte chemoattractant protein-1; (MSC), 2196–2211 Mesenchymal stem cells; (NAO), Nonyl acridine orange; 13. Kilroy GE et al (2007) Cytokine profile of human adipose-derived (Ngb), Neuroglobin; (NGF), nerve growth factor; (OGD), stem cells: expression of angiogenic, hematopoietic, and pro- – Oxygen-glucose deprivation; (PB), Phosphate buffer; (PBS), inflammatory factors. J Cell Physiol 212(3):702 709 14. Linero I, Chaparro O (2014) Paracrine effect of mesenchymal Phosphate buffered saline; (PDGF-BB), Platelet-derived stem cells derived from human adipose tissue in bone regenera- growth factor-BB; (RANTES), Regulated on activation, tion. PLoS One 9(9):e107001

112 2298 Mol Neurobiol (2018) 55:2285–2300

15. Hao P et al (2014) Conditioned medium of human adipose- 34. Yu ZL et al (2014) Neuroglobin—a potential biological marker of derived mesenchymal stem cells mediates protection in neurons retinal damage induced by LED light. Neuroscience 270:158–167 following glutamate excitotoxicity by regulating energy metabo- 35. Acaz-Fonseca E et al. (2015) Sex differences in glia reactivity after lism and GAP-43 expression. Metab Brain Dis 29(1):193–205 cortical brain injury. Glia 16. Wei X et al (2009) IFATS collection: the conditioned media of 36. Yu Z et al (2016) Roles of neuroglobin binding to mitochondrial adipose stromal cells protect against hypoxia-ischemia-induced complex III subunit cytochrome c1 in oxygen-glucose depriva- brain damage in neonatal rats. Stem Cells 27(2):478–488 tion-induced neurotoxicity in primary neurons. Mol Neurobiol 17. Cirillo G et al (2011) Reactive astrocytosis-induced perturbation 53(5):3249–3257 of synaptic homeostasis is restored by nerve growth factor. 37. Taylor JM et al (2014) Neuroglobin overexpression improves sen- Neurobiol Dis 41(3):630–639 sorimotor outcomes in a mouse model of traumatic brain injury. 18. Deng LX et al (2011) GDNF modifies reactive astrogliosis Neurosci Lett 577:125–129 allowing robust axonal regeneration through Schwann cell- 38. Yu Z et al (2012) Neuroglobin, a novel target for endogenous seeded guidance channels after spinal cord injury. Exp Neurol neuroprotection against stroke and neurodegenerative disorders. 229(2):238–250 Int J Mol Sci 13(6):6995–7014 19. Mita T et al (2015) Conditioned medium from the stem cells of 39. Zhao S et al (2012) Neuroglobin-overexpression reduces traumat- human dental pulp improves cognitive function in a mouse model ic brain lesion size in mice. BMC Neurosci 13:67 of Alzheimer's disease. Behav Brain Res 293:189–197 40. Zhou Z et al (2013) Comparison of mesenchymal stromal cells 20. Guo ZY et al (2015) Human umbilical cord mesenchymal stem from human bone marrow and adipose tissue for the treatment of – cells promote peripheral nerve repair via paracrine mechanisms. spinal cord injury. Cytotherapy 15(4):434 448 Neural Regen Res 10(4):651–658 41. Avila Rodriguez M et al (2014) Tibolone protects T98G cells from – 21. Song M et al (2015) Comparison of the effects of human dental glucose deprivation. J Steroid Biochem Mol Biol 144 Pt B:294 pulp stem cells and human bone marrow-derived mesenchymal 303 stem cells on ischemic human astrocytes in vitro. J Neurosci Res 42. Cabezas R et al (2015) PDGF-BB protects mitochondria from – 93(6):973–983 rotenone in T98G cells. Neurotox Res 27(4):355 367 22. Torrente D et al (2014) Paracrine factors of human mesenchymal 43. Mimura J et al (2011) Nrf2 regulates NGF mRNA induction by stem cells increase wound closure and reduce reactive oxygen carnosic acid in T98G glioblastoma cells and normal human as- – species production in a traumatic brain injury in vitro model. trocytes. J Biochem 150(2):209 217 Hum Exp Toxicol 33(7):673–684 44. Sasaki S et al (2015) Functional characterization of 5-oxoproline transport via SLC16A1/MCT1. J Biol Chem 290(4):2303–2311 23. Huang Wet al (2015) Paracrine factors secreted by MSCs promote 45. Toro-Urrego N et al (2016) Testosterone protects mitochondrial astrocyte survival associated with GFAP downregulation after is- function and regulates neuroglobin expression in astrocytic cells chemic stroke via p38 MAPK and JNK. J Cell Physiol 230(10): exposed to glucose deprivation. Front Aging Neurosci 8:152 2461–2475 46. Bourguignon LYet al (2007) Hyaluronan-CD44 interaction stim- 24. Sun H et al (2013) Therapeutic potential of mesenchymal stromal ulates Rac1 signaling and PKN gamma kinase activation leading cells and MSC conditioned medium in amyotrophic lateral scle- to cytoskeleton function and cell migration in astrocytes. J rosis (ALS)—in vitro evidence from primary motor neuron cul- Neurochem 101(4):1002–1017 tures, NSC-34 cells, astrocytes and microglia. PLoS One 8(9): 47. Ouyang Y-Bet al (2011) Overexpressing GRP78 influences Ca 2+ e72926 handling and function of mitochondria in astrocytes after 25. Salgado AJ et al (2010) Role of human umbilical cord mesenchy- ischemia-like stress. Mitochondrion 11(2):279–286 mal progenitors conditioned media in neuronal/glial cell densities, 48. Oliva CR et al (2011) Acquisition of chemoresistance in gliomas viability, and proliferation. Stem Cells Dev 19(7):1067–1074 is associated with increased mitochondrial coupling and decreased 26. Cho YJ et al (2012) Therapeutic effects of human adipose stem – ROS production. PLoS One 6(9):e24665 cell-conditioned medium on stroke. J Neurosci Res 90(9):1794 49. Jeong SH et al (2014) Echinochrome a increases mitochondrial 1802 massandfunctionbymodulatingmitochondrialbiogenesisregu- 27. Egashira Y et al (2012) The conditioned medium of murine and latory genes. Mar Drugs 12(8):4602–4615 human adipose-derived stem cells exerts neuroprotective effects 50. Habersetzer J et al (2013) Human F1F0 ATP synthase, mitochon- – against experimental stroke model. Brain Res 1461:87 95 drial ultrastructure and OXPHOS impairment: a (super-)complex 28. Yamazaki H et al (2015) Adipose-derived stem cell-conditioned matter? PLoS One 8(10):e75429 medium ameliorates antidepression-related behaviors in the 51. Janer A et al (2016) SLC25A46 is required for mitochondrial lipid – mouse model of Alzheimer's disease. Neurosci Lett 609:53 57 homeostasis and cristae maintenance and is responsible for Leigh 29. Yousefi F et al (2016) In vivo immunomodulatory effects of syndrome. EMBO Mol Med 8(9):1019–1038 adipose-derived mesenchymal stem cells conditioned medium in 52. Ott C et al (2012) Sam50 functions in mitochondrial intermem- experimental autoimmune encephalomyelitis. Immunol Lett 172: brane space bridging and biogenesis of respiratory complexes. 94–105 Mol Cell Biol 32(6):1173–1188 30. Baez E et al (2016) Protection by neuroglobin expression in brain 53. Birk AVet al (2013) The mitochondrial-targeted compound SS-31 pathologies. Front Neurol 7:146 re-energizes ischemic mitochondria by interacting with 31. Avivi A et al (2010) Neuroglobin, cytoglobin, and myoglobin cardiolipin. J Am Soc Nephrol 24(8):1250–1261 contribute to hypoxia adaptation of the subterranean mole rat 54. Bankhead P (2013) Analyzing fluorescence microscopy images Spalax. Proc Natl Acad Sci U S A 107(50):21570–21575 with ImageJ. Nikon Imaging Center, Heidelberg University, 32. Lechauve C et al (2013) Neuroglobin involvement in visual path- Queen’s University Belfast ways through the optic nerve. Biochim Biophys Acta 1834(9): 55. Collard JF, Cote F, Julien JP (1995) Defective axonal transport in a 1772–1778 transgenic mouse model of amyotrophic lateral sclerosis. Nature 33. Avila-Rodriguez M et al (2016) Tibolone protects astrocytic cells 375(6526):61–64 from glucose deprivation through a mechanism involving estrogen 56. Bertheuil N et al (2015) Adipose-derived stromal cells: history, receptor beta and the upregulation of neuroglobin expression. Mol isolation, immunomodulatory properties and clinical perspectives. Cell Endocrinol 433:35–46 Ann Chir Plast Esthet 60(2):94–102

113 Mol Neurobiol (2018) 55:2285–2300 2299

57. Pittenger MF, Martin BJ (2004) Mesenchymal stem cells and their 80. Lin WP et al (2013) Effect of neuroglobin genetically modified potential as cardiac therapeutics. Circ Res 95(1):9–20 bone marrow mesenchymal stem cells transplantation on spinal 58. Gnecchi M et al (2008) Paracrine mechanisms in adult stem cell cord injury in rabbits. PLoS One 8(5):e63444 signaling and therapy. Circ Res 103(11):1204–1219 81. Platas J et al (2016) Paracrine effects of human adipose-derived 59. Mirotsou M et al (2011) Paracrine mechanisms of stem cell repar- mesenchymal stem cells in inflammatory stress-induced senes- ative and regenerative actions in the heart. J Mol Cell Cardiol cence features of osteoarthritic chondrocytes. Aging (Albany 50(2):280–289 NY) 8(8):1703–1717 60. Baglio SR, Pegtel DM, Baldini N (2012) Mesenchymal stem cell 82. van Koppen A et al (2012) Human embryonic mesenchymal stem secreted vesicles provide novel opportunities in (stem) cell-free cell-derived conditioned medium rescues kidney function in rats therapy. Front Physiol 3:359 with established chronic kidney disease. PLoS One 7(6):e38746 61. Liang CM et al (2014) Neurotrophic and neuroprotective potential 83. Fernandez-Fernandez S, Almeida A, Bolanos JP (2012) of human limbus-derived mesenchymal stromal cells. Antioxidant and bioenergetic coupling between neurons and as- Cytotherapy 16(10):1371–1383 trocytes. Biochem J 443(1):3–11 62. Scheibe F et al (2012) Mesenchymal stromal cells rescue cortical 84. Griffiths CE, Voorhes JJ (1990) Cyclosporine A in the treatment of neurons from apoptotic cell death in an in vitro model of cerebral psoriasis: a clinical and mechanistic perspective. J Invest Dermatol ischemia. Cell Mol Neurobiol 32(4):567–576 95(5):53S–55S 63. Chen D, et al. (2016) Therapeutic effects of intranigral transplan- 85. Wilson JX (1997) Antioxidant defense of the brain: a role for tation of mesenchymal stem cells in rat models of Parkinson's astrocytes. Can J Physiol Pharmacol 75(10–11):1149–1163 disease. J Neurosci Res 86. Kim WS et al (2008) Evidence supporting antioxidant action of 64. Xie B et al (2016) Therapeutic effects of human umbilical cord adipose-derived stem cells: protection of human dermal fibroblasts mesenchymal stem cells transplantation on hypoxic ischemic en- from oxidative stress. J Dermatol Sci 49(2):133–142 – cephalopathy. Am J Transl Res 8(7):3241 3250 87. Yalvac ME et al (2013) Characterization of the secretome of hu- 65. Allen J, Knoblach S, Faden A (1999) Combined mechanical trau- man tooth germ stem cells (hTGSCs) reveals neuro-protection by ma and metabolic impairment in vitro induces NMDA receptor- fine-tuning micro-environment. Brain Behav Immun 32:122–130 dependent neuronal cell death and caspase-3-dependent apoptosis. 88. Hol EM, Pekny M (2015) Glial fibrillary acidic protein (GFAP) – FASEB J 13(13):1875 1882 and the astrocyte intermediate filament system in diseases of the 66. Greve MW, Zink BJ (2009) Pathophysiology of traumatic brain central nervous system. Curr Opin Cell Biol 32:121–130 injury. Mt Sinai J Med 76(2):97–104 89. Pekny M, Pekna M (2004) Astrocyte intermediate filaments in 67. Kallakuri S et al (2015) Traumatic brain injury by a closed head CNS pathologies and regeneration. J Pathol 204(4):428–437 injury device induces cerebral blood flow changes and 90. Wilhelmsson U et al (2004) Absence of glial fibrillary acidic pro- Microhemorrhages. J Clin Imaging Sci 5:52 tein and vimentin prevents hypertrophy of astrocytic processes 68. Prins M et al (2013) The pathophysiology of traumatic brain injury and improves post-traumatic regeneration. J Neurosci 24(21): at a glance. Dis Model Mech 6(6):1307–1315 5016–5021 69. Lattanzi W et al (2011) Neurotrophic features of human adipose 91. George E, Barreto JG, Capani F and Morales L (2011) Role of tissue-derived stromal cells: in vitro and in vivo studies. J Biomed astrocytes in neurodegenerative diseases, in neurodegenerative Biotechnol 2011:468705 diseases—processes, prevention, protection and monitoring 70. Ong WK, Sugii S (2013) Adipose-derived stem cells: fatty poten- 92. Shafit-Zagardo B, Kume-Iwaki A, Goldman JE (1988) Astrocytes tials for therapy. Int J Biochem Cell Biol 45(6):1083–1086 regulate GFAP mRNA levels by cyclic AMP and protein kinase 71. Cantinieaux D et al (2013) Conditioned medium from bone C-dependent mechanisms. Glia 1(5):346–354 marrow-derived mesenchymal stem cells improves recovery after spinal cord injury in rats: an original strategy to avoid cell trans- 93. Banasr M et al (2010) Glial pathology in an animal model of plantation. PLoS One 8(8):e69515 depression: reversal of stress-induced cellular, metabolic and be- 72. Anne Stetler R et al (2013) The dynamics of the mitochondrial havioral deficits by the glutamate-modulating drug riluzole. Mol – organelle as a potential therapeutic target. J Cereb Blood Flow Psychiatry 15(5):501 511 Metab 33(1):22–32 94. Eliasson C, Sahlgren C, Berthold CH, Stakeberg J, Celis JE, 73. Duchen MR, Szabadkai G (2010) Roles of mitochondria in human Betsholtz C, Eriksson JE, Pekny M (1999) Intermediate filament – disease. Essays Biochem 47:115–137 protein partnership in astrocytes. J Biol Chem 274:23996 24006 74. Picard M et al (2013) Mitochondrial morphology transitions and 95. Hue L (1976) The use of [14C,3H] glucose in the study of so- – functions: implications for retrograde signaling? Am J Physiol called 'futile cycles' in liver. Biochem Soc Trans 4(6):994 998 Regul Integr Comp Physiol 304(6):R393–R406 96. Lee HH et al (2015) Time course and characteristics of astrocyte 75. Nakashima-Kamimura N et al (2005) MIDAS/GPP34, a nuclear activation in the rat brain after injury. Korean J Neurotrauma – gene product, regulates total mitochondrial mass in response to 11(2):44 51 mitochondrial dysfunction. J Cell Sci 118(Pt 22):5357–5367 97. Nunnari J, Suomalainen A (2012) Mitochondria: in sickness and 76. Kaewsuya P, Danielson ND, Ekhterae D (2007) Fluorescent de- in health. Cell 148(6):1145–1159 termination of cardiolipin using 10-N-nonyl acridine orange. Anal 98. Zick M, Rabl R, Reichert AS (2009) Cristae formation-linking Bioanal Chem 387(8):2775–2782 ultrastructure and function of mitochondria. Biochim Biophys 77. Witte I et al (2011) Beyond reduction of atherosclerosis: PON2 Acta 1793(1):5–19 provides apoptosis resistance and stabilizes tumor cells. Cell 99. Rampelt H, et al. (2016) Role of the mitochondrial contact site and Death Dis 2:e112 cristae organizing system in membrane architecture and dynamics. 78. Yuan Y et al (2016) Mesenchymal stem cell-conditioned media Biochim Biophys Acta ameliorate diabetic endothelial dysfunction by improving mito- 100. Cogliati S, Enriquez JA, Scorrano L (2016) Mitochondrial cristae: chondrial bioenergetics via the Sirt1/AMPK/PGC-1alpha path- where beauty meets functionality. Trends Biochem Sci 41(3):261– way. Clin Sci (Lond) 130(23):2181–2198 273 79. Kemp K et al (2010) Mesenchymal stem cell-secreted superoxide 101. Salgado AJ et al (2010) Adipose tissue derived stem cells dismutase promotes cerebellar neuronal survival. J Neurochem secretome: soluble factors and their roles in regenerative medi- 114(6):1569–1580 cine. Curr Stem Cell Res Ther 5(2):103–110

114 2300 Mol Neurobiol (2018) 55:2285–2300

102. Walter MN et al (2010) Mesenchymal stem cell-conditioned me- 114. Sandhir R (2014) Neuroglobin increases brain fitness: commen- dium accelerates skin wound healing: an in vitro study of fibro- tary to: "Neuroglobin overexpression improves sensorimotor out- blast and keratinocyte scratch assays. Exp Cell Res 316(7):1271– comes in a mouse model of traumatic brain injury". Neurosci Lett 1281 577:123–124 103. Aizman I, McGrogan M, Case CC (2013) Quantitative microplate 115. Liu Y et al (2015) Neuroglobin up-regulation after ischaemic pre- assay for studying mesenchymal stromal cell-induced conditioning in a rat model of middle cerebral artery occlusion. neuropoiesis. Stem Cells Transl Med 2(3):223–232 Brain Inj 29(5):651–657 104. Hu L et al (2016) Exosomes derived from human adipose 116. Ren C et al (2015) Limb remote ischemic per-conditioning in mensenchymal stem cells accelerates cutaneous wound healing combination with post-conditioning reduces brain damage and via optimizing the characteristics of fibroblasts. Sci Rep 6:32993 promotes neuroglobin expression in the rat brain after ischemic 105. Yuan H, et al. (2016) Exosomes secreted by human urine-derived stroke. Restor Neurol Neurosci 33(3):369–379 stem cells accelerate skin wound healing by promoting angiogen- 117. Jin K et al (2010) Neuroglobin expression in ischemic stroke. esis in rat. Cell Biol Int Stroke 41(3):557–559 106. Qi X et al (2016) Exosomes secreted by human-induced pluripo- 118. Li Q et al (2004) A syntaxin 1, Galpha(o), and N-type calcium tent stem cell-derived mesenchymal stem cells repair critical-sized channel complex at a presynaptic nerve terminal: analysis by bone defects through enhanced angiogenesis and osteogenesis in quantitative immunocolocalization. J Neurosci 24(16):4070–4081 osteoporotic rats. Int J Biol Sci 12(7):836–849 119. Fiocchetti M et al (2015) ERbeta-dependent neuroglobin up- 107. Zhang J et al (2015) Exosomes released from human induced regulation impairs 17beta-estradiol-induced apoptosis in DLD-1 pluripotent stem cells-derived MSCs facilitate cutaneous wound colon cancer cells upon oxidative stress injury. J Steroid Biochem healing by promoting collagen synthesis and angiogenesis. J MolBiol149:128–137 Transl Med 13:49 108. Eirin A et al (2014) MicroRNA and mRNA cargo of extracellular 120. De Marinis E et al (2013) 17beta-Oestradiol anti-inflammatory vesicles from porcine adipose tissue-derived mesenchymal stem effects in primary astrocytes require oestrogen receptor beta- – mediated neuroglobin up-regulation. J Neuroendocrinol 25(3): cells. Gene 551(1):55 64 – 109. Pegtel DM et al (2010) Functional delivery of viral miRNAs via 260 270 exosomes. Proc Natl Acad Sci U S A 107(14):6328–6333 121. Chen X et al (2015) Long-term neuroglobin expression of human – 110. Liu Y et al (2013) Effects of bone marrow-derived mesenchymal astrocytes following brain trauma. Neurosci Lett 606:194 199 stem cells on the axonal outgrowth through activation of PI3K/ 122. Yu Z et al (2012) Mitochondrial distribution of neuroglobin and its AKT signaling in primary cortical neurons followed oxygen- response to oxygen-glucose deprivation in primary-cultured glucose deprivation injury. PLoS One 8(11):e78514 mouse cortical neurons. Neuroscience 218:235–242 111. Park CM et al (2016) Umbilical cord mesenchymal stem cell- 123. Oliveira KC et al (2015) Thyroid hormone modulates neuroglobin conditioned media prevent muscle atrophy by suppressing muscle and cytoglobin in rat brain. Metab Brain Dis 30(6):1401–1408 atrophy-related proteins and ROS generation. In Vitro Cell Dev 124. Amri F et al (2017) Neuroglobin protects astroglial cells from Biol Anim 52(1):68–76 hydrogen peroxide-induced oxidative stress and apoptotic cell 112. Li L et al (2014) Neuroglobin promotes neurite outgrowth via death. J Neurochem 140(1):151–169 differential binding to PTEN and Akt. Mol Neurobiol 49(1): 125. Gonzalez A, Pariente JA, Salido GM (2007) Ethanol stimulates 149–162 ROS generation by mitochondria through Ca2+ mobilization and 113. Li Y et al (2016) Neuroglobin attenuates beta amyloid-induced increases GFAP content in rat hippocampal astrocytes. Brain Res apoptosis through inhibiting caspases activity by activating 1178:28–37 PI3K/Akt signaling pathway. J Mol Neurosci 58(1):28–38

115 Capítulo 2 Efecto del medio condicionado de células madre mesenquimales derivadas de tejido adiposo humano sobre astrocitos con inhibición mitocondrial en un modelo in vitro de scratch y privación de glucosa.

116

El cerebro es un órgano privilegiado desde el punto de vista inmunológico (W. Chen, Zhang, & Huang, 2016). Las diferentes células que conforman el tejido cerebral pueden responder como sensores a cualquier variación en el ambiente regulando procesos celulares como la neuroinflamación. De estas células, los astrocitos y la microglía regulan directamente los procesos neuroinflamatorios (González, Elgueta, Montoya, & Pacheco, 2014; Karve, Taylor, & Crack, 2016), generando respuestas bioquímicas y celulares. Dichas respuestas son diversas y pueden ir desde la regulación de los niveles de calcio en diferentes compartimentos celulares hasta la expresión de proteínas y genes involucrados en vías de señalización que pueden conducir a un deterioro continuo y sistemático del tejido cerebral (Pedraza-Alva, Pérez-Martínez, Valdez-Hernández, Meza-Sosa, & Ando-Kuri, 2015; Sochocka, Diniz, & Leszek, 2017).

En estudios previos realizados por nuestro grupo de investigación se ha reportado la eficacia de CM-hMSCA para mejorar el cierre de la herida y reducir la producción de ERO (Torrente et al., 2014), además de proteger las mitocondrias en astrocitos sometidos a scratch y privación de glucosa (Baez-Jurado et al., 2018). Sin embargo, los mecanismos de acción de CM-hMSCA para proteger a los astrocitos durante una lesión cerebral traumática no se han explorado completamente.

Por lo anterior, en este capítulo se muestran los efectos del CM-hMSCA sobre las citoquinas, el calcio a nivel citoplasmático, la regulación de la dinámica mitocondrial y la cadena respiratoria en un modelo astrocitario (T98G) sujeto a scratch y privación de glucosa. Además, se muestra el efecto del CM-hMSCA en la modulación de la expresión de diferentes proteínas involucradas en vías de señalización y la confirmación que la neuroglobina (Ngb) está mediando en parte los efectos protectores del CM-hMSCA a través de la regulación de proteínas y del estrés oxidativo. En el manuscrito que se presenta a continuación, el cual ha sido sometido para publicación en la revista Molecular Neurobiology, están los resultados que sugieren que el uso del CM-hMSCA puede estar regulando la inflamación cerebral y la recuperación de aspectos celulares fundamentales en la neuroprotección.

117

Mitochondrial neuroglobin is necessary for protection induced by conditioned medium from human adipose-derived mesenchymal stem cells in astrocytic cells subjected to scratch and metabolic injury

Eliana Baez-Juradoa, Gina Guio-Vegaa, Oscar Hidalgo-Lanussaa, Janneth Gonzáleza, Valentina Echeverriab,c, Ghulam Md Ashrafd, Amirhossein Sahebkare,f,g, George E. Barretoa,*

a Departamento de Nutrición y Bioquímica, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogotá D.C., Colombia b Facultad de Ciencias de la Salud, Universidad San Sebastian, Lientur 1457, 4080871, Concepción, Chile c Research & Development Service, Bay Pines VA Healthcare System, Bay Pines, FL 33744, USA d King Fahd Medical Research Center, King Abdulaziz University, Jeddah 21589, Saudi Arabia e Neurogenic Inflammation Research Center, Mashhad University of Medical Sciences, Mashhad, Iran f Biotechnology Research Center, Pharmaceutical Technology Institute, Mashhad University of Medical Sciences, Mashhad, Iran g School of Pharmacy, Mashhad University of Medical Sciences, Mashhad, Iran

118

Abstract

Astrocytes are specialized cells capable of regulating inflammatory responses in neurodegenerative diseases or traumatic brain injury. In addition to playing an important role in neuroinflammation, these cells regulate essential functions for the preservation of brain tissue. Therefore, the search for therapeutic alternatives to preserve these cells and maintain their functions contributes in some way to counteract the progress of the injury and maintain neuronal survival in various brain pathologies. Among these strategies, the conditioned medium from human adipose-derived mesenchymal stem cells derived (CM- hMSCA) has been reported with a potential beneficial effect against several neuropathologies. In this study, we evaluated the protective effect of CM-hMSCA in a model of human astrocytes (T98G cells) subjected to scratch injury. Our findings demonstrated that CM-hMSCA regulates the cytokines IL-2, IL-6, IL-8, IL-10, GM-CSF and TNF-a, down-regulates calcium at the cytoplasmic level, and regulates mitochondrial dynamics and respiratory chain. These actions are accompanied by modulation of the expression of different proteins involved in signaling pathways such as AKT/pAKT and ERK1/2/pERK, and may mediate the localization of neuroglobin (Ngb) at the cellular level. We also confirmed that Ngb mediated the protective effects of CM-hMSCA through the regulation of proteins involved in survival pathways and oxidative stress. In conclusion, regulation of brain inflammation combined with the recovery of fundamental cellular aspects in the face of injury makes CM-hMSCA a promising candidate for the protection of astrocytes in brain pathologies.

Keywords: Astrocytes; scratch assay; mesenchymal stem cells; inflammation; conditioned medium; neuroglobin.

119

1. Introduction Brain pathologies such as stroke, ischemia, Amyotrophic Lateral Sclerosis (ALS), neurodegeneration and Traumatic Brain Injury (TBI) all share an inflammatory component in their etiology. The brain is a privileged organ from the immune point of view [1]. Different cells that make up the brain tissue are able to respond as sensors to any variation in the environment by regulating cellular processes such as neuroinflammation. Of these cells, astrocytes and microglia directly regulate neuroinflammatory processes [2-4] by generating biochemical and cellular responses. Such responses are diverse and can range from the regulation of calcium levels in different cellular compartments to the expression of proteins involved in signaling pathways that may lead to a continuous and systematic deterioration of brain tissue [5,6]. Currently, several molecules and therapeutic alternatives have been assessed as an attempt to reduce the impact of inflammatory markers, oxidative stress and cell death in face of CNS lesions.

The use of Conditioned Medium-Mesenchymal Stem Cells derived from Human Adipose Tissue (CM- hMSCA) has shown a wide range of neuroprotective effects [7-10], which are mainly attributed to secreted molecules and soluble factors such as neurotrophins, cytokines, anti-inflammatory molecules and anti-apoptotic molecules [11]. CM-hMSCA can intervene in different cellular processes and provide cytoprotective and immunomodulatory effects. For this reason, CM-hMSCA has been considered as a possible therapeutic alternative for the treatment or prevention of secondary injury caused by the inflammatory processes that develop during cerebral pathologies [12,7,8]. Notably, the CM-hMSCA is promising in cell therapy not only for the benefits that had previously been reported [13-15,9,10], but also because these cells are derived from adipose tissue which is an abundant and easily accessible source of MSCs [16,17].

Previous studies have reported the efficacy of CM-hMSCA in improving wound closure and reducing the production of Reactive Oxygen Species (ROS) [18], and protecting mitochondria in astrocytes subjected to scratch [9,10]. Similarly, conditioned medium derived from other MSCs has been reported to provide cytoprotection of astrocytes in different brain pathologies such as ischemia [19], oxygen- glucose deprivation (OGD) [20] and ALS [21]. However, the mechanisms of action of CM-hMSCA in protecting astrocytes during TBI have not been fully explored. In this study, we investigated whether CM-hMSCA can protect human astrocytes subjected to scratch as an experimental model of mechanical injury and metabolic dysfunction (glucose deprivation).

2. Materials and Methods 2.1 Primary Culture of Mesenchymal Stem Cells derived from Human Adipose Tissue (hMSCA). hMSCA were isolated as described elsewhere [22]. The procedures were performed according to a protocol approved by the Ethics Committee of the Pontificia Universidad Javeriana. Briefly, hMSCA were obtained from human adipose tissue obtained by liposuction in patients between 24 and 28 years of age. hMSCA were characterized by assessing the expression of CD34(−), CD73(+), CD90(+) and CD105(+) following the criteria established by the International Society for Cell Therapy. hMSCA cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM) (LONZA, Walkersville, USA) supplemented with 10% fetal bovine serum (FBS) (LONZA, Walkersville, USA) and 1% penicillin, with an incubation temperature of 37°C and 5% CO2.

120

2.2 Preparation of CM-hMSCA hMSCA were cultured until 80% confluency in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS. Then, cells were cultured in serum- and glucose-free DMEM, and the conditioned medium was collected after 48 h. The supernatants were centrifuged at 3000 rpm for 3 min and stored at −80°C. CM-hMSCA wERE collected from hMSCA cultures between passages III and V.

2.3 T98G Cell Culture T98G (ATCC CRL-1690) is a human cell line positive for GFAP [23]. This line has been used and validated as a model of astrocytic cells as reported previously [24-26]. Additionally, our group has observed that these cells have characteristics similar to human astrocytes from primary cultures (data not shown). Cells were maintained under exponential growth in DMEM (LONZA) containing 10% FBS (LONZA,) and 10 U penicillin/10 µg streptomycin/25 ng amphotericin (LONZA). The culture medium was changed three times a week. Cultures were incubated at 37°C in a humidified atmosphere containing 5% CO2.

2.4 Scratch Assay and CM-hMSCA Treatments In this study, our in vitro model (scratch assay) was characterized by both mechanical injury and metabolic insult. As we did not observe mitochondrial damage in cells subjected to mechanical injury only, we indeed performed a metabolic impairment (glucose deprivation, BSS0) to simulate a previously described traumatic brain like-injury model [18]. Briefly, cells were allowed to reach confluence for 48 h and then were serum deprived for 3 h. Later, a denuded area was produced by scratching the inside diameter of the well with the 10-µl pipette tip [27,18]. Immediately after the scratch, cells were rinsed twice with phosphate-buffered saline (PBS) 1× buffer to remove debris and were co-treated according to the following experimental groups: (1) scratch+BSS0: cells under scratch and glucose free conditions (BSS0); (2) scratch+BSS5: scratch cells plus BSS0 supplemented with 5.5 mM glucose (BSS5, control cells); (3) scratch+BSS0+CM2%: scratch cells plus BSS0 and treated with 2% CM-hMSCA; and (4) scratch+BSS5+CM2%: scratch cells plus BSS5 and treated with 2% CM-hMSCA. Glucose deprivation assay was performed as previously reported [28,23] and the composition of the Balanced Salt Solution (BSS0) was: NaCl, 116; CaCl2, 1.8; MgSO4, (7.H2O) 0.8; KCl, 5.4; NaH2PO4, 1; NaHCO3, 14.7, and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 10; pH 7.4 to 37 °C. In this study, cells were subjected to scratch assay (mechanical injury+glucose deprivation) and simultaneously received a treatment with 2% CM-hMSCA for 24 h. This concentration of CM-hMSCAwas chosen based on the findings of our previous study [18,10].

2.5 Determination of Cytokines Cytokine assay was performed according to the manufacturer's instructions. Briefly, an aliquot of the treated cells’ supernatants was taken and evaluated using the Human Inflammatory Cytokines Multi- Analyte ELISArray ™ Kits - Multi-Analyte ELISArray Kit (SABiosciences MD, USA. Catalog #MEM- 004A). This kit uses highly specific antibodies to detect cytokines in multiple samples. Heatmap visualizations were generated using GraphPad Prism version 7 for Windows. The differentially expressed cytokines were identified using one-way ANOVA test.

2.6 Determination of Cellular Calcium (Ca2+) For the determination of cellular Ca2+, cells were seeded at a density of 40.000 cells per well into 48- well plates in DMEM culture medium containing 10% FBS. After 48h, cells were treated according to each experimental paradigm in the second day. Specifically, for each labeled calcium indicator, the manufacturer's specifications and recommendations were followed. Briefly, for the cytoplasmic Ca2+

121

2+ ([Ca ]cyto), the cells were loaded with 3 µM Fluo-4 AM (Invitrogen, F-14217), for the case of 2+ 2+ mitochondrial Ca ([Ca ]mito) the cells were loaded with 5µM Rhod-2 AM (Invitrogen, R1244) and for 2+ 2+ the case of the Ca Endoplasmic Reticulum ([Ca ] ER) the cells were loaded with 3µM Mag-fura-2-AM (Invitrogen, M1291), with an incubation of 30 min at 37°C for each indicator. Then, the reading was performed using FLUOstar Omega multi-mode microplate reader (BMG LABTECH, Ortenberg, Germany) with a label (Ex/Em of Ca2+ -bound form): Fluo-4, AM (485/520); Rhod-2, AM (540/570 nm) and Mag-fura-2, AM (390/510) and with a scan width [mm]: 9, a setting time: 0,2 seg and 20 flashes scan point. Each trial was performed with a minimum of eight replicates for each condition. The experiment was repeated 3 times.

2.7 Reverse Transcription After subjecting the cells to different experimental paradigms for 24h, RNA was isolated from the cultures using Trizol (Invitrogen; 15596026), according to the manufacturer's instructions and as previously reported [29]. The RNA was resuspended in 50 µl of RNase- and DNase-free H2O, and stored at -80°C. Then, a treatment with DNase I (RNase-Free) was performed to eliminate traces of DNA present in the extraction test following the manufacturer's instructions (Biolabs, M0303S). RNA concentration was determined using the NanoDrop (TM) 1000UV/VIS spectrophotometer (Thermo Fisher). OD ratios of 260/280 nm close to 2.0 were obtained for all of the samples, indicating high purity. To obtain the complementary DNA (cDNA), the RNA was first normalized at 400-500 ng/µl with RNase- and DNase-free H2O. To 11 µl of normalized RNA,1 µl of Oligo d(T)18 mRNA Primer (Invitrogen™; SO131) and 1µl of dNTPs Mix (2.5nM) (Bioline, BIO-39029) were added. This mixture was pre-incubated at 65°C for 5 min, leaving it immediately after ice. Subsequently, the reaction was completed with 4 µl of 5X First-Strand Buffer [250 mM Tris-HCl (pH 8.3), 375 mM KCl, 15 mM MgCl], with 2 µl DTT (0.1 M) and 1µl of the M-MLV Reverse Transcriptase (200 U/µl) (Invitrogen™, Cat. 28025013) at the final volume of 20 µl. The reaction mictures were incubated at 37°C for 50 min and then at 70°C for 15 min for the inactivation of the enzyme in a MasterCycler Gradient Thermal Cycler.

2.8 Real-time PCR evaluation The levels of the evaluated genes were analyzed by the QuantStudio ™ 3 Real-Time PCR System (Applied Biosystems). We analyzed genes involved in mitochondrial dynamics (mnf1-mnf2-fis1-Drp1- opa1) as well as ND1 and ND2 present in the respiratory chain. Forward and reverse primer for the specific amplification of genes were selected through the Primer Bank database and a basic local alignment search tool (BLAST, NCBI) to confirm the target gene. The primers were synthesized by Integrated DNA Technologies (IDT). The sequences used are shown in Table 1. Subsequently, 1µl of cDNA from the controls and from the treated cells obtained after reverse transcription was completed to the final volume of 10µl with Power SYBR® Green PCR Master Mix (1X) (Applied Biosystems; 4367659), forward and reverse for each gene of interest (400nM) and the rest with RNase- and DNase- free H2O. The protocol for the QuantStudio™ 3 Real-Time PCR System consists of a step of denaturation at 95°C for 2 min, then 40 cycles of 10 sec at 95°C and 10 sec at the optimal hybridization temperature of each gene (60°C for mfn1, opa1, Drp1, fis1, ND2, ND1 and GAPDH, and 58°C for mnf2), 20 sec at 72°C and 10 sec at 95°C. Then, to obtain melting curves for the resulting PCR products, added temperature increase cycles from 70°C to 95°C by 0.15°C/sec. The relative quantification of the PCR products was carried out using the comparative method Ct [30] and as a relation between the control gene (GAPDH) and the signal of the gene of interest. To ensure data quality, all tests were performed in duplicate. The experiments were repeated at least 3 times.

122

2.9 Protein Extraction and Western Blotting T98G cells were lysed on ice with RIPA Lysis and Extraction Buffer Thermo Scientific™ supplemented with Halt™ Protease Inhibitor Cocktail, EDTA-free (100X) (Roche). Protein content was estimated using the Pierce™ BCA Protein Assay Kit. Equal amounts of protein were dissolved in sample buffer containing 5% β-mercaptoethanol and boiled. Then, proteins were separated by electrophoresis in SDS– PAGE, transferred onto a PVDF membrane and blocked in 5% skim milk dissolved in Tris-buffered saline containing 0.05% Tween 20 (TBS-T), at room temperature (RT) for 1 h. The membranes were incubated at 4°C overnight with antibodies against neuroglobin (Ngb) (sc-133086) (1:100), β-actin (Thermo Fisher) (1:3000), superoxide dismutase 2 (SOD2) (Thermo Fisher) (1:1000), Catalase (Thermo Fisher) (1:1000), GPX1 (Thermo Fisher) (1:1500) and AKT, p-AKT, ERK1/2, p-ERK (Thermo Fisher) (1:1000). The immunoreactivity was visualized by incubating the membrane with specific secondary antibody (IRDye® Antibodies) for 1 h and detected using Odyssey CLx Imaging System Specifications (LI-COR Biosciences). The images were analyzed using the Odyssey application software, version 1.2 (Li-Cor) to obtain the integrated intensities. All data are normalized to control values on each gel. We used the histogram method to analyze and standardize the densitometric data, and also based on previous reports to refine the methodology [31,32].

2.10 Mitochondrial Inhibition in Cell Culture For mitochondrial inhibition experiments, cells were seeded at a density of 40.000 cells per well into 48- well plates. The cultures were treated according to the experimental paradigm and in the presence of 2µM of Antimycin A (AA) (Sigma, A8674) as previously reported [33,34]. We performed a time curve (0, 2, 8, 12, 18 and 24h) to determine the response of the cells against the AA determined viability by the MTT method, previously reported by us [9]. Then, to confirm the inhibitory effect of AA, we performed mitochondrial function tests, such as: Δψm, active mitochondria and ROS production. The experiment was performed in eight biological replicates and three independent trials.

2.11 Determination of Reactive Oxygen Species (ROS) ROS production was measured on a FLUOstar Omega multi-mode microplate reader (BMG LABTECH, Ortenberg, Germany) [35-37]. Briefly, cells were seeded at a density of 40.000 cells per well into 48-well plates in DMEM culture medium containing 10% FBS and after 48h cells were treated according to each experimental paradigm in the second day. To determine the effect of CM- hMSCA on the production of superoxide (O2-), the cells were treated at a final concentration of 10µM Dihydroethidium (DHE) (Sigma, St Louis, MO, USA). Cultures were incubated for 15 minutes in the dark at 37°C and fluorescence was measured using (exc485nm/emi570nm spectra) and with a scan width [mm]: 9, a setting time: 0,2 seg and 20 flashes scan point. Each assay was performed with a minimum of eight replicates for each condition. The experiment was repeated 3 times.

