DOCSLIB.ORG

Sexually Dimorphic Expression of Gonadotropin Subunits in The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Sexually Dimorphic Expression of Gonadotropin Subunits in The BIOLOGY OF REPRODUCTION 82, 1030–1036 (2010) Published online before print 10 February 2010. DOI 10.1095/biolreprod.109.080986 Sexually Dimorphic Expression of Gonadotropin Subunits in the Pituitary of Protogynous Honeycomb Grouper (Epinephelus merra): Evidence That Follicle-Stimulating Hormone (FSH) Induces Gonadal Sex Change1 Yasuhisa Kobayashi,2,3 Mohammad Ashraful Alam,3 Ryo Horiguchi,3 Akio Shimizu,4 and Masaru Nakamura3,4 Sesoko Station,3 Tropical Biosphere Research Center, University of the Ryukyus, Okinawa, Japan National Research Institute of Fisheries Science,4 Fisheries Research Agency, Fukuura, Kanazawa, Yokohama, Japan Downloaded from https://academic.oup.com/biolreprod/article/82/6/1030/2557961 by guest on 27 September 2021 ABSTRACT adulthood [1–3]. During this process, the gonad changes dramatically from ovary to testis (protogynous), or vice versa Recent studies have suggested that the hypothalamic-pitui- (protandrous) [1–3]. Numerous endocrine studies on gonadal tary-gonadal axis is involved in gonadal sex change in sex- steroidogenesis have been performed to reveal the physiolog- changing teleosts. However, its underlying mechanism remains ical mechanisms of sex change. In several protogynous species, largely unknown. In this study, we focused on the distinct roles plasma estrogen (estradiol-17b [E2]) levels are high in the of two gonadotropins (GTHs), follicle-stimulating hormone female phase, and a rapid decrease of E2 was observed in (FSH) and luteinizing hormone (LH), in the protogynous association with sex change [4–6]. Additionally, androgen Downloaded from www.biolreprod.org. hermaphrodite teleost, honeycomb grouper (Epinephelus mer- ra). First, we investigated the expression pattern of mRNAs for treatment of these species during the female phase results in GTH subunits (cga, fshb, and lhb) in the pituitaries from fish at sex change [5, 7, 8]. In contrast, administration of E2 induces the different sexual phases. Real-time RT-PCR analyses showed male-to-female sex change in the protandrous black porgy [9, that fhsb mRNA levels in the female pituitary were low. 10] and the initial-phase male of protogynous wrasse [11, 12]. However, fshb transcripts increased dramatically in association Taken together, these results suggest that regulation of the with testis development. In contrast, levels of cga and lhb appropriate balance of androgen to estrogen biosynthesis is mRNAs did not significantly vary during sex change. In addition, critical to the process of gonadal sex change. However, the immunohistochemical observations of Fshb- and Lhb-producing upstream mechanisms for the regulation of gonadal steroido- cells in the pituitary, through the use of specific antibodies for genesis during sex change are largely unknown. detections of teleost GTH subunits, were consistent with In teleosts, as in other vertebrates, gonadal steroidogenesis sexually dimorphic expression of Fshb. In order to identify the is largely controlled by pituitary-produced gonadotropins role of GTH in gonad of honeycomb grouper, we treated females (GTHs), follicle-stimulating hormone (FSH), and luteinizing with bovine FSH (50 or 500 ng/fish) or LH (500 ng/fish) in vivo. hormone (LH) [13]. These GTHs contain a common After 3 wk, FSH treatments induced female-to-male sex change glycoprotein hormone a subunit (Cga) that forms a heterodimer and up-regulated endogenous androgen levels and fshb tran- with unique b subunits (Fshb and Lhb) (reviewed by Bousfield scripts, whereas LH treatment had no effect on sex change. et al. [14] and Pierce and Parsons [15]). In well-studied These