BIOLOGY OF REPRODUCTION 82, 1030–1036 (2010) Published online before print 10 February 2010. DOI 10.1095/biolreprod.109.080986 Sexually Dimorphic Expression of Gonadotropin Subunits in the Pituitary of Protogynous Honeycomb Grouper (Epinephelus merra): Evidence That Follicle-Stimulating Hormone (FSH) Induces Gonadal Sex Change1 Yasuhisa Kobayashi,2,3 Mohammad Ashraful Alam,3 Ryo Horiguchi,3 Akio Shimizu,4 and Masaru Nakamura3,4 Sesoko Station,3 Tropical Biosphere Research Center, University of the Ryukyus, Okinawa, Japan National Research Institute of Fisheries Science,4 Fisheries Research Agency, Fukuura, Kanazawa, Yokohama, Japan Downloaded from https://academic.oup.com/biolreprod/article/82/6/1030/2557961 by guest on 27 September 2021 ABSTRACT adulthood [1–3]. During this process, the gonad changes dramatically from ovary to testis (protogynous), or vice versa Recent studies have suggested that the hypothalamic-pitui- (protandrous) [1–3]. Numerous endocrine studies on gonadal tary-gonadal axis is involved in gonadal sex change in sex- steroidogenesis have been performed to reveal the physiolog- changing teleosts. However, its underlying mechanism remains ical mechanisms of sex change. In several protogynous species, largely unknown. In this study, we focused on the distinct roles plasma estrogen (estradiol-17b [E2]) levels are high in the of two gonadotropins (GTHs), follicle-stimulating hormone female phase, and a rapid decrease of E2 was observed in (FSH) and luteinizing hormone (LH), in the protogynous association with sex change [4–6]. Additionally, androgen Downloaded from www.biolreprod.org. hermaphrodite teleost, honeycomb grouper (Epinephelus mer- ra). First, we investigated the expression pattern of mRNAs for treatment of these species during the female phase results in GTH subunits (cga, fshb, and lhb) in the pituitaries from fish at sex change [5, 7, 8]. In contrast, administration of E2 induces the different sexual phases. Real-time RT-PCR analyses showed male-to-female sex change in the protandrous black porgy [9, that fhsb mRNA levels in the female pituitary were low. 10] and the initial-phase male of protogynous wrasse [11, 12]. However, fshb transcripts increased dramatically in association Taken together, these results suggest that regulation of the with testis development. In contrast, levels of cga and lhb appropriate balance of androgen to estrogen biosynthesis is mRNAs did not significantly vary during sex change. In addition, critical to the process of gonadal sex change. However, the immunohistochemical observations of Fshb- and Lhb-producing upstream mechanisms for the regulation of gonadal steroido- cells in the pituitary, through the use of specific antibodies for genesis during sex change are largely unknown. detections of teleost GTH subunits, were consistent with In teleosts, as in other vertebrates, gonadal steroidogenesis sexually dimorphic expression of Fshb. In order to identify the is largely controlled by pituitary-produced gonadotropins role of GTH in gonad of honeycomb grouper, we treated females (GTHs), follicle-stimulating hormone (FSH), and luteinizing with bovine FSH (50 or 500 ng/fish) or LH (500 ng/fish) in vivo. hormone (LH) [13]. These GTHs contain a common After 3 wk, FSH treatments induced female-to-male sex change glycoprotein hormone a subunit (Cga) that forms a heterodimer and up-regulated endogenous androgen levels and fshb tran- with unique b subunits (Fshb and Lhb) (reviewed by Bousfield scripts, whereas LH treatment had no effect on sex change. et al. [14] and Pierce and Parsons [15]). In well-studied These results suggest that FSH may trigger the female-to-male salmonids, FSH plays a significant role in puberty and sex change in honeycomb grouper. gametogenesis, whereas LH is primarily involved in final androgen, estrogen, follicle-stimulating hormone, gonadotropin, maturation of the gametes in both sexes [16–18]. However, grouper, luteinizing hormone, ovary, pituitary hormones, sex variations in the expression profiles and potential roles of change, teleost GTHs were reported in other teleost species [19–22]. In protogynous wrasse, sexual dimorphic expression patterns of INTRODUCTION fshb and lhb transcripts were observed during the spawning season [23]. In protandrous black porgy, plasma Lh levels were Sex in most animals is determined at an early developmental higher in male than sex-changing fish [24]. In addition, stage, and is fixed throughout their life span [1]. By contrast, treatment with exogenous human chorionic GTH or LH many marine teleosts exhibit sequential hermaphroditism, induced sex change in the protogynous bluehead wrasse [25] wherein an individual changes from one sex to the other in and rice-field eel [26, 27]. These studies indicate that GTHs participate in regulating sex-changing processes. However, 1Supported by a Grant-in-Aid for a Japan Society for the Promotion of information of GTH expression pattern during the sex- Science fellowship and Solution Oriented Research for Science and changing process is currently absent. Therefore, the detailed Technology (SORST). 