2.12 Determination of Mitochondial Parameters The mitochondrial membrane potential (Δψm) and the determination of active mitochondria through non-peroxidated cardiolipin [38,39,25], were the mitochondrial parameters evaluated. These determinations were made through the FLUOstar Omega multi-mode microplate reader (BMG LABTECH, Ortenberg, Germany). Briefly, for both determinations the cells were seeded at a density of 40.000 cells per well into 48-well plates in DMEM culture medium containing 10% FBS and after 48h cells were treated according to each experimental paradigm in the second day. After cells treated, or not, with 2% CM-hMSCA for 24 h, were stained in the dark at 37 °C for 20 min, con TMRM (Sigma, St Louis, MO, EE.UU.) (500nM) para el Δψm y con acridine orange 10-nonyl bromide (NAO) (Sigma, St Louis, MO, EE.UU.) (200nM) to determine the non-peroxidated cardiolipin.

123

Data were obtained using excitation 540nm/emission 570 nm spectra for TMRM and excitation 485nm/emission 520nm spectra for NAO and with a scan width [mm]: 9, a setting time: 0,2 seg and 20 flashes scan point. Each trial was performed with a minimum of eight replicates for each condition. The experiment was repeated 3 times.

2.13 Immunocytochemistry Cells were washed with 0.1 M phosphate buffer (PB) and fixed in 4% paraformaldehyde for 30 min. Nonspecific binding sites were blocked with blocking buffer (3% bovine albumin and 0.3% Triton X- 100) for 1h. Subsequently, the cells are incubated overnight with the primary antibody for Neuroglobin (Ngb) (sc-133086) (1:100). After incubation with primary antibody, cells were washed twice with PB and incubated with the appropriate secondary antibody Goat anti-mouse IgG (H+L), DyLight 488 conjugate for 1 h and then analyzed using a High-Resolution Digital Camera –DP71 adapted to an Olympus BX51 Microscope.

2.14 Co-localization analysis For co-localization analysis, double staining was performed using the Ngb antibody (green) and a construct used to transfect each organelle (red), according to BacMam 2.0 technology. The organelles were labeled for @ 24h using CellLight® Mitochondria-RFP (C10601), Golgi-RFP (C10593) and ER- RFP (C10591) (Invitrogen), according to the manufacturer's instructions. Subsequently, the cells were treated according to the experimental paradigm and after 24h the immunocytochemistry was performed for Ngb (see 2.13). The assembly was made on slides and then the photographic record was made in four different fields representing an area of 0.03 mm2. The images were acquired with a High-Resolution Digital Camera –DP71 adapted to an Olympus BX51 Microscope.

For the co-localization analysis, the co-localization plugin Intensity Correlation Analysis 6.0 of ImageJ was used and this was made based on previous reports from our laboratory [23,40]. In summary, the plugin generates a scatter plot plus correlation coefficients via Manders’ coefficient. In each scatter plot, the first (channel 1 for example red) image component is represented along the x-axis, the second image (channel 2 for example green) along the y-axis. The intensity of a given pixel in the first image is used as the x-coordinate of the scatter-plot point and the intensity of the corresponding pixel in the second image as the y-coordinate, so the presence of yellow spots in the scatter indicate the co-localization frequency [41].

Dispersion diagrams were used to filter the co-localization of Ngb in each organelle. Using the plugin Intensity Correlation Analysis 6.0 of ImageJ, an image of co-localized pixels and also an image of those co-localized pixels superimposed on a RGB-merge of two 8-bit images were generated. Finally, the co- localization finder algorithm was sued to prompt two grey-scale images and creates a scatter plot and a red-green merged image. The pixels represented by the scatter plot point can be highlighted by selecting the points with the rectangular selection tool only [41]. As a result of this process, the percentage of co- localization for each microphotograph was obtained. Four microscope fields were analyzed in 20 images for each condition. The results were plotted as a percentage of co-location.

2.15 Neuroglobin Silencing Cells were transfected in a serum-free condition with either Stealth RNAi™ Ngb siRNA (siNgb; Invitrogen, Carlsbad, CA, USA) or a mismatch sequence in accordance with the manufacturer’s instructions, using oligofectamine (Invitrogen) as the transfection reagent. The sequence used for Ngb oligonucleotides was 5′-CGUGAUUGAUGCUGCAGUGACCAAU-3′. The mismatch sequence used

124

as a control for Ngb siRNA (siNgb) was 5′-UGUGAUUUAUGGUGCAGUAACCAAC-3′. Briefly, oligofectamine and oligonucleotides (400 pM) were mixed with Optimem, and the mixture was incubated for 20 min at RT, diluted with Optimem and added to the cell medium for 4 h at 37 °C. The medium was added to cells to reach the growing conditions (i.e., 10% (v/v) serum). To evaluate the effective silencing of Ngb, total proteins were extracted 48 h after transfection, and Ngb expression was assessed by western blot analysis.

2.16 Statistical Analysis In the present study, the GraphPad Prism version 6.0 for Windows (GraphPad Software, La Jolla, CA, USA) (www.graphpad.com) was used for all statistical analyses. Data obtained from this study were tested for normal distribution using Kolmogorov–Smirnov test and homogeneity of variance using Levene’s test. Then, data were compared using analysis of variance (ANOVA) followed by Dunnet’s post hoc test for comparisons between controls and treatments, and Tukey’s post hoc test for multiple comparisons between the means of treatments and time points. Data are presented as mean ± SEM of three independent experiments. A statistically significant difference was defined at p< 0.05.

3. Results

3.1 Effect of CM-hMSCA on the secretion of cytokines in the astrocytic model subjected to scratch assay

Previously, we reported that 2% CM-hMSCA was able to protect astrocytic cells under scratch assay. This in vitro model is characterized by both mechanical injury and glucose deprivation [18,10]. We initially assayed cytokines using ELISA kits to profile the inflammatory responses of scratched astrocytic cells following treatment with CM-hMSCA (Fig. 1). An increase in the expression of the cytokines IL-6 (9.05%), TNF-a (3.8%) and GM-CSF (86.4%) was observed in cells subjected to scratch+BSS0 versus control (scratch+BSS5) cells (Fig. 1). Interestingly, our results showed a significant decrease of these cytokines in cells subjected to scratch+BSS0+CM2% for 24h. The reduction of these cytokines was around 17.8%, 27.3% and 33.3% for IL-6, TNF-a and GM-CSF, respectively, compared to the scratch+BSS0 cells (Fig.1). Other cytokines such as IL-2 and IL-8 were elevated by 26% and 95%, respectively, in scratch+BSS0+CM2% cells compared to scratch+BSS0 cells (Fig.1). Nevertheless, no significant difference in the regulation of IL-10 was observed when cells were subjected to scratch+BSS0+CM2% (Fig.1).

3.2 2% CM-hMSCA regulates calcium (Ca2+) levels in the astrocytic model subjected to scratch We evaluated the effect of 2% CM-hMSCA on calcium levels (Ca2+) (Fig.2) at different time periods (0, 2+ 2+ 2+ 6 and 24 h). Ca was evaluated in the cytoplasm ([Ca ] cyto) (Fig. 2A), mitochondria ([Ca ] mito) (Fig. 2+ 2+ 2B) and endoplasmic reticulum ([Ca ]ER) (Fig. 2C). Scratch+BSS0+CM2% cells increased [Ca ] cyto by 25% at 0h and 16% for 6h versus scratch+BSS0, and these levels were similar to scratch+BSS5 cells 2+ 2+ (control) (Fig. 2A). In [Ca ] mito (Fig.2B) and [Ca ]ER (Fig. 2C), no significant difference was observed at 0 and 6h. At 24h, cells exposed to scratch+BSS0 showed a significant increase of 23.8% in 2+ 2+ [Ca ]cyto versus the control (scratch+BSS5) (Fig 2A) while [Ca ]cyto was found to be significantly 2+ decreased by 15.1% in scratch+BSS0+CM2% cells (Fig. 2A). Moreover, at 24h, [Ca ]mito increased 2+ significantly by 16.1%, in scratch+BSS0+CM2% cells (Fig. 2B), while the [Ca ]ER only showed a slight and non-significant increase (6%) against the injured cells (scratch+BSS0) (Fig. 2C).

125

Figure 1. Heat map of the profile of cytokine secretion in an astrocytic model subjected to scratch test. The cytokine profile is shown 24 hours after co-treatment. Dark blue means greater presence and dark red denotes higher levels. Briefly, the scratch+BSS0 assay increased the secretion of IL-6 (scratch+BSS0 vs. scratch+BSS5, p=0,0173), TNF-a (scratch+BSS0 vs. scratch+BSS5, p=0,0387), GM-CSF (scratch+BSS0 vs. scratch+BSS5, p <0,0001), indicated in the heat map in dark pink and dark blue, respectively. 2% CM- hMSCA decreased cytokine secretion induced by the scratch assay: IL-6 (scratch+BSS0+CM2% vs. scratch+BSS0, p<0,0001), TNF-a (scratch+BSS0+CM2% vs. scratch+BSS0, p<0,0001), GM-CSF (scratch+BSS0+CM2% vs. scratch+BSS0, p<0,0001), indicated in the heat map in dark pink. In addition, 2% CM-hMSCA regulated upwards cytokines such as IL-2 (scratch+BSS0+CM2% vs. scratch+BSS0, p<0,0001) and IL-8 (scratch+BSS0+CM2% vs. scratch+BSS0, p<0,0001), indicated in the white and pale pink heat map, respectively. * indicates cytokines with significant increase and ** indicates cytokines with significant decrease in scratch+BSS0+CM2% vs. scratch+BSS0 cells.

126

Figure. 2. CM-hMSCA regulates Calcium (Ca2+) levels in scratch cells exposed to CM2% at different times . The bar graphs show the percentages of Fluorescence Mean Intensity (IMF) 2+ for Fluo 4-AM of [Ca ]cito (A), 2+ Rhod-2 of [Ca ]mito (B) and 2+ MagFura of [Ca ]ER (C). The data are represented as the mean ± SEM of three experiments. In the initial times 0h there was an increase of 2+ [Ca ]cito (scratch+BSS0+CM2% vs. scratch+BSS0, p<0.0001) and at 6h also (scratch+BSS0+CM2% vs. scratch+BSS0, p=0,0108) but these values were not significant compared to the control (scratch+BSS5; p=0,4722(0h); p=0,9832(6h)). At 24h the scratch+BSS0 test increases the 2+ [Ca ]cito (scratch+BSS0 vs. scratch+BSS5, p<0.0001) but in scratch+BSS0+CM2% cells these levels are significantly reduced (scratch+BSS0+CM2% vs. scratch+BSS0, p<0,0003) (A). The 2+ levels of [Ca ]ER tended upwards in cells exposed to scratch+BSS0+CM2% but without significant differences at 24h (scratch+BSS0+CM2% vs. scratch+BSS0, p=0.0536) (C). The 2+ [Ca ]mito increased significantly (scratch+ BSS0+CM2% vs. scratch+BSS0, p=0.0067) (B) at 24h.

127

3.3 Activation of PI3K/AKT and ERK1/2/MAPK by CM-hMSCA in cells subjected to scratch assay.

In Figure 3, we show that cells under scratch+BSS0+CM2% increased AKT expression up to 135% (Fig. 3A) and its phosphorylated form up to 102,8% in comparison to scratch+BSS0 (Fig. 3B). Similar results were observed with the increase in ERK1/2 expression up to 134,7% (Fig. 3C) and its phosphorylated form up to 55,4% against scratch+BSS0 (Fig. 3D).

3.4 The levels of genes expression involved in the processes of mitochondrial dynamics and respiratory chain are regulated by the CM-hMSCA in cells subjected to scratch

Next, we evaluated the expression levels of mnf1, mnf2, fis1, Drp1, opa1, ND1 and ND2 (Table 1, Fig 4), all of them implicated in mitochondrial dynamics and functionality. In scratch+BSS0 cells, the expression of genes involved in mitochondrial fusion was regulated positively at 24h: 54% mnf1 (Fig.4A), 98% mnf2 (Fig.4B) and fission: 124% fis1 (Fig.4C), and 220% Drp1 (Fig.4D) with compared to control (scratch+BSS5). In scratch+BSS0+CM2% cells, expression of fission genes (fis1 and Drp1) were negatively regulated around @ -45% with compared to the scratch+BSS0 group (Fig. 4C-D). Also, in scratch+BSS0 cells we observed an increased gene expression of ND1 (46,1%, Fig.4E) and ND2 (34%, Fig.4F) in respect to control (scratch+BSS5), and decreased expression for opa1 (-54%, Fig.4G). Upon treatment with CM2%, the expression of these genes was found reduced (-44,1% -opa1, -75,7% -ND1, and -50,3% for ND2).

Table 1. Information about primers used in the study

Primer sequences 5′–3′ Primer sequences 5′–3′ Gene Forward Reverse Mfn1 GAGGTGCTATCTCGGAGACAC GCCAATCCCACTAGGGAGAAC Mfn2 CACATGGAGCGTTGTACCAG TTGAGCACCTCCTTAGCAGAC Drp1 CTGCCTCAAATCGTCGTAGTG GAGGTCTCCGGGTGACAATTC Fis1 GATGACATCCGTAAAGGCATCG AGAAGACGTAATCCCGCTGTT Opa1 ATTGAAGCTCTTCATCAGGAG TGTATGCAGAGCTGATTATGAG ND1 TCCTACTCCTCATTGTACCCA TTTCGTTCGGTAAGCATTAGG ND2 GTAAGCCTTCTCCTCACTCTC TTAATCCACCTCAACTGCCT GAPDH CATCAATGGAAATCCCAT TTCTCCATGGTGGTGAAGAC

3.5 Mitochondrial inhibition and Ngb blockade dampen the protective effect of CM-hMSCA in cells subjected to scratch assay.

To determine whether mitochondria are an important mediator of the protective effects exerted by CM-hMSCA, we treated astrocytic cells with Antimycin A (AA) (see 2.10), a mitochondria inhibitor, at different durations (0-2-4-6-12-18-24 h) (Fig.5). In cells exposed to scratch+BSS0+AA, we observed a decrease in viability percentage from 78.4% at 2h to 21.4% at 24h (Fig. 5A). Likewise, cells treated with scratch+BSS0+CM2%+AA showed reduced viability (by 86.4%) compared with cells exposed only to scratch+BSS0+CM2% at 24h. To verify whether treatment with AA inhibited the mitochondrial activity, we evaluated parameters related to mitochondrial function. Our results showed a decrease by 66% in ΔψM (Fig. 5B), a reduction of up to 60.3% in the antioxidant protection of cardiolipin that is related to active and stable mitochondria assessed by Nonyl Acridine Orange

128

Figure. 3. Activation of PI3K/AKT and ERK1/2/MAPK by CM-hMSCA in cells under scratch+BSS0 and CM2%. The western blot analysis indicated that total AKT expression was higher in cells treated with 2% CM-hMSCA (scratch+BSS0+CM2% vs. scratch+BSS0, p=0.0002) (A) and AKT phosphorylation levels also increased significantly in scratch+BSS0+CM2% vs. scratch+BSS0 cells, (p=0,0001) (B). Similarly, an increase in the levels of ERK1/2 (p=0,0001) (C) and its phosphorylation (p=0,0081) (D) was observed in scratch+BSS0+CM2% vs. scratch+BSS0. b-actin was used as charge control. All the data in these figures are presented as mean ± SEM of three individual experiments.

129

(NAO) (data not shown) and ROS production was increased respective to time up to 18,7% for O₂− at 24h (Fig. 5C) and a decrease in H2O2 by 30,5% (data not shown) at 24h. During this assay, we observed that at 6h most of the parameters determined had a different behavior than the other times, for this reason in future tests we take two points that are 6h and 24h which is the time of our model.

Next, we explored whether the protective effect of CM-hMSCA was mediated by Ngb, as previously reported by our group showing that CM2% increases Ngb expression [10]. Ngb gene expression was silenced using RNA interference (RNAi) (Fig.6A). Blockade of Ngb was confirmed by western blotting (see 2.9) (Fig.6A). Since neuroglobin can migrate to mitochondria and interact with different proteins upon cell damage, we inhibited this organelle using AA (for 6 and 24h) to investigate whether mitochondria is important for neuroglobin to exert protection in our model. We found that in cells exposed to scratch+BSS0+CM2%+siRNA-Ngb+AA for 24h, cell viability reached only 6.5% (Fig. 5D) while ΔψM was lost by up to 27.4% (Fig. 5E) and an increase of up to 103.1% in ROS production was observed (Fig. 5F).

3.6 Effect of neuroglobin blockade on the expression of proteins involved in cell survival, oxidative stress and cellular Ca2+

Fig. 6 shows the confirmation of previous findings [10], whereby Ngb is involved in the protective actions of the CM-hMSCA. To corroborate the role of Ngb in the protective effect of CM-hMSCA, we determined the expression of proteins related to different cell functions. Our results showed that silencing of Ngb significantly reduced the expression of AKT (52,8%), ERK1/2 (27%) as well as the phosphorylated state of each protein (43.8% for pAKT, Fig. 6B-C) and 70.8% for pERK1/2, Fig. 6D-E) in scratch+BSS0+CM2%+siRNA-Ngb cells in comparison to scratch+BSS0+CM2%. In addition, blockade of Ngb protein in scratch+BSS0+CM2%+siRNA-Ngb cells at 24h reduced the expression of the antioxidant proteins superoxide dismutase (SOD2) (Fig. 6F), catalase (Cat) (Fig. 6G) and glutathione peroxidase (GPX1) (Fig. 6H) by 80%, 43.6% and 23%, respectively.

Blockade of Ngb also had an impact on cellular Ca2+ levels. Cells exposed to 2+ scratch+BSS0+CM2%+siRNA-Ngb had a reduction by 10.7% in the level of [Ca ] cyto compared to scratch+BSS0 cells. However, no change was observed neither in cells exposed to scratch+BSS5+siRNA-Ngb nor in the group exposed to scratch+BSS0+CM2%+siRNA-Ngb (Fig. 6I). 2+ Interestingly, in cells exposed to scratch+BSS0+siRNA-Ngb the [Ca ] mito decreased significantly by 51.4% compared to scratch+BSS0 cells at 24h. Similar results were observed for cells exposed to 2+ scratch+BSS0+CM2%+siRNA-Ngb with a reduction of 57% in the [Ca ] mito and a reduction of about 23.7% cells exposed to scratch+BSS5+siRNA-Ngb. These differences were obtained by comparing 2+ different experimental groups with that without siRNA (Fig. 6J). Also, as for [Ca ]ER at 24h, we observed a reduction close to 57% after scratch+BSS5+siRNA-Ngb compared to cells without Ngb 2+ silencing (Fig. 6K). However, although there was a decrease in [Ca ] cyto after Ngb silencing, this is 2+ 2+ still augmented compared to [Ca ] mito and [Ca ]ER.

130

Figure 4. Effect of CM-hMSCA on the mitochondrial dynamics and the respiratory chain of cells subjected to scratch assay. The specific quantification of the fusion genes, mfn1 (A), mfn2 (B) and fission genes, Fis1 (C) and Drp1 (D), as well as ND1 (E), ND2 (F) and opa1 (G) was performed by RT-PCR. In scratch+BSS0 cells, mnf1 was positively regulated (scratch+BSS0 vs. scratch+BSS5, p=0, 0381; (A)) as well as mnf2 (scratch+BSS0 vs. scratch+BSS5, p= 0, 0024; (B)), genes responsible for mitochondrial fusion. Similar results were observed with fis1 (scratch+BSS0 vs. scratch+BSS5, p=0, 0017; C), Drp1 (scratch+BSS0 vs. scratch+BSS5, p=0, 0001, D), which in turn are involved in mitochondrial fission. The treatment with 2% of CM-hMSCA reduced the expression of these genes with respect to the scratch+BSS0 (p= 0, 0026 –Drp1); (p=0, 0192 –fis1); (p= 0, 0005 –mnf1); (p= 0,0001 –mnf2). Likewise, a significant decrease was found in opa1 levels (scratch+BSS0+CM2% vs. scratch+BSS0, p=0, 0008, (G)), ND1 (scratch+BSS0+CM2% vs. scratch+BSS0, p<0, 0001, (E)) and ND2 (scratch+BSS0+CM2% vs. scratch+BSS0, p<0, 0001, (F)) after 24h. The data was normalized to GAPDH. The data represent the percentage of control expressed as means ± SEM of triplicates of three experiments.

131

3.7 Expression and co-localization of neuroglobin in cellular organelles is mediated by CM- hMSCA in cells subjected to scratch assay.

To determine whether the CM-hMSCA, in addition to positively regulating Ngb as reported in previous studies [10], could mediate the subcellular localization of this protein in different compartments, an initial qualitative analysis was performed using fluorescence microscopy (Fig.7). Analysis by fluorescence microscopy showed the colocalization of Ngb with Mito-RFP (Fig.7A), Golgi-RFP (Fig. 7B) and ER-RFP (Fig. 7C). Our results showed that in cells exposed to scratch+BSS0+CM2%, the merged signals for Ngb-Mito-RFP were significantly increased by 27.8% (Fig. 7D). On the contrary, we observed a reduction for the merged signals of Ngb-Golgi-RFP (43.4%) and Ngb-ER-RFP (30%) in cells exposed to scratch+BSS0+CM2% compared with control (scratch+BSS5) cells. On the other hand, it should be noted that in scratch+BSS5 cells there was a 66% more merged signal in Ngb-ER-RFP and 90% in the case of Ngb-Golgi-RFP when compared with the scratch+BSS0 group (Fig. 7D). It is noteworthy that the Ngb signal increased approximately 2.9 times more in the mitochondrial compartment of cells treated with scratch+BSS0+CM2% with respect to scratch+BSS0 (Figure 7D).

4. Discussion

A large number of brain pathologies involve an inflammatory component that significantly affects brainfunction [42-44]. Astrocytes are specialized cells with multiple functions [45-47] within the CNS and are able to regulate or influence neuroinflammation [48,49], depending on the state of involvement and the duration of the injury. In this regard, the fact that astrocytes regulate inflammation and avoid in some way the progression of the injury has prompted strategies aimed to preserve their functions and thus promote neuronal survival upon any pathological event including TBI. A previous work from our laboratory showed that CM-hMSCA exerts neuroprotective effects on astrocytes under scratch injury. In the present work, we aimed to determine possible mechanisms of action of CM-hMSCA in astrocytes using the same in vitro model. Our results showed that CM-hMSCA regulates the cytokines IL-2, IL-6, IL-8, IL-10, GM-CSF and TNF-a, and regulates Ca2+ at the cytoplasmic level. These results were accompanied by the regulation of mitochondrial dynamics and genes (opa1, mnf1 and mnf2, fis1, Drp1) as well as activation of survival cascades such as AKT/pAKT and ERK1/2/pERK. Indeed, we observed that CM-hMSCA regulates the subcellular localization of Ngb, and that blockade of this protein affects Ca2+ dynamics and mitochondrial functions.

During CNS damage, there should be a homeostatic balance between an optimal antioxidant response and inflammatory event. A physiological balance between anti- and pro-inflammatory molecules is essential for proper neuroprotective response to any insult or injury that affects brain tissue. However, during TBI the brain cells (namely astrocytes and microglia) secrete cytokines and mediators such as IL-1, TNF-a, IL-12, IFNg, IL-6, prostaglandins and nitric oxide, among other molecules that are positively regulated, thereby causing neuronal death [50,51,48]. This information is in agreement with our findings, in which an increase of the cytokines IL-6, TNF-a and GM-CSF was observed after 24h in astrocytic cells subjected to scratch+BSS0 (Fig.1). Nevertheless, we found a decrease in the levels of these cytokines in scratch+BSS0+CM2% after 24h (Fig.1). This can be explained by the fact that MSC secretion includes growth factors, chemokines, cytokines and extracellular vesicles [52] in addition to the immunomodulatory ability of adipose-derived mesenchymal stem cells (AMSC) [53-55,12]. Likewise, previous studies reported a clear relationship between a traumatic injury of human astrocytes in an in vitro model and positive regulation of IL-6 which induces astrogliosis and angiogenesis, both necessary for tissue remodeling and

132

Figure 5. Ngb and mitochondrial activity are mediating the protective effect of CM-hMSCA. The bar graph show cells scratch+BSS0+CM2%+AA vs. scratch+BSS0+CM2%, which the protective effect of by CM-hMSCA was considerably reduced (p<0,0001) at 24h (A), likewise there was a significant loss in ΔψM (scratch+BSS0+CM2%+AA vs. scratch+BSS0+CM2%, p<0,0001, B) and increase in ROS production (scratch+BSS0+CM2%+AA vs. scratch+BSS0+CM2%, p<0,0001, C). Design bars (dots) are experimental groups in the presence of AA. Also, in the bar graph the siRNA-Ngb together with the AA inhibitor suppressed almost completely the protective effect of the CM-hMSCA in all parameters determined, such as: viability (D), ΔψM (E) and ROS (F) in cells (scratch+BSS0+CM2%+AA+siRNA- Ngb vs. scratch+BSS0+CM2%, p<0,0001) as well as for (scratch+BSS5+AA+siRNA-Ngb vs. scratch+BSS5, p=0,0002). Design bars (horizontal lines) are experimental groups with siRNA-Ngb+AA.

133 recovery [56]. However, sustained IL-6 expression is related to pathogenesis of neurodegenerative diseases, astrogliosis [57,58] and experimental autoimmune encephalomyelitis (EAE) [59]. Therefore, the search for alternatives to decrease or regulate IL-6 and other cytokines may be promising for the recovery of brain tissue. Surprisingly, in this study, a significant decrease in TNF-a in scratch+BSS0+CM2% was observed (Fig.1) which is important because low levels of TNF-a are important for brain tissue recovery [60]. We also observed that the levels of IL-6 in cells exposed to scratch+BSS0+CM2% remained similar with the control (scratch+BSS5) (Fig.1). This finding supports the idea that maintaining basal levels of IL-6 has benefits in increased CNS wound healing after traumatic injury by cryolesion [61,62] and in the regulation of glial activation [63-66] besides this, it is known that it is regulated by other cytokines like TNF-α or IL-1β [67]. Interestingly, IL-6 was found to be responsible for an increase in ATP levels that may be related to the recovery of mitochondrial ultrastructure, and is also involved in improving mitochondrial biogenesis and autophagy in an astrocytic model of experimental sepsis [68]. These findings can explain, at least in part, the protective effects of CM-hMSC at the mitochondrial level [9,10]. However, more studies are necessary to clarify the mechanisms of protection.

In this study, we found that IL-2 and IL-8 were elevated in scratch+BSS0+CM2% cells at 24h (Fig. 1). These cytokines are considered to have neuroprotective functions. For example, IL-2 can stimulate proliferation, promote survival, neurite extension of cultured neurons [69] and the processes of myelination and differentiation of oligodendrocytes [70]. Likewise, IL-2 can regulate inflammation through the Treg cells [71]. Similar results were obtained with IL-8 known as CXCL8 [72]. This cytokine also showed an increase in astrocytes in the scratch+BSS0+CM2% after 24 h (Fig.1). This is interesting because apparently IL-8 can regulate inflammation at the level of nervous tissue [72,58,73,74] besides mediating angiogenic functions [58] and neuroprotection through the activation of CXCR2 [75] or antiapoptotic proteins such as Bcl-2 and Bcl-X1 [76].

We also examined IL-10 which is considered as an anti-inflammatory and neuroprotective mediator [70,77,78]. However, we did not observe any alteration in this cytokine in the scratch+BSS0+CM2% group, which can be explained by the presence of IL-10 in CM-hMSCA as well as other molecules with protective effect in brain tissue [79-81,74,82-84]. Despite being reported that many cytokines have benefits within the CNS, the complete profile of cytokines and chemokines derived from astrocytes during inflammation is not yet fully characterized.

On the other hand, cytokines not only regulate inflammatory processes but also calcium channels, brain excitability and synapse formation [85-87]. In this study, we also investigate the changes of Ca 2+ in the cytosol, the mitochondria and the endoplasmic reticulum. We found that cells subjected to scratch+BSS0 showed a significant increase in cytoplasmic calcium at 24h (Fig. 2A). This observation can not only be explained by the fact that both glial cells and neurons respond to OGD with reversible membrane depolarizations that sustainably increase intracellular Ca2+ [88,89]. Interestingly, in the group of cells treated with scratch+BSS0+CM2% at 24h we observed a significant reduction for cytoplasmic calcium (Fig.2A), which may be related to the mediation of trophic factors such as FGF, BDNF, EGF, NGF capable of providing neuroprotection and reported in the CM-hMSC [90,91,79- 81,74,82] or the presence of molecules such as TNF protection mediator in the CNS identified for the first time in CM-hMSC (Papazian, Kyrargyri, Evangelidou, Voulgari-Kokota, and Probert, 2018), recognized in several studies as neuronal protector [92-94] and by attenuated elevation of stimulus- induced intracellular Ca 2+ [94].

134

135

Figure 6. Effect of neuroglobin silencing on protein expression, oxidative stress and cellular Ca2+. Validation of Ngb siRNA by western blotting. The silencing of Ngb transcendentally reduces Ngb levels in both cell groups scratch+BSS0 (p<0, 0001) as well as in the control scratch+BSS5 (p<0, 0001) (A). The silencing of Ngb significantly reduces the expression of AKT (p=0,0004, B), pAKT (p=0,0464, C), ERK1/2 (p<0,0001, D), pERK (p=0,0241, E) at 24h, as well as affects the expression of antioxidant proteins such as SOD2 (p<0,0001, F), Catalase (p<0,0001, G) and GPX1 (p=0,0152, H) in cells exposed to scratch+BSS0+CM2%+siRNA-Ngb vs. scratch+BSS0+CM2%. Similarly, the silencing of Ngb affected in part the movement of cellular Ca2+. In cells 2+ scratch+BSS0+siRNA-Ngb vs. scratch+BSS0, [Ca ]cito were significantly reduced (p<0,0001, I) but there was no change between the control cells scratch+BSS5+siRNA-Ngb vs. scratch+BSS5 (p=0,2051, J) nor in the cells that were exposed scratch+BSS0+CM2%+siRNA-Ngb vs. 2+ scratch+BSS0+CM2% (p=0,6468, K). [Ca ]mito in scratch+BSS0+siRNA-Ngb vs. scratch+BSS0 2+ cells decreased significantly (p<0,0001, J) as well as for [Ca ]ER (p <0,0001, K).

Figure 7. Expression and co-localization of Ngb in different subcellular compartments. The top panel shows merged images of the expression of Ngb (green) in different organelles (red), for the three representative experimental groups. The percentage of positive cells was obtained by separate analysis of each marker, that is, Ngb, Mitochondria (Mito-RFP) (microphotographs and plots in left panel; A), in Golgi Apparatus (Golgi-RFP) (microphotographs and plots in central panel; B) and in Endoplasmic Reticulum (ER-RFP) (microphotographs and plots in right panel; C). For the location analysis, the areas calculated by the Intensity Correlation Analysis plugin of the ImageJ software are shown in white points. Each scatter diagram represents the correlation between the green and red frequencies of the cells, the yellow area of the scatter plot account for the co-localization of the staining, that is, the organelles (red) and the neuroglobin (green). The results of the analysis are plotted as a percentage of co-localization between organelles and Ngb. Ngb and Mito-RFP showed a significant co-localization in cells exposed to scratch+BSS0+CM2% vs. scratch+BSS0 (p<0,0001, A) and even between cells exposed to scratch+BSS0+CM2% vs. scratch+BSS0 (p=0,0138, A). *** significant differences Ngb-Golgi Apparatus vs. Ngb-Mitochondria for cells exposed to scratch+BSS0 (p=0.0008) (D). * significant differences Ngb-Endoplasmic Reticulum vs. Ngb-Golgi Apparatus for cells exposed to scratch+BSS0 (p=0.0232) (D). ## Ngb-Golgi Apparatus vs. Ngb- Mitochondria (p<0.0001) (D). # Ngb-Endoplasmic Reticulum vs. Ngb-Mitochondria for cells exposed to scratch+BSS0+CM+2% (p<0.0001) (D). Scale 20µm.

136

137

It is well known that the signaling and homeostasis of Ca2+ is not only at the cytoplasmic level but also other compartments such as mitochondria and ER are in charge of regulating this ion and its signaling inside the cells [95,96]. In the present study, we found that the decrease in Ca2+ in the intracellular space in cells under scratch+BSS0+CM2% (Fig. 2A) was related to a distribution of this ion to other organelles such as mitochondria (Fig. 2B) and, though not significantly, ER (Fig.2C) at 24h. This is somehow interesting given that the ER is directly involved in Ca2+ signaling [97]. The regulating the depletion of Ca 2+ in the ER not only prevents the triggering of an ER stress response (ERSR) [97] but also contributes to a delay in the elevation of intracellular Ca 2+ [98]. On the other hand, we also observed a Ca2+ influx to mitochondria in cells subjected to scratch+BSS0+CM2% at 24h (Fig. 2B). This slight increase in mitochondrial Ca2+ can be explained by the fact that mitochondria is another organelle responsible for the regulation of Ca2+ in glial cells [99,96,100] and there is a permanent crosstalk between this organelle and the ER [99]. Indeed, mitochondria can act as a buffer through which cytosolic overloads of Ca2+ are regulated [101,96]. The effects of CM-hMSCA on the regulation of Ca2+ could be explained by the presence of several molecules including EGFP [102] and bFGF [103], both implicated in mediating Ca2+ responses through the regulation and function of the glutamate receptor in neurons or any of the AMPA receptor subunits [104,103]. However, all these investigations have been carried out in neurons, with a lack of studies on astrocytes. For this reason, it is essential to expand and develop more in-depth research in relation to this topic.

One of our aims in the present study was to determine whether CM-hMSCA may regulate the expression of proteins of biological importance involved in signaling pathways. We showed that scratch+BSS0+CM2% cells had increased AKT phosphorylation and possible activation of the PI3K/AKT signaling (Fig.3A-B) and similar results were observed with ERK1/2 and pERK (Fig.3C-D), both being important in cell survival [105,106,21,107]. This finding suggests that CM-hMSCA probably activates survival mechanisms against scratch+BSS0 damage mediated by PI3K/AKT, via ERK1/2/MAPK or both. These pathways are quite known to be activated by growth factors [108-111], in which coincidentally have been reported in the MSC´s secretome [112,82,105]. In these studies, many biological factors have been found, including VEGF, βFGF, PDGF, IGF-1 and S1P, all of which have anti-apoptotic activity and upregulation of the anti-inflammatory TGFβ1 and IL-1 [113-115]. Therefore, this study approximates the study of the AKT and ERK1/2 pathways in the scratch+BSS0 model. The increase in phosphorylation and expression of these proteins may not only be mediating the survival of astrocytes in conditions of scratch+BSS0, but also supports the protective effects of CM-hMSCA possibly through the PI3K/AKT or ERK1/2 /MAPK pathway or both. However, more studies are needed to clarify this. Previously, we showed astrocytic cells under scratch+BSS0+CM2% had greater protection on mitochondrial ultrastructure compared to scratch+BSS0 counterparts [10]. To go further, we assessed genes related to mitochondrial dynamics and oxidative phosphorylation in cells exposed to scratch assay and/or CM2%. Our results demonstrated a downregulation of mfn1 and mfn2 genes (Fig. 4A-B), which are responsible for mitochondrial fusion [116,117], and fis1 (Fig.3C), which is directly responsible for mitochondrial fission (Reviewed by: [118-120]. Surprisingly, these genes areup- regulated in cells under scratch+BSS0, suggesting fusion-fission processes are deregulated in these cells. Nevertheless, upon treatment with CM2%, the expression of these fusion-fission genes are diminished, suggesting that possible factors present in the conditioned medium might in part contribute to maintain mitochondrial dynamics. Homeostasis in mitochondrial dynamics is key for cellular functions in general, not only from the metabolic point of view, but also it is indispensable to prevent the deregulation of Ca2+ or mitochondrial signaling leading to abnormal function and even death [121,122] and cellular stress [123-125]. Interestingly, when evaluating other genes implicated in mitochondrial function (Drp1 and opa1), our results showed a positive regulation in the expression of Drp1 and opa1 in cells under scratch+BSS0 but, surprisingly, a significant decrease in cells exposed to CM2%

138

(scratch+BSS0+CM2%, Fig.3D-G). For instance, these genes (Drp1 and opa1) are associated to mitochondrial dynamics, including cellular apoptosis [126-128]. Different studies have suggested that Drp1 plays an important role in fission [129,128], mitochondrial fragmentation and apoptosis-like cell death [126-128]. These results suggest that CM-hMSCA may regulate the mitochondrial dynamics in astrocytic cells subjected to scratch+BSS0. In this study, we found a decrease in the expression of Drp1 and fis1, both genes responsible for mitochondrial fission [119,130] in cells subjected to scratch+BSS0+CM2%. This finding is supported by several studies [131-134,119], in which a blockade of Drp1 and negative regulation of fis1 protected the cells from apoptosis via decreasing the release of cytochrome c

Additionally, the cells subjected to scratch+BSS0+CM2% presented less opa1 levels (Fig.3G), a result that we did not expect, taking into account that opa1 is related to different mitochondrial functions [135,136] and the control of apoptosis [135,137]. This suggests that cells under scratch+BSS0+CM2% may be presenting a mechanism different from opa1 for their survival, possibly related to autophagy. In relation to the latter, it is known that autophagy is a process mediated by oxidative stress, nutrient deprivation and cell damage, among others [138], associated with quality control and survival [139- 141]. In this sense, previous research carried out by our group showed that cells subjected to scratch+BSS0+CM2% had larger mitochondria and higher number of ridges, which are correlated to previous studies showing that low levels of opa1 are related to autophagy processes [142,143]. Likewise, it has been reported that during autophagy, mitochondria lengthen, spared from degradation and maintain cellular viability [131], apparently maintaining a higher number of ridges through which ATP production is optimized in times of nutrient restriction [144,145] or simply opa1 may be directly involved in the integration of the cellular metabolic state [146,147]. We found the same pattern with two other genes ND1 and ND2, two subunits of Complex I. This is important not only because complex I is involved in disease states for contributing to the production of ROS and the decrease in energy but also because it is being evaluated as a possible therapeutic alternative for encephalomyopathies and neurodegenerative diseases [148-150]. In the present study, we found that both ND1 and ND2 were positively regulated in scratch+BSS0 cells and, surprisingly, their expression was attenuated when scratch cells were treated with CM2% (Fig.3E-F). These findings may be related to previously reported results, in which CM-hMSCA significantly decreased ROS production [10,18] and oxidative damage possibly through overexpression of antioxidant or mediator proteins such as neuroglobin (Ngb) [10] or the binding of Ngb to subunits of mitochondrial complexes [151]. Despite these findings, the molecular mechanisms that can regulate the fusion processes or the action on the respiratory chain are still not clear, and it is not known if the trophic factors, neurotrophic factors, anti-apoptotic and anti- inflammatory molecules of CM-hMSCA can directly mediate these processes within the cell. Likewise, and supporting in part the previous findings, in this study we showed that CM-hMSCA exerts its effect through the protection of the mitochondria. Our results showed that upon inhibition of mitochondria with AA (Fig.5), the protective effect of CM-hMSCA in scratch+BSS0+CM2% cells were abolished. These damaging effects included reduced cell viability (Fig.5A), augmented ROS production (Fig.5B) and ΔψM loss (Fig.5C). Indeed, this protective action of CM-hMSCA on scratched cells was completely dampened by inhibiting both mitochondria and genetically silencing Ngb (Fig.5 D-E-F). These findings suggest that 2% CM-hMSCA can favor astrocyte protection through preservation of mitochondrial functioning and the action of Ngb in neutralizing ROS or inhibiting apoptosis through a mitochondrial- dependent pathway [152-156]. We found that blockade of Ngb decreased the expression of phosphorylated proteins such as AKT (Fig. 6B-C) and ERK1/2 (Fig.6D-E), as well as antioxidant proteins SOD2 (Fig.6F), catalase (Fig.6G) and GPX1 (Fig.6H). It has been suggested that Ngb in astrocytes can influence oxygen homeostasis and protection against hydrogen peroxide through the activation of AKT, and prevent the activation of caspase 3 [154,155]. Therefore, it is possible that CM-

139 hMSCA-induced cytoprotection may be due to activation of Ngb by some factors present in CM- hMSCA or, simply, as a secondary effect or action by activating signaling pathways such as PI3K/AKT or ERK1/2/MAPK or both, which in turn will upregulate antioxidant proteins such as those assessed in our study [107,157,9,10,18]. We also reported that siRNA-Ngb caused an imbalance in the movement 2+ 2+ 2+ of [Ca ]cito, [Ca ]mito and [Ca ]ER and interestingly these findings are supported by experimental studies that reported high levels of cytosolic Ngb suppressed Ca2+ levels and prevented the loss of ATP and ΔΨm normally associated with the onset of apoptosis [158,159]. Since the beneficial effects of the CM-hMSCA were significantly lost after adding siRNA-Ngb along with the blockade of mitochondria with AA (Fig.5A-F), our results suggest that the protective effect of CM-hMSCA is mediated by the interaction of Ngb with mitochondria, related to the mitochondrial mechanisms of neuroprotection [160,153,161-163]. In this way, with the findings obtained so far, we believe that Ngb remains an important protein to be considered as a mediator in the protection of CM-hMSCA in scratch+BSS0 cells. This is an important finding because therapeutic alternatives that promote the protection of mitochondria, especially astrocyte mitochondria, with neuroprotective functions have become a major goal in neuroscience. It is noteworthy that in previous studies reported by us, the cells subjected to scratch+BSS0+CM2% up-regulated Ngb [10].