results suggest that FSH may trigger the female-to-male salmonids, FSH plays a significant role in puberty and sex change in honeycomb grouper. gametogenesis, whereas LH is primarily involved in final androgen, estrogen, follicle-stimulating hormone, gonadotropin, maturation of the gametes in both sexes [16–18]. However, grouper, luteinizing hormone, ovary, pituitary hormones, sex variations in the expression profiles and potential roles of change, teleost GTHs were reported in other teleost species [19–22]. In protogynous wrasse, sexual dimorphic expression patterns of INTRODUCTION fshb and lhb transcripts were observed during the spawning season [23]. In protandrous black porgy, plasma Lh levels were Sex in most animals is determined at an early developmental higher in male than sex-changing fish [24]. In addition, stage, and is fixed throughout their life span [1]. By contrast, treatment with exogenous human chorionic GTH or LH many marine teleosts exhibit sequential hermaphroditism, induced sex change in the protogynous bluehead wrasse [25] wherein an individual changes from one sex to the other in and rice-field eel [26, 27]. These studies indicate that GTHs participate in regulating sex-changing processes. However, 1Supported by a Grant-in-Aid for a Japan Society for the Promotion of information of GTH expression pattern during the sex- Science fellowship and Solution Oriented Research for Science and changing process is currently absent. Therefore, the detailed Technology (SORST). 2Correspondence: Yasuhisa Kobayashi, University of the Ryukyus, 3422 biological functions of GTH during sex change are not clear. Sesoko, Motobu, Okinawa 905-0227, Japan. FAX: 81 980 47 4919; In this study, we used the honeycomb grouper (Epinephelus e-mail: [email protected] merra) as a model. This species is a protogynous hermaphro- dite. All individuals mature initially as females. When the Received: 4 September 2009. females reach a certain age or body size, they change to males First decision: 6 October 2009. [28]. In this species, artificial sex changes have been Accepted: 28 January 2010. intensively studied in our laboratory. Either suppression of Ó 2010 by the Society for the Study of Reproduction, Inc. estrogen biosynthesis with aromatase inhibitors or elevation in This is an Open Access article, freely available through Biology of Reproduction’s Authors’ Choice option. androgen levels by treatment with androgen induced sex eISSN: 1529-7268 http://www.biolreprod.org change in honeycomb grouper [29–31] and other grouper ISSN: 0006-3363 species [32–34]. Since the different sexual-phase individuals of 1030 EXPRESSION OF GTH SUBUNITS IN PROTOGYNOUS GROUPER 1031 TABLE 1. Oligonucleotide primers used in this study. Target gene Purpose Oligonucleotide sequence (50 to 30) cga RT-PCR GGMTGTGAGGARTGYAMACTSAA GCWACGCAGCATGTRGCTTCAGA 30RACE AAGAACAGTGTTTTCTCAAGGGATCGTC 50RACE ATGTTCTTCGGGATCGTCATTGTCTT Real-time PCR AAACATTGGCTGCGAGGAGT CGGGATCGTCATTGTCTTCA fshb RT-PCR TGCAGYTGGTYSTCATGG CWYCTCRTAGGACCASTC 30RACE CCACACCGAGTACATCTACACCACCATA 50RACE ATTGCAGACTTTCTGTTCAGCCCAGT Real-time PCR TGCCACTCCGACTGTCATCT TCTGTTCAGCCCAGTCATCG Downloaded from https://academic.oup.com/biolreprod/article/82/6/1030/2557961 by guest on 27 September 2021 ihb RT-PCR ATCTGCAGYGGYCACTGC ACAGTCRGAMGTGTCCAT 30RACE GAAGGACCCTGTCATCAAGATACCATTC 50RACE GAGGACAGTCAGGAAGCTCAAATGTCTT Real-time PCR GGAGAAGGAAGGCTGTCCAA TGACAGGGTCCTTCGTGATG ef1a Real-time PCR TTGCCCTCTGGAAGTTTGAG ACACCAGCAGCAACAATGAG Downloaded from www.biolreprod.org. Downloaded from www.biolreprod.org. honeycomb grouper are readily captured from the wild, Cloning of Grouper GTH Subunits cDNA honeycomb grouper provides an excellent animal model to Total RNA extracted from pituitary of adult males was used as a template elucidate