DOCSLIB.ORG

Expression of 11 HOX Genes Is Deregulated in Esophageal Squamous Cell Carcinoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression of 11 HOX Genes Is Deregulated in Esophageal Squamous Cell Carcinoma 1044 Vol. 11, 1044–1049, February 1, 2005 Clinical Cancer Research Expression of 11 HOX Genes Is Deregulated in Esophageal Squamous Cell Carcinoma Ke-Neng Chen,1 Zhen-Dong Gu,1 Yang Ke,2 mucosa. Five of the 39 HOX genes were expressed in both Ji-You Li,3 Xiao-Tian Shi,5 and Guang-Wei Xu4 types of tissue indicating their possible role in maintaining Departments of 1Thoracic Surgery, 2Genetics, 3Pathology, and 4General normal structure and function of adult esophageal mucosa. Surgery, Peking University School of Oncology, Beijing Cancer Eleven of the 39 HOX genes were deregulated in cancer Hospital, Beijing, China; and 5Department of Thoracic Surgery, Anyang tissue. These genes possibly participate in the carcinogenesis Tumor Hospital, Anyang City, China of ESCC. ABSTRACT INTRODUCTION Purpose: HOX genes are vital for all aspects of Esophageal cancer is the sixth most common cancer in the mammalian growth and differentiation, and recent data world, of which esophageal squamous cell carcinoma (ESCC) have shown that their deregulated expression is related to accounts for >90% of the cases (1, 2). The highest incidence of carcinogenesis. To date, there has been no systemic study ESCC in the world occurs in north-central China (3). Although on expression of HOX genes in esophageal carcinoma. We tremendous advances in diagnosis and treatment have been investigated the expression pattern of 39 known HOX achieved recently, ESCC is still one of the most lethal genes in cancerous and noncancerous tissue from 36 malignancies mainly because of advanced of stage at discovery patients with esophageal squamous cell carcinoma to and the lack of an efficacious system both in understanding its determine whether their expression is altered in esophageal carcinogenic mechanism and in clinical evaluation. This cancer. understanding could lead to a better clinical evaluation and Experimental Design: Thirty-six patients with resectable treatment for individual patients. Many of the molecular esophageal squamous cell carcinoma (ESCC) were enrolled pathways that underlie carcinogenesis are aberrations of the in this study. Specific primers were designed for each of 39 normal processes (4, 5). The fetal cellular features of tumor HOX genes, and reverse transcription-PCR was done in cells suggest that neoplasia arises through a process of cancerous and noncancerous samples of these 36 patients. defective ontogeny. HOX genes code transcription factors that Furthermore, the expression of HOXA9 protein was orchestrate organogenesis patterning and maintain tissue subjected to Western blot analysis in all 36 paired tissue homeostasis. Thus, if defective ontogeny is a mechanism in samples. cancer development, it can be hypothesized that tumor cells Results: Eight of 39 HOX genes were expressed in should express the HOX genes, which are normally expressed cancerous but not in noncancerous tissue. Five of 39 HOX by the embryonic cells of that tissue. Because of their global genes were expressed both in cancerous and noncancerous importance in development and differentiation and their tissue. Of the latter, expression of HOXA7, HOXA9, and frequent deregulation in cancer, HOX genes are ideal subjects HOXC6 was significantly higher in cancerous tissue (P < for exploration the intimate relationship between carcinogenesis 0.05). The remaining 26 HOX genes were not detected in and embryogenesis. either types of tissue. HOXA9 protein was expressed in both HOX genes constitute a family of transcription factors kinds of tissue (cancer tissue versus noncancerous mucosa: key to developmental processes (6). They all contain the 0.34 F 0.32 versus 0.24 F 0.27, P = 0.121). homeobox, a highly conserved 183-nucleotide sequence Conclusions: This is the first comprehensive survey of encoding a 61-amino-acid domain (the homeodomain) respon- 39 HOX gene expression in ESCC and noncancerous sible for the recognition and binding of sequence-specific DNA motifs. In humans, the 39 HOX genes identified thus far are clustered into 13 paralogue groups distributed on Received 8/30/04; revised 11/7/04; accepted 11/12/04. chromosomes: 7 (HOXA), 17 (HOXB), 12 (HOXC), and 2 Grant support: Beijing New Star of Science and Technology Plan from (HOXD). During embryonic morphogenesis, these HOX genes Beijing Municipal Science and Technology Commission grant 954813600, Institutional research fund of Peking University School of determine positional identity along anterior-posterior axes Oncology, Beijing Cancer Hospital, Research fund of Beijing Municipal according to the colinearity rule (7). They are also expressed Science and Technology Commission grant H020920030390. in some normal adult organs with characteristic patterns, The costs of publication of this article were defrayed in part by the suggesting a role in the maintenance of tissue-specific payment of page charges. This article must therefore be hereby marked architecture (8). A HOX gene is normally required for advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. differentiation of a particular tissue, and it can play a causal Note: Dr. K. Chen is currently a postdoctoral fellow at the Department of role in carcinogenesis of that same tissue if expressed at the Plastic Surgery of University of Texas M.D. Anderson (Houston, Texas). wrong time, at the wrong level, or in the wrong context. HOX Requests for reprints: Ke-Neng Chen, Department of Thoracic Surgery, genes were first believed to be transcriptional activators that Peking University School of Oncology, Beijing Cancer Hospital, Beijing, China, 100036. Phone: 86-10-88121122; Fax: 86-10-88122437; E-mail: enhance oncogenesis through their up-regulation in carcinoma [email protected]. cells. The actual situation seems to be much more D2005 American Association for Cancer Research. complicated, as both losses and gains in HOX gene Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2005 American Association for Cancer Research. Clinical Cancer Research 1045 expression are related to carcinogenesis (4). Therefore, the MATERIALS AND METHODS current state of our knowledge is insufficient to establish a Samples Collection and Preparation. Tissue samples precise, causal relationship between individual HOX genes were removed from 36 patients with ESCC who underwent and the specific cancer phenotypes to which they contribute, surgical resection at the Thoracic Surgery Department of Peking or to understand how HOX genes contribute to the tissue- University School of Oncology from February 2003 to June specific features of cancer. Comprehensive analysis of the 2003. All of the patients underwent radical esophagectomy expression patterns of HOX genes in different cancers is without any preoperative chemotherapy or radiotherapy. They needed to fill these gaps in knowledge. Researchers have include 29 men and seven women ages 40 to 69 years (mean 60 shown that the deregulation of HOX genes is associated both years). The pathologic diagnosis of ESCC was confirmed by two with leukemia and solid malignancies (9–21). To date, no independent senior pathologists from the Pathologic Department persuasive reports have yet been published on HOX gene of Peking University School of Oncology. These tumors were expression patterns in ESCC (22). However, knowing the expressionpatternofthisgenefamilyinESCCmay classified into stage IIa (n = 10), IIb (n = 9), and III (n = 17) contribute to our understanding of what role HOX genes according to the criteria of the Unio Internationale Contra play in this specific cancer phenotype. Cancrum tumor-node-metastasis system of malignant tumors This report is the first systemic study on 39 HOX gene (1987). During operation, each of 500 mg tissue samples was expression portraits both in tissues of ESCC and matched taken both from non-necrotic ESCC tissue and noncancerous noncancerous mucosa. We found unique HOX gene expression mucosa and immediately snap frozen in liquid nitrogen and pattern in both kinds of tissue. These observations indicate stored at À80jC until RNA or protein was extracted. that 11 HOX genes possibly participate in the carcinogenesis Noncancerous mucosa referred the tissue taken from at least of ESCC. 5 cm away from cancerous margin. This study got the approval Table 1 Specific primers for HOX genes Primers Gene Sense Antisense Annealing temperature (jC) Size (bp) Intron HOXA1 ATGAACTCCTTCCTGGAATA CGTACTCTCCAACTTTCC 48 655 + HOXA2 ACAGCGAAGGGAAATGTAAAAGC GGGCCCCAGAGACGCTAA 54 102 À HOXA3 TGCAAAAAGCGACCTACTACGA