Recently the study of Ngb has had great interest in pathologies such as TBI, ischemia and even in spinal cord injury because it is expressed in astrocytes and overexpressed in neurons in models established for the study of these pathologies [164,154-156,153]. However, it is not entirely clear if the location of the Ngb in the cells under scratch+BSS0 and scratch+BSS0+CM2% is strictly mitochondrial or it is present in other organelles, and if its location depends strictly on the state of injury. Interestingly, our results showed an increase mitochondrial accumulation of Ngb (Fig.7A-D), followed by lower concentrations in other organelles such as the Golgi apparatus (Fig.7B) and the ER (Fig.7C). The data observed in the mitochondria in this study are consistent with previous reports [160,153,161,162]. It is possible that these results can be explained from investigations in which it has been described that some molecules that make up the secretome of hMSCs can interact with Ngb giving a protective response in brain tissue. Within these molecules have been reported: PDGF-BB, [165] VEGF [166], EPO [167]. However, to our knowledge, this is the first study that addresses the presence Ngb in different organelles to mitochondria. In conclusion, our results demonstrated the protective effects of CM-hMSCA in our astrocytic model against the loss of viability and oxidative stress damage induced by scratch+BSS0. This protective effect is possibly explained by the regulation of inflammation, and mobilization of Ca2+ and its distribution within the intracellular compartments thus avoiding a cytosolic fluctuation. CM-hMSCA activated PI3K/AKT and ERK1/2/MAPK, and modulated the expression of genes responsible for mitochondrial dynamics. It could also regulate the expression of proteins such as Ngb and its distribution within different organelles from which it may exert different roles or mediate the expression of other proteins with antioxidant or survival functions in our scratch+BSS0 model (Fig. 8). Despite the advances obtained so far, more experiments are still needed such as starting to determine specifically the factors or molecules present in the CM-hMSCA that are beneficial for survival. It is also worthwhile to explore if the protective effect is a synergy of all of the compounds present in the CM-hMSCA, as well as the mechanism of molecules downstream of the PI3K/AKT and ERK1/2/MAPK pathways to promote cell survival and protection. Furthermore, understanding the mechanism of action of Ngb could provide a fundamental basis for the design of new pharmacological targets that suppress or prevent the death of astrocytes. However, we believe that the results of this study are beneficial to expand the understanding of the neuroprotective effects CM-hMSCA, even with a 2% concentration as the treatment.

140

Figure 8. Proposal of the effect of 2% of CM-hMSCA in the protection of our astrocytic model (T98G) exposed to scratch assay. A mechanical injury associated with metabolic alterations is related to cell damage through the increase in the generation of ROS, alteration of cellular signaling pathways, mitochondrial dynamics and intracellular Ca2+ levels that lead to cell loss and deterioration of cognitive and motor functions. In this study, we observed that 2% of CM-hMSCA during 24h has an effect on the secretion of cytokines, in the regulation of Ca2+, of the mitochondrial dynamics possibly mediated by an interaction of Ngb and astrocytic mitochondria, with which cellular signaling pathways are activated, mediated by AKT and ERK1/2 and the expression of antioxidant proteins is increased, regulating in part the inflammatory, apoptotic processes and maintaining the astrocytic functions of neuroprotection.

141

Acknowledgments The authors thank Dr. Jorge Andrés Afanador and the staff of the cosmetic surgery Clinic DHARA in Bogotá – Colombia, for the adipose tissue samples. This work was supported in part by grants PUJ IDs 6260 and 7115 to GEB, and 6278 to JG and scholarship for doctoral studies awarded by the Vicerrectoría Académica of PUJ to EB.

Conflicts of interest The authors declare no conflict of interest

References 1. Chen WW, Zhang X, Huang WJ (2016) Role of neuroinflammation in neurodegenerative diseases (Review). Molecular medicine reports 13 (4):3391-3396. doi:10.3892/mmr.2016.4948 2. Gonzalez H, Elgueta D, Montoya A, Pacheco R (2014) Neuroimmune regulation of microglial activity involved in neuroinflammation and neurodegenerative diseases. Journal of neuroimmunology 274 (1-2):1-13. doi:10.1016/j.jneuroim.2014.07.012 3. Villegas-Llerena C, Phillips A, Garcia-Reitboeck P, Hardy J, Pocock JM (2016) Microglial genes regulating neuroinflammation in the progression of Alzheimer's disease. Current opinion in neurobiology 36:74-81. doi:10.1016/j.conb.2015.10.004 4. Karve IP, Taylor JM, Crack PJ (2016) The contribution of astrocytes and microglia to traumatic brain injury. British journal of pharmacology 173 (4):692-702. doi:10.1111/bph.13125 5. Sochocka M, Diniz BS, Leszek J (2017) Inflammatory Response in the CNS: Friend or Foe? Molecular neurobiology 54 (10):8071-8089. doi:10.1007/s12035-016-0297-1 6. Pedraza-Alva G, Perez-Martinez L, Valdez-Hernandez L, Meza-Sosa KF, Ando-Kuri M (2015) Negative regulation of the inflammasome: keeping inflammation under control. Immunological reviews 265 (1):231-257. doi:10.1111/imr.12294 7. Ulusoy C, Zibandeh N, Yildirim S, Trakas N, Zisimopoulou P, Kucukerden M, Tasli H, Tzartos S, Goker K, Tuzun E, Akkoc T (2015) Dental follicle mesenchymal stem cell administration ameliorates muscle weakness in MuSK-immunized mice. Journal of neuroinflammation 12:231. doi:10.1186/s12974-015-0451-0 8. Trubiani O, Giacoppo S, Ballerini P, Diomede F, Piattelli A, Bramanti P, Mazzon E (2016) Alternative source of stem cells derived from human periodontal ligament: a new treatment for experimental autoimmune encephalomyelitis. Stem cell research & therapy 7:1. doi:10.1186/s13287-015-0253-4 9. Baez-Jurado E, Hidalgo-Lanussa O, Guio-Vega G, Ashraf GM, Echeverria V, Aliev G, Barreto GE (2018) Conditioned Medium of Human Adipose Mesenchymal Stem Cells Increases Wound Closure and Protects Human Astrocytes Following Scratch Assay In Vitro. Molecular neurobiology 55 (6):5377-5392. doi:10.1007/s12035-017-0771-4 10. Baez-Jurado E, Vega GG, Aliev G, Tarasov VV, Esquinas P, Echeverria V, Barreto GE (2018) Blockade of Neuroglobin Reduces Protection of Conditioned Medium from Human Mesenchymal Stem Cells in Human Astrocyte Model (T98G) Under a Scratch Assay. Molecular neurobiology 55 (3):2285-2300. doi:10.1007/s12035-017-0481-y 11. Konala VB, Mamidi MK, Bhonde R, Das AK, Pochampally R, Pal R (2016) The current landscape of the mesenchymal stromal cell secretome: A new paradigm for cell-free regeneration. Cytotherapy 18 (1):13-24. doi:10.1016/j.jcyt.2015.10.008 12. Guillen MI, Platas J, Perez Del Caz MD, Mirabet V, Alcaraz MJ (2018) Paracrine Anti- inflammatory Effects of Adipose Tissue-Derived Mesenchymal Stem Cells in Human Monocytes. Frontiers in physiology 9:661. doi:10.3389/fphys.2018.00661

142

13. Guo ZY, Sun X, Xu XL, Zhao Q, Peng J, Wang Y (2015) Human umbilical cord mesenchymal stem cells promote peripheral nerve repair via paracrine mechanisms. Neural regeneration research 10 (4):651-658. doi:10.4103/1673-5374.155442 14. Mita T, Furukawa-Hibi Y, Takeuchi H, Hattori H, Yamada K, Hibi H, Ueda M, Yamamoto A (2015) Conditioned medium from the stem cells of human dental pulp improves cognitive function in a mouse model of Alzheimer's disease. Behavioural brain research 293:189-197. doi:10.1016/j.bbr.2015.07.043 15. Pischiutta F, Brunelli L, Romele P, Silini A, Sammali E, Paracchini L, Marchini S, Talamini L, Bigini P, Boncoraglio GB, Pastorelli R, De Simoni MG, Parolini O, Zanier ER (2016) Protection of Brain Injury by Amniotic Mesenchymal Stromal Cell-Secreted Metabolites. Critical care medicine 44 (11):e1118-e1131. doi:10.1097/CCM.0000000000001864 16. Mekhemar MK, Adam-Klages S, Kabelitz D, Dorfer CE, Fawzy El-Sayed KM (2018) TLR- induced immunomodulatory cytokine expression by human gingival stem/progenitor cells. Cellular immunology 326:60-67. doi:10.1016/j.cellimm.2017.01.007 17. Fawzy El-Sayed KM, Dorfer CE (2016) Gingival Mesenchymal Stem/Progenitor Cells: A Unique Tissue Engineering Gem. Stem cells international 2016:7154327. doi:10.1155/2016/7154327 18. Torrente D, Avila MF, Cabezas R, Morales L, Gonzalez J, Samudio I, Barreto GE (2014) Paracrine factors of human mesenchymal stem cells increase wound closure and reduce reactive oxygen species production in a traumatic brain injury in vitro model. Human & experimental toxicology 33 (7):673-684. doi:10.1177/0960327113509659 19. Song M, Jue SS, Cho YA, Kim EC (2015) Comparison of the effects of human dental pulp stem cells and human bone marrow-derived mesenchymal stem cells on ischemic human astrocytes in vitro. Journal of neuroscience research 93 (6):973-983. doi:10.1002/jnr.23569 20. Huang W, Lv B, Zeng H, Shi D, Liu Y, Chen F, Li F, Liu X, Zhu R, Yu L, Jiang X (2015) Paracrine Factors Secreted by MSCs Promote Astrocyte Survival Associated With GFAP Downregulation After Ischemic Stroke via p38 MAPK and JNK. Journal of cellular physiology 230 (10):2461-2475. doi:10.1002/jcp.24981 21. Sun H, Benardais K, Stanslowsky N, Thau-Habermann N, Hensel N, Huang D, Claus P, Dengler R, Stangel M, Petri S (2013) Therapeutic potential of mesenchymal stromal cells and MSC conditioned medium in Amyotrophic Lateral Sclerosis (ALS)--in vitro evidence from primary motor neuron cultures, NSC-34 cells, astrocytes and microglia. PloS one 8 (9):e72926. doi:10.1371/journal.pone.0072926 22. Zhou Z, Chen Y, Zhang H, Min S, Yu B, He B, Jin A (2013) Comparison of mesenchymal stromal cells from human bone marrow and adipose tissue for the treatment of spinal cord injury. Cytotherapy 15 (4):434-448. doi:10.1016/j.jcyt.2012.11.015 23. Avila-Rodriguez M, Garcia-Segura LM, Hidalgo-Lanussa O, Baez E, Gonzalez J, Barreto GE (2016) Tibolone protects astrocytic cells from glucose deprivation through a mechanism involving estrogen receptor beta and the upregulation of neuroglobin expression. Molecular and cellular endocrinology 433:35-46. doi:10.1016/j.mce.2016.05.024 24. Sasaki S, Futagi Y, Kobayashi M, Ogura J, Iseki K (2015) Functional characterization of 5- oxoproline transport via SLC16A1/MCT1. The Journal of biological chemistry 290 (4):2303- 2311. doi:10.1074/jbc.M114.581892 25. Cabezas R, Avila MF, Gonzalez J, El-Bacha RS, Barreto GE (2015) PDGF-BB protects mitochondria from rotenone in T98G cells. Neurotoxicity research 27 (4):355-367. doi:10.1007/s12640-014-9509-5

143

26. Mimura J, Kosaka K, Maruyama A, Satoh T, Harada N, Yoshida H, Satoh K, Yamamoto M, Itoh K (2011) Nrf2 regulates NGF mRNA induction by carnosic acid in T98G glioblastoma cells and normal human astrocytes. Journal of biochemistry 150 (2):209-217. doi:10.1093/jb/mvr065 27. Bourguignon LY, Gilad E, Peyrollier K, Brightman A, Swanson RA (2007) Hyaluronan-CD44 interaction stimulates Rac1 signaling and PKN gamma kinase activation leading to cytoskeleton function and cell migration in astrocytes. Journal of neurochemistry 101 (4):1002-1017. doi:10.1111/j.1471-4159.2007.04485.x 28. Ouyang YB, Xu LJ, Emery JF, Lee AS, Giffard RG (2011) Overexpressing GRP78 influences Ca2+ handling and function of mitochondria in astrocytes after ischemia-like stress. Mitochondrion 11 (2):279-286. doi:10.1016/j.mito.2010.10.007 29. Vomelova I, Vaníčková Z, Šedo A (2009) Technical Note Methods of RNA Purification. All Ways (Should) Lead to Rome. Folia Biologica (Praha) 55:243-251 30. Scientific TF (2015) Real-time PCR Solutions. 31. Taylor SC, Berkelman T, Yadav G, Hammond M (2013) A defined methodology for reliable quantification of Western blot data. Molecular biotechnology 55 (3):217-226. doi:10.1007/s12033-013-9672-6 32. Gassmann M, Grenacher B, Rohde B, Vogel J (2009) Quantifying Western blots: pitfalls of densitometry. Electrophoresis 30 (11):1845-1855. doi:10.1002/elps.200800720 33. Voloboueva LA, Lee SW, Emery JF, Palmer TD, Giffard RG (2010) Mitochondrial protection attenuates inflammation-induced impairment of neurogenesis in vitro and in vivo. The Journal of neuroscience : the official journal of the Society for Neuroscience 30 (37):12242-12251. doi:10.1523/JNEUROSCI.1752-10.2010 34. Cassina P, Cassina A, Pehar M, Castellanos R, Gandelman M, de Leon A, Robinson KM, Mason RP, Beckman JS, Barbeito L, Radi R (2008) Mitochondrial dysfunction in SOD1G93A- bearing astrocytes promotes motor neuron degeneration: prevention by mitochondrial-targeted antioxidants. The Journal of neuroscience : the official journal of the Society for Neuroscience 28 (16):4115-4122. doi:10.1523/JNEUROSCI.5308-07.2008 35. Wang H, Joseph JA (1999) Quantifying cellular oxidative stress by dichlorofluorescein assay using microplate reader. Free radical biology & medicine 27 (5-6):612-616 36. Alarifi S, Ali D, Alkahtani S (2015) Nanoalumina induces apoptosis by impairing antioxidant enzyme systems in human hepatocarcinoma cells. International journal of nanomedicine 10:3751- 3760. doi:10.2147/IJN.S82050 37. Pokrzywinski KL, Tilney CL, Warner ME, Coyne KJ (2017) Cell cycle arrest and biochemical changes accompanying cell death in harmful dinoflagellates following exposure to bacterial algicide IRI-160AA. Scientific reports 7:45102. doi:10.1038/srep45102 38. Jeong SH, Kim HK, Song IS, Noh SJ, Marquez J, Ko KS, Rhee BD, Kim N, Mishchenko NP, Fedoreyev SA, Stonik VA, Han J (2014) Echinochrome a increases mitochondrial mass and function by modulating mitochondrial biogenesis regulatory genes. Marine drugs 12 (8):4602- 4615. doi:10.3390/md12084602 39. Oliva CR, Moellering DR, Gillespie GY, Griguer CE (2011) Acquisition of chemoresistance in gliomas is associated with increased mitochondrial coupling and decreased ROS production. PloS one 6 (9):e24665. doi:10.1371/journal.pone.0024665 40. Hidalgo-Lanussa O, Avila-Rodriguez M, Baez-Jurado E, Zamudio J, Echeverria V, Garcia- Segura LM, Barreto GE (2018) Tibolone Reduces Oxidative Damage and Inflammation in Microglia Stimulated with Palmitic Acid through Mechanisms Involving Estrogen Receptor Beta. Mol Neurobiol 55 (7):5462-5477. doi:10.1007/s12035-017-0777-y

144

41. Li Q, Lau A, Morris TJ, Guo L, Fordyce CB, Stanley EF (2004) A syntaxin 1, Galpha(o), and N-type calcium channel complex at a presynaptic nerve terminal: analysis by quantitative immunocolocalization. The Journal of neuroscience : the official journal of the Society for Neuroscience 24 (16):4070-4081. doi:10.1523/JNEUROSCI.0346-04.2004 42. Amor S, Puentes F, Baker D, van der Valk P (2010) Inflammation in neurodegenerative diseases. Immunology 129 (2):154-169. doi:10.1111/j.1365-2567.2009.03225.x 43. Stephenson J, Nutma E, van der Valk P, Amor S (2018) Inflammation in CNS neurodegenerative diseases. Immunology 154 (2):204-219. doi:10.1111/imm.12922 44. Kokiko-Cochran ON, Godbout JP (2018) The Inflammatory Continuum of Traumatic Brain Injury and Alzheimer's Disease. Frontiers in immunology 9:672. doi:10.3389/fimmu.2018.00672 45. Chung WS, Allen NJ, Eroglu C (2015) Astrocytes Control Synapse Formation, Function, and Elimination. Cold Spring Harbor perspectives in biology 7 (9):a020370. doi:10.1101/cshperspect.a020370 46. Becerra-Calixto A, Cardona-Gomez GP (2017) The Role of Astrocytes in Neuroprotection after Brain Stroke: Potential in Cell Therapy. Frontiers in molecular neuroscience 10:88. doi:10.3389/fnmol.2017.00088 47. Kimelberg HK, Nedergaard M (2010) Functions of astrocytes and their potential as therapeutic targets. Neurotherapeutics : the journal of the American Society for Experimental NeuroTherapeutics 7 (4):338-353. doi:10.1016/j.nurt.2010.07.006 48. Cekanaviciute E, Buckwalter MS (2016) Astrocytes: Integrative Regulators of Neuroinflammation in Stroke and Other Neurological Diseases. Neurotherapeutics : the journal of the American Society for Experimental NeuroTherapeutics 13 (4):685-701. doi:10.1007/s13311- 016-0477-8 49. Colombo E, Farina C (2016) Astrocytes: Key Regulators of Neuroinflammation. Trends in immunology 37 (9):608-620. doi:10.1016/j.it.2016.06.006 50. Le Thuc O, Blondeau N, Nahon JL, Rovere C (2015) The complex contribution of chemokines to neuroinflammation: switching from beneficial to detrimental effects. Annals of the New York Academy of Sciences 1351:127-140. doi:10.1111/nyas.12855 51. Kempuraj D, Thangavel R, Selvakumar GP, Zaheer S, Ahmed ME, Raikwar SP, Zahoor H, Saeed D, Natteru PA, Iyer S, Zaheer A (2017) Brain and Peripheral Atypical Inflammatory Mediators Potentiate Neuroinflammation and Neurodegeneration. Frontiers in cellular neuroscience 11:216. doi:10.3389/fncel.2017.00216 52. Cunningham CJ, Redondo-Castro E, Allan SM (2018) The therapeutic potential of the mesenchymal stem cell secretome in ischaemic stroke. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism:271678X18776802. doi:10.1177/0271678X18776802 53. Valencia J, Blanco B, Yanez R, Vazquez M, Herrero Sanchez C, Fernandez-Garcia M, Rodriguez Serrano C, Pescador D, Blanco JF, Hernando-Rodriguez M, Sanchez-Guijo F, Lamana ML, Segovia JC, Vicente A, Del Canizo C, Zapata AG (2016) Comparative analysis of the immunomodulatory capacities of human bone marrow- and adipose tissue-derived mesenchymal stromal cells from the same donor. Cytotherapy 18 (10):1297-1311. doi:10.1016/j.jcyt.2016.07.006 54. Gimeno ML, Fuertes F, Barcala Tabarrozzi AE, Attorressi AI, Cucchiani R, Corrales L, Oliveira TC, Sogayar MC, Labriola L, Dewey RA, Perone MJ (2017) Pluripotent Nontumorigenic Adipose Tissue-Derived Muse Cells have Immunomodulatory Capacity Mediated by Transforming Growth Factor-beta1. Stem cells translational medicine 6 (1):161-173. doi:10.5966/sctm.2016-0014

145

55. Gao F, Chiu SM, Motan DA, Zhang Z, Chen L, Ji HL, Tse HF, Fu QL, Lian Q (2016) Mesenchymal stem cells and immunomodulation: current status and future prospects. Cell death & disease 7:e2062. doi:10.1038/cddis.2015.327 56. Hariri RJ, Chang VA, Barie PS, Wang RS, Sharif SF, Ghajar JB (1994) Traumatic injury induces interleukin-6 production by human astrocytes. Brain research 636 (1):139-142 57. Liu C, Cui G, Zhu M, Kang X, Guo H (2014) Neuroinflammation in Alzheimer's disease: chemokines produced by astrocytes and chemokine receptors. International journal of clinical and experimental pathology 7 (12):8342-8355 58. Phuagkhaopong S, Ospondpant D, Kasemsuk T, Sibmooh N, Soodvilai S, Power C, Vivithanaporn P (2017) Cadmium-induced IL-6 and IL-8 expression and release from astrocytes are mediated by MAPK and NF-kappaB pathways. Neurotoxicology 60:82-91. doi:10.1016/j.neuro.2017.03.001 59. Gijbels K, Van Damme J, Proost P, Put W, Carton H, Billiau A (1990) Interleukin 6 production in the central nervous system during experimental autoimmune encephalomyelitis. European journal of immunology 20 (1):233-235. doi:10.1002/eji.1830200134 60. Jiang Y, Deacon R, Anthony DC, Campbell SJ (2008) Inhibition of peripheral TNF can block the malaise associated with CNS inflammatory diseases. Neurobiology of disease 32 (1):125-132. doi:10.1016/j.nbd.2008.06.017 61. Lucas SM, Rothwell NJ, Gibson RM (2006) The role of inflammation in CNS injury and disease. British journal of pharmacology 147 Suppl 1:S232-240. doi:10.1038/sj.bjp.0706400 62. Tehranian R, Andell-Jonsson S, Beni SM, Yatsiv I, Shohami E, Bartfai T, Lundkvist J, Iverfeldt K (2002) Improved recovery and delayed cytokine induction after closed head injury in mice with central overexpression of the secreted isoform of the interleukin-1 receptor antagonist. Journal of neurotrauma 19 (8):939-951. doi:10.1089/089771502320317096 63. Guida E, Stewart A (1998) Influence of hypoxia and glucose deprivation on tumour necrosis factor-alpha and granulocyte-macrophage colony-stimulating factor expression in human cultured monocytes. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 8 (1-2):75-88. doi:10.1159/000016272 64. Opal SM, DePalo VA (2000) Anti-inflammatory cytokines. Chest 117 (4):1162-1172 65. Xia W, Peng GY, Sheng JT, Zhu FF, Guo JF, Chen WQ (2015) Neuroprotective effect of interleukin-6 regulation of voltage-gated Na(+) channels of cortical neurons is time- and dose- dependent. Neural regeneration research 10 (4):610-617. doi:10.4103/1673-5374.155436 66. Erta M, Quintana A, Hidalgo J (2012) Interleukin-6, a major cytokine in the central nervous system. International journal of biological sciences 8 (9):1254-1266. doi:10.7150/ijbs.4679 67. Jiang T, Cadenas E (2014) Astrocytic metabolic and inflammatory changes as a function of age. Aging cell 13 (6):1059-1067. doi:10.1111/acel.12268 68. Chen XL, Wang Y, Peng WW, Zheng YJ, Zhang TN, Wang PJ, Huang JD, Zeng QY (2018) Effects of interleukin-6 and IL-6/AMPK signaling pathway on mitochondrial biogenesis and astrocytes viability under experimental septic condition. International immunopharmacology 59:287-294. doi:10.1016/j.intimp.2018.04.020 69. Jiang CL, Lu CL (1998) Interleukin-2 and its effects in the central nervous system. Biological signals and receptors 7 (3):148-156. doi:10.1159/000014541 70. Xie L, Choudhury GR, Winters A, Yang SH, Jin K (2015) Cerebral regulatory T cells restrain microglia/macrophage-mediated inflammatory responses via IL-10. European journal of immunology 45 (1):180-191. doi:10.1002/eji.201444823

146

71. Bhela S, Varanasi SK, Jaggi U, Sloan SS, Rajasagi NK, Rouse BT (2017) The Plasticity and Stability of Regulatory T Cells during Viral-Induced Inflammatory Lesions. J Immunol 199 (4):1342-1352. doi:10.4049/jimmunol.1700520 72. Rothhammer V, Quintana FJ (2015) Control of autoimmune CNS inflammation by astrocytes. Seminars in immunopathology 37 (6):625-638. doi:10.1007/s00281-015-0515-3 73. Bajetto A, Bonavia R, Barbero S, Schettini G (2002) Characterization of chemokines and their receptors in the central nervous system: physiopathological implications. Journal of neurochemistry 82 (6):1311-1329 74. Hao P, Liang Z, Piao H, Ji X, Wang Y, Liu Y, Liu R, Liu J (2014) Conditioned medium of human adipose-derived mesenchymal stem cells mediates protection in neurons following glutamate excitotoxicity by regulating energy metabolism and GAP-43 expression. Metabolic brain disease 29 (1):193-205. doi:10.1007/s11011-014-9490-y 75. Bruno V, Copani A, Besong G, Scoto G, Nicoletti F (2000) Neuroprotective activity of chemokines against N-methyl-D-aspartate or beta-amyloid-induced toxicity in culture. European journal of pharmacology 399 (2-3):117-121 76. K Mamik M, Ghorpade A (2016) CXCL8 as a potential therapeutic target for HIV-associated neurocognitive disorders. Current drug targets 17 (1):111-121 77. Meiron M, Zohar Y, Anunu R, Wildbaum G, Karin N (2008) CXCL12 (SDF-1alpha) suppresses ongoing experimental autoimmune encephalomyelitis by selecting antigen-specific regulatory T cells. The Journal of experimental medicine 205 (11):2643-2655. doi:10.1084/jem.20080730 78. Chaudhry H, Zhou J, Zhong Y, Ali MM, McGuire F, Nagarkatti PS, Nagarkatti M (2013) Role of cytokines as a double-edged sword in sepsis. In Vivo 27 (6):669-684 79. Linero I, Chaparro O (2014) Paracrine effect of mesenchymal stem cells derived from human adipose tissue in bone regeneration. PloS one 9 (9):e107001. doi:10.1371/journal.pone.0107001 80. Kilroy GE, Foster SJ, Wu X, Ruiz J, Sherwood S, Heifetz A, Ludlow JW, Stricker DM, Potiny S, Green P, Halvorsen YD, Cheatham B, Storms RW, Gimble JM (2007) Cytokine profile of human adipose-derived stem cells: expression of angiogenic, hematopoietic, and proinflammatory factors. Journal of cellular physiology 212 (3):702-709. doi:10.1002/jcp.21068 81. Wei X, Du Z, Zhao L, Feng D, Wei G, He Y, Tan J, Lee WH, Hampel H, Dodel R, Johnstone BH, March KL, Farlow MR, Du Y (2009) IFATS collection: The conditioned media of adipose stromal cells protect against hypoxia-ischemia-induced brain damage in neonatal rats. Stem Cells 27 (2):478-488. doi:10.1634/stemcells.2008-0333 82. Kupcova Skalnikova H (2013) Proteomic techniques for characterisation of mesenchymal stem cell secretome. Biochimie 95 (12):2196-2211. doi:10.1016/j.biochi.2013.07.015 83. Deng LX, Hu J, Liu N, Wang X, Smith GM, Wen X, Xu XM (2011) GDNF modifies reactive astrogliosis allowing robust axonal regeneration through Schwann cell-seeded guidance channels after spinal cord injury. Experimental neurology 229 (2):238-250. doi:10.1016/j.expneurol.2011.02.001 84. Cirillo G, Bianco MR, Colangelo AM, Cavaliere C, Daniele de L, Zaccaro L, Alberghina L, Papa M (2011) Reactive astrocytosis-induced perturbation of synaptic homeostasis is restored by nerve growth factor. Neurobiology of disease 41 (3):630-639. doi:10.1016/j.nbd.2010.11.012 85. Dimitrov DH, Lee S, Yantis J, Honaker C, Braida N (2014) Cytokine serum levels as potential biological markers for the Psychopathology in Schizophrenia. Advances in Psychiatry 2014 86. Holliday J, Gruol DL (1993) Cytokine stimulation increases intracellular calcium and alters the response to quisqualate in cultured cortical astrocytes. Brain research 621 (2):233-241

147

87. Galic MA, Riazi K, Pittman QJ (2012) Cytokines and brain excitability. Frontiers in neuroendocrinology 33 (1):116-125. doi:10.1016/j.yfrne.2011.12.002 88. Shinotsuka T, Yasui M, Nuriya M (2014) Astrocytic gap junctional networks suppress cellular damage in an in vitro model of ischemia. Biochemical and biophysical research communications 444 (2):171-176. doi:10.1016/j.bbrc.2014.01.035 89. Helleringer R, Chever O, Daniel H, Galante M (2017) Oxygen and Glucose Deprivation Induces Bergmann Glia Membrane Depolarization and Ca(2+) Rises Mainly Mediated by K(+) and ATP Increases in the Extracellular Space. Frontiers in cellular neuroscience 11:349. doi:10.3389/fncel.2017.00349 90. Reuss B, von Bohlen und Halbach O (2003) Fibroblast growth factors and their receptors in the central nervous system. Cell and tissue research 313 (2):139-157. doi:10.1007/s00441-003- 0756-7 91. Wilkins A, Kemp K, Ginty M, Hares K, Mallam E, Scolding N (2009) Human bone marrow- derived mesenchymal stem cells secrete brain-derived neurotrophic factor which promotes neuronal survival in vitro. Stem cell research 3 (1):63-70. doi:10.1016/j.scr.2009.02.006 92. Taoufik E, Valable S, Muller GJ, Roberts ML, Divoux D, Tinel A, Voulgari-Kokota A, Tseveleki V, Altruda F, Lassmann H, Petit E, Probert L (2007) FLIP(L) protects neurons against in vivo ischemia and in vitro glucose deprivation-induced cell death. The Journal of neuroscience : the official journal of the Society for Neuroscience 27 (25):6633-6646. doi:10.1523/JNEUROSCI.1091-07.2007 93. Marchetti L, Klein M, Schlett K, Pfizenmaier K, Eisel UL (2004) Tumor necrosis factor (TNF)- mediated neuroprotection against glutamate-induced excitotoxicity is enhanced by N-methyl-D- aspartate receptor activation. Essential role of a TNF receptor 2-mediated phosphatidylinositol 3- kinase-dependent NF-kappa B pathway. The Journal of biological chemistry 279 (31):32869- 32881. doi:10.1074/jbc.M311766200 94. Probert L (2015) TNF and its receptors in the CNS: The essential, the desirable and the deleterious effects. Neuroscience 302:2-22. doi:10.1016/j.neuroscience.2015.06.038 95. Morales AP, Carvalho AC, Monteforte PT, Hirata H, Han SW, Hsu YT, Smaili SS (2011) Endoplasmic reticulum calcium release engages Bax translocation in cortical astrocytes. Neurochemical research 36 (5):829-838. doi:10.1007/s11064-011-0411-8 96. Verkhratsky A, Rodriguez JJ, Parpura V (2012) Calcium signalling in astroglia. Molecular and cellular endocrinology 353 (1-2):45-56. doi:10.1016/j.mce.2011.08.039 97. Johnson GG, White MC, Wu JH, Vallejo M, Grimaldi M (2014) The deadly connection between endoplasmic reticulum, Ca2+, protein synthesis, and the endoplasmic reticulum stress response in malignant glioma cells. Neuro-oncology 16 (8):1086-1099. doi:10.1093/neuonc/nou012 98. Begum G, Kintner D, Liu Y, Cramer SW, Sun D (2012) DHA inhibits ER Ca2+ release and ER stress in astrocytes following in vitro ischemia. Journal of neurochemistry 120 (4):622-630. doi:10.1111/j.1471-4159.2011.07606.x 99. Hajnoczky G, Robb-Gaspers LD, Seitz MB, Thomas AP (1995) Decoding of cytosolic calcium oscillations in the mitochondria. Cell 82 (3):415-424 100. Reyes RC, Parpura V (2008) Mitochondria modulate Ca2+-dependent glutamate release from rat cortical astrocytes. The Journal of neuroscience : the official journal of the Society for Neuroscience 28 (39):9682-9691. doi:10.1523/JNEUROSCI.3484-08.2008 101. Parpura V, Grubisic V, Verkhratsky A (2011) Ca(2+) sources for the exocytotic release of glutamate from astrocytes. Biochimica et biophysica acta 1813 (5):984-991. doi:10.1016/j.bbamcr.2010.11.006

148

102. Voulgari-Kokota A, Fairless R, Karamita M, Kyrargyri V, Tseveleki V, Evangelidou M, Delorme B, Charbord P, Diem R, Probert L (2012) Mesenchymal stem cells protect CNS neurons against glutamate excitotoxicity by inhibiting glutamate receptor expression and function. Experimental neurology 236 (1):161-170. doi:10.1016/j.expneurol.2012.04.011 103. Cheng B, Furukawa K, O'Keefe JA, Goodman Y, Kihiko M, Fabian T, Mattson MP (1995) Basic fibroblast growth factor selectively increases AMPA-receptor subunit GluR1 protein level and differentially modulates Ca2+ responses to AMPA and NMDA in hippocampal neurons. Journal of neurochemistry 65 (6):2525-2536 104. Papazian I, Kyrargyri V, Evangelidou M, Voulgari-Kokota A, Probert L (2018) Mesenchymal Stem Cell Protection of Neurons against Glutamate Excitotoxicity Involves Reduction of NMDA- Triggered Calcium Responses and Surface GluR1, and Is Partly Mediated by TNF. International journal of molecular sciences 19 (3). doi:10.3390/ijms19030651 105. Hawkins PT, Anderson KE, Davidson K, Stephens LR (2006) Signalling through Class I PI3Ks in mammalian cells. Biochemical Society transactions 34 (Pt 5):647-662. doi:10.1042/BST0340647 106. Anderson CN, Tolkovsky AM (1999) A role for MAPK/ERK in sympathetic neuron survival: protection against a p53-dependent, JNK-independent induction of apoptosis by cytosine arabinoside. The Journal of neuroscience : the official journal of the Society for Neuroscience 19 (2):664-673 107. de Oliveira MR, Ferreira GC, Schuck PF, Dal Bosco SM (2015) Role for the PI3K/Akt/Nrf2 signaling pathway in the protective effects of carnosic acid against methylglyoxal-induced neurotoxicity in SH-SY5Y neuroblastoma cells. Chemico-biological interactions 242:396-406. doi:10.1016/j.cbi.2015.11.003 108. Le Belle JE, Orozco NM, Paucar AA, Saxe JP, Mottahedeh J, Pyle AD, Wu H, Kornblum HI (2011) Proliferative neural stem cells have high endogenous ROS levels that regulate self-renewal and neurogenesis in a PI3K/Akt-dependant manner. Cell stem cell 8 (1):59-71. doi:10.1016/j.stem.2010.11.028 109. Zhang Q, Liu G, Wu Y, Sha H, Zhang P, Jia J (2011) BDNF promotes EGF-induced proliferation and migration of human fetal neural stem/progenitor cells via the PI3K/Akt pathway. Molecules 16 (12):10146-10156. doi:10.3390/molecules161210146 110. Zhao J, Cheng YY, Fan W, Yang CB, Ye SF, Cui W, Wei W, Lao LX, Cai J, Han YF, Rong JH (2015) Botanical drug puerarin coordinates with nerve growth factor in the regulation of neuronal survival and neuritogenesis via activating ERK1/2 and PI3K/Akt signaling pathways in the neurite extension process. CNS neuroscience & therapeutics 21 (1):61-70. doi:10.1111/cns.12334 111. Nguyen TL, Kim CK, Cho JH, Lee KH, Ahn JY (2010) Neuroprotection signaling pathway of nerve growth factor and brain-derived neurotrophic factor against staurosporine induced apoptosis in hippocampal H19-7/IGF-IR [corrected]. Experimental & molecular medicine 42 (8):583-595. doi:10.3858/emm.2010.42.8.060 112. Lotfinia M, Kadivar M, Piryaei A, Pournasr B, Sardari S, Sodeifi N, Sayahpour FA, Baharvand H (2016) Effect of Secreted Molecules of Human Embryonic Stem Cell-Derived Mesenchymal Stem Cells on Acute Hepatic Failure Model. Stem cells and development 25 (24):1898-1908. doi:10.1089/scd.2016.0244 113. Chen YX, Zeng ZC, Sun J, Zeng HY, Huang Y, Zhang ZY (2015) Mesenchymal stem cell- conditioned medium prevents radiation-induced liver injury by inhibiting inflammation and protecting sinusoidal endothelial cells. Journal of radiation research 56 (4):700-708. doi:10.1093/jrr/rrv026

149

114. Zagoura DS, Roubelakis MG, Bitsika V, Trohatou O, Pappa KI, Kapelouzou A, Antsaklis A, Anagnou NP (2012) Therapeutic potential of a distinct population of human amniotic fluid mesenchymal stem cells and their secreted molecules in mice with acute hepatic failure. Gut 61 (6):894-906. doi:10.1136/gutjnl-2011-300908 115. Toma C, Pittenger MF, Cahill KS, Byrne BJ, Kessler PD (2002) Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 105 (1):93- 98 116. Ranieri M, Brajkovic S, Riboldi G, Ronchi D, Rizzo F, Bresolin N, Corti S, Comi GP (2013) Mitochondrial fusion proteins and human diseases. Neurology research international 2013:293893. doi:10.1155/2013/293893 117. Burte F, Carelli V, Chinnery PF, Yu-Wai-Man P (2015) Disturbed mitochondrial dynamics and neurodegenerative disorders. Nature reviews Neurology 11 (1):11-24. doi:10.1038/nrneurol.2014.228 118. Qi X, Disatnik MH, Shen N, Sobel RA, Mochly-Rosen D (2011) Aberrant mitochondrial fission in neurons induced by protein kinase C{delta} under oxidative stress conditions in vivo. Molecular biology of the cell 22 (2):256-265. doi:10.1091/mbc.E10-06-0551 119. Stojanovski D, Koutsopoulos OS, Okamoto K, Ryan MT (2004) Levels of human Fis1 at the mitochondrial outer membrane regulate mitochondrial morphology. Journal of cell science 117 (Pt 7):1201-1210. doi:10.1242/jcs.01058 120. Elgass K, Pakay J, Ryan MT, Palmer CS (2013) Recent advances into the understanding of mitochondrial fission. Biochimica et biophysica acta 1833 (1):150-161. doi:10.1016/j.bbamcr.2012.05.002 121. Szabadkai G, Simoni AM, Bianchi K, De Stefani D, Leo S, Wieckowski MR, Rizzuto R (2006) Mitochondrial dynamics and Ca2+ signaling. Biochimica et biophysica acta 1763 (5- 6):442-449. doi:10.1016/j.bbamcr.2006.04.002 122. Bravo-Sagua R, Parra V, Lopez-Crisosto C, Diaz P, Quest AF, Lavandero S (2017) Calcium Transport and Signaling in Mitochondria. Comprehensive Physiology 7 (2):623-634. doi:10.1002/cphy.c160013 123. Ogunbileje JO, Porter C, Herndon DN, Chao T, Abdelrahman DR, Papadimitriou A, Chondronikola M, Zimmers TA, Reidy PT, Rasmussen BB, Sidossis LS (2016) Hypermetabolism and hypercatabolism of skeletal muscle accompany mitochondrial stress following severe burn trauma. American journal of physiology Endocrinology and metabolism 311 (2):E436-448. doi:10.1152/ajpendo.00535.2015 124. Eisner V, Picard M, Hajnóczky G (2018) Mitochondrial dynamics in adaptive and maladaptive cellular stress responses. Nature cell biology:1 125. Tondera D, Grandemange S, Jourdain A, Karbowski M, Mattenberger Y, Herzig S, Da Cruz S, Clerc P, Raschke I, Merkwirth C, Ehses S, Krause F, Chan DC, Alexander C, Bauer C, Youle R, Langer T, Martinou JC (2009) SLP-2 is required for stress-induced mitochondrial hyperfusion. The EMBO journal 28 (11):1589-1600. doi:10.1038/emboj.2009.89 126. Jagasia R, Grote P, Westermann B, Conradt B (2005) DRP-1-mediated mitochondrial fragmentation during EGL-1-induced cell death in C. elegans. Nature 433 (7027):754-760. doi:10.1038/nature03316 127. Fannjiang Y, Cheng WC, Lee SJ, Qi B, Pevsner J, McCaffery JM, Hill RB, Basanez G, Hardwick JM (2004) Mitochondrial fission proteins regulate programmed cell death in yeast. Genes & development 18 (22):2785-2797. doi:10.1101/gad.1247904