2Correspondence: Yasuhisa Kobayashi, University of the Ryukyus, 3422 biological functions of GTH during sex change are not clear. Sesoko, Motobu, Okinawa 905-0227, Japan. FAX: 81 980 47 4919; In this study, we used the honeycomb grouper (Epinephelus e-mail: [email protected] merra) as a model. This species is a protogynous hermaphro- dite. All individuals mature initially as females. When the Received: 4 September 2009. females reach a certain age or body size, they change to males First decision: 6 October 2009. [28]. In this species, artificial sex changes have been Accepted: 28 January 2010. intensively studied in our laboratory. Either suppression of Ó 2010 by the Society for the Study of Reproduction, Inc. estrogen biosynthesis with aromatase inhibitors or elevation in This is an Open Access article, freely available through Biology of Reproduction’s Authors’ Choice option. androgen levels by treatment with androgen induced sex eISSN: 1529-7268 http://www.biolreprod.org change in honeycomb grouper [29–31] and other grouper ISSN: 0006-3363 species [32–34]. Since the different sexual-phase individuals of 1030 EXPRESSION OF GTH SUBUNITS IN PROTOGYNOUS GROUPER 1031 TABLE 1. Oligonucleotide primers used in this study. Target gene Purpose Oligonucleotide sequence (50 to 30) cga RT-PCR GGMTGTGAGGARTGYAMACTSAA GCWACGCAGCATGTRGCTTCAGA 30RACE AAGAACAGTGTTTTCTCAAGGGATCGTC 50RACE ATGTTCTTCGGGATCGTCATTGTCTT Real-time PCR AAACATTGGCTGCGAGGAGT CGGGATCGTCATTGTCTTCA fshb RT-PCR TGCAGYTGGTYSTCATGG CWYCTCRTAGGACCASTC 30RACE CCACACCGAGTACATCTACACCACCATA 50RACE ATTGCAGACTTTCTGTTCAGCCCAGT Real-time PCR TGCCACTCCGACTGTCATCT TCTGTTCAGCCCAGTCATCG Downloaded from https://academic.oup.com/biolreprod/article/82/6/1030/2557961 by guest on 27 September 2021 ihb RT-PCR ATCTGCAGYGGYCACTGC ACAGTCRGAMGTGTCCAT 30RACE GAAGGACCCTGTCATCAAGATACCATTC 50RACE GAGGACAGTCAGGAAGCTCAAATGTCTT Real-time PCR GGAGAAGGAAGGCTGTCCAA TGACAGGGTCCTTCGTGATG ef1a Real-time PCR TTGCCCTCTGGAAGTTTGAG ACACCAGCAGCAACAATGAG Downloaded from www.biolreprod.org. Downloaded from www.biolreprod.org. honeycomb grouper are readily captured from the wild, Cloning of Grouper GTH Subunits cDNA honeycomb grouper provides an excellent animal model to Total RNA extracted from pituitary of adult males was used as a template elucidate the mechanism of sex change. for cloning (RNeasy mini Kit; Qiagen). First, cDNA fragments of cga, fshb, The aim of this study was to elucidate the involvement of and lhb were isolated by RT-PCR with degenerate primers. Then, full-length GTH during the process of sex change in honeycomb grouper. cDNAs of GTH subunits were identified by a SMART RACE cDNA As a first step, we examined the pattern of gene expression for amplification kit (Clontech). Primers used in cloning are listed in Table 1. GTH subunits in the pituitaries of different sexual phases, Sequencing was done with BigDye (Version 3.1). In all cases, at least three including sex-changing fish, using real-time PCR. Additional- independent clones were sequenced. Transcripts of grouper GTH subunits in pituitary were determined using ly, localization of Fshb- and Lhb-producing cells in the real-time RT-PCR. Described briefly, total RNA was isolated from individual pituitaries of males, females, and sex-changing fishes was pituitaries stored in RNAlater using the RNAeasy mini kit with the RNase-free performed by immunohistochemistry using antisera that DNase kit (Qiagen), according to the manufacturer’s instructions. Samples recognize Fsh and Lh from several teleost species. Finally, were reverse transcribed from 200 ng of total RNA in a 20-ll volume using the effects of purified bovine FSH and LH on the nonbreeding random hexamer primers and OmniScript reverse transcriptase (Qiagen). An aliquot of 2 ll of the above diluted cDNA sample was used for a 22-ll PCR female gonad in vivo were examined. The results generated in reaction with SYBER Premix Ex Taq (Takara Bio Inc., Shiga, Japan) on the this study contribute to the understanding of biological ABI 7000 sequence detection system (Applied Biosystems, Foster City, CA). functions of GTH on the process of sex change. Primer sets for each gene were designed by PrimerExpress Software. Quantitative PCR assay was done with triplicate samples. Copy number in MATERIALS AND METHODS unknown samples was determined by Ct value to the each gene standards. Standard copy number of each gene was estimated based on molecular