CGTCGGCGCCCAAAG 51 126 À HOXA4 TGCATGCGAGCCACGTCCT TTGACCTGGCGCTCAGACAA 52 391 + HOXA5 TGCGCAAGCTGCACATAAGTCATG TTGAAGTGGAACTCCTTCTCCAGC 56 112 + HOXA6 GATGCAGCGCATGAACTCCTGCG TGGGCTGCGTGGAATTGATGAGC 58 250 + HOXA7 CAAAATGCCGAGCCGACTT TAGCCGGACGCAAAGGG 58 146 À HOXA9 CAGCCAACTGGCTTCATGCG CACTCGTCTTTTGCTCGGTC 53 229 À HOXA10 AGAGCAGCAAAGCCTCGCCGGAGAAG GGACGCTGCGGCTAATCTCTAGGCG 62 198 + HOXA11 ACCCGCAAAAAGCGCTGC GAGCATGCAGGACAGTTG 50 114 À HOXA13 GGGAGAAAGAAGCGCGTG CGTCGTGGCTGATATCCG 53 114 À HOXB1 CCTTCTTAGAGTACCCACTCTG GCATCTCCAGCTGCCTCCTT 52 826 + HOXB2 TCCTCCTTTCGAGCAAACCTTCC AGTGGAATTCCTTCTCCAGTTCC 52 353 + HOXB3 AGTACAAGAAGGACCAGAAGGC TGGAGTGTAAGGCGTTCATG 50 120 À HOXB4 GTGCAAAGAGCCCGTCGTCTACC CGTGTCAGGTAGCGGTTGTAGTG 56 161 + HOXB5 GTTCCACTTCAACCGCTACC TGTCCTTCTTCCACTTCATGC 52 122 À HOXB6 GGCGAGGCCGCCAGACATAC ACTCGGCCTGTTTTTCTTCC 52 236 À HOXB7 AGAGTAACTTCCGGATCTA TCTGCTTCAGCCCTGTCTT 48 274 + HOXB8 AGCCTCCTTGTGCAATTG GTAACAATTGCCCACAGC 48 300 À HOXB9 GAGCAGGGCAAAGAGTAA CTTTCTCCTGACACCTAG
Load more

Recommended publications
  • HOXC4 Rabbit Pab
    Leader in Biomolecular Solutions for Life Science HOXC4 Rabbit pAb Catalog No.: A13856 Basic Information Background Catalog No. This gene belongs to the homeobox family of genes. The homeobox genes encode a A13856 highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox Observed MW gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different 30kDa chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC4, is one of several homeobox HOXC genes located in a cluster on chromosome 12. Three Calculated MW genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include 29kDa the shared exon spliced to the gene-specific exons, or they may include only the gene- specific exons. Two alternatively spliced variants that encode the same protein have Category been described for HOXC4. Transcript variant one includes the shared exon, and transcript variant two includes only gene-specific exons. Primary antibody Applications WB Cross-Reactivity Mouse, Rat Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 3221 P09017 Immunogen Recombinant fusion protein containing a sequence corresponding to amino acids 30-130 of human HOXC4 (NP_055435.2). Synonyms HOXC4;HOX3;HOX3E;cp19 Contact Product Information www.abclonal.com Source Isotype Purification Rabbit IgG Affinity purification Storage Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide,50% glycerol,pH7.3. Validation Data Western blot analysis of extracts of various cell lines, using HOXC4 antibody (A13856) at 1:3000 dilution.
    [Show full text]
  • Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells
    The Journal of Clinical Investigation RESEARCH ARTICLE Prospective isolation of NKX2-1–expressing human lung progenitors derived from pluripotent stem cells Finn Hawkins,1,2 Philipp Kramer,3 Anjali Jacob,1,2 Ian Driver,4 Dylan C. Thomas,1 Katherine B. McCauley,1,2 Nicholas Skvir,1 Ana M. Crane,3 Anita A. Kurmann,1,5 Anthony N. Hollenberg,5 Sinead Nguyen,1 Brandon G. Wong,6 Ahmad S. Khalil,6,7 Sarah X.L. Huang,3,8 Susan Guttentag,9 Jason R. Rock,4 John M. Shannon,10 Brian R. Davis,3 and Darrell N. Kotton1,2 2 1Center for Regenerative Medicine, and The Pulmonary Center and Department of Medicine, Boston University School of Medicine, Boston, Massachusetts, USA. 3Center for Stem Cell and Regenerative Medicine, Brown Foundation Institute of Molecular Medicine, University of Texas Health Science Center, Houston, Texas, USA. 4Department of Anatomy, UCSF, San Francisco, California, USA. 5Division of Endocrinology, Diabetes and Metabolism, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts, USA. 6Department of Biomedical Engineering and Biological Design Center, Boston University, Boston, Massachusetts, USA. 7Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts, USA. 8Columbia Center for Translational Immunology & Columbia Center for Human Development, Columbia University Medical Center, New York, New York, USA. 9Department of Pediatrics, Monroe Carell Jr. Children’s Hospital, Vanderbilt University, Nashville, Tennessee, USA. 10Division of Pulmonary Biology, Cincinnati Children’s Hospital, Cincinnati, Ohio, USA. It has been postulated that during human fetal development, all cells of the lung epithelium derive from embryonic, endodermal, NK2 homeobox 1–expressing (NKX2-1+) precursor cells.