150

128. Chang CR, Blackstone C (2010) Dynamic regulation of mitochondrial fission through modification of the dynamin-related protein Drp1. Annals of the New York Academy of Sciences 1201:34-39. doi:10.1111/j.1749-6632.2010.05629.x 129. Alavi MV, Fuhrmann N (2013) Dominant optic atrophy, OPA1, and mitochondrial quality control: understanding mitochondrial network dynamics. Molecular neurodegeneration 8:32. doi:10.1186/1750-1326-8-32 130. Mishra P, Chan DC (2016) Metabolic regulation of mitochondrial dynamics. The Journal of cell biology 212 (4):379-387. doi:10.1083/jcb.201511036 131. Gomes LC, Di Benedetto G, Scorrano L (2011) During autophagy mitochondria elongate, are spared from degradation and sustain cell viability. Nat Cell Biol 13 (5):589-598. doi:10.1038/ncb2220 132. Lee YJ, Jeong SY, Karbowski M, Smith CL, Youle RJ (2004) Roles of the mammalian mitochondrial fission and fusion mediators Fis1, Drp1, and Opa1 in apoptosis. Molecular biology of the cell 15 (11):5001-5011. doi:10.1091/mbc.e04-04-0294 133. Cereghetti GM, Costa V, Scorrano L (2010) Inhibition of Drp1-dependent mitochondrial fragmentation and apoptosis by a polypeptide antagonist of calcineurin. Cell death and differentiation 17 (11):1785-1794. doi:10.1038/cdd.2010.61 134. Frank S, Gaume B, Bergmann-Leitner ES, Leitner WW, Robert EG, Catez F, Smith CL, Youle RJ (2001) The role of dynamin-related protein 1, a mediator of mitochondrial fission, in apoptosis. Developmental cell 1 (4):515-525 135. Frezza C, Cipolat S, Martins de Brito O, Micaroni M, Beznoussenko GV, Rudka T, Bartoli D, Polishuck RS, Danial NN, De Strooper B, Scorrano L (2006) OPA1 controls apoptotic cristae remodeling independently from mitochondrial fusion. Cell 126 (1):177-189. doi:10.1016/j.cell.2006.06.025 136. Elachouri G, Vidoni S, Zanna C, Pattyn A, Boukhaddaoui H, Gaget K, Yu-Wai-Man P, Gasparre G, Sarzi E, Delettre C, Olichon A, Loiseau D, Reynier P, Chinnery PF, Rotig A, Carelli V, Hamel CP, Rugolo M, Lenaers G (2011) OPA1 links human mitochondrial genome maintenance to mtDNA replication and distribution. Genome research 21 (1):12-20. doi:10.1101/gr.108696.110 137. Olichon A, Baricault L, Gas N, Guillou E, Valette A, Belenguer P, Lenaers G (2003) Loss of OPA1 perturbates the mitochondrial inner membrane structure and integrity, leading to cytochrome c release and apoptosis. The Journal of biological chemistry 278 (10):7743-7746. doi:10.1074/jbc.C200677200 138. Mizushima N (2005) The pleiotropic role of autophagy: from protein metabolism to bactericide. Cell death and differentiation 12 Suppl 2:1535-1541. doi:10.1038/sj.cdd.4401728 139. Klionsky DJ, Emr SD (2000) Autophagy as a regulated pathway of cellular degradation. Science 290 (5497):1717-1721 140. Wu YT, Tan HL, Huang Q, Kim YS, Pan N, Ong WY, Liu ZG, Ong CN, Shen HM (2008) Autophagy plays a protective role during zVAD-induced necrotic cell death. Autophagy 4 (4):457- 466 141. Cecconi F, Levine B (2008) The role of autophagy in mammalian development: cell makeover rather than cell death. Developmental cell 15 (3):344-357. doi:10.1016/j.devcel.2008.08.012 142. White KE, Davies VJ, Hogan VE, Piechota MJ, Nichols PP, Turnbull DM, Votruba M (2009) OPA1 deficiency associated with increased autophagy in retinal ganglion cells in a murine model of dominant optic atrophy. Investigative ophthalmology & visual science 50 (6):2567-2571. doi:10.1167/iovs.08-2913

151

143. Kane MS, Alban J, Desquiret-Dumas V, Gueguen N, Ishak L, Ferre M, Amati-Bonneau P, Procaccio V, Bonneau D, Lenaers G, Reynier P, Chevrollier A (2017) Autophagy controls the pathogenicity of OPA1 mutations in dominant optic atrophy. Journal of cellular and molecular medicine 21 (10):2284-2297. doi:10.1111/jcmm.13149 144. Gomes LC, Scorrano L (2011) Mitochondrial elongation during autophagy: a stereotypical response to survive in difficult times. Autophagy 7 (10):1251-1253. doi:10.4161/auto.7.10.16771 145. Gomes LC, Scorrano L (2013) Mitochondrial morphology in mitophagy and macroautophagy. Biochimica et biophysica acta 1833 (1):205-212. doi:10.1016/j.bbamcr.2012.02.012 146. Hackenbrock CR (1968) Chemical and physical fixation of isolated mitochondria in low- energy and high-energy states. Proceedings of the National Academy of Sciences of the United States of America 61 (2):598-605 147. Pidoux G, Witczak O, Jarnaess E, Myrvold L, Urlaub H, Stokka AJ, Kuntziger T, Tasken K (2011) Optic atrophy 1 is an A-kinase anchoring protein on lipid droplets that mediates adrenergic control of lipolysis. The EMBO journal 30 (21):4371-4386. doi:10.1038/emboj.2011.365 148. Seo BB, Nakamaru-Ogiso E, Flotte TR, Matsuno-Yagi A, Yagi T (2006) In vivo complementation of complex I by the yeast Ndi1 enzyme. Possible application for treatment of Parkinson disease. The Journal of biological chemistry 281 (20):14250-14255. doi:10.1074/jbc.M600922200 149. Marella M, Seo BB, Yagi T, Matsuno-Yagi A (2009) Parkinson's disease and mitochondrial complex I: a perspective on the Ndi1 therapy. Journal of bioenergetics and biomembranes 41 (6):493-497. doi:10.1007/s10863-009-9249-z 150. Seo BB, Nakamaru-Ogiso E, Cruz P, Flotte TR, Yagi T, Matsuno-Yagi A (2004) Functional expression of the single subunit NADH dehydrogenase in mitochondria in vivo: a potential therapy for complex I deficiencies. Human gene therapy 15 (9):887-895. doi:10.1089/hum.2004.15.887 151. Yu Z, Zhang Y, Liu N, Yuan J, Lin L, Zhuge Q, Xiao J, Wang X (2016) Roles of Neuroglobin Binding to Mitochondrial Complex III Subunit Cytochrome c1 in Oxygen-Glucose Deprivation- Induced Neurotoxicity in Primary Neurons. Molecular neurobiology 53 (5):3249-3257. doi:10.1007/s12035-015-9273-4 152. Ma WW, Hou CC, Zhou X, Yu HL, Xi YD, Ding J, Zhao X, Xiao R (2013) Genistein alleviates the mitochondria-targeted DNA damage induced by Beta-amyloid peptides 25-35 in C6 glioma cells. Neurochemical Research 38 (7):1315-1323. doi:10.1007/s11064-013-1019-y 153. Lan WB, Lin JH, Chen XW, Wu CY, Zhong GX, Zhang LQ, Lin WP, Liu WN, Li X, Lin JL (2014) Overexpressing neuroglobin improves functional recovery by inhibiting neuronal apoptosis after spinal cord injury. Brain research 1562:100-108. doi:10.1016/j.brainres.2014.03.020 154. Amri F, Ghouili I, Amri M, Carrier A, Masmoudi-Kouki O (2017) Neuroglobin protects astroglial cells from hydrogen peroxide-induced oxidative stress and apoptotic cell death. Journal of neurochemistry 140 (1):151-169. doi:10.1111/jnc.13876 155. Chen X, Liu Y, Zhang L, Zhu P, Zhu H, Yang Y, Guan P (2015) Long-term neuroglobin expression of human astrocytes following brain trauma. Neuroscience letters 606:194-199. doi:10.1016/j.neulet.2015.09.002 156. Yu Z, Poppe JL, Wang X (2013) Mitochondrial mechanisms of neuroglobin's neuroprotection. Oxidative medicine and cellular longevity 2013:756989. doi:10.1155/2013/756989 157. Na HK, Kim EH, Jung JH, Lee HH, Hyun JW, Surh YJ (2008) (-)-Epigallocatechin gallate induces Nrf2-mediated antioxidant enzyme expression via activation of PI3K and ERK in human

152

mammary epithelial cells. Archives of biochemistry and biophysics 476 (2):171-177. doi:10.1016/j.abb.2008.04.003 158. Liu J, Yu Z, Guo S, Lee SR, Xing C, Zhang C, Gao Y, Nicholls DG, Lo EH, Wang X (2009) Effects of neuroglobin overexpression on mitochondrial function and oxidative stress following hypoxia/reoxygenation in cultured neurons. Journal of neuroscience research 87 (1):164-170. doi:10.1002/jnr.21826 159. Duong TT, Witting PK, Antao ST, Parry SN, Kennerson M, Lai B, Vogt S, Lay PA, Harris HH (2009) Multiple protective activities of neuroglobin in cultured neuronal cells exposed to hypoxia re-oxygenation injury. Journal of neurochemistry 108 (5):1143-1154. doi:10.1111/j.1471- 4159.2008.05846.x 160. Yu Z, Xu J, Liu N, Wang Y, Li X, Pallast S, van Leyen K, Wang X (2012) Mitochondrial distribution of neuroglobin and its response to oxygen-glucose deprivation in primary-cultured mouse cortical neurons. Neuroscience 218:235-242. doi:10.1016/j.neuroscience.2012.05.054 161. Fiocchetti M, Cipolletti M, Leone S, Naldini A, Carraro F, Giordano D, Verde C, Ascenzi P, Marino M (2016) Neuroglobin in Breast Cancer Cells: Effect of Hypoxia and Oxidative Stress on Protein Level, Localization, and Anti-Apoptotic Function. PloS one 11 (5):e0154959. doi:10.1371/journal.pone.0154959 162. De Marinis E, Fiocchetti M, Acconcia F, Ascenzi P, Marino M (2013) Neuroglobin upregulation induced by 17beta-estradiol sequesters cytocrome c in the mitochondria preventing H2O2-induced apoptosis of neuroblastoma cells. Cell death & disease 4:e508. doi:10.1038/cddis.2013.30 163. Gorgun FM, Zhuo M, Singh S, Englander EW (2014) Neuroglobin mitigates mitochondrial impairments induced by acute inhalation of combustion smoke in the mouse brain. Inhalation toxicology 26 (6):361-369. doi:10.3109/08958378.2014.902147 164. Baez E, Echeverria V, Cabezas R, Avila-Rodriguez M, Garcia-Segura LM, Barreto GE (2016) Protection by Neuroglobin Expression in Brain Pathologies. Frontiers in neurology 7:146. doi:10.3389/fneur.2016.00146 165. Cabezas R, Vega-Vela NE, Gonzalez-Sanmiguel J, Gonzalez J, Esquinas P, Echeverria V, Barreto GE (2018) PDGF-BB Preserves Mitochondrial Morphology, Attenuates ROS Production, and Upregulates Neuroglobin in an Astrocytic Model Under Rotenone Insult. Molecular neurobiology 55 (4):3085-3095. doi:10.1007/s12035-017-0567-6 166. Jin K, Mao X, Xie L, Greenberg DA (2012) Interactions between vascular endothelial growth factor and neuroglobin. Neuroscience letters 519 (1):47-50. doi:10.1016/j.neulet.2012.05.018 167. Zhu L, Huang L, Wen Q, Wang T, Qiao L, Jiang L (2017) Recombinant human erythropoietin offers neuroprotection through inducing endogenous erythropoietin receptor and neuroglobin in a neonatal rat model of periventricular white matter damage. Neuroscience letters 650:12-17. doi:10.1016/j.neulet.2017.03.024

153

Capítulo 3 Confirmación del efecto del medio condicionado de células madre mesenquimales derivadas de tejido adiposo humano en astrocitos humanos sujetos scratch y privación de glucosa.

154

Los astrocitos son las células gliales, no neuronales más abundantes en el cerebro (D. Sun & Jakobs, 2012; H. Sun et al., 2013). Su abundancia les proporciona funciones esenciales como la preservación del tejido neural (Steele & Robinson, 2012), la remodelación sináptica, el mantenimiento de barreras protectoras (Steele & Robinson, 2012) y la homeostasis cerebral (Hamby & Sofroniew, 2010). Además, los astrocitos contribuyen al mantenimiento del sistema antioxidante y la producción de neurotrofinas (Panickar & Norenberg, 2005). Sin embargo, los astrocitos no sólo realizan funciones neuroprotectoras sino que también pueden ser perjudiciales para el mantenimiento de la función neuronal (Pekny et al., 2016). Esto ocurre cuando los astrocitos cambian de un estado de reposo a uno reactivo, en la que adquieren una morfología y función diferentes, con importantes consecuencias para la homeostasis neuronal (Pekny & Pekna, 2016). Comprender la respuesta de los astrocitos y otros tipos de células en patologías cerebrales puede arrojar una luz sobre los mecanismos que conducen al deterioro funcional del tejido nervioso, así como identificar posibles tratamientos dirigidos a evitar la progresión de esta fisiopatología (Prins et al., 2013a). Estudios recientes confirmaron que el CM- hMSCA puede liberar factores con funciones antiapoptóticas y antiinflamatorias, incluidas hormonas, proteínas de la matriz extracelular y factores neurotróficos (Salgado et al., 2015), que mejoran la recuperación de redes neuronales (Yamazaki, Jin, Tsuchiya, Kanno, & Nishizaki, 2015) y reducen el daño cerebral en los modelos de rata de accidente cerebrovascular al aumentar la proliferación de células endoteliales, reducir la apoptosis neuronal y la astrogliosis (Cho et al., 2012; Egashira et al., 2012). En este capítulo se presenta el efecto del CM-hMSCA sobre astrocitos humanos primarios. Estos resultados confirman lo observado en el modelo astrocitario (T98G), usado en la primera parte de esta investigación. Según lo observado en los astrocitos humanos primarios, el CM-hMSCA mejoró la viabilidad celular, redujo la fragmentación nuclear y preservó el potencial de membrana mitocondrial. Además, estos efectos fueron acompañados por cambios morfológicos y aumento del índice de polaridad, parámetros relacionados con la migración celular. En conjunto, estos resultados son presentados en la siguiente publicación y permiten la confirmación del potencial efecto del CM-hMSCA en astrocitos sujetos a scratch y privación de glucosa.

155 Mol Neurobiol (2018) 55:5377–5392 DOI 10.1007/s12035-017-0771-4

Conditioned Medium of Human Adipose Mesenchymal Stem Cells Increases Wound Closure and Protects Human Astrocytes Following Scratch Assay In Vitro

Eliana Baez-Jurado1 & Oscar Hidalgo-Lanussa1 & Gina Guio-Vega1 & Ghulam Md Ashraf2 & Valentina Echeverria3,4 & Gjumrakch Aliev5,6,7 & George E. Barreto1,8

Received: 2 August 2017 /Accepted: 11 September 2017 /Published online: 21 September 2017 # Springer Science+Business Media, LLC 2017

Abstract Astrocytes perform essential functions in the pres- study, the effects of CM-hMSCA on human astrocytes sub- ervation of neural tissue. For this reason, these cells can re- jected to scratch assay were assessed. Our findings indicated spond with changes in gene expression, hypertrophy, and pro- that CM-hMSCA improved cell viability, reduced nuclear liferation upon a traumatic brain injury event (TBI). Different fragmentation, and preserved mitochondrial membrane poten- therapeutic strategies may be focused on preserving astrocyte tial. These effects were accompanied by morphological functions and favor a non-generalized and non-sustained pro- changes and an increased polarity index thus reflecting the tective response over time post-injury. A recent strategy has ability of astrocytes to migrate to the wound stimulated by been the use of the conditioned medium of human adipose CM-hMSCA. In conclusion, CM-hMSCA may be considered mesenchymal stem cells (CM-hMSCA) as a therapeutic strat- as a promising therapeutic strategy for the protection of astro- egy for the treatment of various neuropathologies. However, cyte function in brain pathologies. although there is a lot of information about its effect on neuronal protection, studies on astrocytes are scarce and its spe- Keywords Human astrocytes . Brain injury . Conditioned cific action in glial cells is not well explored. In the present medium . Mesenchymal stem cells . Migration . Scratch

Introduction * George E. Barreto [email protected]; [email protected] Astrocytes are the most abundant non-neuronal cells in the 1 Departamento de Nutrición y Bioquímica, Facultad de Ciencias, brain [1, 2]. Their abundance provides them with essential Pontificia Universidad Javeriana, Bogotá, D.C., Colombia functions such as the preservation of neural tissue [3], synaptic 2 King Fahd Medical Research Center, King Abdulaziz University, remodeling [4], maintenance of protective barriers [5], and Jeddah, Saudi Arabia cerebral homeostasis [6–8]. Moreover, astrocytes contribute 3 Research & Development Service, Bay Pines VAHealthcare System, to the maintenance of the antioxidant system and production Bay Pines, FL 33744, USA of neurotrophins [5]. However, astrocytes not only perform 4 Fac. Cs de la Salud, Universidad San Sebastián, Lientur 1457, neuroprotective functions but may also be detrimental to the 4080871 Concepción, Chile maintenance of neuronal function [9]. This occurs when as- 5 Institute of Physiologically Active Compounds, Russian Academy of trocytes undergo from a resting state to a reactive one acquir- Sciences, Chernogolovka, Moscow Region 142432, Russia ing a different morphology and function, with important con- 6 – GALLY International Biomedical Research Consulting LLC, San sequences to neuronal homeostasis [10 12]. Antonio, TX 78229, USA The brain tissue is frequently affected by pathologies in 7 School of Health Science and Healthcare Administration, University which glucose supply is diminished. Some of these diseases of Atlanta, Johns Creek, GA 30097, USA include hypoglycemia [13] or diabetes mellitus [14], and trau- 8 Instituto de Ciencias Biomédicas, Universidad Autónoma de Chile, matic brain injury (TBI) [15–17]. Both types of pathologies Santiago, Chile have adverse effects on cognitive, sensory, and/or physical

156 5378 Mol Neurobiol (2018) 55:5377–5392 performance with severe and permanent consequences Preparation of CM-hMSCA [18–20]. In this regard, TBI is considered as the leading cause of mortality and disability in children older than 1 year [21, hMSCA were cultured until 80% confluency with DMEM 22] and in older adults in developed countries [17, 23–25]. supplemented with 10% FBS. Thereafter, the cells were then TBI is more prevalent than some major diseases like cultured in serum-free DMEM and the CM-hMSCA was col- Parkinson’s disease, multiple sclerosis, and breast cancer lected after 48 h. The supernatants were centrifuged at [18]. Even after such a high level of incidence of TBI, there 3000 rpm for 3 min and stored at −80 °C. CM-hMSCA was is still no effective treatments available to prevent neuronal collected from hMSCA cultures between passages III and V. damage. This occurs, in part, because of the high diversity of cells involved in the lesion and the lack of knowledge about Human Astrocyte Cell Culture their functional changes during injury [26]. For example, the overall effects of TBI-reactive astrocytes are still uncertain [3], We used GIBCO® Human Astrocytes (N7805-100, Life and it is unclear as to what extent these cells are neuroprotec- Technologies,Warsaw, Poland), a cell line previously used tive or deleterious for the brain [27, 28]. and validated [36–38]. GIBCO® Human Astrocytes are de- Understanding the response of astrocytes and other types of rived from normal brain tissue and stain positive for the astro- cells to TBI can shed light on the mechanisms leading to cyte marker glial fibrillary acid protein (GFAP) [37, 38]. The functional deterioration of the nervous tissue, as well as to cells were cultured at 37 °C in GIBCO Astrocyte Medium identify possible treatments or prevention targeted to avoid [A1261301, Dulbecco’s modified Eagle’smedium progression of this pathophysiology [18]. Recently, condi- (DMEM), N-2 Supplement, fetal bovine serum (FBS), tioned medium of human mesenchymal stem cells from and 10 U penicillin/10 μg streptomycin/25 ng adipose tissue (CM-hMSCA) has been used to treat pathol- amphotericin (LONZA)] according to the manufacturer’s ogies of the central nervous system (CNS). Recent studies instructions. Cell plates were Geltrex matrix-coated confirmed that the CM-hMSCA may release factors with (A14132) and were seeded 4 × 104 cells/cm2 in 96-well anti-apoptotic, anti-inflammatory functions including hor- plates. The cultures were incubated at 37 °C in a humidi- mones, extracellular matrix proteins, and neurotrophic fac- fied atmosphere containing 5% CO2, and the culture me- tors [29, 30]. Recent studies provided evidence on the pro- dium was changed three times a week. tective effects of CM-hMSCA by enhancing the recovery of neuronal networks [31]. For example, CM-hMSCA re- Scratch Assay and CM-hMSCA Treatments duced brain damage in rat models of stroke by increasing the proliferation of endothelial cells, reducing neuronal ap- In this study, our in vitro model (scratch assay) was charac- optosis and astrogliosis [32–34]. In this study, we explored terized by mechanical injury as well as metabolic insult, and the effect of CM-hMSCA in protecting human astrocytes has been previously used to mimic an in vitro model of TBI from scratch injury. [39–41]. Briefly, the cells were allowed to reach confluence for 72 h and then serum deprived for 6 h. Later, a denuded area was produced by scratching the inside diameter of the well Materials and Methods with a 10-μlpipettetip[40–42]. Then, the scratch cells were immediately rinsed with phosphate-buffered saline (PBS) 1× Primary Culture of hMSCA to remove debris and treated with different concentrations of CM-hMSCA (5–10–15% (v/v)). The experimental groups Human mesenchymal stem cells from adipose tissue were as follows: (1) scratch ± BSS0, cells under scratch and (hMSCA) were isolated according to a previously described glucose-free conditions (BSS0); (2) scratch ± BSS5, scratch method [35]. The procedures were performed according to a cells plus BSS0 supplemented with 5.5 mM glucose (BSS5, protocol approved by the ethics committee of the Pontificia control cells); (3) scratch ± BSS0 ± CM, scratch cells plus Universidad Javeriana. Briefly, hMSCA were isolated from BSS0 and treated with different concentrations of CM- human adipose tissue that was obtained by liposuction in pa- hMSCA (5, 10, 15%); and (4) scratch ± BSS5 ± CM 5–10– tients between 24 and 28 years of age. hMSCA were charac- 15%, scratch cells plus BSS5 and treated with different con- terized by assessing the expression of CD34(−), CD73(+), centrations of CM-hMSCA. Glucose-free condition assay was CD90(+), and CD105(+) following the criteria established performed as reported previously [43–45]. The composition by the International Society for Cell Therapy. The cells were of the balanced salt solution (BSS0) was NaCl, 116; CaCl2, cultivated in Dulbecco’smodifiedEagle’smedium(DMEM) 1.8; MgSO4 7H2O, 0.8; KCl, 5.4; NaH2PO4, 1; NaHCO3, (LONZA, Walkersville, USA) supplemented with 10% fetal 14.7; and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid bovine serum (FBS) (LONZA, Walkersville, USA) and 1% (HEPES), 10; pH 7.4. In this study, cells were submitted to penicillin, at 37 °C in an atmosphere of 5% CO2. scratch + BSS0 (mechanical injury plus glucose-free

157 Mol Neurobiol (2018) 55:5377–5392 5379 conditions) and simultaneously received a co-treatment with calculated as described [47] by counting the processes of the different concentrations of CM-hMSCA for 30 h at 37 °C. cell body in 20 cells per experimental group. In addition, to complement the morphological study, the binary silhouette of Determination of Viability and Nuclear Fragmentation a cell was reduced to its one-pixel contour to show a visual representation of the cell dimensions and complexity in the We determined viability through MTT assay (3-(4,5-dimeth- main experimental groups [48]. The cell area, polarity, and ylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (Sigma, St astrocytic processes of wound-border cells were calculated Louis, MO, USA). Cells were seeded into 96-well plates in to determine the effect of scratch + BSS0 and CM-hMSCA GIBCO Astrocyte Medium (A1261301, Dulbecco’smodified on cell morphology relative to control cultures (scratch + Eagle’s medium (DMEM), N-2 Supplement, fetal bovine se- BSS5). Data were obtained with a minimum of 25 cells for rum (FBS), and 10 U penicillin/10 μg streptomycin/25 ng each condition. amphotericin (LONZA)) at a seeding density of 4 × 104 cells/cm2, incubated for 72 h until they reached confluence, Microscopy and Migration Analysis and treated. Cell viability was assessed and standardized at 24, 30, and 48 h, following injury by adding MTT solution at the For the wound closure assay, confluent astrocyte monolayers final concentration of 2 mg/ml, for 3 h at 37 °C. Then, DMSO cultured on plastic plates were used. Before CM-hMSCA co- was added to the cells and the blue formazan production was treatment, the scratch was performed on the monolayer using evaluated in a plate reader at 595 nm. The MTT values were a10-μl pipette tip and washing once with PBS-1X to remove normalized with the experimental control group (scratch + detached cells and debris. Immediately afterwards, treatment BSS5), which was considered as 100% survival. The experi- was started with the different experimental groups proposed in mental groups taken into account for the determination of BScratch Assay and CM-hMSCA Treatments.^ At the begin- viability, as well as for the other determinations, were present- ning of the experiment with 0 h of treatment (basal time), ed in BScratch Assay and CM-hMSCA Treatments.^ Each digital images were taken from scratch cells using a ×10 mag- viability assay was performed with a minimum of six repli- nification lens. Subsequently, after 30 h (end time of the trial), cates per condition. the same region was again visualized and the photographic Nuclear fragmentation was determined by Hoechst 33258 record was made. staining. Briefly, after treatments, the cells were washed with To complete the evaluation of the astrocytes to migrate, in PBS and fixed for 20 min in 4% formaldehyde at room tem- theimagesatbasetimeand30hafterco-treatments,thedis- perature (RT). Subsequently, the cells were washed and la- tance occupied by the cells from the edge of the wound was beled with Hoechst 33258 (5 mg/ml; Invitrogen) for 15 min. measured as indicated by the asterisk in Fig. 4b. The measure- Cell nuclei were observed and photographed using an inverted ment was performed on both sides of the wound, and the value fluorescence microscope, Olympus IX-53 (UV excitation, fil- was averaged and the analysis is presented in percentage of ter CKX-NU N1157600) (excitation 352 nm/emission migration. The images were taken in black and white by a 461 nm) with an exposure time set between 80 and 100 ms digital camera (Moticam CMOS 10) attached to an inverted to avoid the saturation of the pixels. The number of microscope (Olympus IX-53). The images were then analyzed fragmented nuclei was determined in at least eight randomly with NIH ImageJ software 1.46r (National Institutes of Health, selected areas (0.03 mm2) from each experimental group. Data download http://rsbweb.nih.gov/ij/) to quantify the percentage were expressed as a percentage of nuclear fragmented relative of wound closure by quantifying the remaining free area of cells to the value in control cultures (scratch + BSS5). The exper- in basal time (t = 0 h) and comparing it with that after 30 h. For iments were replicated at least in three different cell cultures. the determination of the percentage of cell migration, the average of the distance occupied by the cells from the border Morphological Analysis of the wound in base time and then with 30 h of co-treatment was compared. Experiments were performed at least three times Digitized ×20 magnified black and white images were taken and measurements were performed in triplicate. by a digital camera (Moticam CMOS 10) attached to an inverted microscope (Olympus IX-53). The images were used Determination of Mitochondrial Membrane Potential to evaluate the area, polarity, and percentage of the astrocytic processes in all the treatments. Cell area and polarity were Mitochondrial membrane potential was evaluated by using calculated by randomly selecting cells from the images. The tetramethylrhodamine methyl ester (TMRM) and assessed by polarity index was calculated as the length of the main migra- fluorescence image analysis. Cells were seeded at a density of tion axis (parallel to the direction of movement) divided by the 4×104 cells/cm2 into 48-well plates in GIBCO Astrocyte length of the perpendicular axis that intersects the center of the Medium (previously described), and subjected to each experi- cell [41, 46]. The percentage of astrocytic processes was mental paradigm after 72 h. After treatments, the cells were

158 5380 Mol Neurobiol (2018) 55:5377–5392 incubated with TMRM for 20 min. Finally, the cells were washed analysis of variance (ANOVA), followed by Dunnet’s post with PBS and photographed in a fluorescence microscope hoc test for comparisons between controls and treatments. (Olympus IX-53). The images were processed with ImageJ soft- Tukey’s post hoc test was used for multiple comparisons be- ware, and the mean fluorescence intensity of randomly selected tween the means of treatments and time points. Data were cells was determined as described below. The mean was calcu- presented as mean ± SEM of three independent experiments. lated with a minimum of 20 cells analyzed for each condition. A statistically significant difference was defined at p <0.05. The experiments were repeated in three different cultures.

Estimation of Cellular Mean Fluorescence Intensity Results

The calculation of the mean fluorescence intensity of the cells Scratch Assay Reduced Astrocytes’ Viability at 30 h for the determination of mitochondrial membrane potential and nuclear fragmentation was performed using ImageJ [49]. Both brain injury and glucose deprivation are recognized as The microphotographs were loaded in the software and pre- one of the causes of increased cognitive impairment and dam- processed eliminating the background. Subsequently, 20 cells age in many brain pathologies [18, 50, 51]. We did not find were randomly selected using a numbered grid in each micro- any damage or alteration in viability or at the mitochondrial photograph. The mean fluorescence value of the 20 cells was level induced only by scratch (data not shown); therefore, we determined in six microphotographs for each treatment using associated this mechanical damage (scratch) with a metabolic the Measure algorithm of ImageJ and selecting each cell man- deterioration (glucose deprivation), as the experimental group ually via ROI’s Management. The control cultures in the fluo- scratch + BSS0. In this regard, after 6 h without FBS, we rescence determinations were the cells under the conditions of subject the cells to scratch + BSS0 during increasing periods scratch + BSS5. The cells were analyzed in an area of of times: 24 h (Fig. 1d), 30 h (Fig. 1e), and 48 h (Fig. 1f). Cells 0.03 mm2. There were no variations in the conditions of the cultured in scratch + BSS5 solution (5.5 mM glucose) were image processing. Each assay was performed with a minimum used as controls. The results show that after 30 h of scratch + of six replicate wells for each condition. BSS0 treatment, cells reached a 50% decrease in cell viability (Fig. 1e–g) when compared to control cultures (scratch + Protein Extraction and Western Blotting BSS5) incubated for the same period of time (p < 0.0001; Fig. 1c–g). We observed that 30 h of scratch +BSS0was GIBCO® Human Astrocytes were lysed on ice with RIPA the optimum time to be selected for the next experiments. Lysis and Extraction Buffer Thermo Scientific™ supplement- Cellular morphological changes were evident over time in ed with Halt™ Protease Inhibitor Cocktail, EDTA-free (100×) cells subjected to scratch +BSS0(Fig.1d, e), reaching up (Roche). Protein content was estimated using the Pierce™ to 40% viability at 48 h (Fig. 1f). BCA Protein Assay Kit. Equal amounts of protein were dissolved in sample buffer and separated by electrophoresis in Dose–Response of the CM-hMSCA Against Cell Death SDS-PAGE, transferred onto PVDF membranes, and blocked Induced by Scratch in Human Astrocytes in 5% skim milk dissolved in Tris-buffered saline containing 0.05% Tween 20 (TBS-T), at RT for 1 h. The membranes were To determine the effect of CM-hMSCA on cell survival, astro- incubated at 4 °C ON with antibodies against β-actin (Thermo cytes were treated with increasing concentrations of CM- Fisher) (1:3000), superoxide dismutase 2 (SOD2) (Thermo hMSCA (5–10–15%) and subjected to scratch +BSS0for Fisher) (1:1000), and GPX1 (Thermo Fisher) (1:1500). The 30h(Fig.1d). Figure 2 shows the viability results obtained immunoreactivity was visualized by incubating the membrane during co-treatment with scratch + BSS0 + CM at 5, 10, or with specific secondary antibody (IRDye® Antibodies) for 15%. Our results evidenced a recovery of 91.48% (p < 0.0001), 1 h and detected using Odyssey CLx Imaging System (LI- 97.4% (p < 0.0001), and 103.7% (p < 0.0001) in cell viability COR Biosciences). The intensity of each band was quantified during co-treatment with scratch +BSS0+CM5%(Fig.2a–d), using Image Studio Software 5.x. All data were normalized to scratch + BSS0 + CM10% (Fig. 2b–e), and scratch +BSS0+ control values (scratch + BSS5) on each gel. All experiments CM15% (Fig. 2c–f), respectively, compared to scratch +BSS0 were performed in triplicates. (Fig. 2g). This confirms that low concentrations of CM- hMSCA in the range of 2–5% were able to recover astrocytes Statistical Analysis and attenuated cell death in this model of cell injury [39, 41]. Furthermore, our findings suggest that CM-hMSCA provides Data obtained from this study were tested for normal distribu- cell protection in a concentration-dependent manner (Fig. 2g). tion by Kolmogorov–Smirnov test and homogeneity of vari- However, the differences between CM treatment effects did not ance by Levene’s test. The data were then examined by reach statistical significance (p = 0.8678) (Fig. 2g).

159 Mol Neurobiol (2018) 55:5377–5392 5381

observed changes in cellular morphology under scratch + BSS0 conditions (Fig. 3b). In addition, in the visualization of the binary silhouette of a representative cell per experimental group, compared to the control cells (scratch + BSS5) (Fig. 3d), we found evident morphological changes and an increase in cells arbor under conditions of scratch + BSS0 (Fig. 3e). Indeed, we determined the percentage of astrocytic processes (Fig. 3g) and the cell area (Fig. 3h) to evaluate our observations quantitatively. Figure 3g shows the differences in the number of astrocytic processes per experimental group, with an increase of up to 133.7% in astrocytes under scratch + BSS0 conditions compared to scratch + BSS5 (p = 0.0013). All experimental groups, scratch +BSS0+CM5%(p < 0.0001), scratch +BSS0 +CM10%(p < 0.0001), and scratch +BSS0+CM15%of CM-hMSCA (p = 0.0004) presented with time a significant decrease in the number of astrocytic processes and cellular complexity with relation to baseline. Furthermore, after 30 h of scratch, treatment with CM-hMSCA induced significant decreases in astrocytic processes in the groups when compared to controls (scratch + BSS0): 82% (p < 0.0001) for scratch + BSS0 + CM5%, 82.19% (p < 0.0001) for scratch + BSS0 + CM10%, and 75.57% (p < 0.0001) for scratch + BSS0 + CM15%-CM-hMSCA. However, in the analysis of astrocytic processes, no significant differences were found between the concentrations of CM-hMSCA assayed (p > 0.9999). In contrast, cells that were treated with CM-hMSCA at different concentrations maintained the mean cell area and showed significant differences with the scratch + BSS0 group (Fig. 3h). The area was higher at increasing CM concentration as follows: 562.4 μm2 at 5% (p < 0.0001), 725.7 μm2 at 10% (p < 0.0001), and 822.2 μm2 at 15% (p < 0.0001). In this time, the differences between the concentrations of scratch +BSS0+ CM5% and scratch +BSS0+CM15%(p = 0.0057) of CM- Fig. 1 Effects of scratch assay on human astrocytes. The figure shows hMSCA were significant (p <0.05). representative images of astrocytes treated with scratch +BSS5at – different times 24 h (a), 30 h (b), and 48 h (c). d f Changes in the CM-hMSCA Induces Wound Closure and Cell Migration growth and cellular morphology of astrocytes at different times after Scratch scratch + BSS0 were observed. The graph of lines (g) show cellular in Human Astrocytes Subjected to viability at 24, 30, and 48 h after 6 h without FBS. Number sign, p < 0.0001 between scratch + BSS0 from 24 and 30 h. Asterisk, Wound closure and cell migration were evaluated under con- p < 0.0001, between scratch + BSS5 and scratch +BSS0at30h.ns trol conditions (scratch + BSS5; scratch + BSS0) (Fig. 4b) (p = 0.9949) in the percentage of cell viability between the groups with and without scratch assay. All data in these figures are presented as and in the groups treated with scratch + BSS0 + CM5% mean ± SEM of three individual experiments. Error bars indicate SEM. (Fig. 4c), scratch + BSS0 + CM10% (Fig. 4d), and scratch Scale bar, 50 μm + BSS0 + CM15% (Fig. 4e). The results show that treatment with scratch + BSS0 + CM5 increased wound closure in a direct proportion to the concentration of CM used. After 30 h CM-hMSCA Induces Changes in Human Astrocyte of incubation, an increase in wound closure of 22.45% Morphology Under Scratch Assay (p < 0.0001; Fig. 4c), 31.92% (p < 0.0001; Fig. 4d), and 35.48% (p <0.0001,Fig.4e) was observed when cells were Changes in surface and cellular complexity over time may re- treated with scratch + BSS0 + CM5%, scratch + BSS0 + flect functional differences in reactive astrocytes [48, 52]. CM10%, and scratch + BSS0 + CM15%, respectively. Figure 3 shows changes in cell morphology for different exper- Figure 4f shows the percentage of cell migration, which imental groups: scratch + BSS5 (Fig. 3a), scratch +BSS0(Fig. correlates with wound closure. Cells treated with scratch + 3b), and scratch + BSS0 + CM15% (Fig. 3c). Qualitatively, we BSS0 + CM showed a higher percentage of cell migration than

160 5382 Mol Neurobiol (2018) 55:5377–5392

Fig. 2 Dose-response of CM-hMSCA in human astrocytes with scratch experimental groups and the response in cell viability to different +BSS0at30h.scratch + BSS0 + CM-MSCA at 5 (a–d), 10 (b–e), and concentrations of CM-hMSCA. Four asterisks, p < 0.0001 between 15% (c–f) increase cellular viability of astrocytes near to control scratch + BSS0 and the different concentrations scratch + BSS0 + CM- conditions. h This figure shows the recovery of cell viability by hMSCA 5–10–15%. ns (p = 0,8678) in the viability at 5–10–15% into different concentrations of CM-hMSCA. MTT values were normalized group scratch + BSS0 + CM-hMSCA. Error bars indicate SEM. Scale with scratch + BSS5 control cells. g Comparison between the different bar, 50 μm

controls, and this was dependent upon the concentration of control cells (scratch + BSS5) (Fig. 6a) and astrocytes CM-hMSCA. After 30 h, cell migration was 4.3 times higher subjected to scratch + BSS0 with an increased nuclear in cells that were treated with scratch + BSS0 + CM15% (Fig. fragmentation by 35.4% compared to control (p < 0.0001; 4e, f) than control cells treated with scratch + BSS0 Fig. 6b). However, cells that were treated with scratch + (p < 0.0001) (Fig. 4b–f). To confirm whether the increase in BSS0 + CM showed a marked reduction in nuclear frag- wound closure was induced by cell migration, we evaluated the mentation by 41.54 and 48.59% in the presence of scratch index of polarity of the cells in each of the experimental groups +BSS0+CM5%(p < 0.0001; Fig. 6c) and scratch + BSS0 as the index of polarity has been reported to indicate the state of + CM10% (p < 0.0001; Fig. 6d), respectively. Surprisingly, migration of the cells [46]. In this context, it was found that the areductionofupto53.55%withscratch +BSS0+ polarity index of the cells subjected to scratch +BSS0was1.7 CM15% (p < 0.0001; Fig. 6e) with respect to scratch + times lower than that of cells subjected to scratch + BSS5 cells BSS0 cells was observed (Fig. 6f). (p < 0.0001; Fig. 5a–d). However, after 30 h of treatments, CM- Similar results were observed when the mitochondrial treated cells showed in comparison to control cells (scratch + membrane potential (Δψm) was determined. Figure 7 BSS5) a 2.3 (p < 0.0001), 2.9 (p = 0.0002), and 4.7 (p < 0.0001) shows differences in Δψminastrocytesexposedtoscratch times increase in the polarity index in the cells that were treated + BSS5 (Fig. 7a), scratch + BSS0 (Fig. 7b), and astrocytes with scratch +BSS0+CM5%,scratch +BSS0+CM10%,and co-treated with scratch + BSS0 + CM5% (Fig. 7c), 10% scratch +BSS0+CM15%,respectively(Fig.5d). (Fig. 7d), and 15% (Fig. 7e). Cells subjected to scratch + BSS0 + CM maintained a Δψm close to that of the control CM-hMSCA Decreases Nuclear Fragmentation (scratch + BSS5) when evaluated at different concentra- and Improves Mitochondrial Membrane Potential tions. Also, an increase of 2.31 times (p = 0.0013; Fig. in Human Astrocytes 7e, f) protection of the Δψm in the group of cells with scratch + BSS0 + CM15% compared to the control To further evaluate the protective effects of CM in astro- (scratch + BSS5). Likewise, we found significant differ- cytes subjected to scratch assay, the effect of CM-hMSCA ences between the scratch + BSS0 + CM10% and scratch on nuclear fragmentation was assessed. Figure 6 shows +BSS0+CM15%Δψmvalues(p < 0.0001) (Fig. 7f).

