DOCSLIB.ORG

Racgap1 Is a Novel Downstream Effector of E2F7-Dependent

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Racgap1 Is a Novel Downstream Effector of E2F7-Dependent Published OnlineFirst May 27, 2015; DOI: 10.1158/1535-7163.MCT-15-0076 Cancer Biology and Signal Transduction Molecular Cancer Therapeutics RacGAP1 Is a Novel Downstream Effector of E2F7-Dependent Resistance to Doxorubicin and Is Prognostic for Overall Survival in Squamous Cell Carcinoma Mehlika Hazar-Rethinam1, Lilia Merida de Long1, Orla M. Gannon1, Samuel Boros2, Ana Cristina Vargas2, Marcin Dzienis3, Pamela Mukhopadhyay1, Natalia Saenz-Ponce1, Daniel D.E. Dantzic1, Fiona Simpson1, and Nicholas A. Saunders1 Abstract We have previously shown that E2F7 contributes to drug E2F7-dependent upregulation of RacGAP1 in doxorubicin- resistance in head and neck squamous cell carcinoma (HNSCC) insensitive SCC25 cells. Extending this, we found that selective cells. Considering that dysregulation of responses to chemother- upregulation of RacGAP1 induced doxorubicin resistance in apy-induced cytotoxicity is one of the major reasons for treatment previously sensitive KJDSV40. Similarly, stable knockdown of failure in HNSCC, identifying the downstream effectors that RacGAP1 in insensitive SCC25 cells induced sensitivity to regulate E2F7-dependent sensitivity to chemotherapeutic agents doxorubicin in vitro and in vivo. RacGAP1 expression was may have direct clinical impact. We used transcriptomic profiling validated in a TMA, and we showed that HNSCCs that over- to identify candidate pathways that contribute to E2F7-dependent express RacGAP1 are associated with a poorer patient overall resistance to doxorubicin. We then manipulated the expression of survival. Furthermore, E2F7-induced doxorubicin resistance the candidate pathway using overexpression and knockdown in in was mediated via RacGAP1-dependent activation of AKT. Final- vitro and in vivo models of SCC to demonstrate causality. In ly, we show that SCC cells deficient in RacGAP1 grow slower addition, we examined the expression of E2F7 and RacGAP1 in and are sensitized to the cytotoxic actions of doxorubicin in a custom tissue microarray (TMA) generated from HNSCC patient vivo.Thesefindings identify RacGAP1 overexpression as a novel samples. Transcriptomic profiling identified RacGAP1 as a poten- prognostic marker of survival and a potential target to sensitize tial mediator of E2F7-dependent drug resistance. We validated SCC to doxorubicin. Mol Cancer Ther; 14(8); 1939–50. Ó2015 AACR. Introduction terized by the development of drug resistance. Thus, there is a need to identify new therapeutic strategies that can bypass the emer- Cutaneous squamous cell carcinomas (CSCC) and head and gence of a drug-resistant phenotype. neck SCC (HNSCC) are among the most common malignancies The E2F transcription factor complex comprises a family of afflicting man (1, 2). Current treatment options for advanced SCC activating (E2F1, 2, 3a) or repressive/inhibitory (E2F3b, 4, 5, 6, 7, include adjuvant chemotherapy with platinum-based drugs, such or 8) E2Fs that regulate key cellular functions, such as transcrip- as taxanes, 5-Fluorouracil, or therapeutic antibodies against EGFR tion, differentiation, and apoptosis. In the context of keratino- (3, 4). However, the response is generally transient and charac- cytes (KC), the E2F transcription factor family has been shown to control (i) proliferation, (ii) differentiation, (iii) stress responses, and (iv) apoptosis (5–10). Consistent with their roles in KCs, 1 Epithelial Pathobiology Group, University of Queensland Diamantina dysregulation of E2F is a common occurrence in SCC (11, 12), and Institute, Princess Alexandra Hospital,Translational Research Institute, Woolloongabba, Queensland, Australia. 