the mechanism of sex change. for cloning (RNeasy mini Kit; Qiagen). First, cDNA fragments of cga, fshb, The aim of this study was to elucidate the involvement of and lhb were isolated by RT-PCR with degenerate primers. Then, full-length GTH during the process of sex change in honeycomb grouper. cDNAs of GTH subunits were identified by a SMART RACE cDNA As a first step, we examined the pattern of gene expression for amplification kit (Clontech). Primers used in cloning are listed in Table 1. GTH subunits in the pituitaries of different sexual phases, Sequencing was done with BigDye (Version 3.1). In all cases, at least three including sex-changing fish, using real-time PCR. Additional- independent clones were sequenced. Transcripts of grouper GTH subunits in pituitary were determined using ly, localization of Fshb- and Lhb-producing cells in the real-time RT-PCR. Described briefly, total RNA was isolated from individual pituitaries of males, females, and sex-changing fishes was pituitaries stored in RNAlater using the RNAeasy mini kit with the RNase-free performed by immunohistochemistry using antisera that DNase kit (Qiagen), according to the manufacturer’s instructions. Samples recognize Fsh and Lh from several teleost species. Finally, were reverse transcribed from 200 ng of total RNA in a 20-ll volume using the effects of purified bovine FSH and LH on the nonbreeding random hexamer primers and OmniScript reverse transcriptase (Qiagen). An aliquot of 2 ll of the above diluted cDNA sample was used for a 22-ll PCR female gonad in vivo were examined. The results generated in reaction with SYBER Premix Ex Taq (Takara Bio Inc., Shiga, Japan) on the this study contribute to the understanding of biological ABI 7000 sequence detection system (Applied Biosystems, Foster City, CA). functions of GTH on the process of sex change. Primer sets for each gene were designed by PrimerExpress Software. Quantitative PCR assay was done with triplicate samples. Copy number in MATERIALS AND METHODS unknown samples was determined by Ct value to the each gene standards. Standard copy number of each gene was estimated based on molecular
Load more

Recommended publications
  • Strategies to Increase ß-Cell Mass Expansion
    This electronic thesis or dissertation has been downloaded from the King’s Research Portal at https://kclpure.kcl.ac.uk/portal/ Strategies to increase -cell mass expansion Drynda, Robert Lech Awarding institution: King's College London The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without proper acknowledgement. END USER LICENCE AGREEMENT Unless another licence is stated on the immediately following page this work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International licence. https://creativecommons.org/licenses/by-nc-nd/4.0/ You are free to copy, distribute and transmit the work Under the following conditions: Attribution: You must attribute the work in the manner specified by the author (but not in any way that suggests that they endorse you or your use of the work). Non Commercial: You may not use this work for commercial purposes. No Derivative Works - You may not alter, transform, or build upon this work. Any of these conditions can be waived if you receive permission from the author. Your fair dealings and other rights are in no way affected by the above. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 02. Oct. 2021 Strategies to increase β-cell mass expansion A thesis submitted by Robert Drynda For the degree of Doctor of Philosophy from King’s College London Diabetes Research Group Division of Diabetes & Nutritional Sciences Faculty of Life Sciences & Medicine King’s College London 2017 Table of contents Table of contents .................................................................................................