161 Mol Neurobiol (2018) 55:5377–5392 5383

Fig. 3 CM-hMSCA induces changes in the cellular morphology of sign, p <0.0001scratch +BSS0+CM-hMSCA5–10–15% vs. scratch + human astrocytes with scratch + BSS0 at 30 h. The figure shows BSS0 at 30 h; ampersand, p < 0.0001 scratch + BSS0 + CM-hMSCA 5– representative micrographs of the morphology of astrocytes treated with 10–15% vs. scratch + BSS0 in base time. h shows the mean cell area scratch +BSS5(a), scratch +BSS0(b), and scratch + BSS0+ CM- (μm2). Four asterisks, p <0.0001scratch +BSS5vs.scratch +BSS0at hMSCA 15% (c). e Arboreal morphology of astrocytes in scratch + 30 h; a, p=0.0057 scratch + BSS0 + hMSCA-CM 5% vs. scratch + BSS0 conditions in binary silhouette and f morphological changes in BSS0 + CM-hMSCA 15% at 30 h. No significant differences between astrocytes treated with scratch + BSS0 + CM-hMSCA15% in binary CM-hMSCA concentrations for astrocytic processes. Error bars indicate silhouette. g Percentage of astrocytic processes in different groups. Two SEM. Scale bar, 50 μm asterisks, p=0.0013 scratch +BSS5vs.scratch + BSS0 at 30 h; number

CM-hMSCA Expression of Antioxidant Proteins treated with scratch + BSS0 + CM15% when compared to in Human Astrocytes upon Scratch cells treated with scratch +BSS0alone,respectively.

Since several parameters evaluated in this work showed a better recovery of astrocytes treated with scratch +BSS0+ Discussion CM15%, the effect of CM-hMSC on the endogenous antioxidant defense was tested (Fig. 8). In this regard, it was ob- In this study, we aimed to explore the effect of CM-hMSCA served that 30 h of co-treatment with scratch +BSS0+ on human astrocytes subjected to scratch assay. Our findings CM15% resulted in an upregulation of antioxidant enzymes. indicated that CM-hMSCA improved cell viability, reduced We observed 1.8- and 0.4-fold increases in glutathione perox- nuclear fragmentation, and preserved mitochondrial mem- idase expression (GPX1; p < 0.0001, Fig. 8a, b), and super- brane potential. These results were accompanied by morpho- oxide dismutase 2 (SOD2; p < 0.0001, Fig. 8a–c) in astrocytes logical changes and increased the polarity index, thus

162 5384 Mol Neurobiol (2018) 55:5377–5392

Fig. 4 Effect of CM-hMSCA on cell migration and wound closure. a, b altered cellular morphology. One asterisk indicates the distance covered Microphotographs of cell migration (p = 0.0452) treated with scratch + by the cells from the edge of the wound used to calculate the percentage BSS5 and scratch + BSS0 at 30 h, respectively. c–e Microphotographs of of cell migration. On the other hand, g scratch + BSS0 + CM-hMSCA cells treated with scratch + BSS0 + CM-hMSCA at 5, 10, and 15%, increases wound closure at any concentration 5% (a, p < 0.0001), 10% (b, respectively. f Scratch + BSS0 + CM-hMSCA increases cell migration p < 0.0001), and 15% (c, p < 0.0001) with respect to scratch +BSS0at vs. base time in the concentration of 5 (a, p = 0.0180), 10 (b, p = 0.0180), 30 h. Four asterisks, p <0.0001scratch +BSS5vs.scratch + BSS0 at and 15% (c, p < 0.0001). At 30 h, we found significant differences 30 h. ns (p > 0.9999) without significant differences between scratch + between the scratch +BSS0vs.scratch + BSS0 + CM-hMSCA 10% BSS0 base time and 30 h. All data in these figures are presented as mean ± (two asterisks, p = 0.0031) and 15% (four asterisks, p < 0.0001). Blue SEM of three individual experiments. Error bars indicate SEM. Scale bar, arrows indicate non-migrating cells and black arrows migrating cells with 50 μm reflecting the ability of cells treated with CM-hMSCA to mi- signaling pathways that lead to neurodegeneration [18]. The grate towards the wound suggesting that CM-hMSCA may be complexity of this pathology has made it difficult to under- considered as a promising therapeutic strategy for the protec- stand and prevent the progress of the neuronal damage. tion of astrocytes in brain pathologies. Recently, in order to understand the pathophysiology of TBI, TBI is considered a pathology with dynamic and complex several studies have been carried out using different in vitro processes that involve multiple cells and trigger various cell models proposed as complementary tools for discovery in the

Fig. 5 CM-hMSCA increases the polarity index in human astrocytes. scratch + BSS0 + CM-hMSCA 15%, respectively. Number sign, Scratch + BSS0 + CM-hMSCA increases polarity index in wound p < 0.0001 scratch +BSS5vs.scratch + BSS0 de 30 h. Four asterisks, border cells. a Microphotograph of control cells (scratch +BSS5). p < 0.0001 scratch + BSS0 + CM-hMSCA 5, 10, and 15% vs. scratch + Yellow lines indicate the main migration axis (parallel to the direction BSS0 at 30 h. One asterisk, p =0.0294scratch + BSS0 + CM-hMSCA of movement) and intersection the center of the cell used to determine the 5% vs. scratch + BSS0 + CM-hMSCA 15%. Error bars indicate SEM. polarity index of the cells. b, c Microphotographs of scratch +BSS0and Scale bar, 50 μm

163 Mol Neurobiol (2018) 55:5377–5392 5385

Fig. 6 CM-hMSCA reduces nuclear fragmentation following scratch + percentage of cells with fragmented nuclei (f). Four asterisks, BSS0. Upper panel shows representative micrographs of astrocytes p <0.0001scratch + BSS0 + CM-hMSCA 5, 10, and 15% vs. scratch exposed to scratch +BSS5(a); scratch +BSS0(b); scratch +BSS0+ + BSS0 at 30 h. Three asterisks, scratch + BSS0 + CM-hMSCA 10% vs. CM-hMSCA 5% (c); scratch + BSS0 + CM-hMSCA 10% (d), and scratch + BSS0 + CM-hMSCA 15% at 30 h. Error bars indicate SEM. scratch + BSS0 + CM-hMSCA 15% (e). The bar graph shows the Scale bar, 50 μm field [26, 53–55]. One of these models is the scratch assay that work, we used a scratch assay model associated with a meta- has been widely used to assess the effects of brain injury in a bolic dysfunction (glucose deprivation) to address the ability controlled in vitro environment [26, 56, 57]. In the present of astrocytes to migrate and whether glucose deprivation in

Fig. 7 CM-hMSCA preserves the mitochondrial membrane potential CM-hMSCA 10% (d), and scratch + BSS0 + CM-hMSCA 15% (e). The following scratch + BSS0. Upper panel shows representative bar graph shows the values of TMRM fluorescence (f). Four asterisks, photomicrographs of astrocytes exposed to scratch +BSS5(a); scratch p < 0.0001 scratch + BSS0 + CM-hMSCA 5, 10, and 15% vs. scratch + +BSS0(b); scratch + BSS0 + CM-hMSCA 5% (c); scratch +BSS0+ BSS0 at 30 h. Error bars indicate SEM. Scale bar, 50 μm

164 5386 Mol Neurobiol (2018) 55:5377–5392

Fig. 8 CM-hMSCA slightly induced the expression of antioxidant to untreated cells under scratch +BSS0at30h.β-Actin was used as proteins in human astrocytes. Western blot analysis indicated that the loading control. Number sign, p <0.0001scratch +BSS5vs.scratch + expression of GPX1 (a, b) and SOD2 (a–c) was 1.8- and 0.4-fold BSS0 at 30 h. Four asterisks, p <0.0001scratch + BSS0 + CM-hMSCA increase in scratch + BSS0 + CM-hMSCA15%-treated cells compared 15% vs. scratch +BSS0at30h astrocytes might impair mitochondrial functionality and re- of astrocytes during glial activation is still unclear, some mol- generation processes. The mechanical damage suffered during ecules or pathways that may be mediating these changes have TBI and glucose withdrawal due to the interruption of blood been reported. For example, fibroblast growth factor (FGF) flow lead to metabolic alterations and a direct relation with through the β-adrenergic receptors (β-AR) [83], cAMP sig- cell death pathways [58, 59]. Besides, previous works have naling [84–86], the heparin-binding epidermal growth factor- shown that glucose withdrawal may affect wound closure and like growth factor (HB-EGF), which induces EGF receptor contribute to an increase of the secondary lesions in various phosphorylation in Y1068, Mapk/Erk pathway activation, cerebral pathologies [41, 60, 61]. In this context, various com- and the JAK-STAT3 signaling pathway altogether are key pounds such as estrogens [43] and the use of MSCs [62, 63]or factors in astrocyte activation. Canonical signaling in astro- their conditioned medium [64–66] are being evaluated to treat cyte reactivity including overexpression of GFAP [87][88, brain tissue lesions or to decrease glial reactivity. Some studies 89] and a simple subcellular distribution in most cytoskeletal suggest that the use of conditioned medium or extracellular proteins are factors that can participate in the morphological vesicles derived from MSCs may help to counteract neuronal and physiological changes of astrocytes. injury upon a neurodegenerative event [67], decrease It is well known that astrocytes perform important func- microgliosis induced by inflammation in conditions such as tions for the maintenance of tissue structure not only in ner- amyotrophic lateral sclerosis (ALS) [68], and prevent reactive vous developmental stages but also during brain adulthood astrogliosis after ischemic stroke [68–70]. [90]. According to Faber-Elman et al. [91], one of the prob- Astrocytes become reactive upon brain injury or metabolic lems in axonal regeneration is the lack of astrocytes to repop- insult, which is characterized by increased expression of inter- ulate the site of injury in a balanced environment [91–94]. It is mediate filament proteins such as GFAP and vimentin, and widely described that the amniotic fluid-derived conditioned accompanied by prominent morphological changes [48, 71, medium and adipose-derived stem cells significantly enhance 72](Fig.3b–e). Astrocytes respond to lesions by changing wound healing [95] and cell migration [96–98]. Firstly, we their morphology and showing hypertrophy of processes aimed to investigate the percentage of cell migration and [48, 73]; [2]. These changes can last for days or even months wound closure (Fig. 4f, g) and the polarity index (Fig. 5d) in or become generalized in the brain tissue [74]; [75]. In the scratch astrocytes subjected to conditioned medium. Our evi- present study, we evaluated the activation or reactivity of as- dences showed a significant increase in both parameters in trocyte changes in morphology that have been associated to astrocytes that were exposed to scratch + BSS0 + CM 5– brain pathologies [48, 73]; [2]; [75, 76]). In our model, differ- 10–15% compared to scratch + BSS0. The increase in the ences in morphology (Fig. 3b) and cell area (Fig. 3h) were migration of cells treated with scratch + BSS0 + CM 5–10– observed. Morphological alterations were evident in astro- 15% suggests an effect probably related to the production and cytes subjected to scratch +BSS0(Fig.3b–e), with a signif- secretion of molecules such as transforming growth factor β1 icant recovery in cells treated with scratch +BSS0+CM5– (TGF-β1) [95], basic fibroblast growth factor (bFGF) [99, 10–15% (Fig. 3c–f), positively correlating this with recovery 100], epidermal growth factor (EGF) [95], laminin [101], fi- in cell viability [77] and reported in previous studies in our bronectin [56, 101], and some heparan sulfate proteoglycans laboratory [41, 78]. Experimental studies have reported (HSPG) [102–104]. These molecules have been identified in changes in the morphology of astrocytes similar to those ob- the secretome of different MSCs [29, 30, 63, 96, 98, 104, 105] served in our model [79–82] and which are associated with and have been reported as fundamental factors to maintain the glial activation. Although the process of structural remodeling migration of astrocytes and other cells such as fibroblasts [56,

165 Mol Neurobiol (2018) 55:5377–5392 5387

Fig. 9 Proposed model of the effect of CM-hMSCA on the protection of was attenuated by CM-hMSCA at 5–10–15% for 30 h by preserving cell human astrocytes subjected to scratch assay. Scratch assay in association viability, reversing morphological changes, increasing polarity index and with glucose-free conditions leads to cell death, morphological changes, cell migration, decreasing nuclear fragmentation, and conserving Δψm alterations in the removal of ROS that can be correlated with loss of in addition to favoring cellular antioxidant capacity with the expression of Δψm, and DNA fragmentation, thus causing unrepairable cellular SOD2 and GPX1 damage. This damage induced by scratch + BSS0 on human astrocytes

91, 101, 105]. It is possible that the presence of molecules in apoptosis and astrogliosis, thus providing neuroprotection CM-hMSCA involved in cell migration is regulating both the [64, 67]; [65, 66, 69, 70]; [68]. Our findings show a decrease migration and closure of the wound in our model through the in the number of fragmented nuclei (Fig. 6f) suggesting that activation or mediation of different pathways such as ERK1/2 apoptosis linked to energy depletion caused by the absence of [106], Rac1 [107], ERK and JNK signaling pathways [108], glucose was diminished by the effect of CM-hMSCA. The and Rho GTPases [109], or perhaps with the direct action of above finding is probably related to the hypothesis that the TGF-β1 mediated through the activation of CysLT1R present CM-hMSCA contributes to maintaining mitochondrial mem- in astrocytes (X. Q. [110]), and control of cell polarity regu- brane potential (Δψm), which was confirmed through our lated by the Cdc42 integrin [111] or EBI2-mediated cell sig- assays. As observed in Fig. 7f, Δψm was recovered in astro- naling [112]. However, further research on the role of each cytes subjected to scratch + BSS0 and treated with CM5–10– signaling cascade is deserved. 15%. Maintenance of Δψm suggests that CM-hMSCA may Finally, deprived or low-glucose conditions can also induce have a direct effect on mitochondrial function, as suggested by the release of free fatty acids, impair ionic homeostasis, in- our previous studies [39]. This may also be related to the crease intracellular calcium flow, alter mitochondrial metabo- maintenance of ATP levels or the activation of other metabolic lism, and increase the production of free radicals [113, 114]. pathways important for cell recovery. However, these mecha- These changes subsequently lead to DNA and mitochondrial nisms require further investigation in this cell type and model. membrane damage [44, 78]. Several studies have reported that The above discussion suggests that CM-MSCA can over- the CM-hMSC from different sources including adipose tissue come and neutralize the negative effect of scratch assay, act- exerts a protective effect both at the neuronal and astrocytic ing in synergy with other proteins or through the activation of levels, maintaining neural networks, reducing neuronal mechanisms that may promote cell migration and/or survival.

166 5388 Mol Neurobiol (2018) 55:5377–5392

This cellular survival may also be related to the control of 4. Panickar KS, Norenberg MD (2005) Astrocytes in cerebral ische- ROS by means of antioxidant proteins. In this case, we found mic injury: morphological and general considerations. Glia 50(4): 287–298. https://doi.org/10.1002/glia.20181 a slight increase in the expression of antioxidant proteins like 5. Steele ML, Robinson SR (2012) Reactive astrocytes give neurons GPX1 (Fig. 8a, b) and SOD2 (Fig. 8a–c) in cells treated with less support: implications for Alzheimer's disease. [Research scratch + BSS0 + CM15%, as these enzymes are expressed by Support, Non-U.S. Gov't]. Neurobiol Aging 33(2):423 e421- astrocytes that help scavenge the production of ROS 413. https://doi.org/10.1016/j.neurobiolaging.2010.09.018 – 6. Hamby ME, Sofroniew MV (2010) Reactive astrocytes as thera- [115 117]. This result confirms our previous studies per- peutic targets for CNS disorders. [Research Support, N.I.H., formed using T98G cells [39]. However, further research is Extramural Research Support, Non-U.S. Gov't Review]. required to fully evaluate the effect of CM-hMSCA on the Neurotherapeutics 7(4):494–506. https://doi.org/10.1016/j.nurt. activity of these enzymes, as well as other proteins of biolog- 2010.07.003 7. Pekny M, Nilsson M (2005) Astrocyte activation and reactive ical importance such as neuroglobin (Ngb), a protein which gliosis. [Research Support, Non-U.S. Gov't Review]. Glia 50(4): was reported as mediating the protective effect of CM-MSCA 427–434. https://doi.org/10.1002/glia.20207 in the T98G astrocyte model [39]. A summary of the main 8. Sofroniew MV (2009) Molecular dissection of reactive findings found in the present manuscript is displayed in Fig. 9. astrogliosis and glial scar formation. [Research Support, N.I.H., Extramural Research Support, Non-U.S. Gov't Review]. Trends In conclusion, our results demonstrate that CM-hMSCA Neurosci 32(12):638–647. https://doi.org/10.1016/j.tins.2009.08. exerts protective effects on human astrocytes exposed to 002 scratch assay, confirming that the adipose-derived mesenchy- 9. Pekny M, Pekna M, Messing A, Steinhauser C, Lee JM, Parpura mal stem cells may participate in protective actions V et al (2016) Astrocytes: a central element in neurological diseases. [Research Support, N.I.H., Extramural Research Support, of astrocytes and contribute to the maintenance of their Non-U.S. Gov't Review]. Acta Neuropathol 131(3):323–345. neurosupportive functions in different brain pathologies. https://doi.org/10.1007/s00401-015-1513-1 10. Bardehle S, Kruger M, Buggenthin F, Schwausch J, Ninkovic J, Clevers H et al (2013) Live imaging of astrocyte responses to acute injury reveals selective juxtavascular proliferation. [Research Support, Non-U.S. Gov't]. Nat Neurosci 16(5):580– Acknowledgements The authors thank Dr. Camilo Prieto and the staff 586. https://doi.org/10.1038/nn.3371 of the cosmetic surgery in Bogota, Colombia, for the adipose tissue sam- 11. Pekny M, Pekna M (2016) Reactive gliosis in the pathogenesis of ples. This work was supported by PUJ ID 6260 to GEB and scholarship CNS diseases. Biochim Biophys Acta 1862(3):483–491. https:// for doctoral studies awarded by the Vicerrectoría Académica of PUJ to doi.org/10.1016/j.bbadis.2015.11.014 Baez-Jurado E. 12. Sofroniew MV (2005) Reactive astrocytes in neural repair and protection. [Research Support, N.I.H., Extramural Research Abbreviations BSS0, balanced salt solution; bFGF, basic fibroblast Support, Non-U.S. Gov't Research Support, U.S. Gov't, P.H.S. growth factor; CNS, central nervous system; CMhMSCA, conditioned Review]. Neuroscientist (11, 5):400–407. https://doi.org/10. medium of human adipose mesenchymal stem cells; DMSO, dimethyl 1177/1073858405278321 sulfoxide; DMEM, Dulbecco’smodifiedEagle’smedium;EGF,epider- 13. Su J, Wang L (2012) Research advances in neonatal hypoglycemic mal growth factor; FBS, fetal bovine serum; GFAP, glial fibrillary acid brain injury. [Review]. Transl Pediatr 1(2):108–115. https://doi. protein; GPX1, glutathione peroxidase; HB-EGF, heparin-binding epider- org/10.3978/j.issn.2224-4336.2012.04.06 mal growth factor-like growth factor; HSPG, heparan sulfate proteogly- 14. Qiu C, Sigurdsson S, Zhang Q, Jonsdottir MK, Kjartansson O, cans; hMSCA, human mesenchymal stem cells from adipose tissue; Eiriksdottir G et al (2014) Diabetes, markers of brain pathology MSCs, mesenchymal stem cells; mesenchymal stem cells; MTT, 3-(4,5- and cognitive function: the age, gene/environment susceptibility- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Ngb, Reykjavik study. [Research Support, N.I.H., Extramural Research neuroglobin; PBS, phosphate-buffered saline; ROS, reactive oxygen spe- Support, N.I.H., Intramural Research Support, Non-U.S. Gov't]. cies; SOD2, superoxide dismutase 2; TMRM, tetramethylrhodamine Ann Neurol 75(1):138–146. https://doi.org/10.1002/ana.24063 methyl ester; TGFbeta 1, transforming growth factor beta 1; TBI,trau- 15. Langlois JA, Rutland-Brown W, Wald MM (2006) The epidemi- matic brain injury ology and impact of traumatic brain injury: a brief overview. J Head Trauma Rehabil 21(5):375–378 References 16. Mathers CD, Loncar D (2006) Projections of global mortality and burden of disease from 2002 to 2030. [Research Support, Non- U.S. Gov't]. PLoS Med 3(11):e442. https://doi.org/10.1371/ 1. Barreto G, White RE, Ouyang Y, Xu L, Giffard RG (2011) journal.pmed.0030442 Astrocytes: targets for neuroprotection in stroke. [Research 17. Tagliaferri F, Compagnone C, Korsic M, Servadei F, Kraus J Support, N.I.H., Extramural Review]. Cent Nerv Syst Agents (2006) A systematic review of brain injury epidemiology in Med Chem 11(2):164–173 Europe. [Research Support, Non-U.S. Gov't Review]. Acta 2. Sun D, Jakobs TC (2012) Structural remodeling of astrocytes in Neurochir (Wien) 148(3):255–268; discussion 268. https://doi. the injured CNS. [Research Support, N.I.H., Extramural Research org/10.1007/s00701-005-0651-y Support, Non-U.S. Gov'tReview]. Neuroscientist 18(6):567–588. 18. Prins M, Greco T, Alexander D, Giza CC (2013) The pathophys- https://doi.org/10.1177/1073858411423441 iology of traumatic brain injury at a glance. [Research Support, 3. Myer DJ, Gurkoff GG, Lee SM, Hovda DA, Sofroniew MV N.I.H., Extramural Research Support, Non-U.S. Gov't]. Dis (2006) Essential protective roles of reactive astrocytes in traumatic Model Mech 6(6):1307–1315. https://doi.org/10.1242/dmm. brain injury. [Comparative Study Research Support, N.I.H., 011585 Extramural Research Support, Non-U.S. Gov't]. Brain 129(Pt 19. Seaquist ER (2015) The impact of diabetes on cerebral structure 10):2761–2772. https://doi.org/10.1093/brain/awl165 and function. [Research Support, N.I.H., Extramural Review].

167 Mol Neurobiol (2018) 55:5377–5392 5389

Psychosom Med 77(6):616–621. https://doi.org/10.1097/PSY. Cytotherapy 15(4):434–448. https://doi.org/10.1016/j.jcyt.2012. 0000000000000207 11.015 20. Stiles MC, Seaquist ER (2010) Cerebral structural and functional 36. Mytych J, Lewinska A, Zebrowski J, Wnuk M (2015) Gold nano- changes in type 1 diabetes. [Review]. Minerva Med 101(2):105–114 particles promote oxidant-mediated activation of NF-kappaB and 21. Dennis EL, Faskowitz J, Rashid F, Babikian T, Mink R, Babbitt C 53BP1 recruitment-based adaptive response in human astrocytes. et al (2017) Diverging volumetric trajectories following pediatric Biomed Res Int 2015:304575. https://doi.org/10.1155/2015/ traumatic brain injury. Neuroimage Clin 15:125–135. https://doi. 304575 org/10.1016/j.nicl.2017.03.014 37. Zhang L, Wang H, Ding K, Xu J (2015a) FTY720 induces 22. Meadows EA, Owen Yeates K, Rubin KH, Taylor HG, Bigler ED, autophagy-related apoptosis and necroptosis in human glioblasto- Dennis M et al (2017) Rejection sensitivity as a moderator of ma cells. Toxicol Lett 236(1):43–59. https://doi.org/10.1016/j. psychosocial outcomes following pediatric traumatic brain injury. toxlet.2015.04.015 J Int Neuropsychol Soc:1–9. https://doi.org/10.1017/ 38. Zhang L, Yin JC, Yeh H, Ma NX, Lee G, Chen XA et al (2015b) S1355617717000352 Small molecules efficiently reprogram human astroglial cells into 23. Calviello LA, Donnelly J, Zeiler FA, Thelin EP, Smielewski P, functional neurons. Cell Stem Cell 17(6):735–747. https://doi.org/ Czosnyka M (2017) Cerebral autoregulation monitoring in acute 10.1016/j.stem.2015.09.012 ’ traumatic brain injury: what s the evidence? Minerva Anestesiol. 39. Baez-Jurado E, Vega GG, Aliev G, Tarasov VV, Esquinas P, 10.23736/S0375-9393.17.12043-2 Echeverria V, Barreto GE (2017) Blockade of neuroglobin reduces 24. Yasen AL, Howell DR, Chou LS, Pazzaglia AM, Christie AD protection of conditioned medium from human mesenchymal stem (2017a) Cortical and physical function after mild traumatic brain cells in human astrocyte model (T98G) under a scratch assay. Mol – injury. Med Sci Sports Exerc 49(6):1066 1071. https://doi.org/10. Neurobiol. https://doi.org/10.1007/s12035-017-0481-y 1249/MSS.0000000000001217 40. Bourguignon LY, Gilad E, Peyrollier K, Brightman A, Swanson 25. Yasen AL, Howell DR, Chou LS, Pazzaglia AM, Christie AD RA (2007) Hyaluronan-CD44 interaction stimulates Rac1 signal- (2017b) Cortical and physical function following mild traumatic ing and PKN gamma kinase activation leading to cytoskeleton brain injury. Med Sci Sports Exerc. https://doi.org/10.1249/MSS. function and cell migration in astrocytes. J Neurochem 101(4): 0000000000001217 1002–1017. https://doi.org/10.1111/j.1471-4159.2007.04485.x 26. Janowitz T, Menon DK (2010) Exploring new routes for neuro- 41. Torrente D, Avila MF, Cabezas R, Morales L, Gonzalez J, protective drug development in traumatic brain injury. [Research Samudio I, Barreto GE (2014) Paracrine factors of human mesen- Support, Non-U.S. Gov't]. Sci Transl Med 2(27):27rv21. https:// chymal stem cells increase wound closure and reduce reactive doi.org/10.1126/scitranslmed.3000330 oxygen species production in a traumatic brain injury in vitro 27. Burda JE, Bernstein AM, Sofroniew MV (2016) Astrocyte roles in model. Hum Exp Toxicol 33(7):673–684. https://doi.org/10. traumatic brain injury. [Research Support, N.I.H., Extramural 1177/0960327113509659 Research Support, Non-U.S. gov't Review]. Exp Neurol 275(Pt 42. Loov C, Shevchenko G, Geeyarpuram Nadadhur A, Clausen F, 3):305–315. https://doi.org/10.1016/j.expneurol.2015.03.020 Hillered L, Wetterhall M, Erlandsson A (2013) Identification of 28. Karve IP, Taylor JM, Crack PJ (2016) The contribution of astro- injury specific proteins in a cell culture model of traumatic brain cytes and microglia to traumatic brain injury. [Review]. Br J injury. [Research Support, Non-U.S. Gov't]. PLoS One 8(2): Pharmacol 173(4):692–702. https://doi.org/10.1111/bph.13125 e55983. https://doi.org/10.1371/journal.pone.0055983 29. Salgado, A. J., Sousa, J. C., Costa, B. M., Pires, A. O., Mateus- 43. Avila-Rodriguez M, Garcia-Segura LM, Hidalgo-Lanussa O, Pinheiro, A., Teixeira, F., . . . Sousa, N. (2015). Mesenchymal Baez E, Gonzalez J, Barreto GE (2016) Tibolone protects astro- stem cells secretome as a modulator of the neurogenic niche: basic cytic cells from glucose deprivation through a mechanism involv- insights and therapeutic opportunities. Front Cell Neurosci, 9 ing estrogen receptor beta and the upregulation of neuroglobin 30. Teixeira FG, Carvalho MM, Sousa N, Salgado AJ (2013) expression. Mol Cell Endocrinol 433:35–46. https://doi.org/10. Mesenchymal stem cells secretome: a new paradigm for central 1016/j.mce.2016.05.024 nervous system regeneration? [Research Support, Non-U.S. Gov't Review]. Cell Mol Life Sci 70(20):3871–3882. https://doi.org/10. 44. Avila Rodriguez M, Garcia-Segura LM, Cabezas R, Torrente D, 1007/s00018-013-1290-8 Capani F, Gonzalez J, Barreto GE (2014) Tibolone protects T98G 31. Yamazaki H, Jin Y, Tsuchiya A, Kanno T, Nishizaki T (2015) cells from glucose deprivation. [Research Support, Non-U.S. – Adipose-derived stem cell-conditioned medium ameliorates Gov't]. J Steroid Biochem Mol Biol 144(Pt B):294 303. https:// antidepression-related behaviors in the mouse model of doi.org/10.1016/j.jsbmb.2014.07.009 Alzheimer's disease. Neurosci Lett 609:53–57. https://doi.org/10. 45. Ouyang YB, Xu LJ, Emery JF, Lee AS, Giffard RG (2011) 1016/j.neulet.2015.10.023 Overexpressing GRP78 influences Ca2+ handling and function 32. Cho YJ, Song HS, Bhang S, Lee S, Kang BG, Lee JC et al (2012) of mitochondria in astrocytes after ischemia-like stress. – Therapeutic effects of human adipose stem cell-conditioned me- Mitochondrion 11(2):279 286. https://doi.org/10.1016/j.mito. dium on stroke. [Research Support, Non-U.S. Gov't]. J Neurosci 2010.10.007 Res 90(9):1794–1802. https://doi.org/10.1002/jnr.23063 46. Lamers ML, Almeida ME, Vicente-Manzanares M, Horwitz AF, 33. Egashira Y, Sugitani S, Suzuki Y, Mishiro K, Tsuruma K, Santos MF (2011) High glucose-mediated oxidative stress impairs Shimazawa M et al (2012) The conditioned medium of murine cell migration. PLoS One 6(8):e22865 and human adipose-derived stem cells exerts neuroprotective ef- 47. Paquet M, Kuwajima M, Yun CC, Smith Y, Hall RA (2006) fects against experimental stroke model. Brain Res 1461:87–95. Astrocytic and neuronal localization of the scaffold protein Na+/ https://doi.org/10.1016/j.brainres.2012.04.033 H+ exchanger regulatory factor 2 (NHERF-2) in mouse brain. J 34. Wei X, Zhao L, Zhong J, Gu H, Feng D, Johnstone BH et al (2009) Comp Neurol 494(5):752–762. https://doi.org/10.1002/cne.20854 Adipose stromal cells-secreted neuroprotective media against neu- 48. Barreto GE, White RE, Xu L, Palm CJ, Giffard RG (2012) Effects ronal apoptosis. Neurosci Lett 462(1):76–79. https://doi.org/10. of heat shock protein 72 (Hsp72) on evolution of astrocyte activa- 1016/j.neulet.2009.06.054 tion following stroke in the mouse. Exp Neurol 238(2):284–296. 35. Zhou Z, Chen Y, Zhang H, Min S, Yu B, He B, Jin A (2013) https://doi.org/10.1016/j.expneurol.2012.08.015 Comparison of mesenchymal stromal cells from human bone mar- 49. Gralinski LE, Bankhead A 3rd, Jeng S, Menachery VD, Proll S, row and adipose tissue for the treatment of spinal cord injury. Belisle SE et al (2013) Mechanisms of severe acute respiratory

168 5390 Mol Neurobiol (2018) 55:5377–5392

syndrome coronavirus-induced acute lung injury. MBio 4(4). injury. Int J Neurosci:1–39. https://doi.org/10.1080/00207454. https://doi.org/10.1128/mBio.00271-13 2017.1325884 50. Aye, T., Reiss, A. L., Kesler, S., Hoang, S., Drobny, J., Park, Y.,. . . 64. Hoch AI, Binder BY, Genetos DC, Leach JK (2012) Buckingham, B. A. (2011). The feasibility of detecting Differentiation-dependent secretion of proangiogenic factors by neuropsychologic and neuroanatomic effects of type 1 diabetes mesenchymal stem cells. [Research Support, N.I.H., Extramural in young children. [Research Support, N.I.H., extramural Research Support, Non-U.S. Gov't]. PLoS One 7(4):e35579. Research Support, Non-U.S. Gov't]. Diabetes Care, 34(7), 1458– https://doi.org/10.1371/journal.pone.0035579 1462. doi: https://doi.org/10.2337/dc10-2164 65. Jain A, McKeon RJ, Brady-Kalnay SM, Bellamkonda RV (2011) 51. Hershey T, Perantie DC, Warren SL, Zimmerman EC, Sadler M, Sustained delivery of activated Rho GTPases and BDNF promotes White NH (2005) Frequency and timing of severe hypoglycemia axon growth in CSPG-rich regions following spinal cord injury. affects spatial memory in children with type 1 diabetes. [Research [Research Support, N.I.H., Extramural Research Support, U.S. Support, N.I.H., Extramural Research Support, Non-U.S. Gov't Gov't, Non-P.H.S.] PLoS One 6(1):e16135. https://doi.org/10. Research Support, U.S. Gov't, P.H.S.] Diabetes Care 28(10): 1371/journal.pone.0016135 2372–2377 66. Pawitan JA (2014) Prospect of stem cell conditioned medium in 52. Pirici D, Mogoanta L, Margaritescu O, Pirici I, Tudorica V, regenerative medicine. [Research Support, Non-U.S. Gov't]. Coconu M (2009) Fractal analysis of astrocytes in stroke and Biomed Res Int 2014:965849. https://doi.org/10.1155/2014/ dementia. Romanian J Morphol Embryol 50(3):381–390 965849 53. DeRidder MN, Simon MJ, Siman R, Auberson YP, Raghupathi R, 67. Baglio SR, Pegtel DM, Baldini N (2012) Mesenchymal stem cell Meaney DF (2006) Traumatic mechanical injury to the hippocam- secreted vesicles provide novel opportunities in (stem) cell-free pus in vitro causes regional caspase-3 and calpain activation that is therapy. Front Physiol 3:359. https://doi.org/10.3389/fphys.2012. influenced by NMDA receptor subunit composition. [Research 00359 Support, N.I.H., Extramural]. Neurobiol Dis 22(1):165–176. 68. Sun H, Benardais K, Stanslowsky N, Thau-Habermann N, Hensel https://doi.org/10.1016/j.nbd.2005.10.011 N, Huang D et al (2013) Therapeutic potential of mesenchymal 54. Marklund N, Hillered L (2011) Animal modelling of traumatic stromal cells and MSC conditioned medium in amyotrophic lateral brain injury in preclinical drug development: where do we go from sclerosis (ALS)—in vitro evidence from primary motor neuron here? [Research Support, Non-U.S. Gov't Review]. Br J cultures, NSC-34 cells, astrocytes and microglia. [Research Pharmacol 164(4):1207–1229. https://doi.org/10.1111/j.1476- Support, Non-U.S. Gov't]. PLoS One 8(9):e72926. https://doi. 5381.2010.01163.x org/10.1371/journal.pone.0072926 55. Morrison B 3rd, Saatman KE, Meaney DF, McIntosh TK (1998) 69. Huang W, Lv B, Zeng H, Shi D, Liu Y, Chen F et al (2015) In vitro central nervous system models of mechanically induced Paracrine factors secreted by MSCs promote astrocyte survival trauma: a review. [Research Support, Non-U.S. Gov't Research associated with GFAP downregulation after ischemic stroke via Support, U.S. Gov't, Non-P.H.S. Research Support, U.S. Gov't, p38 MAPK and JNK. [Research Support, Non-U.S. Gov't]. J Cell P.H.S. Review]. J Neurotrauma 15(11):911–928. https://doi.org/ Physiol 230(10):2461–2475. https://doi.org/10.1002/jcp.24981 10.1089/neu.1998.15.911 70. Song M, Jue SS, Cho YA, Kim EC (2015) Comparison of the 56. Johnson KM, Milner R, Crocker SJ (2015) Extracellular matrix effects of human dental pulp stem cells and human bone composition determines astrocyte responses to mechanical and marrow-derived mesenchymal stem cells on ischemic human as- inflammatory stimuli. [Research Support, N.I.H., Extramural trocytes in vitro. [Research Support, Non-U.S. Gov't]. J Neurosci Research Support, Non-U.S. Gov't]. Neurosci Lett 600:104–109. Res 93(6):973–983. https://doi.org/10.1002/jnr.23569 https://doi.org/10.1016/j.neulet.2015.06.013 71. Holtje M, Hoffmann A, Hofmann F, Mucke C, Grosse G, Van 57. Loov C, Hillered L, Ebendal T, Erlandsson A (2012) Engulfing Rooijen N et al (2005) Role of Rho GTPase in astrocyte morphol- astrocytes protect neurons from contact-induced apoptosis follow- ogy and migratory response during in vitro wound healing. ing injury. [Research Support, Non-U.S. Gov't]. PLoS One 7(3): [Comparative Study Research Support, Non-U.S. Gov't]. J e33090. https://doi.org/10.1371/journal.pone.0033090 Neurochem 95(5):1237–1248. https://doi.org/10.1111/j.1471- 58. Brown JI, Moulton RJ, Konasiewicz SJ, Baker AJ (1998) Cerebral 4159.2005.03443.x oxidative metabolism and evoked potential deterioration after se- 72. Robel S, Bardehle S, Lepier A, Brakebusch C, Gotz M (2011) vere brain injury: new evidence of early posttraumatic ischemia. Genetic deletion of cdc42 reveals a crucial role for astrocyte re- [Research Support, Non-U.S. Gov't]. Neurosurgery 42(5):1057– cruitment to the injury site in vitro and in vivo. [Research Support, 1063 discussion 1063-1054 Non-U.S. Gov't Video-Audio Media]. J Neurosci 31(35):12471– 59. Honda M, Ichibayashi R, Yokomuro H, Yoshihara K, Masuda H, 12482. https://doi.org/10.1523/JNEUROSCI.2696-11.2011 Haga D et al (2016) Early cerebral circulation disturbance in pa- 73. Ding S (2014) Dynamic reactive astrocytes after focal ischemia. tients suffering from severe traumatic brain injury (TBI): a xenon Neural Regen Res 9(23):2048–2052. https://doi.org/10.4103/ CT and perfusion CT study. Neurol Med Chir (Tokyo) 56(8):501– 1673-5374.147929 509. https://doi.org/10.2176/nmc.oa.2015-0341 74. Oberheim NA, Tian GF, Han X, Peng W, Takano T, Ransom B, 60. Bergsneider M, Hovda DA, Shalmon E, Kelly DF, Vespa PM, Nedergaard M (2008) Loss of astrocytic domain organization in Martin NA et al (1997) Cerebral hyperglycolysis following severe the epileptic brain. J Neurosci 28(13):3264–3276. https://doi.org/ traumatic brain injury in humans: a positron emission tomography 10.1523/JNEUROSCI.4980-07.2008 study. J Neurosurg 86(2):241–251 75. Sun D, Lye-Barthel M, Masland RH, Jakobs TC (2010) Structural 61. Lauffenburger DA, Horwitz AF (1996) Cell migration: a physi- remodeling of fibrous astrocytes after axonal injury. J Neurosci cally integrated molecular process. Cell 84(3):359–369 30(42):14008–14019. https://doi.org/10.1523/JNEUROSCI. 62. Duncan T, Valenzuela M (2017) Alzheimer's disease, dementia, 3605-10.2010 and stem cell therapy. [Review]. Stem Cell Res Ther 8(1):111. 76. Wilhelmsson U, Li L, Pekna M, Berthold CH, Blom S, Eliasson C https://doi.org/10.1186/s13287-017-0567-5 et al (2004) Absence of glial fibrillary acidic protein and vimentin 63. Xu C, Fu F, Li X, Zhang S (2017) Mesenchymal stem cells main- prevents hypertrophy of astrocytic processes and improves post- tain the microenvironment of central nervous system by regulating traumatic regeneration. J Neurosci 24(21):5016–5021. https://doi. the polarization of macrophages/microglia after traumatic brain org/10.1523/JNEUROSCI.0820-04.2004