2Department of Pathology, overexpression of E2Fs, such as E2F1 and E2F7, occurs in the Princess Alexandra Hospital, Woolloongabba, Queensland, Australia. majority of CSCCs and HNSCCs (12–15). E2F1 and E2F7 are 3 Department of Medical Oncology, Princess Alexandra Hospital,Wool- known to have opposing actions in the regulation of proliferation loongabba, Queensland, Australia. (5), differentiation (14), and apoptosis (9, 14). For example, Note: Supplementary data for this article are available at Molecular Cancer recent reports have shown that treatment of wild-type cells with Therapeutics Online (http://mct.aacrjournals.org/). DNA-damaging agents, such as doxorubicin or etoposide, induces Current address for P. Mukhopadhyay: The QIMR Berghofer Medical Research E2F7 protein levels and subsequent inhibition of the E2F1-medi- Institute, Brisbane, Queensland, Australia. ated DNA damage response (9, 10). In the context of KCs, E2F7 Corresponding Author: Nicholas A. Saunders, The University of Queensland was shown to causally modify responses to conventional che- Diamantina Institute, Translational Research Institute, 37 Kent St, Woolloon- motherapeutics (15) and UV responses in vitro (14). Thus, sen- gabba, Queensland 4102, Australia. Phone: 61-7-34437098; Fax: 61-7-34436966; sitivity to common cytotoxic agents and stimuli appear to be E-mail: [email protected] regulated by the relative ratio of E2F1 to E2F7 in the tissue. Given doi: 10.1158/1535-7163.MCT-15-0076 that both E2F1 and E2F7 are known to be overexpressed in SCC Ó2015 American Association for Cancer Research. (14, 15), it is reasonable to speculate that this may also www.aacrjournals.org 1939 Downloaded from mct.aacrjournals.org on September 25, 2021. © 2015 American Association for Cancer Research. Published OnlineFirst May 27, 2015; DOI: 10.1158/1535-7163.MCT-15-0076 Hazar-Rethinam et al. contribute to drug resistance in SCC. In this regard, we recently AGTCATGG, RacGAP1 Reverse: GCTCAAACAGATTCCGCACA; showed that the sphingosine kinase 1 (Sphk1)geneisadirect Sphk1 Forward: AAGACCTCCTGACCAACTGC, Sphk1 Reverse: target of E2F7 in SCC (15). E2F7-dependent overexpression of GGCTGAGCACAGAGAAGAGG. Sphk1 in SCC induces increased production of the antiapop- totic phospholipid, sphingosine-1-phosphate (S1P), which in Gene expression analysis turn invokes anthracycline resistance via activation of the PI3K/ Each sample was analyzed in duplicate. Complementary RNA AKT pathway (15). Thus, E2F dysregulation in SCC induced the was generated from samples using the Illumina TotalPrep RNA activation of a Sphk1/S1P-dependent drug-resistant phenotype Amplification Kit and hybridized with Illumina HumanHT-12 v4 (15). Identification of this novel pathway was noteworthy Expression BeadChips (Illumina) as the per manufacturer's pro- because anthracyclines such as doxorubicin are not in clinical tocol. Expression data from the microarrays were analyzed as use for the treatment of SCC, and thus the ability to sensitize previously described (19). Only genes with a fold change of 1 (in SCCs to an existing class of chemotherapeutics would be of either direction) or greater and a B value of greater than 3 clinical value. However, the activation of the Sphk1 pathway (exceeding the 95% probability of differential expression) were was clearly only part of the explanation for the anthracycline considered to be differentially expressed and further analyzed. resistance observed in SCC. Thus, other pathways that control Differentially expressed probe sets were analyzed as pair-wise drug resistance in SCC were likely to exist. contrasts. Microarray data have been uploaded to Gene Expres- In the present study, we