    [Show full text]
  • Redirecting Intracellular Trafficking and the Secretion Pattern of FSH Dramatically Enhances Ovarian Function in Mice
    Redirecting intracellular trafficking and the secretion pattern of FSH dramatically enhances ovarian function in mice Huizhen Wanga, Melissa Larsona, Albina Jablonka-Shariffb, Christopher A. Pearlb, William L. Millerc, P. Michael Connd, Irving Boimeb, and T. Rajendra Kumara,e,1 Departments of aMolecular and Integrative Physiology and ePathology and Laboratory Medicine, University of Kansas Medical Center, Kansas City, KS 66160; bDepartment of Developmental Biology, Washington University School of Medicine, St. Louis, MO 63110; cDepartment of Molecular and Structural Biochemistry, North Carolina State University, Raleigh, NC 27695; and dDepartments of Internal Medicine and Cell Biology and Biochemistry, Texas Tech University Health Sciences Center, Lubbock, TX 79430 Edited by R. Michael Roberts, University of Missouri, Columbia, MO, and approved February 28, 2014 (received for review November 14, 2013) FSH and luteinizing hormone (LH) are secreted constitutively or in Results pulses, respectively, from pituitary gonadotropes in many vertebrates, Strategy to Redirect FSH from the Constitutive to Regulated Pathway. Our and regulate ovarian function. The molecular basis for this evolution- in vitro screens indicated that a carboxyterminal (C′)-heptapeptide arily conserved gonadotropin-specific secretion pattern is not un- in the human LHβ (LSGLLFL) (12) or a modified FSHβ con- derstood. Here, we show that the carboxyterminal heptapeptide in taining this peptide (13) favors secretion of corresponding dimers LH is a gonadotropin-sorting determinant in vivo that directs pulsatile via the regulated pathway in heterologous somatotrope cells. secretion. FSH containing this heptapeptide enters the regulated Based on these initial data, we engineered human transgenes en- pathway in gonadotropes of transgenic mice, and is released in β ′ response to gonadotropin-releasing hormone, similar to LH.
    [Show full text]
  • Dynamic Gnrh and Hcg Testing: Establishment of New Diagnostic Reference Levels
    176:4 PROOF ONLY A K Bang and others Reference levels on GnRH and 176:4 379–391 Clinical Study hCG tests Dynamic GnRH and hCG testing: establishment of new diagnostic reference levels A Kirstine Bang1,2, Loa Nordkap1,2, Kristian Almstrup1,2, Lærke Priskorn1,2, Jørgen Holm Petersen1,2,3, Ewa Rajpert-De Meyts1,2, Anna-Maria Andersson1,2, Anders Juul1,2 and Niels Jørgensen1,2 1Department of Growth and Reproduction, Rigshospitalet, University of Copenhagen, Copenhagen, Correspondence Denmark, 2International Center for Research and Research Training in Endocrine Disruption of Male should be addressed Reproduction and Child Health (EDMaRC), Rigshospitalet, Denmark, and 3Department of Biostatistics, to N Jørgensen University of Copenhagen, Copenhagen, Denmark Email [email protected] Abstract Objective: Gonadotropin-releasing hormone (GnRH) and human chorionic gonadotropin (hCG) stimulation tests may be used to evaluate the pituitary and testicular capacity. Our aim was to evaluate changes in follicular-stimulating hormone (FSH), luteinizing hormone (LH) and testosterone after GnRH and hCG stimulation in healthy men and assess the impact of six single nucleotide polymorphisms on the responses. Design: GnRH and hCG stimulation tests were performed on 77 healthy men, 18–40 years (reference group) at a specialized andrology referral center at a university hospital. The potential influence of the tests was illustrated by results from 45 patients suspected of disordered hypothalamic–pituitary–gonadal axis. Methods: Baseline, stimulated, relative and absolute changes in serum FSH and LH were determined by ultrasensitive TRIFMA, and testosterone was determined by LC–MS/MS. Results: For the reference group, LH and FSH increased almost 400% and 40% during GnRH testing, stimulated levels varied from 4.4 to 58.8 U/L and 0.2 to 11.8 U/L and FSH decreased in nine men.