    [Show full text]
  • Effect of Testosterone and Hypoxia on the Expansion of Umbilical Cord Blood CD34+ Cells in Vitro
    EXPERIMENTAL AND THERAPEUTIC MEDICINE 14: 4467-4475, 2017 Effect of testosterone and hypoxia on the expansion of umbilical cord blood CD34+ cells in vitro LIPING ZHOU1,2, XIAOWEI ZHANG2, PANPAN ZHOU1, XUE LI1, XUEJING XU1, QING SHI1, DONG LI1 and XIULI JU1 1Department of Pediatrics, Qilu Hospital, Shandong University, Jinan, Shandong 250012; 2Department of Pediatrics, The Sixth People's Hospital of Jinan, Jinan, Shandong 250200, P.R. China Received October 12, 2016; Accepted June 15, 2017 DOI: 10.3892/etm.2017.5026 Abstract. Successfully expanding hematopoietic stem cells Therefore, the results of the current study indicate that a combina- (HSCs) is advantageous for clinical HSC transplantation. The tion of hypoxia and testosterone may be a promising cultivation present study investigated the influence of testosterone on the condition for HSC/hemopoietic progenitor cell expansion ex vivo. proliferation, antigen phenotype and expression of hemato- poiesis-related genes in umbilical cord blood-derived cluster Introduction of differentiation (CD)34+ cells under normoxic or hypoxia conditions. Cord blood (CB) CD34+ cells were separated using Hematopoietic stem cell (HSC) transplantation is a poten- magnetic activated cell sorting. A cytokine cocktail and feeder tially life-saving procedure used to treat a broad spectrum cells were used to stimulate the expansion of CD34+ cells under of disorders, including hematological, immune and genetic normoxic (20% O2) and hypoxic (1% O2) conditions for 7 days diseases (1). It has been demonstrated that bone marrow and testosterone was added accordingly. Cells were identified reconstituting HSCs reside within a small subpopulation using flow cytometry and reconstruction capacity was deter- of bone marrow or blood-derived mononuclear cells that mined using a colony-forming unit (CFU) assay.
    [Show full text]
  • Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
    Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes.
    [Show full text]
  • Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis
    Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis Deepti Verma, Anna-Karin Ekman, Cecilia Bivik Eding and Charlotta Enerbäck The self-archived postprint version of this journal article is available at Linköping University Institutional Repository (DiVA): http://urn.kb.se/resolve?urn=urn:nbn:se:liu:diva-147791 N.B.: When citing this work, cite the original publication. Verma, D., Ekman, A., Bivik Eding, C., Enerbäck, C., (2018), Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis, Journal of Investigative Dermatology, 138(5), 1088-1093. https://doi.org/10.1016/j.jid.2017.11.036 Original publication available at: https://doi.org/10.1016/j.jid.2017.11.036 Copyright: Elsevier http://www.elsevier.com/ Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis Deepti Verma*a, Anna-Karin Ekman*a, Cecilia Bivik Edinga and Charlotta Enerbäcka *Authors contributed equally aIngrid Asp Psoriasis Research Center, Department of Clinical and Experimental Medicine, Division of Dermatology, Linköping University, Linköping, Sweden Corresponding author: Charlotta Enerbäck Ingrid Asp Psoriasis Research Center, Department of Clinical and Experimental Medicine, Linköping University SE-581 85 Linköping, Sweden Phone: +46 10 103 7429 E-mail: [email protected] Short title Differential methylation in psoriasis Abbreviations CGI, CpG island; DMS, differentially methylated site; RRBS, reduced representation bisulphite sequencing Keywords (max 6) psoriasis, epidermis, methylation, Wnt, susceptibility, expression 1 ABSTRACT Psoriasis is a chronic inflammatory skin disease with both local and systemic components. Genome-wide approaches have identified more than 60 psoriasis-susceptibility loci, but genes are estimated to explain only one third of the heritability in psoriasis, suggesting additional, yet unidentified, sources of heritability.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • Transcription Factor Gene Expression Profiling and Analysis of SOX Gene Family Transcription Factors in Human Limbal Epithelial