used transcriptomic profiling to iden- sion Omnibus under the reference: GSE58074. tify a novel druggable E2F7/RacGAP1/AKT pathway that selec- tively induces anthracycline resistance in SCC. Colony-forming assay Known number of SCC cells was plated and allowed to grow for 15 days. Plates were fixed and stained with Coomassie Blue and Materials and Methods counted as previously described (20). Colony-forming efficiency Chemicals and viability assays was expressed as the total number of colonies/total number of The following drugs were purchased: AZA1 (Millipore), doxo- cells plated  100. rubicin (Sigma Aldrich), NSC23766 (Abcam), S1P (Cayman Chemicals), Y-27632 (Sigma Aldrich), and ZVAD-fmk (Alexis DNA synthesis Biochemicals). BGT26 was provided by Novartis, and stocks of DNA synthesis was measured using a colorimetric ELISA 5- BGT226 were prepared as described (16). ZVAD-fmk was added bromo-2-deoxyuridine (BrdUrd) incorporation assay (Roche 30 minutes before other treatments. Cell viability was performed Diagnostics) in accordance with the manufacturer's instructions. by trypan blue exclusion or using Cell Titer 96 Aqueous One Solution Cell Proliferation Assay (Promega). Chromatin immunoprecipitation Chromatin immunoprecipitation (ChIP) was performed using Tissue culture, adenovirus infection, and transfection the SimpleChIP Enzymatic Chromatin IP Kit (Magnetic Beads; Murine epidermal keratinocytes (MEK) and human epider- Cell Signaling Technology) in accordance with the manufacturer's mal keratinocytes (HEK) were isolated and cultured as instructions. ChIP enrichment was determined by conducting described (17, 18). E2F7 KO KCs were generated by ready- qRT-PCR as described above. The primers used were as follows: to-use adenovirus harboring Cre recombinase infection of 50-GAAGTGAGTAGTGGGGGTGC-30 (RacGAP1 Forward); 50- murine epidermal keratinocytes as per the manufacturer's TCCATCTTTCACACGAACACTCT-30 (RacGAP1 Reverse). recommendations (MOI of 50; Vector Biolabs). Detroit562 and SCC25 cells were obtained from the American Type Culture Immunoblot Collection, and cultures were not passaged for longer than 6 Immunoblotting was carried out according to previously pub- months. SCC15 was a kind gift from Dr. Elizabeth Musgrove lished procedures
Load more

Recommended publications
  • Systems Analysis Implicates WAVE2&Nbsp
    JACC: BASIC TO TRANSLATIONAL SCIENCE VOL.5,NO.4,2020 ª 2020 THE AUTHORS. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/). PRECLINICAL RESEARCH Systems Analysis Implicates WAVE2 Complex in the Pathogenesis of Developmental Left-Sided Obstructive Heart Defects a b b b Jonathan J. Edwards, MD, Andrew D. Rouillard, PHD, Nicolas F. Fernandez, PHD, Zichen Wang, PHD, b c d d Alexander Lachmann, PHD, Sunita S. Shankaran, PHD, Brent W. Bisgrove, PHD, Bradley Demarest, MS, e f g h Nahid Turan, PHD, Deepak Srivastava, MD, Daniel Bernstein, MD, John Deanfield, MD, h i j k Alessandro Giardini, MD, PHD, George Porter, MD, PHD, Richard Kim, MD, Amy E. Roberts, MD, k l m m,n Jane W. Newburger, MD, MPH, Elizabeth Goldmuntz, MD, Martina Brueckner, MD, Richard P. Lifton, MD, PHD, o,p,q r,s t d Christine E. Seidman, MD, Wendy K. Chung, MD, PHD, Martin Tristani-Firouzi, MD, H. Joseph Yost, PHD, b u,v Avi Ma’ayan, PHD, Bruce D. Gelb, MD VISUAL ABSTRACT Edwards, J.J. et al. J Am Coll Cardiol Basic Trans Science. 2020;5(4):376–86. ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2020.01.012 JACC: BASIC TO TRANSLATIONALSCIENCEVOL.5,NO.4,2020 Edwards et al. 377 APRIL 2020:376– 86 WAVE2 Complex in LVOTO HIGHLIGHTS ABBREVIATIONS AND ACRONYMS Combining CHD phenotype–driven gene set enrichment and CRISPR knockdown screening in zebrafish is an effective approach to identifying novel CHD genes.