169 Mol Neurobiol (2018) 55:5377–5392 5391

77. Xiong, J., Dai, W., Chen, L., Liu, G., Liu, M., Zhang, Z., & Xiao, 91. Faber-Elman A, Lavie V, Schvartz I, Shaltiel S, Schwartz M H. (2006). New method for studying the relationship between (1995) Vitronectin overrides a negative effect of TNF-alpha on morphological parameters and cell viability. astrocyte migration. FASEB J 9(15):1605–1613 78. Baez E, Guio-Vega GP, Echeverria V, Sandoval-Rueda DA, 92. Jacobsen CT, Miller RH (2003) Control of astrocyte migration in Barreto GE (2017) 4′-Chlorodiazepam protects mitochondria in the developing cerebral cortex. Dev Neurosci 25(2-4):207–216 T98G astrocyte cell line from glucose deprivation. Neurotox Res. 93. Rolls A, Shechter R, Schwartz M (2009) The bright side of the https://doi.org/10.1007/s12640-017-9733-x glial scar in CNS repair. Nat Rev Neurosci 10(3):235–241. https:// 79. Cano V, Valladolid-Acebes I, Hernandez-Nuno F, Merino B, Del doi.org/10.1038/nrn2591 Olmo N, Chowen JA, Ruiz-Gayo M (2014) Morphological chang- 94. Zamanian JL, Xu L, Foo LC, Nouri N, Zhou L, Giffard RG, es in glial fibrillary acidic protein immunopositive astrocytes in Barres BA (2012) Genomic analysis of reactive astrogliosis. the hippocampus of dietary-induced obese mice. Neuroreport. [Research Support, N.I.H., Extramural Research Support, Non- https://doi.org/10.1097/WNR.0000000000000180 U.S. Gov't]. J Neurosci 32(18):6391–6410. https://doi.org/10. 80. Gzielo K, Kielbinski M, Ploszaj J, Janeczko K, Gazdzinski SP, 1523/JNEUROSCI.6221-11.2012 Setkowicz Z (2017) Long-term consumption of high-fat diet in 95. Yoon BS, Moon JH, Jun EK, Kim J, Maeng I, Kim JS et al (2010) rats: effects on microglial and astrocytic morphology and neuronal Secretory profiles and wound healing effects of human amniotic nitric oxide synthase expression. Cell Mol Neurobiol 37(5):783– fluid-derived mesenchymal stem cells. [Research Support, Non- 789. https://doi.org/10.1007/s10571-016-0417-5 U.S. Gov't]. Stem Cells Dev 19(6):887–902. https://doi.org/10. 81. Kane CJ, Phelan KD, Douglas JC, Wagoner G, Johnson JW, Xu J 1089/scd.2009.0138 et al (2014) Effects of ethanol on immune response in the brain: 96. Chen J, Li Y, Hao H, Li C, Du Y, Hu Y et al (2015) Mesenchymal region-specific changes in adolescent versus adult mice. [Research stem cell conditioned medium promotes proliferation and migra- Support, N.I.H., Extramural]. Alcohol Clin Exp Res 38(2):384– tion of alveolar epithelial cells under septic conditions in vitro via 391. https://doi.org/10.1111/acer.12244 the JNK-P38 signaling pathway. Cell Physiol Biochem 37(5): – 82. Saur L, Baptista PP,de Senna PN, Paim MF, do Nascimento P, Ilha 1830 1846. https://doi.org/10.1159/000438545 J et al (2014) Physical exercise increases GFAP expression and 97. Frese L, Dijkman PE, Hoerstrup SP (2016) Adipose tissue-derived induces morphological changes in hippocampal astrocytes. stem cells in regenerative medicine. Transfus Med Hemother – [Research Support, Non-U.S. Gov't]. Brain Struct Funct 219(1): 43(4):268 274. https://doi.org/10.1159/000448180 293–302. https://doi.org/10.1007/s00429-012-0500-8 98. ShenC,LieP,MiaoT,YuM,LuQ,FengTetal(2015) Conditioned medium from umbilical cord mesenchymal stem 83. Vardjan N, Kreft M, Zorec R (2014) Dynamics of beta-adrenergic/ cells induces migration and angiogenesis. Mol Med Rep 12(1): cAMP signaling and morphological changes in cultured astro- 20–30. https://doi.org/10.3892/mmr.2015.3409 cytes. [Research Support, Non-U.S. Gov't]. Glia 62(4):566–579. 99. Kilroy GE, Foster SJ, Wu X, Ruiz J, Sherwood S, Heifetz A et al https://doi.org/10.1002/glia.22626 (2007) Cytokine profile of human adipose-derived stem cells: ex- 84. Fedoroff S, McAuley WA, Houle JD, Devon RM (1984) pression of angiogenic, hematopoietic, and pro-inflammatory fac- Astrocyte cell lineage. V. Similarity of astrocytes that form in tors. [Research Support, N.I.H., Extramural Research Support, the presence of dBcAMP in cultures to reactive astrocytes Non-U.S. Gov't]. J Cell Physiol 212(3):702–709. https://doi.org/ in vivo. [Comparative Study Research Support, Non-U.S. 10.1002/jcp.21068 Gov't]. J Neurosci Res 12(1):14–27. https://doi.org/10.1002/jnr. 100. Linero I, Chaparro O (2014) Paracrine effect of mesenchymal 490120103 stem cells derived from human adipose tissue in bone regenera- 85. Paco S, Hummel M, Pla V, Sumoy L, Aguado F (2016) Cyclic tion. [Research Support, Non-U.S. Gov't]. PLoS One 9(9): AMP signaling restricts activation and promotes maturation and e107001. https://doi.org/10.1371/journal.pone.0107001 antioxidant defenses in astrocytes. [Research Support, Non-U.S. 101. Fok-Seang J, Smith-Thomas LC, Meiners S, Muir E, Du JS, Gov't]. BMC Genomics 17:304. https://doi.org/10.1186/s12864- Housden E et al (1995) An analysis of astrocytic cell lines with 016-2623-4 different abilities to promote axon growth. [Comparative Study 86. Tiryaki VM, Ayres VM, Ahmed I, Shreiber DI (2015) Research Support, Non-U.S. Gov't]. Brain Res 689(2):207–223 Differentiation of reactive-like astrocytes cultured on nanofibrillar 102. Beller JA, Snow DM (2014) Proteoglycans: road signs for neurite and comparative culture surfaces. [Research Support, American outgrowth. Neural Regen Res 9(4):343–355. https://doi.org/10. Recovery and Reinvestment Act Research Support, N.I.H., 4103/1673-5374.128235 Extramural Research Support, Non-U.S. Gov't Research 103. Bovolenta P, Fernaud-Espinosa I (2000) Nervous system proteo- Support, U.S. Gov't, Non-P.H.S.] Nanomedicine (Lond) 10(4): glycans as modulators of neurite outgrowth. Prog Neurobiol – 529 545. https://doi.org/10.2217/nnm.14.33 61(2):113–132 87. Kang W, Hebert JM (2011) Signaling pathways in reactive astro- 104. Walter MN, Kohli N, Khan N, Major T, Fuller H, Wright KT et al cytes, a genetic perspective. [Review]. Mol Neurobiol 43(3):147– (2015) Human mesenchymal stem cells stimulate EaHy926 endo- 154. https://doi.org/10.1007/s12035-011-8163-7 thelial cell migration: combined proteomic and in vitro analysis of 88. Eng LF, Ghirnikar RS, Lee YL (2000) Glial fibrillary acidic pro- the influence of donor-donor variability. J Stem Cells Regen Med tein: GFAP-thirty-one years (1969-2000). [Historical Article 11(1):18–24 Research Support, U.S. Gov't, Non-P.H.S. Research Support, 105. Lee DE, Ayoub N, Agrawal DK (2016) Mesenchymal stem cells U.S. Gov't, P.H.S. Review]. Neurochem Res 25(9–10):1439–1451 and cutaneous wound healing: novel methods to increase cell de- 89. Placone AL, McGuiggan PM, Bergles DE, Guerrero-Cazares H, livery and therapeutic efficacy. [Research Support, N.I.H., Quinones-Hinojosa A, Searson PC (2015) Human astrocytes de- Extramural Review]. Stem Cell Res Ther 7:37. https://doi.org/ velop physiological morphology and remain quiescent in a novel 10.1186/s13287-016-0303-6 3D matrix. [Research Support, N.I.H., Extramural]. Biomaterials 106. Li Z, Fang ZY, Xiong L, Huang XL (2010) Spinal cord injury- 42:134–143. https://doi.org/10.1016/j.biomaterials.2014.11.046 induced astrocyte migration and glial scar formation: effects of 90. Bozoyan L, Khlghatyan J, Saghatelyan A (2012) Astrocytes con- magnetic stimulation frequency. [Research Support, Non-U.S. trol the development of the migration-promoting vasculature scaf- Gov't]. Indian J Biochem Biophys 47(6):359–363 fold in the postnatal brain via VEGF signaling. J Neurosci 32(5): 107. Ishii T, Ueyama T, Shigyo M, Kohta M, Kondoh T, Kuboyama T 1687–1704. https://doi.org/10.1523/JNEUROSCI.5531-11.2012 et al (2017) A novel Rac1-GSPT1 signaling pathway controls

170 5392 Mol Neurobiol (2018) 55:5377–5392

astrogliosis following central nervous system injury. J Biol Chem 113. Dixon KJ (2017) Pathophysiology of traumatic brain injury. 292(4):1240–1250. https://doi.org/10.1074/jbc.M116.748871 [Review]. Phys Med Rehabil Clin N Am 28(2):215–225. https:// 108. Zeng Z, Leng T, Feng X, Sun H, Inoue K, Zhu L, Xiong ZG doi.org/10.1016/j.pmr.2016.12.001 (2015) Silencing TRPM7 in mouse cortical astrocytes impairs cell 114. Werner C, Engelhard K (2007) Pathophysiology of traumatic brain proliferation and migration via ERK and JNK signaling pathways. injury. [Review]. Br J Anaesth 99(1):4–9. https://doi.org/10.1093/ [Research support, N.I.H., extramural Research Support, Non- bja/aem131 U.S. Gov't]. PLoS One 10(3):e0119912. https://doi.org/10.1371/ 115. Fernandez-Fernandez S, Almeida A, Bolanos JP (2012) journal.pone.0119912 Antioxidant and bioenergetic coupling between neurons and as- 109. Raftopoulou M, Hall A (2004) Cell migration: Rho GTPases lead trocytes. [Research Support, Non-U.S. Gov't Review]. Biochem J the way. Dev Biol 265(1):23–32 443(1):3–11. https://doi.org/10.1042/BJ20111943 110. Huang XQ, Zhang XY, Wang XR, Yu SY, Fang SH, Lu YB et al 116. Kim WS, Park BS, Kim HK, Park JS, Kim KJ, Choi JS et al (2008) (2012) Transforming growth factor beta1-induced astrocyte mi- Evidence supporting antioxidant action of adipose-derived stem gration is mediated in part by activating 5-lipoxygenase and cells: protection of human dermal fibroblasts from oxidative stress. cysteinyl leukotriene receptor 1. J Neuroinflammation 9:145. [Research Support, Non-U.S. Gov't]. J Dermatol Sci 49(2):133– https://doi.org/10.1186/1742-2094-9-145 142. https://doi.org/10.1016/j.jdermsci.2007.08.004 111. Farhan H, Hsu VW (2016) Cdc42 and cellular polarity: emerging 117. Yalvac ME, Yarat A, Mercan D, Rizvanov AA, Palotas A, Sahin F roles at the golgi. [Research Support, N.I.H., Extramural Research – (2013) Characterization of the secretome of human tooth germ Support, Non-U.S. Gov't Review]. Trends Cell Biol 26(4):241 stem cells (hTGSCs) reveals neuro-protection by fine-tuning mi- 248. https://doi.org/10.1016/j.tcb.2015.11.003 cro-environment. [Research Support, Non-U.S. Gov't]. Brain 112. Rutkowska A, Preuss I, Gessier F, Sailer AW, Dev KK (2015) Behav Immun 32:122–130. https://doi.org/10.1016/j.bbi.2013. EBI2 regulates intracellular signaling and migration in human as- 03.007 trocyte. [Research Support, Non-U.S. Gov't]. Glia 63(2):341–351. https://doi.org/10.1002/glia.22757

171 Discusión General

Las patologías como la isquemia y la lesión cerebral traumática se caracterizan por presentar una perdida de nutrientes y gases disueltos (Vavilis et al., 2015). La glucosa es el principal sustrato energético y su regulación proporciona un ambiente fisiológico para el funcionamiento cerebral (Dienel, 2012; Ivannikov et al., 2010). Por lo tanto, alteraciones en los niveles de glucosa contribuyen con el deterioro y la muerte celular, debido principalmente al agotamiento energético y al aumento del estrés oxidativo (Gerónimo-Olvera et al., 2017; Mavroeidi et al., 2017). Otros estudios demostraron una asociación positiva entre el deterioro de la función cerebral y cambios en el componente inflamatorio que se presenta en la mayoría de patologías cerebrales (Kokiko-Cochran & Godbout, 2018; Stephenson, Nutma, van der Valk, & Amor, 2018). Estas alteraciones junto con la afectación de múltiples células del tejido cerebral y vías de señalización celular hacen que la fisiopatología, especialmente en la lesión cerebral traumática (LCT), sea dinámica, compleja y conlleve a un deterioro cognitivo y motor, que a futuro está relacionado con procesos neurodegenerativos (Prins et al., 2013a). Además, la complejidad de la patología ha dificultado el descubrimiento de tratamientos efectivos y oportunos.

En los últimos años, se han implementado varios modelos tanto in vivo como in vitro para el estudio de la LCT (Janowitz & Menon, 2010; Marklund & Hillered, 2011). Uno de estos modelos es el ensayo de scratch, que ha sido usado para evaluar los efectos de la lesión en un entorno in vitro controlado (Johnson et al., 2015; Marklund & Hillered, 2011). Previas investigaciones en nuestro grupo han evidenciado que el scratch y la privación de glucosa disminuyen la viabilidad celular, aumentan la producción de ERO, afectan el cierre de la herida y causan cambios morfológicos en el modelo astrocitario (T98G) (Torrente et al., 2014). Así que con el desarrollo de este trabajo no sólo se confirmaron los hallazgos anteriores, sino también se encontró que este modelo de scratch+BSS0 aumenta la fragmentación nuclear (Figura 1-Capítulo 1; Figura 6-Capítulo 3), afecta las funciones mitocondriales (Figura 1-2-Capítulo 1; Figura 7-Capítulo 3), la ultraestructura celular (Figura 5-Capítulo 1), regula la liberación de citoquinas (Figura 1-Capítulo 2) y aumenta el Ca2+ a nivel citoplasmático (Figura 2-Capítulo 2). Estos resultados fueron acompañados por

172 una desregulación de la dinámica mitocondrial y los genes (opa1, mnf1 y mnf2, fis1, Drp1) (Figura 4-Capítulo 2), así como la disminución en la expresión y fosforilación de AKT y ERK1/2 (Figura 3-Capítulo 2) o de proteínas antioxidantes como SOD, Catalasa y GPX-1 en células expuestas a scratch+BSS0 (Figura 3-Capítulo 1; Figura 8-Capítulo 3).

Por otra parte, el secretoma de las células madre mesenquimales (MSC) se ha postulado ampliamente como una de las posibles alternativas terapéuticas para el tratamiento de las patologías cerebrales (Hoch, Binder, Genetos, & Leach, 2012; Pawitan, 2014). Sin embargo, aún no es claro el efecto de los factores tróficos y moléculas bioactivas que hacen parte de este secretoma sobre las células gliales como los astrocitos. Por tal razón, uno de los principales objetivos del presente estudio fue determinar el efecto del CM-hMSCA en un modelo astrocítico humano (T98G) y en astrocitos humanos primarios, sujetos a scratch y privación de glucosa (scratch+BSS0) (Baez, Guio-Vega, Echeverria, Sandoval-Rueda, & Barreto, 2017; Toro-Urrego, Garcia-Segura, Echeverria, & Barreto, 2016). Aún cuando el modelo astrocitario (T98G) presentó grandes afectaciones a nivel celular cuando se expuso a scratch+BSS0, nosotros observamos que el tratamiento con un 2% de concentración de medio condicionado de células madre derivadas de tejido adiposo humano (CM-hMSCA) aumenta la protección y recuperación a nivel celular. Nuestros datos están de acuerdo con informes anteriores que muestran una neuroprotección en un rango de 0,25 a 5% de CM en un modelo de isquemia (Scheibe, Klein, Klose, & Priller, 2012), aunque otros estudios han requerido mayores concentraciones de CM-hMSC entre 20, 30 o 50% para encontrar un efecto protector en diferentes modelos de patologías cerebrales (Cantinieaux et al., 2013; Hao et al., 2014; Song et al., 2015).

En un primer momento, nosotros confirmamos el efecto del 2% CM-hMSCA sobre la viabilidad celular con una recuperación cercana al 81,15% en la fragmentación nuclear (Figura 1-Capítulo 1) que demuestra un efecto del CM-hMSCA sobre la supervivencia de celular. Además, teniendo en cuenta que la viabilidad celular está relacionada directamente con la función mitocondrial, al evaluar parámetros mitocondriales sorprendentemente encontramos que el 2% CM-hMSCA recupera casi en un 100% el Δψm y en un 63% el estado no oxidado de la cardiolipina (Figura 1- Capítulo 1), manteniendo de esta forma los

173 parámetros mitocondriales estables, como ha sido reportado (Stetler, Leak, Gao, & Chen, 2013). Sin embargo, el efecto protector en los anteriores parámetros no son el único reflejo del efecto protector del CM-hMSCA sobre la mitocondria astrocítica, ya que también se encontró en las células expuestas a scratch+BSS0+2%CM-hMSCA una reducción en las ERO con una consecuente disminución significativa del daño en el ADN, la nitración de proteínas y la peroxidación de lípidos (Figura 2- Capítulo 1). Estos resultados resaltan las implicaciones del CM-hMSCA en la eliminación de ERO y ERN, acción que se ve alterada frecuentemente en muchas patologías cerebrales (Stetler et al., 2013). Nosotros también confirmamos estos hallazgos en determinaciones realizadas en el segundo capítulo donde fue evidente el efecto del CM-hMSCA y su importancia sobre la protección de la mitocondria astrocítica (Figura 5-Capítulo 2).

Con el propósito de hacer una aproximación sobre el mecanismo a través del cual el CM- hMSCA preserva los parámetros mitocondriales nosotros, evaluamos también la ultraestructura astrocítica. Esto indicó la protección no sólo en organelos, sino también en la estabilidad del citoesqueleto junto con una ultraestructura organizada en células sujetas a scratch+BSS0+2%CM-hMSCA comparada con células expuestas a scratch+BSS0. El tratamiento con el 2% CM-hMSCA mostró un número mayor de mitocondrias y preservación de la integridad de las crestas mitocondriales (Figura 5-Capítulo 1) (Rampelt, Zerbes, van der Laan, & Pfanner, 2017). Además, la organización ultraestructural fue confirmada con la reducción en el número de vacuolas, así como la regulación y la estabilidad de proteínas citoesqueléticas astrocíticas como GFAP y vimentina (Hol & Pekny, 2015). Todo esto sugiere un efecto del CM-hMSCA en la disminución de la activación glial (Figuras 4 y 5-Capítulo 1). Otros hallazgos experimentales muestran que las células expuestas a scratch+BSS0 presentan alteración en los niveles de calcio (Ca2+) citoplasmático (Verkhratsky, Rodríguez, & Parpura, 2012) y en la secreción de citoquinas de manera similar a lo observado en la patología cerebral, causando así la muerte neuronal (Cekanaviciute & Buckwalter, 2016; Kempuraj et al., 2017). Con relación a estos parámetros, hemos observado también que el CM-hMSCA regula los niveles de Ca2+ citoplasmático con una compensación de este ion en otros organelos como la mitocondria y el retículo endoplásmico (RE) (Figura 2-Capítulo 2). Por otro lado, en la secreción de citoquinas no

174 sólo encontramos una regulación negativa de citoquinas proinflamatorias (IL-6, TNF-a y GM-CSF), sino también un aumento de otras que a nivel del tejido cerebral favorecen la neuroprotección, como son IL-2 e IL-8 (C.-L. Jiang & Lu, 1998; Rothhammer & Quintana, 2015) (Figura 1-Capítulo 2)

Como conclusión para esta primera parte, el 2% CM-hMSCA protege la viabilidad celular en un modelo del scratch+BSS0 al parecer mediando varios aspectos celulares que incluyen la protección de las mitocondrias, la protección del DNA y la reducción del daño por estrés oxidativo, así como la protección de la ultraestructura, y mediación de los niveles de Ca2+ y componente inflamatorio. Sin embargo, el mecanismo a través del cual el CM-hMSCA ejerce su efecto protector en los astrocitos aún es desconocido.

Nuestros estudios demuestran que efectivamente el CM-hMSCA en el modelo de scratch+BSS0 no sólo aumenta la expresión de proteínas antioxidantes como SOD2, catalasa y glutatión peroxidasa (Figura 3-Capítulo 1; Figura 8-Capítulo 3), sino que también es probable que se encuentre regulando algunas vías de supervivencia. En ese sentido, se observó un aumento en la expresión de AKT y ERK1/2, así como de sus proteínas fosforiladas en células tratadas con scratch+BSS0+2%CM-hMSCA al compararlas con las expuestas únicamente a scratch+BSS0 (Figura 3-Capítulo 2). Además, evaluamos los genes relacionados con la dinámica mitocondrial y la fosforilación oxidativa en células expuestas al scratch+BSS0. Nuestros datos sugieren que genes tanto de fisión (Drp1-fis1) como de fusión (mfn1-mfn2) mitocondrial se encuentran desregulados en células sujetas a scratch+BSS0, pero en células tratadas con scratch+BSS0+2%CM-hMSCA la expresión de estos genes de fusión-fisión disminuye (Figura 4-Capítulo 2). Eso demuestra que los factores presentes en el medio condicionado pueden contribuir, en parte, a aumentar la expresión de proteínas de interés biológico, regular vías de señalización o a mantener la dinámica mitocondrial (Kupcova Skalnikova, 2013; Linero & Chaparro, 2014; Wei et al., 2009).

Se conoce que en condiciones adversas o patológicas los astrocitos transcriben genes o expresan proteínas para mejorar la supervivencia neuronal (Pennypacker, Kassed, Eidizadeh, & O’Callaghan, 2000). En nuestro caso, hemos centrado el interés en identificar si la

175 proteína Neuroglobina (Ngb) participó en el efecto protector del CM-hMSCA encontrado en nuestro modelo. El interés en esta proteína está centrado en que a pesar que la Ngb a nivel neuronal tiene funciones de protección, supervivencia y detoxificación (Baez et al., 2016), algunos estudios también confirman su expresión en astrocitos bajo condiciones basales (Avivi et al., 2010). Además, un gran número de investigaciones mostró su expresión en astrocitos en condiciones patológicas como apoplejía, hipoxia, isquemia y lesión cerebral traumática (Taylor, Kelley, Gregory, & Berman, 2014). Interesantemente, nuestros hallazgos indicaron que las células sometidas a scratch+BSS0 expresaban Ngb (Figura 6-Capítulo 1), consistentes con estudios previos que muestran la expresión de Ngb en astrocitos humanos luego de un trauma cerebral (Taylor et al., 2014). Sin embargo, el 2% CM-hMSCA aumentó 4 veces más la expresión de esta proteína, al ser evaluada por western blot (Figura 6- Capítulo 1). Es así que la sobreexpresión de Ngb en células tratadas con scratch+BSS0+2%CM-hMSCA se relacionó con el efecto protector del CM-hMSCA, y que fue confirmado luego del silenciamiento genético de la Ngb. Con el bloqueo de la Ngb, se perdió el efecto protector del CM-hMSCA en la viabilidad, los parámetros mitocondriales se encontraron alterados (Figura 7-Capítulo 1) y se redujo la expresión de proteínas antioxidantes, así como aquellas involucradas en las vías de señalización celular (Figura 6- Capítulo 2). Asimismo, nuestros resultados mostraron un aumento de la Ngb, colocalizada a nivel mitocondrial (Figura 7-Capítulo 2). Es posible que estos resultados puedan explicarse a partir de investigaciones en las que se ha descrito que algunas moléculas que forman el secretoma de hMSCs, tales como PDGF-BB, bFGF, EGF, BDNF, NGF, IGF-1 y GDNF (Kupcova Skalnikova, 2013; Linero & Chaparro, 2014; Wei et al., 2009), pueden interactuar con Ngb dando una respuesta neuroprotectora. Según nuestro conocimiento, éste es el primer estudio que aborda la presencia de Ngb en diferentes orgánulos como aparato de Golgi y RE (Figura 7-Capítulo 2). Además, estos hallazgos sugieren que 2% CM-hMSCA puede favorecer las mitocondrias y que su efecto se da a través de la relación directa entre la integridad mitocondrial y la Ngb (Yu, Liu, Liu, Yang, & Wang, 2012), la reducción del daño oxidativo y como un agente que previene apoptosis (Amri, Ghouili, Amri, Carrier, & Masmoudi-Kouki, 2017), lo que sugiere la importancia de la Ngb mitocondrial y la neuroprotección ejercida por los astrocitos (Fig. 5-Capítulo 2).

176

Teniendo en cuenta que los resultados anteriores fueron obtenidos en un modelo astrocitario (T98G), nosotros confirmamos el efecto protector del CM-hMSCA en astrocitos humanos primarios, con resultados cercanos que validan el efecto del CM-hMSCA. En estos astrocitos, se observó un efecto del medio condicionado sobre la fragmentación nuclear, con una protección del 41,54% (Figura 6-Capítulo3) y un 81,2% para el modelo astrocitario (T98G) (Figura 1-Capítulo 1). Asimismo, encontramos coincidencia al evaluar el porcentaje de migración celular y cierre de la herida, parámetro que para los astrocitos humanos primarios fue de alrededor del 22,4% (Figura 4-Capítulo3) y para el modelo astrocitario (T98G) fue de un 12%. Por otro lado, y relacionado con algunos de los parámetros mitocondriales determinados, encontramos que el CM-hMSCA preservó el Δψm en los dos modelos evaluados, en donde se evidenció un incremento de aproximadamente un 100% en los astrocitos humanos primarios (Figura 7-Capítulo3) y de manera similar una protección del 102% en el modelo astrocitario (T98G) (Figura 1-Capítulo 1). Además, los valores de expresión en las proteínas antioxidantes como glutatión peroxidasa (GPX1) se observaron incrementos para los astrocitos humanos primarios (Figura 8-Capítulo3) y el modelo astrocitario (T98G) (Figura 3-Capítulo 1) en un 180% y 47%, respectivamente. De igual forma para la proteína SOD2, se observó un valor de 40% más de expresión en astrocitos humanos primarios y de un 118,2% para el modelo astrocitario (T98G) frente a las células expuestas únicamente a scratch+BSS0. Sin embargo, se requieren investigaciones adicionales para evaluar completamente el efecto de CM-hMSCA, y si los factores del CM- hMSCA actúan en correlación con otras proteínas o mediante la activación de mecanismos. Así como confirmar si la Ngb también esta mediando el efecto protector de CM-hMSCA en este tipo de célula, en otros tipos celulares y modelos in vivo que confirmen la importancia de nuestros hallazgos.

Por último, vale la pena mencionar que una discusión con más detalle y exhaustiva de nuestros resultados se presenta para cada uno de los tres (3) capítulos que hacen parte de la sección de resultados de este documento.

177

Conclusiones

Con el desarrollo de esta investigación se aporta nueva información sobre la respuesta de los astrocitos y el efecto protector del medio condicionado de células madre mesenquimales derivadas de tejido adiposo humano (CM-hMSCA) en un modelo de scratch y privación de glucosa.

1. Se comprobó que una lesión mecánica (scratch) y privación de glucosa producen efectos nocivos sobre parámetros esenciales para la supervivencia y el buen funcionamiento de los astrocitos. 2. La caracterización del modelo en astrocitos humanos primarios permitió establecer los principales eventos que ocurren durante un daño mecánico (scratch) y metabólico, con el principal objeto de intervenir en los aspectos más críticos y evaluar la protección de factores paracrinos derivados de células madre mesenquimales de tejido adiposo. 3. El CM-hMSCA posee efectos de protección mitocondrial a través del mantenimiento del Δψm, la reducción de las ERO y la reducción en la oxidación de la cardiolipina, que contrarresta la muerte celular característica del modelo de scratch y privación de glucosa. 4. El mecanismo de acción del CM-hMSCA desde el punto de vista celular, favorece la supervivencia astrocítica mediante la reducción en el número de vacuolas, conservación en la integridad de las crestas mitocondriales y número de mitocondrias además de la preservación de parámetros ultraestructurales en el modelo. 5. Se comprobó que los efectos protectores del CM-hMSCA incluyen la regulación de las citoquinas, la estabilización de los niveles de calcio citoplasmático, mitocondrial y de retículo endoplásmico, además de modular la dinámica mitocondrial y la cadena respiratoria en un modelo astrocitario (T98G) sujeto a scratch y privación de glucosa. Estos datos sugieren una interrelación entre varios de los componentes del sistema astrocítico (calcio, ERO, Δψm, proteínas, genes, etc.) en los mecanismos de protección mediados por el CM-hMSCA. 6. Nuestros datos sugieren una relación entre el CM-hMSCA la expresión de proteínas antioxidantes, características de los astrocitos, como superóxido dismutasa (SOD2), catalasa y glutatión peroxidasa lo cual puede explicar la reducción del daño oxidativo y la preservación de la función mitocondrial.

178

7. El mecanismo de acción del CM-hMSCA parece estar mediado por vías de señalización, tales como AKT/pAKT y ERK1/2/pERK, ya que el CM-hMSCA, pero no el scratch y la privación de glucosa, tiene un efecto en la expresión y fosforilación de estas proteínas en nuestro modelo de estudio. 8. Uno de los hallazgos principales del presente estudio fue la regulación positiva de la proteína neuroglobina (Ngb) en células tratadas con CM-hMSCA. 9. Nuestra hipótesis es que la neuroglobina es transportada a la mitocondria en condiciones de daño celular, tal como ocurre en nuestro modelo. Al inhibir la mitocondria utilizando un fármaco, el efecto protector de la neuroglobina sobre células astrocíticas se pierde casi por completo. Además, al inducir un bloqueo de la neuroglobina utilizando un RNAi, el efecto protector del medio condicionado sobre los astrocitos se reduce considerablemente. 10. Los resultados sugieren un papel importante de la proteína neuroglobina, la cual tiene efectos tanto antioxidantes como de modulación de la función mitocondrial. Al parecer la neuroglobina mitocondrial es necesaria para la protección inducida por el CM-hMSCA en células astrocíticas sometidas a scratch y privación de glucosa.

179

Publicaciones y presentación en congresos

• Lista de publicaciones 1. Baez-Jurado, E., Rincón-Benavides, M. A., Hidalgo-Lanussa, O., Guio-Vega, G., Ashraf, G. M., Sahebkar, A., ... & Barreto, G. E. (2018). Molecular mechanisms involved in the protective actions of Selective Estrogen Receptor Modulators in brain cells. Frontiers in Neuroendocrinology. Factor de impacto: 6.875 Q1 ISI/SCOPUS.

2. Vesga-Jiménez, D. J., Hidalgo-Lanussa, O., Baez-Jurado, E., Echeverría, V., Ashraf, G. M., Sahebkar, A., & Barreto, G. E. (2018). Raloxifene attenuates oxidative stress and preserves mitochondrial function in astrocytic cells upon glucose deprivation. Journal of Cellular Physiology. Factor de impacto: 3.9 Q1 ISI/SCOPUS (Physiology).

3. Cabezas, R., Baez-Jurado, E., Hidalgo-Lanussa, O., Echeverría, V., Ashrad, G. M., Sahebkar, A., & Barreto, G. E. (2018). Growth factors and Neuroglobin in astrocyte protection against neurodegeneration and oxidative stress. Molecular Neurobiology, 1- 13. Factor de impacto: 6.19 Q1 ISI/SCOPUS.

4. Hidalgo-Lanussa, O., Ávila-Rodriguez, M., Baez-Jurado, E., Zamudio, J., Echeverría, V., Garcia-Segura, L. M., & Barreto, G. E. (2017). Tibolone Reduces Oxidative Damage and Inflammation in Microglia Stimulated with Palmitic Acid through Mechanisms Involving Estrogen Receptor Beta. Molecular Neurobiology, 1-16. Factor de impacto: 6.19 Q1 ISI/SCOPUS.

5. Baez-Jurado, E., Hidalgo-Lanussa, O., Guio-Vega, G., Ashraf, G. M., Echeverría, V., Aliev, G., & Barreto, G. E. (2017). Conditioned Medium of Human Adipose Mesenchymal Stem Cells Increases Wound Closure and Protects Human Astrocytes Following Scratch Assay In Vitro. Molecular Neurobiology, 1-16. Factor de impacto: 6.19 Q1 ISI/SCOPUS.

6. Baez, E., Guio-Vega, G. P., Echeverría, V., Sandoval-Rueda, D. A., & Barreto, G. E. (2017). 4′-Chlorodiazepam Protects Mitochondria in T98G Astrocyte Cell Line from Glucose Deprivation. Neurotoxicity Research, 1-9. Factor de impacto: 3.1 Q2 ISI/SCOPUS.

7. Baez-Jurado, E., Vega, G. G., Aliev, G., Tarasov, V. V., Esquinas, P., Echeverría, V., & Barreto, G. E. (2018). Blockade of neuroglobin reduces protection of conditioned medium from human mesenchymal stem cells in human astrocyte model (T98G) under a scratch assay. Molecular Neurobiology, 55(3), 2285-2300. Factor de impacto: 6.19 Q1 ISI/SCOPUS

8. Baez, E., Echeverría, V., Cabezas, R., Ávila-Rodriguez, M., Garcia-Segura, L. M., & Barreto, G. E. (2016). Protection by neuroglobin expression in brain pathologies. Frontiers in Neurology, 7. Factor de impacto: 3.2 Q2 ISI/SCOPUS.

180

9. Avila-Rodriguez, M., Garcia-Segura, L. M., Hidalgo-lanussa, O., Baez, E., González, J., & Barreto, G. E. (2016). Tibolone protects astrocytic cells from glucose deprivation through a mechanism involving estrogen receptor beta and the upregulation of neuroglobin expression. Molecular and Cellular Endocrinology, 433, 35-46. Factor de impacto: 3.9 Q2 ISI/SCOPUS.

10. Cabezas, R., Ávila, M., González, J., El-Bachá, R. S., Báez, E., García-Segura, L. M., ... & Barreto, G. E. (2014). Astrocytic modulation of blood brain barrier: perspectives on Parkinson’s disease. Frontiers in Cellular Neuroscience, 8, 211. Factor de impacto: 4.5 Q1 ISI/SCOPUS.

• Premios y distinciones

1. Primer lugar en el concurso de poster. XI Congreso Nacional/XII Seminario Internacional de Neurociencias. Organizado por el Colegio Colombiano de Neurociencias. Abril 28 de 2018. 2. FEBS Journal Poster Prize. This award was received in Italy during the meeting of ICGEB Arturo Falaschi Conference Series: "Atypical dementias: from diagnosis to emerging therapies" - 21-23 November 2017. 3. 2018 Latin American Training Program. "From Molecules to Behavior: The Quest for New Treatments of Neuropathologies". August 26 - September 15, 2018 in the Centro Interdisciplinario de Neurociencias de Valparaíso (CINV) at the University of Valparaíso in Chile. 4. Travel Grants of Latin America Regional Committee (LARC) from International Brain Research Organization (IBRO). 2017

• Participación en congresos y cursos internacionales

1. The Arturo Falaschi Conference Series 2017 - Atypical dementias: from diagnosis to emerging therapies. International Centre for Genetic Engineering and Biotechnology ICGEB. Trieste, Italia. Noviembre. 2017 2. International Course “Cell and Animal Models for Drug Discovery” Institute Pasteur Montevideo. 16 - 27 October, 2017. Montevideo, Uruguay. 3. CIASEM 2017. XIV Inter-American Congress of Microscopy. Neurosciences Symposium. Varadero, Cuba. September 25-29, 2017. Travel Grants of Latin America Regional Committee (LARC) from International Brain Research Organization (IBRO). 4. Motorized Stereotaxic Neurosurgery for Chronic Electrophysiological Recordings in Rodents. Satellite Courses - FALAN Pre-Congress. Buenos Aires, Argentina. Octubre, 2016. 5. 2o Congreso FALAN–Federation of Societies of Neurosciences of Latin America and the Caribbean. Buenos Aires, Argentina. 17-20 Octubre, 2016. 181

• Participación en congresos y cursos nacionales 1. Modelos Experimentales de Enfermedades Neurodegenerativas: trastornos metabólicos, motores y cognitivos asociados a la Neurodegeneración. Colegio Colombiano de Neurociencias y el Grupo de Investigación Modelos Experimentales para las Ciencias Zoológicas, Universidad Nacional de Colombia. Bogotá́, Colombia. Mayo, 2016. 2. IV Curso Internacional de Neurobiología: Enfoques electrofisiológicos, celulares y computacionales para el estudio del Sistema Nervioso. Pontificia Universidad Javeriana. Bogotá́, Colombia. Mayo, 2014 3. Curso Neurobioinformática. Pontificia Universidad Javeriana. Bogotá́, Colombia. Octubre, 2014 4. Escuela de Neurociencia Computacional. Pontificia Universidad Javeriana. Bogotá́, Colombia. Octubre a Noviembre, 2014 5. Second Latin-American School on glial cells in the diseased brain. Universidad Nacional de Colombia. Bogotá́, Colombia. 12 – 14 Octubre, 2017 6. Latin-American School on glial cells in the diseased brain. Pontificia Universidad Javeriana. Bogotá́, Colombia. Julio 2015. 7. Curso de formación para usuarios de modelos animales con fines experimentales. Pontificia Universidad Javeriana y Universidad de los Andes. Bogotá́, Colombia. Julio, 2014.