    [Show full text]
  • Maternal Adiponectin Prevents Visceral Adiposity and Adipocyte Hypertrophy in Prenatal Androgenized Female Mice
    Received: 25 September 2020 | Revised: 26 November 2020 | Accepted: 7 December 2020 DOI: 10.1096/fj.202002212R RESEARCH ARTICLE Maternal adiponectin prevents visceral adiposity and adipocyte hypertrophy in prenatal androgenized female mice Yanling Wu1 | Belén Chanclón1 | Peter Micallef1 | qElisabet Stener-Victorin2 | Ingrid Wernstedt Asterholm1 | Anna Benrick1,3 1Department of Physiology, Institute of Neuroscience and Physiology, Sahlgrenska Abstract Academy, University of Gothenburg, Hyperandrogenism is the main characteristic of polycystic ovary syndrome, which Gothenburg, Sweden affects placental function and fetal growth, and leads to reproductive and metabolic 2 Department of Physiology and dysfunction in female offspring. Adiponectin acts on the placenta and may exert Pharmacology, Karolinska Institute, Stockholm, Sweden endocrine effects on the developing fetus. This study aims to investigate if mater- 3School of Health Sciences, University of nal and/or fetal adiponectin can prevent metabolic and reproductive dysfunction in Skövde, Skövde, Sweden prenatal androgenized (PNA) female offspring. Adiponectin transgenic (APNtg) and wild-type dams received dihydrotestosterone/vehicle injections between gesta- Correspondence Anna Benrick, Department of Physiology, tional days 16.5-18.5 to induce PNA offspring, which were followed for 4 months. University of Gothenburg, Institute of Offspring from APNtg dams were smaller than offspring from wild-type dams, in- Neuroscience and Physiology, Box 423, 405 30 Gothenburg, Sweden. dependent of genotype. Insulin sensitivity was higher in wild-type mice from APNtg Email: [email protected] dams compared to wild-types from wild-type dams, and insulin sensitivity correlated with fat mass and adipocyte size. PNA increased visceral fat% and adipocyte size in Funding information Novo Nordisk Fonden (NNF), Grant/ wild-type offspring from wild-type dams, while wild-type and APNtg offspring from Award Number: NNF19OC0056601; APNtg dams were protected against this effect.
    [Show full text]
  • Follicle-Stimulating Hormone Regulates Expression and Activity of Epidermal Growth Factor Receptor in the Murine Ovarian Follicle
    Follicle-stimulating hormone regulates expression and activity of epidermal growth factor receptor in the murine ovarian follicle Stephany El-Hayeka,b,c, Isabelle Demeesterea,c,d, and Hugh J. Clarkea,b,c,e,1 Departments of aObstetrics and Gynecology, bBiology, and eMedicine, McGill University, Montreal, QC, Canada H3A 1A1; cResearch Institute–McGill University Health Centre; Montreal, QC, Canada H3A 1A1; and dResearch Laboratory on Human Reproduction Fertility Clinic, Université Libre de Bruxelles Erasme, 1070 Brussels, Belgium Edited by John J. Eppig, The Jackson Laboratory, Bar Harbor, ME, and approved October 21, 2014 (received for review August 4, 2014) Fertility depends on the precise coordination of multiple events view that the EGFR signaling mediates many or most ovulatory within the ovarian follicle to ensure ovulation of a fertilizable egg. events. First, the release of the EGFR ligands follows the LH surge FSH promotes late follicular development, including expression of but precedes the LH-dependent responses (9–11). Second, EGF luteinizing hormone (LH) receptor by the granulosa cells. Expres- and the EGFR ligands can induce cumulus expansion and oocyte sion of its receptor permits the subsequent LH surge to trigger the maturation in vitro, independently of LH (9, 10, 20, 29). Third, release of ligands that activate EGF receptors (EGFR) on the gran- these events are impaired in mice bearing a hypomorphic Egfr allele ulosa, thereby initiating the ovulatory events. Here we identify a previously unknown role for FSH in this signaling cascade. We that reduces EGFR activity by about one-half and in mice in which show that follicles of Fshb−/− mice, which cannot produce FSH, Egfr has been selectively inactivated in GCs through a targeted have a severely impaired ability to support two essential EGFR- mutation (22, 23).