    [Show full text]
  • IL21R Expressing CD14+CD16+ Monocytes Expand in Multiple
    Plasma Cell Disorders SUPPLEMENTARY APPENDIX IL21R expressing CD14 +CD16 + monocytes expand in multiple myeloma patients leading to increased osteoclasts Marina Bolzoni, 1 Domenica Ronchetti, 2,3 Paola Storti, 1,4 Gaetano Donofrio, 5 Valentina Marchica, 1,4 Federica Costa, 1 Luca Agnelli, 2,3 Denise Toscani, 1 Rosanna Vescovini, 1 Katia Todoerti, 6 Sabrina Bonomini, 7 Gabriella Sammarelli, 1,7 Andrea Vecchi, 8 Daniela Guasco, 1 Fabrizio Accardi, 1,7 Benedetta Dalla Palma, 1,7 Barbara Gamberi, 9 Carlo Ferrari, 8 Antonino Neri, 2,3 Franco Aversa 1,4,7 and Nicola Giuliani 1,4,7 1Myeloma Unit, Dept. of Medicine and Surgery, University of Parma; 2Dept. of Oncology and Hemato-Oncology, University of Milan; 3Hematology Unit, “Fondazione IRCCS Ca’ Granda”, Ospedale Maggiore Policlinico, Milan; 4CoreLab, University Hospital of Parma; 5Dept. of Medical-Veterinary Science, University of Parma; 6Laboratory of Pre-clinical and Translational Research, IRCCS-CROB, Referral Cancer Center of Basilicata, Rionero in Vulture; 7Hematology and BMT Center, University Hospital of Parma; 8Infectious Disease Unit, University Hospital of Parma and 9“Dip. Oncologico e Tecnologie Avanzate”, IRCCS Arcispedale Santa Maria Nuova, Reggio Emilia, Italy ©2017 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2016.153841 Received: August 5, 2016. Accepted: December 23, 2016. Pre-published: January 5, 2017. Correspondence: [email protected] SUPPLEMENTAL METHODS Immunophenotype of BM CD14+ in patients with monoclonal gammopathies. Briefly, 100 μl of total BM aspirate was incubated in the dark with anti-human HLA-DR-PE (clone L243; BD), anti-human CD14-PerCP-Cy 5.5, anti-human CD16-PE-Cy7 (clone B73.1; BD) and anti-human CD45-APC-H 7 (clone 2D1; BD) for 20 min.
    [Show full text]
  • Peripherally Generated Foxp3+ Regulatory T Cells Mediate the Immunomodulatory Effects of Ivig in Allergic Airways Disease
    Published February 20, 2017, doi:10.4049/jimmunol.1502361 The Journal of Immunology Peripherally Generated Foxp3+ Regulatory T Cells Mediate the Immunomodulatory Effects of IVIg in Allergic Airways Disease Amir H. Massoud,*,†,1 Gabriel N. Kaufman,* Di Xue,* Marianne Be´land,* Marieme Dembele,* Ciriaco A. Piccirillo,‡ Walid Mourad,† and Bruce D. Mazer* IVIg is widely used as an immunomodulatory therapy. We have recently demonstrated that IVIg protects against airway hyper- responsiveness (AHR) and inflammation in mouse models of allergic airways disease (AAD), associated with induction of Foxp3+ regulatory T cells (Treg). Using mice carrying a DTR/EGFP transgene under the control of the Foxp3 promoter (DEREG mice), we demonstrate in this study that IVIg generates a de novo population of peripheral Treg (pTreg) in the absence of endogenous Treg. IVIg-generated pTreg were sufficient for inhibition of OVA-induced AHR in an Ag-driven murine model of AAD. In the absence of endogenous Treg, IVIg failed to confer protection against AHR and airway inflammation. Adoptive transfer of purified IVIg-generated pTreg prior to Ag challenge effectively prevented airway inflammation and AHR in an Ag-specific manner. Microarray gene expression profiling of IVIg-generated pTreg revealed upregulation of genes associated with cell cycle, chroma- tin, cytoskeleton/motility, immunity, and apoptosis. These data demonstrate the importance of Treg in regulating AAD and show that IVIg-generated pTreg are necessary and sufficient for inhibition of allergen-induced AAD. The ability of IVIg to generate pure populations of highly Ag-specific pTreg represents a new avenue to study pTreg, the cross-talk between humoral and cellular immunity, and regulation of the inflammatory response to Ags.