• Poster y presentaciones orales

1. Poster: “Tibolone preserves the viability, attenuates the production of reactive species and affects the translocation of Nf-Kβ in an astrocytic model under glucose-free conditions” CIASEM 2017. XIV Inter-American Congress of Microscopy. Neurosciences Symposium. Varadero, Cuba. September 25-29, 2017. 2. Poster: "Conditioned medium from mesenchymal stem cells protects astrocytes subject to mechanical injury (scratch) and glucose-free conditions” Báez, E., González, J. & Barreto, G. 2o Congreso FALAN–Federation of Societies of Neurosciences of Latin America and the Caribbean. Buenos Aires, Argentina. 17-20 Octubre, 2016. 3. Congreso Nacional/XI Seminario Internacional de Neurociencias. Colegio Colombiano de Neurociencias. Universidad Tecnológica de Pereira. Pereira, Colombia. Mayo, 2016. 4. Poster: "Neuroprotección por tibolona en microglia expuesta a palmitato". Hidalgo, O., Ávila, M., Báez, E., Segura, Luis-Miguel., & Barreto, G. X Congreso Nacional/XI Seminario Internacional de Neurociencias. Colegio Colombiano de Neurociencias. Universidad Tecnológica de Pereira. Pereira, Colombia. Mayo, 2016. 5. Poster: "El medio condicionado de células madre mesenquimales protege a los astrocitos en condiciones libres de glucosa" Báez-Jurado, E., Hidalgo, O. Guio-Vega,

182

G., & Barreto, G. Curso ICGEB "Escuela Internacional de Bioinformática y Neurociencia Computacional 2016" Bogotá-Colombia. 5-8 Octubre, 2016 6. Oral: La importancia de la función mitocondrial astrocítica para la protección neuronal contra lesión cerebral traumática. Escuela de Neurociencia Computacional. Pontificia Universidad Javeriana. Del 29 de octubre al 7 de noviembre de 2014 7. Oral: Blockade of Neuroglobin Reduces Protection of Conditioned Medium from Human Mesenchymal Stem Cells in Human Astrocyte Model (T98G) Under a Scratch Assay. III Encuentro de Investigación. Junio 1 – 2018 Bogotá.

Anexos

Anexo 1: Consentimiento informado Anexo 2: Certificados Premios y distinciones

183 Pontificia Universidad Javeriana Facultad de Ciencias*

CONSENTIMIENTO DE INFORMADO PARA LA DONACIÓN VOLUNTARIA DE TEJIDO ADIPOSO1

Información General

Los lipoaspirados contienen una variedad celular incluyendo las células madre denominadas mesenquimales (MSC). Las MSC se proyectan como herramientas con gran potencia en la regeneración de tejidos y estudios de cáncer. Por tanto la investigación con estas células es imprescindible. Actualmente, estamos investigando el efecto de los factores paracrinos de las MSC que pueden tener algún efecto sobre la función astrocítica dirigida a conservar la supervivencia y función neuronal tras una Lesión Cerebral Traumática (LCT). Por ésta razón solicitamos que usted seda voluntariamente una muestra de tejido adiposo, considerado como material de desecho durante el procedimiento quirúrgico que llevará a cabo su cirujano plástico.

Este proceso no implica riesgos adicionales a la cirugía a la cual usted se está sometiendo. Su muestra de lipoaspirado proporcionará las MSC para investigar el posible potencial terapéutico frente a una LCT. El proyecto de investigación se titula: “Potencial efecto del medio condicionado de células madre mesenquimales derivadas de tejido adiposo sobre astrocitos humanos en un modelo in vitro de scratch y privación de glucosa”.

Las MSC derivadas de su muestra (al igual que la muestra misma) serán descartadas inmediatamente después de la finalización de nuestros estudios. No se almacenarán ningún tipo de muestras proveniente de su donación después de la finalización de los estudios.

Confidencialidad: La historia médica, los resultados de exámenes y la información que usted nos ha dado son de carácter absolutamente confidencial de manera que, solamente el equipo de atención clínica y de investigación tendrá acceso a estos datos, por ningún motivo se divulgará ésta información sin su consentimiento.

Cualquier información adicional usted puede obtenerla de los investigadores del grupo de investigación Terapia Celular y Molecular de la Facultad de Ciencias de la Pontificia Universidad Javeriana:

1 El uso de éste consentimiento está aprobado para el periodo comprendido entre 1 de Julio de 2014 y el 1 de Julio de 2015.

* Formato adoptado y adaptado del Laboratorio de Hematología de la Pontificia Universidad Javeriana 184 Pontificia Universidad Javeriana Facultad de Ciencias* Dr. George Emilio Sampaio Barreto. Tel: 320 83 20 Ext. 4096. Correo: [email protected] M Sc. Eliana María Báez Jurado. Tel 320 83 20 Ext. 4136 Correo. [email protected]

Procedimiento: Con previa autorización se procederá a tomar una muestra del material adiposo descartado por el cirujano (lipoaspirado) de aproximadamente 200ml durante el procedimiento quirúrgico. La muestra será procesada en el Laboratorio de Investigación Bioquímica de la pontificia Universidad Javeriana. Estas muestras serán manejadas únicamente por personal involucrado en el equipo de atención clínica y de investigación.

APROBACIÓN ESCRITA DONACION VOLUNTARIA

Yo ______identificado(a) con número de cédula ______declaro que:

1. Entiendo que la muestra de lipoaspirado será utilizada con fines de investigación y será manejado bajo las normas éticas pertinentes. 2. Entiendo que la información referente a mi será manejada de forma confidencial para proteger mi identidad. 3. Entiendo que no recibiré ninguna compensación económica por la donación. 4. Entiendo que la donación del lipoaspirado NO REPRESENTA NINGÚN PELIGRO para mí. 5. En caso de ver la necesidad de retirarme del estudio, avisaré oportunamente a los investigadores

La utilización de la muestra en estudios posteriores nos podría ayudar en el futuro a entender las causas y/o el comportamiento de la(s) entidad(es) anteriormente mencionada(s). Se puede dar el caso en donde usted y su familia no se beneficien directamente de estos estudios, pero tanto su familia como otros individuos afectados podrían beneficiarse. Usted tiene el derecho a no permitir que sus tejidos (células mesenquimales adiposas/medio condicionado) sean estudiados inmediatamente o guardados para estudios en el futuro. Usted se puede retirar del estudio en cualquier momento. Los investigadores podrán guardar las muestras como parte del tratamiento rutinario sin que éstas sean incluidas en la investigación. Por lo tanto, por favor marque su decisión con respecto al almacenamiento de la muestra y su utilización en estudios de investigación posteriores:

* Formato adoptado y adaptado del Laboratorio de Hematología de la Pontificia Universidad Javeriana 185 Pontificia Universidad Javeriana Facultad de Ciencias* Deseo que la muestra que me fue extraída sea DESECHADA una vez completado el estudio de investigación.

Autorizo conservar la muestra que me fue extraída con la posibilidad de emplearla en las situaciones señaladas a continuación:

• En estudios complementarios de diagnóstico para mí o algún Si No miembro de mi familia : • En estudios de investigación específicos para la(s) entidad(es), objeto de esta toma de muestra, siempre y cuando se conserve en Si No anonimato mis datos de identificación: • En estudios de investigación de entidades distintas a la(s) entidad(es) objeto de esta toma de muestra, siempre y cuando se Si No conserve en anonimato mis datos de identificación: • En estudios de investigación colaborativos con otras instituciones nacionales y/o internacionales, siempre y cuando exista acuerdo Si No interinstitucional previo, aprobación del comité de ética y se conserve en anonimato mis datos de identificación:

He leído comprendido toda la información entregada, estoy satisfecho(a) con la información recibida, he podido formular todas las preguntas que he creído convenientes y me han aclarado todas las dudas planteadas.

En consecuencia, doy mi consentimiento para la donación voluntaria de lipoaspirado durante el procedimiento quirúrgico que me será practicado por el cirujano plástico.

Paciente

Nombre:______CC.:______Teléfono:______Fecha:______

Testigos

Nombre:______CC.:______Relación con el paciente:______Teléfono:______Fecha:______

* Formato adoptado y adaptado del Laboratorio de Hematología de la Pontificia Universidad Javeriana 186 Pontificia Universidad Javeriana Facultad de Ciencias* Beneficios: La donación de la muestra es un acto altruista de colaboración con la investigación científica. Esto no implica ninguna remuneración económica para ninguna de las partes.

Beneficios adicionales: La utilización de las muestras nos podrían ayudar a entender las causas y/o comportamiento de la(s) entidad(es) anteriormente mencionada(s). Se puede dar el caso en donde usted y su familia no se beneficien directamente de estos estudios, pero en un futuro otros individuos afectados podrían beneficiarse. Su participación en el estudio es una participación voluntaria para el entendimiento de los procesos de protección de la función astrocítica dirigida a conservar la supervivencia y función neuronal tras una Lesión Cerebral Traumática (LCT).

Notas Aclaratorias: • Para la investigación se contará con la participación, de 1 a 5 personas, debido a que la extracción de las células mesenquimales a partir del lipoaspirado es un proceso largo y, en algunos casos puede estar sujeto a perdida de la muestra por contaminación o falla en la manipulación de la misma o de los cultivos que de ésta se deriven. • Se tiene como criterio de selección para la toma de la muestra que el donante haya decidido llevar a cabo un procedimiento estético en el que se obtenga un lipoaspirado. • Éste consentimiento se encuentra en duplicado. Una copia queda como soporte para el equipo de investigación y la otra le será entregada a usted o su representante legal.

* Formato adoptado y adaptado del Laboratorio de Hematología de la Pontificia Universidad Javeriana 187 188 CCCCBogotá, abril 26, 27 y 28 de 2018

El presidente del Colegio Colombiano de Neurociencias COLNE

SE PERMITE INFORMAR QUE:

ELIANA MARÍA BÁEZ JURADO C.C. 46385051

Ha ocupado el primer lugar en el concurso de carteles, con el trabajo titulado: “Medio condicionado de células madre mesenquimales adiposas humanas aumenta el cierre de la herida y protege a los astrocitos humanos en un modelo de scratch in vitro”

George Barreto Ph.D. Presidente Bogotá, Abril 28 de 2018

189 Bibliografía

Alluri, H., Anasooya Shaji, C., Davis, M. L., & Tharakan, B. (2015). Oxygen-Glucose Deprivation and Reoxygenation as an In Vitro Ischemia-Reperfusion Injury Model for Studying Blood-Brain Barrier Dysfunction. Journal of Visualized Experiments, (99). https://doi.org/10.3791/52699 Amri, F., Ghouili, I., Amri, M., Carrier, A., & Masmoudi-Kouki, O. (2017). Neuroglobin protects astroglial cells from hydrogen peroxide-induced oxidative stress and apoptotic cell death. Journal of Neurochemistry, 140(1), 151–169. https://doi.org/10.1111/jnc.13876 Anderson, M. A., Burda, J. E., Ren, Y., Ao, Y., O’Shea, T. M., Kawaguchi, R., … Sofroniew, M. V. (2016). Astrocyte scar formation aids central nervous system axon regeneration. Nature, 532(7598), 195–200. https://doi.org/10.1038/nature17623 Andreev, D. E., O’Connor, P. B., Zhdanov, A. V, Dmitriev, R. I., Shatsky, I. N., Papkovsky, D. B., & Baranov, P. V. (2015). Oxygen and glucose deprivation induces widespread alterations in mRNA translation within 20 minutes. Genome Biology, 16(1), 90. https://doi.org/10.1186/s13059-015-0651-z Avila-Rodriguez, M., Garcia-Segura, L. M., Hidalgo-lanussa, O., Baez, E., Gonzalez, J., & Barreto, G. E. (2016). Tibolone protects astrocytic cells from glucose deprivation through a mechanism involving estrogen receptor beta and the upregulation of neuroglobin expression. Molecular and cellular endocrinology, 433, 35–46. Avivi, A., Gerlach, F., Joel, A., Reuss, S., Burmester, T., Nevo, E., & Hankeln, T. (2010). Neuroglobin, cytoglobin, and myoglobin contribute to hypoxia adaptation of the subterranean mole rat Spalax. Proceedings of the National Academy of Sciences, 107(50), 21570–21575. https://doi.org/10.1073/pnas.1015379107 Azevedo, F. A. C., Carvalho, L. R. B., Grinberg, L. T., Farfel, J. M., Ferretti, R. E. L., Leite, R. E. P., … Herculano-Houzel, S. (2009). Equal numbers of neuronal and nonneuronal cells make the human brain an isometrically scaled-up primate brain. The Journal of Comparative Neurology, 513(5), 532–541. https://doi.org/10.1002/cne.21974 Azouna, N., Jenhani, F., Regaya, Z., Berraeis, L., Othman, T., Ducrocq, E., & Domenech, J. (2012). Phenotypical and functional characteristics of mesenchymal stem cells from bone marrow: comparison of culture using different media supplemented with human platelet lysate or fetal bovine serum. Stem Cell Research & Therapy, 3(1), 6. https://doi.org/10.1186/scrt97 Baez-Jurado, E., Vega, G. G., Aliev, G., Tarasov, V. V., Esquinas, P., Echeverria, V., & Barreto, G. E. (2018). Blockade of Neuroglobin Reduces Protection of Conditioned Medium from Human Mesenchymal Stem Cells in Human Astrocyte Model (T98G) Under a Scratch Assay. Molecular Neurobiology, 55(3), 2285–2300. https://doi.org/10.1007/s12035-017-0481-y Baez, E., Echeverria, V., Cabezas, R., Ávila-Rodriguez, M., Garcia-Segura, L. M., & Barreto, G. E. (2016). Protection by Neuroglobin Expression in Brain Pathologies. Frontiers in Neurology, 7. https://doi.org/10.3389/fneur.2016.00146 Baez, E., Guio-Vega, G. P., Echeverria, V., Sandoval-Rueda, D. A., & Barreto, G. E. (2017). 4′-Chlorodiazepam Protects Mitochondria in T98G Astrocyte Cell Line from Glucose Deprivation. Neurotoxicity Research, 32(2), 163–171. https://doi.org/10.1007/s12640- 017-9733-x Balduini, W., Carloni, S., & Buonocore, G. (2009). Autophagy in hypoxia-ischemia induced 190 brain injury: evidence and speculations. Autophagy, 5(2), 221–223. Barreto, G. E., White, R. E., Xu, L., Palm, C. J., & Giffard, R. G. (2012). Effects of heat shock protein 72 (Hsp72) on evolution of astrocyte activation following stroke in the mouse. Experimental Neurology, 238(2), 284–296. https://doi.org/10.1016/j.expneurol.2012.08.015 Bartnik, B. L., Sutton, R. L., Fukushima, M., Harris, N. G., Hovda, D. A., & Lee, S. M. (2005). Upregulation of Pentose Phosphate Pathway and Preservation of Tricarboxylic Acid Cycle Flux after Experimental Brain Injury. Journal of Neurotrauma, 22(10), 1052– 1065. https://doi.org/10.1089/neu.2005.22.1052 Bélanger, M., Allaman, I., & Magistretti, P. J. (2011). Brain energy metabolism: focus on astrocyte-neuron metabolic cooperation. Cell metabolism, 14(6), 724–738. https://doi.org/10.1016/j.cmet.2011.08.016 Bélanger, M., & Magistretti, P. J. (2009). The role of astroglia in neuroprotection. Dialogues in clinical neuroscience, 11(3), 281–295. Bonow, R. H., Barber, J., Temkin, N. R., Videtta, W., Rondina, C., Petroni, G., … Alvarado, R. (2018). The Outcome of Severe Traumatic Brain Injury in Latin America. World Neurosurgery, 111, e82–e90. https://doi.org/10.1016/j.wneu.2017.11.171 Bramlett, H. M., & Dietrich, W. D. (2004). Pathophysiology of cerebral ischemia and brain trauma: Similarities and differences. Journal of Cerebral Blood Flow & Metabolism, 24(2), 133–150. https://doi.org/10.1097/01.WCB.0000111614.19196.04 Brennan, A. M., Won Suh, S., Joon Won, S., Narasimhan, P., Kauppinen, T. M., Lee, H., … Swanson, R. A. (2009). NADPH oxidase is the primary source of superoxide induced by NMDA receptor activation. Nature Neuroscience, 12(7), 857–863. https://doi.org/10.1038/nn.2334 Burmester, T., & Hankeln, T. (2009). What is the function of neuroglobin? The Journal of experimental biology, 212(Pt 10), 1423–1428. https://doi.org/10.1242/jeb.000729 Caballero Chacón, Sara; Nieto-Sampedro, M. (2005). Fisiopatología de la lesión medular. Revisión de literatura. Veterinaria México, 36(0301-5092), 75–86. Recuperado de http://www.redalyc.org/pdf/423/42336107.pdf Cabezas, R., Avila, M. F., González, J., El-Bachá, R. S., & Barreto, G. E. (2015). PDGF-BB protects mitochondria from rotenone in T98G cells. Neurotoxicity research, 27(4), 355– 367. Cabezas, R., El-Bachá, R. S., González, J., & Barreto, G. E. (2012). Mitochondrial functions in astrocytes: Neuroprotective implications from oxidative damage by rotenone. Neuroscience Research, 74(2), 80–90. https://doi.org/10.1016/j.neures.2012.07.008 Cantinieaux, D., Quertainmont, R., Blacher, S., Rossi, L., Wanet, T., Noël, A., … Franzen, R. (2013). Conditioned Medium from Bone Marrow-Derived Mesenchymal Stem Cells Improves Recovery after Spinal Cord Injury in Rats: An Original Strategy to Avoid Cell Transplantation. PLoS ONE, 8(8), e69515. https://doi.org/10.1371/journal.pone.0069515 Carmody, R. N., & Wrangham, R. W. (2009). The energetic significance of cooking. Journal of human evolution, 57(4), 379–391. https://doi.org/10.1016/j.jhevol.2009.02.011 Cavallucci, V., Nobili, A., & D’Amelio, M. (2013). Emerging role of mitochondria dysfunction in the onset of neurodegenerative diseases. Journal of biological regulators and homeostatic agents, 27(2 Suppl), 1–9. Cekanaviciute, E., & Buckwalter, M. S. (2016). Astrocytes: Integrative Regulators of Neuroinflammation in Stroke and Other Neurological Diseases. Neurotherapeutics, 13(4), 685–701. https://doi.org/10.1007/s13311-016-0477-8 191

Chagastelles, P. C., Nardi, N. B., & Camassola, M. (2010). Biology and applications of mesenchymal stem cells. Science progress, 93(Pt 2), 113–127. Recuperado de http://www.ncbi.nlm.nih.gov/pubmed/20681317 Chang, C.-P., Chio, C.-C., Cheong, C.-U., Chao, C.-M., Cheng, B.-C., & Lin, M.-T. (2013). Hypoxic preconditioning enhances the therapeutic potential of the secretome from cultured human mesenchymal stem cells in experimental traumatic brain injury. Clinical Science, 124(3), 165–176. https://doi.org/10.1042/CS20120226 Chen, J., Li, Y., Hao, H., Li, C., Du, Y., Hu, Y., … Liu, J. (2015). Mesenchymal stem cell conditioned medium promotes proliferation and migration of alveolar epithelial cells under septic conditions in vitro via the JNK-P38 signaling pathway. Cellular Physiology and Biochemistry, 37(5), 1830–1846. Chen, W., Zhang, X. I. A., & Huang, W. (2016). Role of neuroinflammation in neurodegenerative diseases. Molecular medicine reports, 13(4), 3391–3396. Chen, X. Q., Qin, L. Y., Zhang, C. G., Yang, L. T., Gao, Z., Liu, S., … Yu, A. C. (2005). Presence of neuroglobin in cultured astrocytes. Glia, 50(2), 182–186. Chen, Y.-X., Zeng, Z.-C., Sun, J., Zeng, H.-Y., Huang, Y.-, & Zhang, Z.-Y. (2015). Mesenchymal stem cell–conditioned medium prevents radiation-induced liver injury by inhibiting inflammation and protecting sinusoidal endothelial cells. Journal of Radiation Research, 56(4), 700–708. https://doi.org/10.1093/jrr/rrv026 Chen, Y., & Swanson, R. A. (2003). Astrocytes and Brain Injury. Journal of Cerebral Blood Flow & Metabolism, 23(2), 137–149. https://doi.org/10.1097/01.WCB.0000044631.80210.3C Chicote Álvarez, E., González Castro, A., Ortiz Lasa, M., Jiménez Alfonso, A., Escudero Acha, P., Rodríguez Borregán, J. C., … Dierssen Sotos, T. (2018). Epidemiología del traumatismo craneoencefálico en la población mayor de 65 años a lo largo de 25 años. Revista Española de Anestesiología y Reanimación. https://doi.org/10.1016/j.redar.2018.06.003 Cho, Y. J., Song, H. S., Bhang, S., Lee, S., Kang, B. G., Lee, J. C., … Kim, B. S. (2012). Therapeutic effects of human adipose stem cell-conditioned medium on stroke. Journal of neuroscience research, 90(9), 1794–1802. Cirillo, G., Bianco, M. R., Colangelo, A. M., Cavaliere, C., Daniele, D. L., Zaccaro, L., … Papa, M. (2011). Reactive astrocytosis-induced perturbation of synaptic homeostasis is restored by nerve growth factor. Neurobiology of Disease, 41(3), 630–639. https://doi.org/10.1016/j.nbd.2010.11.012 Clark, R. S. B., Empey, P. E., Bayır, H., Rosario, B. L., Poloyac, S. M., Kochanek, P. M., … Bell, M. J. (2017). Phase I randomized clinical trial of N-acetylcysteine in combination with an adjuvant probenecid for treatment of severe traumatic brain injury in children. PLOS ONE, 12(7), e0180280. https://doi.org/10.1371/journal.pone.0180280 Colell, A., Ricci, J.-E., Tait, S., Milasta, S., Maurer, U., Bouchier-Hayes, L., … Green, D. R. (2007). GAPDH and autophagy preserve survival after apoptotic cytochrome c release in the absence of caspase activation. Cell, 129(5), 983–997. https://doi.org/10.1016/j.cell.2007.03.045 Corps, K. N., Roth, T. L., & McGavern, D. B. (2015). Inflammation and Neuroprotection in Traumatic Brain Injury. JAMA Neurology, 72(3), 355. https://doi.org/10.1001/jamaneurol.2014.3558 Dallérac, G., Chever, O., & Rouach, N. (2013). How do astrocytes shape synaptic transmission? Insights from electrophysiology. Frontiers in Cellular Neuroscience, 7. 192

https://doi.org/10.3389/fncel.2013.00159 De Marinis, E., Acaz-Fonseca, E., Arevalo, M. A., Ascenzi, P., Fiocchetti, M., Marino, M., & Garcia-Segura, L. M. (2013). 17β-Oestradiol anti-inflammatory effects in primary astrocytes require oestrogen receptor β-mediated neuroglobin up-regulation. Journal of neuroendocrinology, 25(3), 260–270. De Marinis, E., Fiocchetti, M., Acconcia, F., Ascenzi, P., & Marino, M. (2013). Neuroglobin upregulation induced by 17β-estradiol sequesters cytocrome c in the mitochondria preventing H2O2-induced apoptosis of neuroblastoma cells. Cell Death and Disease, 4(2), e508. https://doi.org/10.1038/cddis.2013.30 DellaValle, B., Hempel, C., Kurtzhals, J. A. L., & Penkowa, M. (2010). In vivo expression of neuroglobin in reactive astrocytes during neuropathology in murine models of traumatic brain injury, cerebral malaria, and autoimmune encephalitis. Glia, 58(10), 1220–1227. Deng, L.-X., Hu, J., Liu, N., Wang, X., Smith, G. M., Wen, X., & Xu, X.-M. (2011). GDNF modifies reactive astrogliosis allowing robust axonal regeneration through Schwann cell- seeded guidance channels after spinal cord injury. Experimental Neurology, 229(2), 238– 250. https://doi.org/10.1016/j.expneurol.2011.02.001 Deshpande, L. S., Sun, D. A., Sombati, S., Baranova, A., Wilson, M. S., Attkisson, E., … DeLorenzo, R. J. (2008). Alterations in neuronal calcium levels are associated with cognitive deficits after traumatic brain injury. Neuroscience Letters, 441(1), 115–119. https://doi.org/10.1016/j.neulet.2008.05.113 Dienel, G. A. (2012). Fueling and imaging brain activation. ASN NEURO, 4(5), 267–321. https://doi.org/10.1042/AN20120021 DiNunzio, J. C., & Williams, R. O. (2008). CNS Disorders—Current Treatment Options and the Prospects for Advanced Therapies. Drug Development and Industrial Pharmacy, 34(11), 1141–1167. https://doi.org/10.1080/03639040802020536 Dringen, R., & Hirrlinger, J. (2003). Glutathione Pathways in the Brain. Biological Chemistry, 384(4), 505–516. https://doi.org/10.1515/BC.2003.059 Duchen, M. R., & Szabadkai, G. (2010). Roles of mitochondria in human disease: Figure 1. Essays In Biochemistry, 47, 115–137. https://doi.org/10.1042/bse0470115 Dugan, L. L., & Kim-Han, J.-S. (2004a). Astrocyte mitochondria in in vitro models of ischemia. Journal of bioenergetics and biomembranes, 36(4), 317–321. https://doi.org/10.1023/B:JOBB.0000041761.61554.44 Dugan, L. L., & Kim-Han, J.-S. (2004b). Astrocyte Mitochondria in In Vitro Models of Ischemia. Journal of Bioenergetics and Biomembranes, 36(4), 317–321. https://doi.org/10.1023/B:JOBB.0000041761.61554.44 Eddleston, M., & Mucke, L. (1993). Molecular profile of reactive astrocytes--implications for their role in neurologic disease. Neuroscience, 54(1), 15–36. Recuperado de http://www.ncbi.nlm.nih.gov/pubmed/8515840 Egashira, Y., Sugitani, S., Suzuki, Y., Mishiro, K., Tsuruma, K., Shimazawa, M., … Hara, H. (2012). The conditioned medium of murine and human adipose-derived stem cells exerts neuroprotective effects against experimental stroke model. Brain research, 1461, 87–95. Estrada-Rojo, F., Martínez-Tapia, R. J., Estrada-Bernal, F., Martínez-Vargas, M., Perez- Arredondo, A., Flores-Avalos, L., & Navarro, L. (2018). Models used in the study of traumatic brain injury. Reviews in the Neurosciences, 29(2), 139–149. https://doi.org/10.1515/revneuro-2017-0028 Faber-Elman, A., Lavie, V., Schvartz, I., Shaltiel, S., & Schwartz, M. (1995). Vitronectin overrides a negative effect of TNF-alpha on astrocyte migration. The FASEB journal, 193

9(15), 1605–1613. Falkowska, A., Gutowska, I., Goschorska, M., Nowacki, P., Chlubek, D., & Baranowska- Bosiacka, I. (2015). Energy Metabolism of the Brain, Including the Cooperation between Astrocytes and Neurons, Especially in the Context of Glycogen Metabolism. International Journal of Molecular Sciences, 16(11), 25959–25981. https://doi.org/10.3390/ijms161125939 Farzanegan, G. R., Derakhshan, N., Khalili, H., Ghaffarpasand, F., & Paydar, S. (2017). Effects of atorvastatin on brain contusion volume and functional outcome of patients with moderate and severe traumatic brain injury; a randomized double-blind placebo- controlled clinical trial. Journal of Clinical Neuroscience, 44, 143–147. https://doi.org/10.1016/j.jocn.2017.06.010 Faul, M., & Coronado, V. (2015). Epidemiology of traumatic brain injury (pp. 3–13). https://doi.org/10.1016/B978-0-444-52892-6.00001-5 Frese, L., Dijkman, P. E., & Hoerstrup, S. P. (2016). Adipose tissue-derived stem cells in regenerative medicine. Transfusion Medicine and Hemotherapy, 43(4), 268–274. Fuchs, C., Burmester, T., & Hankeln, T. (2006). The amphibian globin gene repertoire as revealed by the Xenopus genome. Cytogenetic and genome research, 112(3–4), 296–306. https://doi.org/10.1159/000089884 Gao, X.-Y., Huang, J.-O., Hu, Y.-F., Gu, Y., Zhu, S.-Z., Huang, K.-B., … Pan, S.-Y. (2015). Combination of mild hypothermia with neuroprotectants has greater neuroprotective effects during oxygen-glucose deprivation and reoxygenation-mediated neuronal injury. Scientific Reports, 4(1), 7091. https://doi.org/10.1038/srep07091 Gardner, O. F. W., Alini, M., & Stoddart, M. J. (2015). Mesenchymal Stem Cells Derived from Human Bone Marrow (pp. 41–52). https://doi.org/10.1007/978-1-4939-2938-2_3 Gerónimo-Olvera, C., Montiel, T., Rincon-Heredia, R., Castro-Obregón, S., & Massieu, L. (2017). Autophagy fails to prevent glucose deprivation/glucose reintroduction-induced neuronal death due to calpain-mediated lysosomal dysfunction in cortical neurons. Cell Death and Disease, 8(6), e2911. https://doi.org/10.1038/cddis.2017.299 Gil, N., Gómez, J. C., & Gómez, A. (2008). Radicales libres y lesión cerebral. Universitas Médica, 49(2). Gnecchi, M., Danieli, P., Malpasso, G., & Ciuffreda, M. C. (2016). Paracrine mechanisms of mesenchymal stem cells in tissue repair. En Mesenchymal Stem Cells (pp. 123–146). Springer. Gold, P. E. (1995). Role of glucose in regulating the brain and cognition. The American Journal of Clinical Nutrition, 61(4), 987S–995S. https://doi.org/10.1093/ajcn/61.4.987S Gold, P. E. (2005). Glucose and age-related changes in memory. Neurobiology of Aging, 26(1), 60–64. https://doi.org/10.1016/j.neurobiolaging.2005.09.002 González, H., Elgueta, D., Montoya, A., & Pacheco, R. (2014). Neuroimmune regulation of microglial activity involved in neuroinflammation and neurodegenerative diseases. Journal of neuroimmunology, 274(1–2), 1–13. Gotting, M., & Nikinmaa, M. (2015). More than hemoglobin - the unexpected diversity of globins in vertebrate red blood cells. Physiological Reports, 3(2), e12284–e12284. https://doi.org/10.14814/phy2.12284 Greenamyre, J. T., Betarbet, R., & Sherer, T. B. (2003). The rotenone model of Parkinson’s disease: genes, environment and mitochondria. Parkinsonism & related disorders, 9 Suppl 2, S59-64. Guadix, J. A., Zugaza, J. L., & Gálvez-Martín, P. (2017). Características, aplicaciones y 194

perspectivas de las células madre mesenquimales en terapia celular. Medicina Clínica, 148(9), 408–414. https://doi.org/10.1016/j.medcli.2016.11.033 Guo, Z., Sun, X., Xu, X., Zhao, Q., Peng, J., & Wang, Y. (2015). Human umbilical cord mesenchymal stem cells promote peripheral nerve repair via paracrine mechanisms. Neural regeneration research, 10(4), 651. Guzmán, F., Moreno, M. C., & Montoya, A. (2008). Evolución de los pacientes con trauma craneoencefálico en el Hospital Universitario del Valle: Seguimiento a 12 meses. Colombia Médica, 39, 25–28. Hamby, M. E., & Sofroniew, M. V. (2010). Reactive astrocytes as therapeutic targets for CNS disorders. Neurotherapeutics, 7(4), 494–506. Hao, P., Liang, Z., Piao, H., Ji, X., Wang, Y., Liu, Y., … Liu, J. (2014). Conditioned medium of human adipose-derived mesenchymal stem cells mediates protection in neurons following glutamate excitotoxicity by regulating energy metabolism and GAP-43 expression. Metabolic Brain Disease, 29(1), 193–205. https://doi.org/10.1007/s11011- 014-9490-y Harris, J., Jolivet, R., & Attwell, D. (2012). Synaptic Energy Use and Supply. Neuron, 75(5), 762–777. https://doi.org/10.1016/j.neuron.2012.08.019 Haugeto, O., Ullensvang, K., Levy, L. M., Chaudhry, F. A., Honore, T., Nielsen, M., … Danbolt, N. C. (1996). Brain Glutamate Transporter Proteins Form Homomultimers. Journal of Biological Chemistry, 271(44), 27715–27722. https://doi.org/10.1074/jbc.271.44.27715 Herrero-Mendez, A., Almeida, A., Fernández, E., Maestre, C., Moncada, S., & Bolaños, J. P. (2009). The bioenergetic and antioxidant status of neurons is controlled by continuous degradation of a key glycolytic enzyme by APC/C–Cdh1. Nature Cell Biology, 11(6), 747–752. https://doi.org/10.1038/ncb1881 Hoch, A. I., Binder, B. Y., Genetos, D. C., & Leach, J. K. (2012). Differentiation-dependent secretion of proangiogenic factors by mesenchymal stem cells. PloS one, 7(4), e35579. Hol, E. M., & Pekny, M. (2015). Glial fibrillary acidic protein (GFAP) and the astrocyte intermediate filament system in diseases of the central nervous system. Current Opinion in Cell Biology, 32, 121–130. https://doi.org/10.1016/j.ceb.2015.02.004 Huang, B., Cheng, X., Wang, H., Huang, W., Wang, D., Zhang, K., … Zhang, N. (2016). Mesenchymal stem cells and their secreted molecules predominantly ameliorate fulminant hepatic failure and chronic liver fibrosis in mice respectively. Journal of translational medicine, 14(1), 45. Huang, W., Lv, B., Zeng, H., Shi, D., Liu, Y., Chen, F., … Yu, L. (2015). Paracrine factors secreted by MSCs promote astrocyte survival associated with GFAP downregulation after ischemic stroke via p38 MAPK and JNK. Journal of Cellular Physiology, 230(10), 2461– 2475. Ivannikov, M. V., Sugimori, M., & Llinás, R. R. (2010). Calcium clearance and its energy requirements in cerebellar neurons. Cell Calcium, 47(6), 507–513. https://doi.org/10.1016/j.ceca.2010.04.004 Janowitz, T., & Menon, D. K. (2010). Exploring new routes for neuroprotective drug development in traumatic brain injury. Science translational medicine, 2(27), 27rv1- 27rv1. Jayaraman, T., Tejero, J., Chen, B. B., Blood, A. B., Frizzell, S., Shapiro, C., … Gladwin, M. T. (2011). 14-3-3 binding and phosphorylation of neuroglobin during hypoxia modulate six-to-five heme pocket coordination and rate of nitrite reduction to nitric oxide. The 195