    [Show full text]
  • An Exploration of Non-Coding RNA in Exosomes Delivered by Swine Anterior Pituitary
    An exploration of non-coding RNA in exosomes delivered by swine anterior pituitary Jiali Xiong South China Agricultural University Haojie Zhang South China Agricultural University Bin Zeng South China Agricultural University Jie Liu South China Agricultural University Junyi Luo South China Agricultural University Ting Chen South China Agricultural University Jiajie Sun South China Agricultural University Qianyun Xi South China Agricultural University Yong-Liang Zhang ( [email protected] ) South China Agricultural University Research article Keywords: Anterior pituitary exosomes, MiRNA, LncRNA, CircRNA, Cross-talk Posted Date: July 29th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-36112/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/26 Abstract Background: The anterior pituitary is a key endocrine organ both in animal and human being drawing much concern. Exosomes are extracellular secretory vesicles carrying proteins, lipids and small RNAs. Previous studies have demonstrated that they had regulatory function both physiologically and pathologically. However, information on exosomes from anterior pituitary remains unknown. Results: In this study, we separated and identied exosomes from anterior pituitary of Duroc swine model for the rst time. Total RNA was extracted and RNA-seq was performed, followed by a comprehensive analysis of miRNAs, lncRNAs and circRNAs. Resultantly, we obtained 343 known miRNAs and 73 novel miRNAs, 15545 lncRNAs and 494 circRNAs. Furthermore, GO and KEGG enrichment analysis showed that the ncRNAs in exosomes may participate in regulating intracellular signal transduction, cellular component organization or biogenesis, small molecule binding, transferase activity. The cross-talk between them also suggested that they may play an important role in signaling process and the biological regulation.
    [Show full text]
  • Single Cell Transcriptomic Analysis of the Adult Mouse Pituitary Reveals a Novel Multi-Hormone Cell Cluster and Physiologic Demand-Induced Lineage Plasticity
    bioRxiv preprint doi: https://doi.org/10.1101/475558; this version posted November 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single cell transcriptomic analysis of the adult mouse pituitary reveals a novel multi-hormone cell cluster and physiologic demand-induced lineage plasticity Yugong Ho1,5,*. Peng Hu1,3,5, Michael T. Peel1, Pablo G. Camara1,4, Hao Wu1,3,* , and Stephen A. Liebhaber1,2, Departments of Genetics1 and Medicine2, Penn Epigenetics Institute3, and Penn Institute for Biomedical Informatics4, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104 5 These authors contributed equally * Corresponding authors Running title: Single cell transcriptomic analysis of the adult mouse pituitary 1 bioRxiv preprint doi: https://doi.org/10.1101/475558; this version posted November 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The anterior pituitary gland drives a set of highly conserved physiologic processes in mammalian species. These hormonally-controlled processes are central to somatic growth, pubertal transformation, fertility, lactation, and metabolism. Current models, based on targeted immuno-histochemical and mRNA analyses, suggest that each of the seven hormones synthesized by the pituitary is produced by a specific and exclusive cell lineage. However, emerging evidence suggests a more complex model in which critical aspects of hormone specificity and plasticity of pituitary cells remain undefined. Here we have applied massively parallel single-cell RNA sequencing (scRNA-seq), in conjunction with a set of orthogonal imaging studies, to systematically map the cellular composition of adult male and female mouse pituitaries at single-cell resolution and in the setting of major physiologic demands.
    [Show full text]
  • The FSHB &Minus;211G>T Variant Attenuates Serum FSH
    European Journal of Human Genetics (2015) 23, 700–703 & 2015 Macmillan Publishers Limited All rights reserved 1018-4813/15 www.nature.com/ejhg SHORT REPORT The FSHB À211G4T variant attenuates serum FSH levels in the supraphysiological gonadotropin setting of Klinefelter syndrome Alexander S Busch1,3, Frank Tu¨ttelmann2,3, Michael Zitzmann1, Sabine Kliesch1 and Jo¨rg Gromoll*,1 Klinefelter syndrome (47, XXY) is the most frequent genetic cause of male infertility and individuals share the endocrine hallmark of hypergonadotropic hypogonadism. Single-nucleotide polymorphisms located within the FSHB/FSHR gene were recently shown to impact serum follicle-stimulating hormone (FSH) levels and other reproductive parameters in men. The objective of this study was to analyse the effect of FSHB-211G4T (c. À280G4T, rs10835638) as well as FSHR c.2039G4A (rs6166) and FSHR c. À29G4A (rs1394205) on endocrine and reproductive parameters in untreated and testosterone-treated Klinefelter patients. Patients were retrospectively selected from the clientele attending a university-based andrology centre. A total of 309 non-mosaic Klinefelter individuals between 18 and 65 years were included and genotyped for the variants by TaqMan assays. The untreated group comprised 248 men, in which the FSHB À211G4T allele was significantly associated with the reduced serum follicle-stimulating hormone levels ( À6.5 U/l per T allele, P ¼ 1.3 Â 10 À3). Testosterone treatment (n ¼ 150) abolished the observed association. When analysing patients before and under testosterone treatment (n ¼ 89), gonadotropin levels were similarly suppressed independently of the FSHB genotype. The FSHR polymorphisms did not exhibit any significant influence in any group, neither on the endocrine nor reproductive parameters.