    [Show full text]
  • Dysregulation of Mitotic Machinery Genes Precedes Genome Instability
    The Author(s) BMC Genomics 2016, 17(Suppl 8):728 DOI 10.1186/s12864-016-3068-5 RESEARCH Open Access Dysregulation of mitotic machinery genes precedes genome instability during spontaneous pre-malignant transformation of mouse ovarian surface epithelial cells Ulises Urzúa1*, Sandra Ampuero2, Katherine F. Roby3, Garrison A. Owens4,6 and David J. Munroe4,5 From 6th SolBio International Conference 2016 (SoIBio-IC&W-2016) Riviera Maya, Mexico. 22-26 April 2016 Abstract Background: Based in epidemiological evidence, repetitive ovulation has been proposed to play a role in the origin of ovarian cancer by inducing an aberrant wound rupture-repair process of the ovarian surface epithelium (OSE). Accordingly, long term cultures of isolated OSE cells undergo in vitro spontaneous transformation thus developing tumorigenic capacity upon extensive subcultivation. In this work, C57BL/6 mouse OSE (MOSE) cells were cultured up to passage 28 and their RNA and DNA copy number profiles obtained at passages 2, 5, 7, 10, 14, 18, 23, 25 and 28 by means of DNA microarrays. Gene ontology, pathway and network analyses were focused in passages earlier than 20, which is a hallmark of malignancy in this model. Results: At passage 14, 101 genes were up-regulated in absence of significant DNA copy number changes. Among these, the top-3 enriched functions (>30 fold, adj p < 0.05) comprised 7 genes coding for centralspindlin, chromosome passenger and minichromosome maintenance protein complexes. The genes Ccnb1 (Cyclin B1), Birc5 (Survivin), Nusap1 and Kif23 were the most recurrent in over a dozen GO terms related to the mitotic process. On the other hand, Pten plus the large non-coding RNAs Malat1 and Neat1 were among the 80 down-regulated genes with mRNA processing, nuclear bodies, ER-stress response and tumor suppression as relevant terms.
    [Show full text]
  • Identification of Novel Biomarkers in Hepatocellular Carcinoma By
    Identication of Novel Biomarkers in Hepatocellular Carcinoma by Integrated Bioinformatical Analysis and Experimental Validation Chen Liao Yunnan University of Traditional Chinese Medicine Lanlan Wang Shaanxi University of Chinese Medicine Xiaoqiang Li Fourth Military Medical University Department of Social Sciences: Air Force Medical University Jinyu Bai Yunnan University of Traditional Chinese Medicine Jieqiong Wu Shaanxi University of Chinese Medicine Wei Zhang Shaanxi University of Chinese Medicine Hailong Shi Shaanxi University of Chinese Medicine Xuesong Feng Shaanxi University of Chinese Medicine Xu Chao ( [email protected] ) Shaanxi University of Chinese Medicine https://orcid.org/0000-0001-5520-4834 Research Keywords: Hepatocellular carcinoma, novel biomarkers, candidate small molecules, prognosis, bioinformatics analysis Posted Date: June 16th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-533830/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/14 Abstract Background: Hepatocellular carcinoma (HCC) is one of the most common poorly prognosed virulent neoplasms of the digestive system. In this study, we identied novel biomarkers associated with the pathogenesis of HCC aiming to provide new diagnostic and therapeutic approaches for HCC. Methods: Gene expression proles of GSE62232, GSE84402,GSE121248 and GSE45267 were obtained in GEO database. Differential expressed genes (DEGs) between HCC and normal samples were identied using the GEO2R tool and Venn diagram software.Database for Annotation, Visualization and Integrated Discovery (DAVID) were used to carry out enrichment analysis on gene ontology (GO) and the Kyoto Encyclopaedia of Genes and Genomes pathway (KEGG). The protein-protein interaction (PPI) network of DEGs was constructed by the Search Tool for the Retrieval of Interacting Genes (STRING) and visualized by Cytoscape.