Journal of biological chemistry, 286(49), 42679–42689. https://doi.org/10.1074/jbc.M111.271973 Jha, R. M., Kochanek, P. M., & Simard, J. M. (2018). Pathophysiology and treatment of cerebral edema in traumatic brain injury. Neuropharmacology. https://doi.org/10.1016/j.neuropharm.2018.08.004 Jiang, C.-L., & Lu, C.-L. (1998). Interleukin-2 and Its Effects in the Central Nervous System. Neurosignals, 7(3), 148–156. https://doi.org/10.1159/000014541 Jiang, R., Diaz-Castro, B., Looger, L. L., & Khakh, B. S. (2016). Dysfunctional Calcium and Glutamate Signaling in Striatal Astrocytes from Huntington’s Disease Model Mice. Journal of Neuroscience, 36(12), 3453–3470. https://doi.org/10.1523/JNEUROSCI.3693- 15.2016 Jing, L., He, M.-T., Chang, Y., Mehta, S. L., He, Q.-P., Zhang, J.-Z., & Li, P. A. (2015). Coenzyme Q10 Protects Astrocytes from ROS-Induced Damage through Inhibition of Mitochondria-Mediated Cell Death Pathway. International Journal of Biological Sciences, 11(1), 59–66. https://doi.org/10.7150/ijbs.10174 Johnson, K. M., Milner, R., & Crocker, S. J. (2015). Extracellular matrix composition determines astrocyte responses to mechanical and inflammatory stimuli. Neuroscience letters, 600, 104–109. Karve, I. P., Taylor, J. M., & Crack, P. J. (2016). The contribution of astrocytes and microglia to traumatic brain injury. British journal of pharmacology, 173(4), 692–702. Katayama, Y., Becker, D. P., Tamura, T., & Hovda, D. A. (1990). Massive increases in extracellular potassium and the indiscriminate release of glutamate following concussive brain injury. Journal of Neurosurgery, 73(6), 889–900. https://doi.org/10.3171/jns.1990.73.6.0889 Kawamata, T., Katayama, Y., Hovda, D. A., Yoshino, A., & Becker, D. P. (1992a). Administration of excitatory amino acid antagonists via microdialysis attenuates the increase in glucose utilization seen following concussive brain injury. Journal of Cerebral Blood Flow and Metabolism, 12(1), 12–24. https://doi.org/10.1038/jcbfm.1992.3 Kawamata, T., Katayama, Y., Hovda, D. A., Yoshino, A., & Becker, D. P. (1992b). Administration of Excitatory Amino Acid Antagonists via Microdialysis Attenuates the Increase in Glucose Utilization Seen following Concussive Brain Injury. Journal of Cerebral Blood Flow & Metabolism, 12(1), 12–24. https://doi.org/10.1038/jcbfm.1992.3 Kempuraj, D., Thangavel, R., Selvakumar, G. P., Zaheer, S., Ahmed, M. E., Raikwar, S. P., … Zaheer, A. (2017). Brain and Peripheral Atypical Inflammatory Mediators Potentiate Neuroinflammation and Neurodegeneration. Frontiers in Cellular Neuroscience, 11. https://doi.org/10.3389/fncel.2017.00216 Khalili, M. A., Anvari, M., Hekmati-Moghadam, S. H., Sadeghian-Nodoushan, F., Fesahat, F., & Miresmaeili, S. M. (2012). Therapeutic Benefit of Intravenous Transplantation of Mesenchymal Stem Cells After Experimental Subarachnoid Hemorrhage in Rats. Journal of Stroke and Cerebrovascular Diseases, 21(6), 445–451. https://doi.org/10.1016/j.jstrokecerebrovasdis.2010.10.005 Kilroy, G. E., Foster, S. J., Wu, X., Ruiz, J., Sherwood, S., Heifetz, A., … Gimble, J. M. (2007). Cytokine profile of human adipose-derived stem cells: Expression of angiogenic, hematopoietic, and pro-inflammatory factors. Journal of Cellular Physiology, 212(3), 702–709. https://doi.org/10.1002/jcp.21068 Kim, S., Han, S. C., Gallan, A. J., & Hayes, J. P. (2017). Neurometabolic indicators of 196

mitochondrial dysfunction in repetitive mild traumatic brain injury. Concussion, 2(3), CNC45. https://doi.org/10.2217/cnc-2017-0013 Kimelberg, H. K. (2010). Functions of Mature Mammalian Astrocytes: A Current View. The Neuroscientist, 16(1), 79–106. https://doi.org/10.1177/1073858409342593 King, A., & Gottlieb, E. (2009). Glucose metabolism and programmed cell death: an evolutionary and mechanistic perspective. Current Opinion in Cell Biology, 21(6), 885– 893. https://doi.org/10.1016/j.ceb.2009.09.009 Kiseleva, L. N., Kartashev, A. V., Vartanyan, N. L., Pinevich, A. A., & Samoilovich, M. P. (2016). A172 and T98G cell lines characteristics. Cell and Tissue Biology, 10(5), 341– 348. https://doi.org/10.1134/S1990519X16050072 Kokiko-Cochran, O. N., & Godbout, J. P. (2018). The Inflammatory Continuum of Traumatic Brain Injury and Alzheimer’s Disease. Frontiers in Immunology, 9. https://doi.org/10.3389/fimmu.2018.00672 Korol, D. L., & Gold, P. E. (1998). Glucose, memory, and aging. The American Journal of Clinical Nutrition, 67(4), 764S–771S. https://doi.org/10.1093/ajcn/67.4.764S Kubik, L. L., & Philbert, M. A. (2015). The Role of Astrocyte Mitochondria in Differential Regional Susceptibility to Environmental Neurotoxicants: Tools for Understanding Neurodegeneration. Toxicological Sciences, 144(1), 7–16. https://doi.org/10.1093/toxsci/kfu254 Kupcova Skalnikova, H. (2013). Proteomic techniques for characterisation of mesenchymal stem cell secretome. Biochimie, 95(12), 2196–2211. https://doi.org/10.1016/j.biochi.2013.07.015 Kyryachenko, S., Formicola, L., Ollitrault, D., Correra, R., Denizot, A.-L., Kyrylkova, K., … Sassoon, D. A. (2016). The Adult Stem Cell Niche: Multiple Cellular Players in Tissue Homeostasis and Regeneration. En Encyclopedia of Cell Biology (pp. 794–806). Elsevier. https://doi.org/10.1016/B978-0-12-394447-4.30118-3 Lai, R. C., Chen, T. S., & Lim, S. K. (2011). Mesenchymal stem cell exosome: a novel stem cell-based therapy for cardiovascular disease. Regenerative Medicine, 6(4), 481–492. https://doi.org/10.2217/rme.11.35 Laird, D. J., von Andrian, U. H., & Wagers, A. J. (2008). Stem Cell Trafficking in Tissue Development, Growth, and Disease. Cell, 132(4), 612–630. https://doi.org/10.1016/j.cell.2008.01.041 LaPlaca, M. C., Prado, G. R., Kacy Cullen, D., & Simon, C. M. (2009). Plasma membrane damage as a marker of neuronal injury. En 2009 Annual International Conference of the IEEE Engineering in Medicine and Biology Society (pp. 1113–1116). IEEE. https://doi.org/10.1109/IEMBS.2009.5334457 LaPlaca, M. C., Simon, C. M., Prado, G. R., & Cullen, D. K. (2007). CNS injury biomechanics and experimental models (pp. 13–26). https://doi.org/10.1016/S0079- 6123(06)61002-9 Lavoie, J. R., & Rosu-Myles, M. (2013). Uncovering the secretes of mesenchymal stem cells. Biochimie, 95(12), 2212–2221. https://doi.org/10.1016/j.biochi.2013.06.017 Lechauve, C., Augustin, S., Roussel, D., Sahel, J.-A., & Corral-Debrinski, M. (2013). Neuroglobin involvement in visual pathways through the optic nerve. Biochimica et Biophysica Acta (BBA)-Proteins and Proteomics, 1834(9), 1772–1778. LeDoux, S. P., Druzhyna, N. M., Hollensworth, S. B., Harrison, J. F., & Wilson, G. L. (2007). Mitochondrial DNA repair: a critical player in the response of cells of the CNS to genotoxic insults. Neuroscience, 145(4), 1249–1259. 197

https://doi.org/10.1016/j.neuroscience.2006.10.002 Lee, D. E., Ayoub, N., & Agrawal, D. K. (2016). Mesenchymal stem cells and cutaneous wound healing: novel methods to increase cell delivery and therapeutic efficacy. Stem cell research & therapy, 7(1), 37. Lee, H.-Y., & Hong, I.-S. (2017). Double-edged sword of mesenchymal stem cells: Cancer- promoting versus therapeutic potential. Cancer Science, 108(10), 1939–1946. https://doi.org/10.1111/cas.13334 Lee, M.-C., Yasuda, R., & Ehlers, M. D. (2010). Metaplasticity at single glutamatergic synapses. Neuron, 66(6), 859–870. https://doi.org/10.1016/j.neuron.2010.05.015 Lee, V. Y. (2002). Hypoxia Sensitizes Cells to Nitric Oxide-induced Apoptosis. Journal of Biological Chemistry, 277(18), 16067–16074. https://doi.org/10.1074/jbc.M111177200 Levin, H. S., & Diaz-Arrastia, R. R. (2015). Diagnosis, prognosis, and clinical management of mild traumatic brain injury. The Lancet Neurology, 14(5), 506–517. https://doi.org/10.1016/S1474-4422(15)00002-2 Lin, J. H.-C., Weigel, H., Cotrina, M. L., Liu, S., Bueno, E., Hansen, A. J., … Nedergaard, M. (1998). Gap-junction-mediated propagation and amplification of cell injury. Nature Neuroscience, 1(6), 494–500. https://doi.org/10.1038/2210 Linero, I., & Chaparro, O. (2014). Paracrine Effect of Mesenchymal Stem Cells Derived from Human Adipose Tissue in Bone Regeneration. PLoS ONE, 9(9), e107001. https://doi.org/10.1371/journal.pone.0107001 Liu, F., Lu, J., Manaenko, A., Tang, J., & Hu, Q. (2018). Mitochondria in Ischemic Stroke: New Insight and Implications. Aging and disease, 9(5), 924. https://doi.org/10.14336/AD.2017.1126 Liu, Y., Kintner, D. B., Begum, G., Algharabli, J., Cengiz, P., Shull, G. E., … Sun, D. (2010). Endoplasmic reticulum Ca2+ signaling and mitochondrial Cyt c release in astrocytes following oxygen and glucose deprivation. Journal of Neurochemistry, no-no. https://doi.org/10.1111/j.1471-4159.2010.06862.x Lutas, A., & Yellen, G. (2013). The ketogenic diet: metabolic influences on brain excitability and epilepsy. Trends in Neurosciences, 36(1), 32–40. https://doi.org/10.1016/j.tins.2012.11.005 Magistretti, P., & Ransom, B. (2002). ASTROCYTES. (K. Davis, D. Charney, J. Coyle, & C. Nemeroff., Eds.), Neuropsychopharmacology: The Fifth Generation of Progress. American College of Neuropsychopharmacology. Magnoni, S., Tedesco, C., Carbonara, M., Pluderi, M., Colombo, A., & Stocchetti, N. (2012). Relationship between systemic glucose and cerebral glucose is preserved in patients with severe traumatic brain injury, but glucose delivery to the brain may become limited when oxidative metabolism is impaired. Critical Care Medicine, 40(6), 1785–1791. https://doi.org/10.1097/CCM.0b013e318246bd45 Mahmoudifar, N., & Doran, P. M. (2015). Mesenchymal Stem Cells Derived from Human Adipose Tissue (pp. 53–64). https://doi.org/10.1007/978-1-4939-2938-2_4 Mammen, P. P. A., Shelton, J. M., Goetsch, S. C., Williams, S. C., Richardson, J. A., Garry, M. G., & Garry, D. J. (2002). Neuroglobin, A Novel Member of the Globin Family, Is Expressed in Focal Regions of the Brain. Journal of Histochemistry & Cytochemistry, 50(12), 1591–1598. https://doi.org/10.1177/002215540205001203 Maragakis, N. J., & Rothstein, J. D. (2006). Mechanisms of Disease: astrocytes in neurodegenerative disease. Nature Clinical Practice Neurology, 2(12), 679–689. https://doi.org/10.1038/ncpneuro0355 198

Marion, D. W., Penrod, L. E., Kelsey, S. F., Obrist, W. D., Kochanek, P. M., Palmer, A. M., … DeKosky, S. T. (1997). Treatment of Traumatic Brain Injury with Moderate Hypothermia. New England Journal of Medicine, 336(8), 540–546. https://doi.org/10.1056/NEJM199702203360803 Marklund, N., & Hillered, L. (2011). Animal modelling of traumatic brain injury in preclinical drug development: where do we go from here? British journal of pharmacology, 164(4), 1207–1229. Martello, G., & Smith, A. (2014). The Nature of Embryonic Stem Cells. Annual Review of Cell and Developmental Biology, 30(1), 647–675. https://doi.org/10.1146/annurev- cellbio-100913-013116 Mavroeidi, P., Mavrofrydi, O., Pappa, E., Panopoulou, M., Papazafiri, P., Haralambous, S., & Efthimiopoulos, S. (2017). Oxygen and Glucose Deprivation Alter Synaptic Distribution of Tau Protein: The Role of Phosphorylation. Journal of Alzheimer’s Disease, 60(2), 593–604. https://doi.org/10.3233/JAD-170157 Medina-Ceja, L., Guerrero-cazares, H., Canales-aguirre, A., Morales-Villagrán, A., & Feria- Velasco, A. (2007). Características estructurales y funcionales de los transportadores de glutamato : su relación con la epilepsia y el estrés oxidativo. Rev Neurol, 45(6), 341–352. Mergenthaler, P., Kahl, A., Kamitz, A., van Laak, V., Stohlmann, K., Thomsen, S., … Meisel, A. (2012). Mitochondrial hexokinase II (HKII) and phosphoprotein enriched in astrocytes (PEA15) form a molecular switch governing cellular fate depending on the metabolic state. Proceedings of the National Academy of Sciences, 109(5), 1518–1523. https://doi.org/10.1073/pnas.1108225109 Mergenthaler, P., Kahl, A., Kamitz, A., van Laak, V., Stohlmann, K., Thomsen, S., … Meisel, A. (2012). Mitochondrial hexokinase II (HKII) and phosphoprotein enriched in astrocytes (PEA15) form a molecular switch governing cellular fate depending on the metabolic state. Proceedings of the National Academy of Sciences, 109(5), 1518–1523. https://doi.org/10.1073/pnas.1108225109 Mergenthaler, P., Lindauer, U., Dienel, G. a., & Meisel, A. (2013). Sugar for the brain: the role of glucose in physiological and pathological brain function. Trends in Neurosciences, 36(10), 587–597. https://doi.org/10.1016/j.tins.2013.07.001 Mimura, J., Kosaka, K., Maruyama, A., Satoh, T., Harada, N., Yoshida, H., … Itoh, K. (2011). Nrf2 regulates NGF mRNA induction by carnosic acid in T98G glioblastoma cells and normal human astrocytes. The Journal of Biochemistry, 150(2), 209–217. Mita, T., Furukawa-Hibi, Y., Takeuchi, H., Hattori, H., Yamada, K., Hibi, H., … Yamamoto, A. (2015). Conditioned medium from the stem cells of human dental pulp improves cognitive function in a mouse model of Alzheimer’s disease. Behavioural Brain Research, 293, 189–197. Mola, M. G., Sparaneo, A., Gargano, C. D., Spray, D. C., Svelto, M., Frigeri, A., … Nicchia, G. P. (2016). The speed of swelling kinetics modulates cell volume regulation and calcium signaling in astrocytes: A different point of view on the role of aquaporins. Glia, 64(1), 139–154. https://doi.org/10.1002/glia.22921 Morrison, B., Saatman, K. E., Meaney, D. F., & Mcintosh, T. K. (1998). In Vitro Central Nervous System Models of Mechanically Induced Trauma: A Review. Journal of Neurotrauma, 15(11), 911–928. https://doi.org/10.1089/neu.1998.15.911 Musen, G., Jacobson, A. M., Bolo, N. R., Simonson, D. C., Shenton, M. E., McCartney, R. L., … Hoogenboom, W. S. (2012). Resting-State Brain Functional Connectivity Is Altered in Type 2 Diabetes. Diabetes, 61(9), 2375–2379. https://doi.org/10.2337/db11-1669 199 Myer, D. J. (2006). Essential protective roles of reactive astrocytes in traumatic brain injury. Brain, 129(10), 2761–2772. https://doi.org/10.1093/brain/awl165 Norenberg, M. D. (1994). Astrocyte responses to CNS injury. Journal of neuropathology and experimental neurology, 53(3), 213–220. Recuperado de http://www.ncbi.nlm.nih.gov/pubmed/8176405 Ohsumi, A., Nawashiro, H., Otani, N., Ooigawa, H., Toyooka, T., & Shima, K. (2010). Temporal and Spatial Profile of Phosphorylated Connexin43 after Traumatic Brain Injury in Rats. Journal of Neurotrauma, 27(7), 1255–1263. https://doi.org/10.1089/neu.2009.1234 Oliveira, K. C., da Conceição, R. R., Piedade, G. C., de Souza, J. S., Sato, M. A., de Barros Maciel, R. M., & Giannocco, G. (2015). Thyroid hormone modulates neuroglobin and cytoglobin in rat brain. Metabolic Brain Disease. https://doi.org/10.1007/s11011-015- 9718-5 Organization, W. H. (2006). Neurological disorders: public health challenges. World Health Organization. Osteen, C. L., Moore, A. H., Prins, M. L., & Hovda, D. A. (2001). Age-Dependency of 45 Calcium Accumulation Following Lateral Fluid Percussion: Acute and Delayed Patterns. Journal of Neurotrauma, 18(2), 141–162. https://doi.org/10.1089/08977150150502587 Ouyang, Y.-B., Xu, L.-J., Emery, J. F., Lee, A. S., & Giffard, R. G. (2011). Overexpressing GRP78 influences Ca2+ handling and function of mitochondria in astrocytes after ischemia-like stress. Mitochondrion, 11(2), 279–286. https://doi.org/10.1016/j.mito.2010.10.007 Panickar, K. S., & Norenberg, M. D. (2005). Astrocytes in cerebral ischemic injury: morphological and general considerations. Glia, 50(4), 287–298. Pannasch, U., & Rouach, N. (2013). Emerging role for astroglial networks in information processing: from synapse to behavior. Trends in Neurosciences, 36(7), 405–417. https://doi.org/10.1016/j.tins.2013.04.004 Park, I.-H., Lerou, P. H., Zhao, R., Huo, H., & Daley, G. Q. (2008). Generation of human- induced pluripotent stem cells. Nature Protocols, 3(7), 1180–1186. https://doi.org/10.1038/nprot.2008.92 Patel, V. P., & Chu, C. T. (2011). Nuclear transport, oxidative stress, and neurodegeneration. International journal of clinical and experimental pathology, 4(3), 215–229. Pawitan, J. A. (2014). Prospect of stem cell conditioned medium in regenerative medicine. BioMed research international, 2014. Pedraza-Alva, G., Pérez-Martínez, L., Valdez-Hernández, L., Meza-Sosa, K. F., & Ando-Kuri, M. (2015). Negative regulation of the inflammasome: keeping inflammation under control. Immunological reviews, 265(1), 231–257. Pekny, M., & Pekna, M. (2016). Reactive gliosis in the pathogenesis of CNS diseases. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease, 1862(3), 483–491. Pekny, M., Pekna, M., Messing, A., Steinhäuser, C., Lee, J.-M., Parpura, V., … Verkhratsky, A. (2016). Astrocytes: a central element in neurological diseases. Acta neuropathologica, 131(3), 323–345. Pellerin, L., & Magistretti, P. J. (2012). Sweet sixteen for ANLS. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 32(7), 1152–1166. https://doi.org/10.1038/jcbfm.2011.149 Pennypacker, K. R., Kassed, C. A., Eidizadeh, S., & O’Callaghan, J. P. (2000). Brain injury: prolonged induction of transcription factors. Acta neurobiologiae experimentalis, 60(4), 200

515–530. Recuperado de http://www.ncbi.nlm.nih.gov/pubmed/11200181 Petgrave-Pérez, A., Padilla, J. I., Díaz, J., Chacón, R., Chaves, C., Torres, H., & Fernández, J. (2016). Perfil epidemiológico del traumatismo craneoencefálico en el Servicio de Neurocirugía del Hospital Dr. Rafael A. Calderón Guardia durante el período 2007 a 2012. Neurocirugía, 27(3), 112–120. https://doi.org/10.1016/j.neucir.2015.10.003 Phan, J., Kumar, P., Hao, D., Gao, K., Farmer, D., & Wang, A. (2018). Engineering mesenchymal stem cells to improve their exosome efficacy and yield for cell-free therapy. Journal of extracellular vesicles, 7(1), 1522236. https://doi.org/10.1080/20013078.2018.1522236 Phelps, J., Sanati-Nezhad, A., Ungrin, M., Duncan, N. A., & Sen, A. (2018). Bioprocessing of Mesenchymal Stem Cells and Their Derivatives: Toward Cell-Free Therapeutics. Stem cells international, 2018, 9415367. https://doi.org/10.1155/2018/9415367 Prieto, R., Gutiérrez-González, R., Pascual, J. M., Roda, J. M., Cerdán, S., Matias-Guiu, J., & Barcia, J. A. (2009). Modelos experimentales de traumatismo craneoencefálico. Neurocirugía, 20(3), 225–244. Prins, M., Greco, T., Alexander, D., & Giza, C. C. (2013a). The pathophysiology of traumatic brain injury at a glance. Disease Models & Mechanisms, 6(6), 1307–1315. https://doi.org/10.1242/dmm.011585 Prins, M., Greco, T., Alexander, D., & Giza, C. C. (2013b). The pathophysiology of traumatic brain injury at a glance. Disease Models & Mechanisms, 6(6), 1307–1315. https://doi.org/10.1242/dmm.011585 Quijano, M. C., Cuervo, M. T., Aponte, M., & Arango, J. C. (2012). Neuropsicología del trauma craneoencefálico en Cali, Colombia. Revista Ciencias de la Salud, 10(1), 21–31. Ramachandran, A., Ranjit, A., Zogg, C. K., Herrera-Escobar, J. P., Appelson, J. R., Pino, L. F., … Ordonez, C. A. (2017). Comparison of Epidemiology of the Injuries and Outcomes in Two First-Level Trauma Centers in Colombia Using the Pan-American Trauma Registry System. World Journal of Surgery, 41(9), 2224–2230. https://doi.org/10.1007/s00268-017-4013-8 Rampelt, H., Zerbes, R. M., van der Laan, M., & Pfanner, N. (2017). Role of the mitochondrial contact site and cristae organizing system in membrane architecture and dynamics. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, 1864(4), 737–746. https://doi.org/10.1016/j.bbamcr.2016.05.020 Regner, A., Meirelles, L. da S., Ikuta, N., Cecchini, A., & Simon, D. (2018). Prognostic utility of circulating nucleic acids in acute brain injuries. Expert Review of Molecular Diagnostics, 1–14. https://doi.org/10.1080/14737159.2018.1535904 Ricci, G., Volpi, L., Pasquali, L., Petrozzi, L., & Siciliano, G. (2009). Astrocyte–neuron interactions in neurological disorders. Journal of Biological Physics, 35(4), 317–336. https://doi.org/10.1007/s10867-009-9157-9 Ridet, J. L., Malhotra, S. K., Privat, A., & Gage, F. H. (1997). Reactive astrocytes: cellular and molecular cues to biological function. Trends in neurosciences, 20(12), 570–577. Recuperado de http://www.ncbi.nlm.nih.gov/pubmed/9416670 Ridge, S. M., Sullivan, F. J., & Glynn, S. A. (2017). Mesenchymal stem cells: key players in cancer progression. Molecular Cancer, 16(1), 31. https://doi.org/10.1186/s12943-017- 0597-8 Risdall, J. E., & Menon, D. K. (2011). Traumatic brain injury. Philosophical Transactions of the Royal Society B: Biological Sciences, 366(1562), 241–250. https://doi.org/10.1098/rstb.2010.0230 201

Rodriguez-Rodriguez, A., Jose Egea-Guerrero, J., Murillo-Cabezas, F., & Carrillo-Vico, A. (2014). Oxidative stress in traumatic brain injury. Current medicinal chemistry, 21(10), 1201–1211. Rothhammer, V., & Quintana, F. J. (2015). Control of autoimmune CNS inflammation by astrocytes. Seminars in Immunopathology, 37(6), 625–638. https://doi.org/10.1007/s00281-015-0515-3 Sahuquillo, J. (2006). Decompressive craniectomy for the treatment of refractory high intracranial pressure in traumatic brain injury. Cochrane Database of Systematic Reviews. https://doi.org/10.1002/14651858.CD003983.pub2 Salgado, A. J., Fraga, J. S., Mesquita, A. R., Neves, N. M., Reis, R. L., & Sousa, N. (2009). Role of human umbilical cord mesenchymal progenitors conditioned media in neuronal/glial cell densities, viability, and proliferation. Stem cells and development, 19(7), 1067–1074. Salgado, A. J., Sousa, J. C., Costa, B. M., Pires, A. O., Mateus-Pinheiro, A., Teixeira, F. G., … Sousa, N. (2015). Mesenchymal stem cells secretome as a modulator of the neurogenic niche: basic insights and therapeutic opportunities. Frontiers in cellular neuroscience, 9, 249. Sarkar, C., Zhao, Z., Aungst, S., Sabirzhanov, B., Faden, A. I., & Lipinski, M. M. (2014). Impaired autophagy flux is associated with neuronal cell death after traumatic brain injury. Autophagy, 10(12), 2208–2222. https://doi.org/10.4161/15548627.2014.981787 Sasaki, S., Futagi, Y., Kobayashi, M., Ogura, J., & Iseki, K. (2015). Functional characterization of 5-oxoproline transport via SLC16A1/MCT1. Journal of Biological Chemistry, 290(4), 2303–2311. Satchell, M. A., Zhang, X., Kochanek, P. M., Dixon, C. E., Jenkins, L. W., Melick, J., … Clark, R. S. B. (2003). A dual role for poly-ADP-ribosylation in spatial memory acquisition after traumatic brain injury in mice involving NAD+ depletion and ribosylation of 14-3-3gamma. Journal of neurochemistry, 85(3), 697–708. Recuperado de http://www.ncbi.nlm.nih.gov/pubmed/12694396 Schäffler, A., & Büchler, C. (2007). Concise Review: Adipose Tissue-Derived Stromal Cells- Basic and Clinical Implications for Novel Cell-Based Therapies. Stem Cells, 25(4), 818– 827. https://doi.org/10.1634/stemcells.2006-0589 Scheibe, F., Klein, O., Klose, J., & Priller, J. (2012). Mesenchymal stromal cells rescue cortical neurons from apoptotic cell death in an in vitro model of cerebral ischemia. Cellular and molecular neurobiology, 32(4), 567–576. Schlenk, F., Nagel, A., Graetz, D., & Sarrafzadeh, A. S. (2008). Hyperglycemia and cerebral glucose in aneurysmal subarachnoid hemorrhage. Intensive Care Medicine, 34(7), 1200– 1207. https://doi.org/10.1007/s00134-008-1044-5 Schousboe, A., & Waagepetersen, H. S. (2006). Glial modulation of GABAergic and glutamat ergic neurotransmission. Current topics in medicinal chemistry, 6(10), 929–934. Recuperado de http://www.ncbi.nlm.nih.gov/pubmed/16787266 Semedo, P., Burgos-Silva, M., Donizetti-Oliveira, C., & Camara, N. O. S. (2011). How do mesenchymal stem cells repair? En Stem Cells in Clinic and Research. InTech. Shah, K., DeSilva, S., & Abbruscato, T. (2012). The Role of Glucose Transporters in Brain Disease: Diabetes and Alzheimer’s Disease. International Journal of Molecular Sciences, 13(12), 12629–12655. https://doi.org/10.3390/ijms131012629 Shen, C., Lie, P., Miao, T., Yu, M., Lu, Q., Feng, T., … Li, H. (2015). Conditioned medium from umbilical cord mesenchymal stem cells induces migration and angiogenesis. 202

Molecular medicine reports, 12(1), 20–30. Shi, J., Dong, B., Mao, Y., Guan, W., Cao, J., Zhu, R., & Wang, S. (2016). Review: Traumatic brain injury and hyperglycemia, a potentially modifiable risk factor. Oncotarget, 7(43). https://doi.org/10.18632/oncotarget.11958 Shih, A. Y., Johnson, D. A., Wong, G., Kraft, A. D., Jiang, L., Erb, H., … Murphy, T. H. (2003). Coordinate regulation of glutathione biosynthesis and release by Nrf2-expressing glia potently protects neurons from oxidative stress. The Journal of neuroscience : the official journal of the Society for Neuroscience, 23(8), 3394–3406. Shoichet, M. S., Tate, C. C., Baumann, M. D., & LaPlaca, M. C. (2008). Strategies for Regeneration and Repair in the Injured Central Nervous System. Indwelling Neural Implants: Strategies for Contending with the In Vivo Environment. Recuperado de http://www.ncbi.nlm.nih.gov/pubmed/21204406 Shologu, N., Scully, M., Laffey, J. G., & O’Toole, D. (2018). Human Mesenchymal Stem Cell Secretome from Bone Marrow or Adipose-Derived Tissue Sources for Treatment of Hypoxia-Induced Pulmonary Epithelial Injury. International journal of molecular sciences, 19(10). https://doi.org/10.3390/ijms19102996 Singh, G., Siddiqui, M. a., Khanna, V. K., Kashyap, M. P., Yadav, S., Gupta, Y. K., … Pant, a. B. (2009). Oxygen Glucose Deprivation Model of Cerebral Stroke in PC-12 Cells: Glucose as a Limiting Factor. Toxicology Mechanisms and Methods, 19(2), 154–160. https://doi.org/10.1080/15376510802355216 Skalnikova, H. K. (2013). Proteomic techniques for characterisation of mesenchymal stem cell secretome. Biochimie, 95(12), 2196–2211. Sochocka, M., Diniz, B. S., & Leszek, J. (2017). Inflammatory response in the CNS: friend or foe? Molecular neurobiology, 54(10), 8071–8089. Sofroniew, M. V, & Vinters, H. V. (2010). Astrocytes: biology and pathology. Acta Neuropathologica, 119(1), 7–35. https://doi.org/10.1007/s00401-009-0619-8 Sokoloff, L. (2008). The physiological and biochemical bases of functional brain imaging. Cognitive Neurodynamics, 2(1), 1–5. https://doi.org/10.1007/s11571-007-9033-x Song, M., Jue, S., Cho, Y., & Kim, E. (2015). Comparison of the effects of human dental pulp stem cells and human bone marrow-derived mesenchymal stem cells on ischemic human astrocytes in vitro. Journal of neuroscience research, 93(6), 973–983. Starkov, A. A., Chinopoulos, C., & Fiskum, G. (2004). Mitochondrial calcium and oxidative stress as mediators of ischemic brain injury. Cell Calcium, 36(3–4), 257–264. https://doi.org/10.1016/j.ceca.2004.02.012 Steele, M. L., & Robinson, S. R. (2012). Reactive astrocytes give neurons less support: implications for Alzheimer’s disease. Neurobiology of Aging, 33(2), 423.e1-423.e13. https://doi.org/10.1016/j.neurobiolaging.2010.09.018 Stein, G. H. (1979). T98G: An anchorage-independent human tumor cell line that exhibits stationary phase G1 arrest in vitro. Journal of Cellular Physiology, 99(1), 43–54. https://doi.org/10.1002/jcp.1040990107 Stephenson, J., Nutma, E., van der Valk, P., & Amor, S. (2018). Inflammation in CNS neurodegenerative diseases. Immunology. https://doi.org/10.1111/imm.12922 Stetler, R. A., Leak, R. K., Gao, Y., & Chen, J. (2013). The Dynamics of the Mitochondrial Organelle as a Potential Therapeutic Target. Journal of Cerebral Blood Flow & Metabolism, 33(1), 22–32. https://doi.org/10.1038/jcbfm.2012.158 Sulhan, S., Lyon, K. A., Shapiro, L. A., & Huang, J. H. (2018). Neuroinflammation and blood- brain barrier disruption following traumatic brain injury: Pathophysiology and potential 203

therapeutic targets. Journal of Neuroscience Research. https://doi.org/10.1002/jnr.24331 Sullivan, P. G., Keller, J. N., Bussen, W. L., & Scheff, S. W. (2002). Cytochrome c release and caspase activation after traumatic brain injury. Brain research, 949(1–2), 88–96. Recuperado de http://www.ncbi.nlm.nih.gov/pubmed/12213303 Sun, D., & Jakobs, T. C. (2012). Structural remodeling of astrocytes in the injured CNS. The Neuroscientist, 18(6), 567–588. Sun, H., Bénardais, K., Stanslowsky, N., Thau-Habermann, N., Hensel, N., Huang, D., … Petri, S. (2013). Therapeutic potential of mesenchymal stromal cells and MSC conditioned medium in amyotrophic lateral sclerosis (ALS)-in vitro evidence from primary motor neuron cultures, NSC-34 cells, astrocytes and microglia. PloS one, 8(9), e72926. Suzuki, A., Stern, S. A., Bozdagi, O., Huntley, G. W., Walker, R. H., Magistretti, P. J., & Alberini, C. M. (2011). Astrocyte-Neuron Lactate Transport Is Required for Long-Term Memory Formation. Cell, 144(5), 810–823. https://doi.org/10.1016/j.cell.2011.02.018 Szczygielski, J., Glameanu, C., Müller, A., Klotz, M., Sippl, C., Hubertus, V., … Oertel, J. (2018). Changes in Posttraumatic Brain Edema in Craniectomy-Selective Brain Hypothermia Model Are Associated With Modulation of Aquaporin-4 Level. Frontiers in Neurology, 9. https://doi.org/10.3389/fneur.2018.00799 Takano, T., Oberheim, N., Cotrina, M. L., & Nedergaard, M. (2009). Astrocytes and Ischemic Injury. Stroke, 40(3, Supplement 1), S8–S12. https://doi.org/10.1161/STROKEAHA.108.533166 Tani, K. (2015). Towards the safer clinical translation of human induced pluripotent stem cell– derived cells to regenerative medicine. Molecular Therapy - Methods & Clinical Development, 2, 15032. https://doi.org/10.1038/mtm.2015.32 Taylor, J. M., Kelley, B., Gregory, E. J., & Berman, N. E. J. (2014). Neuroglobin overexpression improves sensorimotor outcomes in a mouse model of traumatic brain injury. Neuroscience Letters, 577, 125–129. https://doi.org/10.1016/j.neulet.2014.03.012 Teixeira, F. G., Carvalho, M. M., Neves-Carvalho, A., Panchalingam, K. M., Behie, L. A., Pinto, L., … Salgado, A. J. (2015). Secretome of mesenchymal progenitors from the umbilical cord acts as modulator of neural/glial proliferation and differentiation. Stem Cell Reviews and Reports, 11(2), 288–297. Toma, C., Pittenger, M. F., Cahill, K. S., Byrne, B. J., & Kessler, P. D. (2002). Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation, 105(1), 93–98. Recuperado de http://www.ncbi.nlm.nih.gov/pubmed/11772882 Toro-Urrego, N., Garcia-Segura, L. M., Echeverria, V., & Barreto, G. E. (2016). Testosterone protects mitochondrial function and regulates neuroglobin expression in astrocytic cells exposed to glucose deprivation. Frontiers in aging neuroscience, 8, 152. Torrente, D., Avila, M. F., Cabezas, R., Morales, L., Gonzalez, J., Samudio, I., & Barreto, G. E. (2014). Paracrine factors of human mesenchymal stem cells increase wound closure and reduce reactive oxygen species production in a traumatic brain injury in vitro model. Human & experimental toxicology, 33(7), 673–684. Tuttolomondo, A., Di Sciacca, R., Di Raimondo, D., Arnao, V., Renda, C., Pinto, A., & Licata, G. (2009). Neuron protection as a therapeutic target in acute ischemic stroke. Current topics in medicinal chemistry, 9(14), 1317–1334. Recuperado de http://www.ncbi.nlm.nih.gov/pubmed/19849659 Uccelli, A., Pistoia, V., & Moretta, L. (2007). Mesenchymal stem cells: a new strategy for 204

immunosuppression? Trends in Immunology, 28(5), 219–226. https://doi.org/10.1016/j.it.2007.03.001 Vagnozzi, R., Marmarou, A., Tavazzi, B., Signoretti, S., Di Pierro, D., Del Bolgia, F., … Lazzarino, G. (1999). Changes of Cerebral Energy Metabolism and Lipid Peroxidation in Rats Leading to Mitochondrial Dysfunction After Diffuse Brain Injury. Journal of Neurotrauma, 16(10), 903– 913. https://doi.org/10.1089/neu.1999.16.903 Vavilis, T., Delivanoglou, N., Aggelidou, E., Stamoula, E., Mellidis, K., Kaidoglou, A., … Kritis, A. (2015). Oxygen–Glucose Deprivation (OGD) Modulates the Unfolded Protein Response (UPR) and Inflicts Autophagy in a PC12 Hypoxia Cell Line Model. Cellular and Molecular Neurobiology. https://doi.org/10.1007/s10571-015-0250-2 Vavilis, T., Delivanoglou, N., Aggelidou, E., Stamoula, E., Mellidis, K., Kaidoglou, A., … Kritis, A. (2016). Oxygen–Glucose Deprivation (OGD) Modulates the Unfolded Protein Response (UPR) and Inflicts Autophagy in a PC12 Hypoxia Cell Line Model. Cellular and Molecular Neurobiology, 36(5), 701–712. https://doi.org/10.1007/s10571-015-0250- 2 Venugopal, C., Shobha, K., Rai, K. S., Pinnelli, V. B., Kutty, B. M., & Dhanushkodi, A. (2018). Neuroprotection by Human Dental Pulp Mesenchymal Stem Cells: From Billions to Nano. Current Gene Therapy, 18. https://doi.org/10.2174/1566523218666180913152615 Vergun, O., Keelan, J., Khodorov, B. I., & Duchen, M. R. (1999). Glutamate-induced mitochondrial depolarisation and perturbation of calcium homeostasis in cultured rat hippocampal neurones. The Journal of physiology, 519 Pt 2, 451–466. Recuperado de http://www.ncbi.nlm.nih.gov/pubmed/10457062 Verkhratsky, A., Rodríguez, J. J., & Parpura, V. (2012). Calcium signalling in astroglia. Molecular and Cellular Endocrinology, 353(1–2), 45–56. https://doi.org/10.1016/j.mce.2011.08.039 Vizoso, F., Eiro, N., Cid, S., Schneider, J., & Perez-Fernandez, R. (2017). Mesenchymal Stem Cell Secretome: Toward Cell-Free Therapeutic Strategies in Regenerative Medicine. International Journal of Molecular Sciences, 18(9), 1852. https://doi.org/10.3390/ijms18091852 Volarevic, V., Markovic, B. S., Gazdic, M., Volarevic, A., Jovicic, N., Arsenijevic, N., … Stojkovic, M. (2018). Ethical and Safety Issues of Stem Cell-Based Therapy. International Journal of Medical Sciences, 15(1), 36–45. https://doi.org/10.7150/ijms.21666 Voloboueva, L. a., Suh, S. W., Swanson, R. a., & Giffard, R. G. (2007). Inhibition of mitochondrial function in astrocytes: implications for neuroprotection. Journal of Neurochemistry, 102(4), 1383–1394. https://doi.org/10.1111/j.1471-4159.2007.04634.x Walter, M. N. M., Kohli, N., Khan, N., Major, T., Fuller, H., Wright, K. T., … Johnson, W. E. B. (2015). Human mesenchymal stem cells stimulate EaHy926 endothelial cell migration: combined proteomic and in vitro analysis of the influence of donor-donor variability. Journal of stem cells & regenerative medicine, 11(1), 18. Wang, H., Cao, H., Zhang, X., Ge, L., & Bie, L. (2017). The effect of hypertonic saline and mannitol on coagulation in moderate traumatic brain injury patients. The American Journal of Emergency Medicine, 35(10), 1404–1407. https://doi.org/10.1016/j.ajem.2017.04.020 Wang, Y., Liu, Y., Lopez, D., Lee, M., Dayal, S., Hurtado, A., … Baudry, M. (2018). 205 Protection against TBI-Induced Neuronal Death with Post-Treatment with a Selective Calpain-2 Inhibitor in Mice. Journal of Neurotrauma, 35(1), 105–117. https://doi.org/10.1089/neu.2017.5024 Warden, D. L., Gordon, B., McAllister, T. W., Silver, J. M., Barth, J. T., Bruns, J., … Zitnay, G. (2006). Guidelines for the Pharmacologic Treatment of Neurobehavioral Sequelae of Traumatic Brain Injury. Journal of Neurotrauma, 23(10), 1468–1501. https://doi.org/10.1089/neu.2006.23.1468 Wei, X., Du, Z., Zhao, L., Feng, D., Wei, G., He, Y., … Du, Y. (2009). IFATS Collection: The Conditioned Media of Adipose Stromal Cells Protect Against Hypoxia-Ischemia- Induced Brain Damage in Neonatal Rats. Stem Cells, 27(2), 478–488. https://doi.org/10.1634/stemcells.2008-0333 Werner, C., & Engelhard, K. (2007). Pathophysiology of traumatic brain injury. British journal of anaesthesia, 99(1), 4–9. https://doi.org/10.1093/bja/aem131 Wiedemann, F., Siemen, D., Mawrin, C., Horn, T., & Dietzmann, K. (2006). The neurotrophin receptor TrkB is colocalized to mitochondrial membranes. The International Journal of Biochemistry & Cell Biology, 38(4), 610–620. https://doi.org/10.1016/j.biocel.2005.10.024 Wystub, S., Laufs, T., Schmidt, M., Burmester, T., Maas, U., Saaler-Reinhardt, S., … Reuss, S. (2003). Localization of neuroglobin protein in the mouse brain. Neuroscience Letters, 346(1–2), 114–116. https://doi.org/10.1016/S0304-3940(03)00563-9 Xing, G., Ren, M., Watson, W. A., O’Neil, J. T., & Verma, A. (2009). Traumatic brain injury- induced expression and phosphorylation of pyruvate dehydrogenase: A mechanism of dysregulated glucose metabolism. Neuroscience Letters, 454(1), 38–42. https://doi.org/10.1016/j.neulet.2009.01.047 Yagi, H., & Kitagawa, Y. (2013). The role of mesenchymal stem cells in cancer development. Frontiers in Genetics, 4. https://doi.org/10.3389/fgene.2013.00261 Yamazaki, H., Jin, Y., Tsuchiya, A., Kanno, T., & Nishizaki, T. (2015). Adipose-derived stem cell-conditioned medium ameliorates antidepression-related behaviors in the mouse model of Alzheimer’s disease. Neuroscience letters, 609, 53–57. Yi, J.-H., & Hazell, A. S. (2006). Excitotoxic mechanisms and the role of astrocytic glutamate transporters in traumatic brain injury. Neurochemistry International, 48(5), 394–403. https://doi.org/10.1016/j.neuint.2005.12.001 Yoon, B. S., Moon, J.-H., Jun, E. K., Kim, J., Maeng, I., Kim, J. S., … Cho, K. S. (2009). Secretory profiles and wound healing effects of human amniotic fluid–derived mesenchymal stem cells. Stem cells and development, 19(6), 887–902. Yoshino, A., Hovda, D. A., Kawamata, T., Katayama, Y., & Becker, D. P. (1991). Dynamic changes in local cerebral glucose utilization following cerebral conclusion in rats: evidence of a hyper- and subsequent hypometabolic state. Brain research, 561(1), 106– 119. Recuperado de http://www.ncbi.nlm.nih.gov/pubmed/1797338 Yu, Z., Fan, X., Lo, E. H., & Wang, X. (2009). Neuroprotective roles and mechanisms of neuroglobin. Neurological research, 31(2), 122–127. https://doi.org/10.1179/174313209X389866 Yu, Z., Liu, N., Liu, J., Yang, K., & Wang, X. (2012). Neuroglobin, a Novel Target for Endogenous Neuroprotection against Stroke and Neurodegenerative Disorders. International Journal of Molecular Sciences, 13(6), 6995–7014. https://doi.org/10.3390/ijms13066995 Yu, Z., Poppe, J. L., & Wang, X. (2013). Mitochondrial Mechanisms of Neuroglobin’s 206 Neuroprotection. Oxidative Medicine and Cellular Longevity, 2013, 1–11. https://doi.org/10.1155/2013/756989 Yue, X., Hariri, D. J., Caballero, B., Zhang, S., Bartlett, M. J., Kaut, O., … Falk, T. (2014). Comparative study of the neurotrophic effects elicited by VEGF-B and GDNF in preclinical in vivo models of Parkinson’s disease. Neuroscience, 258, 385–400. https://doi.org/10.1016/j.neuroscience.2013.11.038 Zagoura, D. S., Roubelakis, M. G., Bitsika, V., Trohatou, O., Pappa, K. I., Kapelouzou, A., … Anagnou, N. P. (2012). Therapeutic potential of a distinct population of human amniotic fluid mesenchymal stem cells and their secreted molecules in mice with acute hepatic failure. Gut, 61(6), 894–906. https://doi.org/10.1136/gutjnl-2011-300908 Zheng, G., Huang, L., Tong, H., Shu, Q., Hu, Y., Ge, M., … Xu, J. (2014). Treatment of acute respiratory distress syndrome with allogeneic adipose-derived mesenchymal stem cells: a randomized, placebo-controlled pilot study. Respiratory Research, 15(1), 39. https://doi.org/10.1186/1465-9921-15-39

207