    [Show full text]
  • FSHB Monoclonal ANTIBODY Catalog Number:67131-1-Ig
    For Research Use Only FSHB Monoclonal ANTIBODY www.ptglab.com Catalog Number:67131-1-Ig Catalog Number: GenBank Accession Number: Purification Method: Basic Information 67131-1-Ig BC113488 Protein A purification Size: GeneID (NCBI): CloneNo.: 150UL , Concentration: 1000 μg/ml by 2488 1B10A11 Bradford method using BSA as the Full Name: Recommended Dilutions: standard; follicle stimulating hormone, beta IHC 1:500-1:2000 Source: polypeptide Mouse Calculated MW: Isotype: 129 aa, 15 kDa IgG2b Immunogen Catalog Number: AG13788 Applications Tested Applications: Positive Controls: IHC, ELISA IHC : human pituitary tissue, human pituitary Species Specificity: adenoma tissue Human Note-IHC: suggested antigen retrieval with TE buffer pH 9.0; (*) Alternatively, antigen retrieval may be performed with citrate buffer pH 6.0 The FSHB gene encodes the beta subunit of follicle-stimulating hormone (FSH), particularly expressed in Background Information gonadotroph cells within the anterior pituitary gland and plays a critical role in the regulation of gonadal function, pubertal maturation and reproductive processes in mammals. The transcription of the FSHB gene is critical for the production of the FSH hormone(PMID:28281143). And FSH is required for ovarian folliculogenesis in females, in males it promotes spermatogenesis in conjunction with testosterone(PMID:11739331). Mutations in FSHB gene would result in infertility both in men and women (PMID: 23766128). Storage: Storage Store at -20°C. Storage Buffer: PBS with 0.1% sodium azide and 50% glycerol pH 7.3. Aliquoting is unnecessary for -20ºC storage For technical support and original validation data for this product please contact: This product is exclusively available under Proteintech T: 1 (888) 4PTGLAB (1-888-478-4522) (toll free E: [email protected] Group brand and is not available to purchase from any in USA), or 1(312) 455-8498 (outside USA) W: ptglab.com other manufacturer.
    [Show full text]
  • Comparison of Syncytiotrophoblast Generated from Human Embryonic Stem Cells and from Term Placentas
    Comparison of syncytiotrophoblast generated from human embryonic stem cells and from term placentas Shinichiro Yabea, Andrei P. Alexenkob, Mitsuyoshi Amitab,c, Ying Yangb, Danny J. Schusta, Yoel Sadovskyd, Toshihiko Ezashib, and R. Michael Robertsb,e,1 aDepartment of Obstetrics, Gynecology, and Women’s Health, University of Missouri, Columbia, MO 65211; bDivision of Animal Sciences, Bond Life Sciences Center, University of Missouri, Columbia, MO 65211; cDepartment of Obstetrics and Gynecology, Faculty of Medicine, Yamagata University, Yamagata, 990-9585, Japan; dMagee-Womens Research Institute, University of Pittsburgh, Pittsburgh, PA 15213; and eDepartment of Biochemistry, University of Missouri, Columbia, MO 65211 Contributed by R. Michael Roberts, March 10, 2016 (sent for review February 1, 2016; reviewed by Joanna James and Michael J. Soares) Human embryonic stem cells (ESCs) readily commit to the trophoblast is controversial; an alternative theory is that the latter are rem- lineage after exposure to bone morphogenetic protein-4 (BMP-4) and nants of the original primitive syncytium formed during initial two small compounds, an activin A signaling inhibitor and a FGF2 trophoblast invasion (2, 3). The extent to which the phenotypes of signaling inhibitor (BMP4/A83-01/PD173074; BAP treatment). During these different forms of STB resemble each other and whether the differentiation, areas emerge within the colonies with the biochem- underlying processes that lead to cell fusion have features in ical and morphological features of syncytiotrophoblast (STB). Rela- common remain unclear. tively pure fractions of mononucleated cytotrophoblast (CTB) and Several main cell systems have been used to study STB for- larger syncytial sheets displaying the expected markers of STB can mation.