    [Show full text]
  • Novel Targets of Apparently Idiopathic Male Infertility
    International Journal of Molecular Sciences Review Molecular Biology of Spermatogenesis: Novel Targets of Apparently Idiopathic Male Infertility Rossella Cannarella * , Rosita A. Condorelli , Laura M. Mongioì, Sandro La Vignera * and Aldo E. Calogero Department of Clinical and Experimental Medicine, University of Catania, 95123 Catania, Italy; [email protected] (R.A.C.); [email protected] (L.M.M.); [email protected] (A.E.C.) * Correspondence: [email protected] (R.C.); [email protected] (S.L.V.) Received: 8 February 2020; Accepted: 2 March 2020; Published: 3 March 2020 Abstract: Male infertility affects half of infertile couples and, currently, a relevant percentage of cases of male infertility is considered as idiopathic. Although the male contribution to human fertilization has traditionally been restricted to sperm DNA, current evidence suggest that a relevant number of sperm transcripts and proteins are involved in acrosome reactions, sperm-oocyte fusion and, once released into the oocyte, embryo growth and development. The aim of this review is to provide updated and comprehensive insight into the molecular biology of spermatogenesis, including evidence on spermatogenetic failure and underlining the role of the sperm-carried molecular factors involved in oocyte fertilization and embryo growth. This represents the first step in the identification of new possible diagnostic and, possibly, therapeutic markers in the field of apparently idiopathic male infertility. Keywords: spermatogenetic failure; embryo growth; male infertility; spermatogenesis; recurrent pregnancy loss; sperm proteome; DNA fragmentation; sperm transcriptome 1. Introduction Infertility is a widespread condition in industrialized countries, affecting up to 15% of couples of childbearing age [1]. It is defined as the inability to achieve conception after 1–2 years of unprotected sexual intercourse [2].
    [Show full text]
  • The Human Gene Connectome As a Map of Short Cuts for Morbid Allele Discovery
    The human gene connectome as a map of short cuts for morbid allele discovery Yuval Itana,1, Shen-Ying Zhanga,b, Guillaume Vogta,b, Avinash Abhyankara, Melina Hermana, Patrick Nitschkec, Dror Friedd, Lluis Quintana-Murcie, Laurent Abela,b, and Jean-Laurent Casanovaa,b,f aSt. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, The Rockefeller University, New York, NY 10065; bLaboratory of Human Genetics of Infectious Diseases, Necker Branch, Paris Descartes University, Institut National de la Santé et de la Recherche Médicale U980, Necker Medical School, 75015 Paris, France; cPlateforme Bioinformatique, Université Paris Descartes, 75116 Paris, France; dDepartment of Computer Science, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel; eUnit of Human Evolutionary Genetics, Centre National de la Recherche Scientifique, Unité de Recherche Associée 3012, Institut Pasteur, F-75015 Paris, France; and fPediatric Immunology-Hematology Unit, Necker Hospital for Sick Children, 75015 Paris, France Edited* by Bruce Beutler, University of Texas Southwestern Medical Center, Dallas, TX, and approved February 15, 2013 (received for review October 19, 2012) High-throughput genomic data reveal thousands of gene variants to detect a single mutated gene, with the other polymorphic genes per patient, and it is often difficult to determine which of these being of less interest. This goes some way to explaining why, variants underlies disease in a given individual. However, at the despite the abundance of NGS data, the discovery of disease- population level, there may be some degree of phenotypic homo- causing alleles from such data remains somewhat limited. geneity, with alterations of specific physiological pathways under- We developed the human gene connectome (HGC) to over- come this problem.