    Transcription factor gene expression profiling and analysis of SOX gene family transcription factors in human limbal epithelial progenitor cells Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat. vorgelegt von Dr. med. Johannes Menzel-Severing aus Bonn Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg Tag der mündlichen Prüfung: 7. Februar 2018 Vorsitzender des Promotionsorgans: Prof. Dr. Georg Kreimer Gutachter: Prof. Dr. Andreas Feigenspan Prof. Dr. Ursula Schlötzer-Schrehardt 1 INDEX 1. ABSTRACTS Page 1.1. Abstract in English 4 1.2. Zusammenfassung auf Deutsch 7 2. INTRODUCTION 2.1. Anatomy and histology of the cornea and the corneal surface 11 2.2. Homeostasis of corneal epithelium and the limbal stem cell paradigm 13 2.3. The limbal stem cell niche 15 2.4. Cell therapeutic strategies in ocular surface disease 17 2.5. Alternative cell sources for transplantation to the corneal surface 18 2.6. Transcription factors in cell differentiation and reprogramming 21 2.7. Transcription factors in limbal epithelial cells 22 2.8. Research question 25 3. MATERIALS AND METHODS 3.1. Human donor corneas 27 3.2. Laser Capture Microdissection (LCM) 28 3.3. RNA amplification and RT2 profiler PCR arrays 29 3.4. Real-time PCR analysis 33 3.5. Immunohistochemistry 34 3.6. Limbal epithelial cell culture 38 3.7. Transcription-factor knockdown/overexpression in vitro 39 3.8. Proliferation assay 40 3.9. Western blot 40 3.10. Statistical analysis 41 2 4. RESULTS 4.1. Quality control of LCM-isolated and amplified RNA 42 4.2.
    [Show full text]
  • Supplementary Table 5. Clover Results Indicate the Number Of
    Supplementary Table 5. Clover results indicate the number of chromosomes with transcription factor binding motifs statistically over‐ or under‐represented in HTE DHS within intergenic sequence (more than 2kb outside of any gene). Analysis was divided into three groups (all DHS, HTE‐selective DHS, and ubiquitous DHS). Motifs with more than one entry in the databases utilized were edited to retain only the first occurrence of the motif. All DHS x Intergenic TE­selective DHS x Intergenic Ubiquitous DHS x Intergenic ID Name p < 0.01 p > 0.99 ID Name p < 0.01 p > 0.99 ID Name p < 0.01 p > 0.99 MA0002.2 RUNX1 23 0 MA0080.2 SPI1 23 0 MA0055.1 Myf 23 0 MA0003.1 TFAP2A 23 0 MA0089.1 NFE2L1::MafG 23 0 MA0068.1 Pax4 23 0 MA0039.2 Klf4 23 0 MA0098.1 ETS1 23 0 MA0080.2 SPI1 23 0 MA0055.1 Myf 23 0 MA0099.2 AP1 23 0 MA0098.1 ETS1 23 0 MA0056.1 MZF1_1‐4 23 0 MA0136.1 ELF5 23 0 MA0139.1 CTCF 23 0 MA0079.2 SP1 23 0 MA0145.1 Tcfcp2l1 23 0 V$ALX3_01 ALX‐3 23 0 MA0080.2 SPI1 23 0 MA0150.1 NFE2L2 23 0 V$ALX4_02 Alx‐4 23 0 myocyte enhancer MA0081.1 SPIB 23 0 MA0156.1 FEV 23 0 V$AMEF2_Q6 factor 23 0 MA0089.1 NFE2L1::MafG 23 0 V$AP1FJ_Q2 activator protein 1 23 0 V$AP1_01 AP‐1 23 0 MA0090.1 TEAD1 23 0 V$AP4_Q5 activator protein 4 23 0 V$AP2_Q6_01 AP‐2 23 0 MA0098.1 ETS1 23 0 V$AR_Q6 half‐site matrix 23 0 V$ARX_01 Arx 23 0 BTB and CNC homolog MA0099.2 AP1 23 0 V$BACH1_01 1 23 0 V$BARHL1_01 Barhl‐1 23 0 BTB and CNC homolog MA0136.1 ELF5 23 0 V$BACH2_01 2 23 0 V$BARHL2_01 Barhl2 23 0 MA0139.1 CTCF 23 0 V$CMAF_02 C‐MAF 23 0 V$BARX1_01 Barx1 23 0 MA0144.1 Stat3 23 0
    [Show full text]