    [Show full text]
  • Hormones Growth Factors and Receptors
    Estrogens and Progestins ANSC 630 Reproductive Biology I 1 Hormone Functions 2 Physiological Roles of Hormones • Neuromodulation • Reproductive Processes • Metabolism (anabolic/catabolic) • Cellular proliferation and growth • Excretion and readsorption • Behavior • Immune system • More being discovered every day ! 3 Classical Definition of a Hormone: Physiological organic substance produced by specialized cells and released into circulating blood or lymph for transport to target tissues in distant organs to exert specific actions. Classical hormones are cell signaling molecules that: are synthesized by endocrine cells, e.g., gonadotrophs are secreted into the circulation (blood or lymph) interact with proteins called receptors on target cells (e.g., theca cells of ovarian follicle) have specific effects on target cells (e.g., stimulate theca cells to produce androgens such as testosterone) 4 Modern Definition of Hormone • Hormone – Substance released by one cell to regulate another cell. Synonymous with chemical messenger. – Delivered through endocrine, neuroendocrine, neurocrine, paracrine, autocrine, lactocrine or pheromonal systems • Chemical Nature of Hormones: • Amino Acids (norepinephrine, epinephrine, dopamine from tyrosine; thyroid hormones Triiodothyronine (T3) and Thryoxin (T4) from two iodinated tyrosines • Peptides (e.g., oxytocin) and Proteins (e.g., Follicle Stimulating Hormone and Luteinizing Hormone) • Steroid Hormones – Intact steroid nucleus (cortisol, estrogen, progesterone) – Broken steroid nucleus (Vitamin D and metabolites)
    [Show full text]
  • Neuroendocrine Tumor V1-907-4109.0.Indd
    IHC PANEL MARKERS Neuroendocrine Tumor BioGenex offers wide-ranging antibodies for several IHC panel for initial differentiation, tumor origin, treatment methods, and prognosis. All BioGenex antibodies are validated on human tissues to ensure sensitivity and specificity. BioGenex comprehensive IHC panels include a range of mouse monoclonal, rabbit monoclonal, and polyclonal antibodies to choose from. BioGenex offers a vast spectrum of high-quality antibodies for both diagnostic and reference laboratories. BioGenex strives to support efforts in clinical diagnostics and drug discovery development as we continue to expand our antibody product line offering in both ready-to-use and concentrated formats for both manual and automation systems. Antibodies for Neuroendocrine Tumor PGP9.5, IDH1, Chromogranin A, Ki-67, NKX3.1, Synaptophysin, Chromogranin A, Human Chorionic Gonadotropin (hCG) Beta, HCGα, Glucagon, Alpha-Fetoprotein (AFP), VIP, FSH-BETA, Inhibin-Alpha, Neurofilament, CD56, NSE, CDX2, TTF1, GFAP, Prolactin, Ki-67, LH, CD57, NSE NEW IHC PANEL MARKERS - Neuroendocrine Tumor PGP9.5 This antibody reacts with a protein of 20-30kDa, identified as PGP9.5, also known as ubiquitin UchL1. PGP9.5 is highly expressed in neurons and to cells of the diffuse neuroendocrine system and their tumors. It is abundantly present in all neurons (accounts for 1-2% of total brain protein), expressed specifically in neurons and testis/ovary.[5][6] Although UCH-L1 protein expression is specific to neurons and testis/ovary tissue, it has been found to be expressed in certain lung-tumor cell lines.[16] This abnormal expression of UCH-L1 is implicated in cancer and has led to the designation of UCH-L1 as an oncogene.[17] Furthermore, immunostaining for PGP9.5 has been shown in a wide variety of mesenchymal neoplasms as well.
    [Show full text]