    [Show full text]
  • 1 Up-Regulation of Rac Gtpase Activating Protein 1 Is Significantly
    Author Manuscript Published OnlineFirst on August 8, 2011; DOI: 10.1158/1078-0432.CCR-11-0557 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. RACGAP1 and HCC recurrence Up-regulation of Rac GTPase activating protein 1 is significantly associated with the early recurrence of human hepatocellular carcinoma Suk Mei Wang1, London Lucien P.J. Ooi2, and Kam M. Hui1,3 Authors' Affiliations: 1Bek Chai Heah Laboratory of Cancer Genomics, Division of Cellular and Molecular Research, Humphrey Oei Institute of Cancer Research, National Cancer Centre, Singapore; 2Department of Surgical Oncology, National Cancer Centre, Singapore and 3Cancer and Stem Cell Biology Program, Duke-NUS Graduate Medical School, Singapore. Corresponding Author: Kam M. Hui, Division of Cellular and Molecular Research, National Cancer Centre, 11 Hospital Drive, Singapore 169610; Phone: (65) 6436-8337; Fax: (65) 6226-3843; E-mail: [email protected]. Running title: RACGAP1 and HCC recurrence Key words: human hepatocellular carcinoma; interactome; oligonucleotide gene arrays; prediction of recurrent HCC disease; RACGAP1. Abbreviations: RACGAP1, Rac GTPase activating protein 1; HCC, hepatocellular carcinoma; HBV, Hepatitis B virus; HCV, Hepatitis C virus; AFP, alpha-fetoprotein. Grant support: This work was supported by grants from the National Medical Research Council, Biomedical Research Council of Singapore and The Singapore Millennium Foundation. 1 Downloaded from clincancerres.aacrjournals.org on September 24, 2021. © 2011 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 8, 2011; DOI: 10.1158/1078-0432.CCR-11-0557 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • Anti-RACGAP1 (Aa 1-172) Polyclonal Antibody (CPBT-44743RH) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Anti-RACGAP1 (aa 1-172) polyclonal antibody (CPBT-44743RH) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Product Overview Rabbit Polyclonal antibody to Human RACGAP1. Antigen Description The protein encoded by this gene belongs to the GTPase-activating protein (GAP) family. GAPs bind activated forms of Rho GTPases and stimulate GTP hydrolysis. Through this catalytic function, GAPs negatively regulate Rho-mediated signals. This protein plays a regulatory role in initiation of cytokinesis, controlling cell growth and differentiation of hematopoietic cells, regulating spermatogenesis, and in neuronal proliferation. Alternatively spliced transcript variants have been found for this gene. Immunogen Recombinant fragment containing a sequence corresponding to a region within amino acids 1- 172 of Human RACGAP1 (AAH32754). Isotype IgG Source/Host Rabbit Species Reactivity Human Purification Immunogen affinity purified Conjugate Unconjugated Applications WB, IHC-P, ICC/IF Cellular Localization Cytoplasmic and Nuclear Format Liquid Size 100 μl Buffer Preservative: 0.01% Thimerosal (merthiolate)Constituents: 10% Glycerol, 0.1M Tris, 0.1M Glycine, pH 7.0 Preservative None Storage Shipped at 4℃. Upon delivery aliquot and store at -20℃ or -80℃. Avoid repeated freeze / thaw cycles. 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved GENE INFORMATION Gene Name RACGAP1 Rac GTPase activating protein
    [Show full text]
  • Human PRC1 Protein (His Tag)
    Human PRC1 Protein (His Tag) Catalog Number: 13280-H07B General Information SDS-PAGE: Gene Name Synonym: ASE1 Protein Construction: A DNA sequence encoding the human PRC1 isoform 1 (NP_003972.1) (Met 1-Ser 620) was expressed, with a polyhistidine tag at the N-terminus. Source: Human Expression Host: Baculovirus-Insect Cells QC Testing Purity: > 95 % as determined by SDS-PAGE Endotoxin: Protein Description < 1.0 EU per μg of the protein as determined by the LAL method PRC1 (protein regulator of cytokinesis 1) is a key regulator of cytokinesis Stability: that cross-links antiparrallel microtubules at an average distance of 35 nM. It is essential for controlling the spatiotemporal formation of the midzone Samples are stable for up to twelve months from date of receipt at -70 ℃ and successful cytokinesis. PRC1 is required for KIF14 localization to the central spindle and midbody. It is also required to recruit PLK1 to the Predicted N terminal: Met spindle. PRC1 stimulates PLK1 phosphorylation of RACGAP1 to allow Molecular Mass: recruitment of ECT2 to the central spindle. It is a homodimer and interacts with the C-terminal Rho-GAP domain and the basic region of RACGAP1. The recombinant human PRC1 consists of 639 amino acids and predicts a The interaction with RACGAP1 inhibits its GAP activity towards CDC42 in molecular mass of 74 kDa. It migrates as an approximately 75 KDa band vitro, which may be required for maintaining normal spindle morphology. in SDS-PAGE under reducing conditions. PRC1 also interacts separately via its N-terminal region with the C-terminus of CENPE, KIF4A and KIF23 during late mitosis.
    [Show full text]
  • Rac Gtpase Activating Protein 1 Promotes Gallbladder Cancer Via
    1 Rac GTPase activating protein 1 promotes gallbladder cancer via 2 binding DNA ligase 3 to reduce apoptosis 3 Rui Bian134#, Wei Dang234#, Xiaoling Song234#, Liguo Liu134, Chengkai Jiang134, Yang Yang134, 4 Yongsheng Li134, Lin Li134, Xuechuan Li134, Yunping Hu234, Runfa Bao234*, Yingbin Liu134* 5 1. Department of Biliary-Pancreatic Surgery, Renji Hospital, School of Medicine, Shanghai Jiao 6 Tong University, Shanghai, 200127, China. 7 2. Department of General Surgery and Laboratory of General Surgery, Xinhua Hospital, School of 8 Medicine, Shanghai Jiao Tong University, Shanghai, 200092, China. 9 3. Shanghai Key Laboratory of Biliary Tract Disease Research, Shanghai 200092, China 10 4. State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, School of 11 Medicine, Shanghai Jiao Tong University, Shanghai, 200240, China. 12 #These authors contributed equally to this work. 13 *These authors are designated conjointly as corresponding authors. Yingbin Liu (Email: 14 [email protected]) or Runfa Bao (Email: [email protected]). 15 Abstract 16 Rac GTPase activating protein 1 (RACGAP1) has been characterized in the pathogenesis and 17 progression of several malignancies, however, little is known regarding its role in the development 18 of gallbladder cancer (GBC). This investigation seeks to describe the role of RACGAP1 and its 19 associated molecular mechanisms in GBC. It was found that RACGAP1 was highly expressed in 20 human GBC tissues, which was associated to poorer overall survival (OS). Gene knockdown of 21 RACGAP1 hindered tumor cell proliferation and survival both in vitro and in vivo. We further 22 identified that RACGAP1 was involved in DNA repair through its binding with DNA ligase 3 23 (LIG3), a crucial component of the alternative-non-homologous end joining (Alt-NHEJ) pathway.
    [Show full text]
  • RACGAP1 Mouse Monoclonal Antibody [Clone ID: OTI4C5] Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for CF811640 RACGAP1 Mouse Monoclonal Antibody [Clone ID: OTI4C5] Product data: Product Type: Primary Antibodies Clone Name: OTI4C5 Applications: IHC, WB Recommended Dilution: WB 1:500~2000, IHC 1:150 Reactivity: Human, Mouse, Rat Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Human recombinant protein fragment corresponding to amino acids 123-238 of human RACGAP1 (NP_001119575) produced in E.coli. Formulation: Lyophilized powder (original buffer 1X PBS, pH 7.3, 8% trehalose) Reconstitution Method: For reconstitution, we recommend adding 100uL distilled water to a final antibody concentration of about 1 mg/mL. To use this carrier-free antibody for conjugation experiment, we strongly recommend performing another round of desalting process. (OriGene recommends Zeba Spin Desalting Columns, 7KMWCO from Thermo Scientific) Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Gene Name: Homo sapiens Rac GTPase activating protein 1 (RACGAP1), transcript variant 2, mRNA. Database Link: NP_001119575 Entrez Gene 26934 MouseEntrez Gene 315298 RatEntrez Gene 29127 Human Q9H0H5 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 RACGAP1 Mouse Monoclonal Antibody [Clone ID: OTI4C5] – CF811640 Background: This gene encodes a GTPase-activating protein (GAP) that is a compoment of the centralspindlin complex.
    [Show full text]