Number 7 July 2012

VolumeVolume 16 1 -- NumberNumber 71 May -July Sept 2012ember 1997

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Scope

The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It presents structured review articles ("cards") on genes, leukaemias, solid tumours, cancer-prone diseases, more traditional review articles on these and also on surrounding topics ("deep insights"), case reports in hematology, and educational items in the various related topics for students in Medicine and in Sciences.

Editorial correspondance

Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected]

Staff Mohammad Ahmad, Mélanie Arsaban, Jérémy Cigna, Marie-Christine Jacquemot-Perbal, Vanessa Le Berre, Anne Malo, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski. Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave Roussy Institute – Villejuif – France).

The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008.

The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS.

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Editor

Jean-Loup Huret (Poitiers, France) Editorial Board

Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section Alessandro Beghini (Milan, Italy) Genes Section Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections Judith Bovée (Leiden, The Netherlands) Solid Tumours Section Vasantha Brito-Babapulle (London, UK) Leukaemia Section Charles Buys (Groningen, The Netherlands) Deep Insights Section Anne Marie Capodano (Marseille, France) Solid Tumours Section Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections Antonio Cuneo (Ferrara, Italy) Leukaemia Section Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section Louis Dallaire (Montreal, Canada) Education Section Brigitte Debuire (Villejuif, France) Deep Insights Section François Desangles (Paris, France) Leukaemia / Solid Tumours Sections Enric Domingo-Villanueva (London, UK) Solid Tumours Section Ayse Erson (Ankara, Turkey) Solid Tumours Section Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections Anne Hagemeijer (Leuven, Belgium) Deep Insights Section Nyla Heerema (Colombus, Ohio) Leukaemia Section Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections Sakari Knuutila (Helsinki, Finland) Deep Insights Section Lidia Larizza (Milano, Italy) Solid Tumours Section Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section Edmond Ma (Hong Kong, China) Leukaemia Section Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections Yasmin Mehraein (Homburg, Germany) Cancer-Prone Diseases Section Fredrik Mertens (Lund, Sweden) Solid Tumours Section Konstantin Miller (Hannover, Germany) Education Section Felix Mitelman (Lund, Sweden) Deep Insights Section Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section Mariano Rocchi (Bari, Italy) Genes Section Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section Albert Schinzel (Schwerzenbach, Switzerland) Education Section Clelia Storlazzi (Bari, Italy) Genes Section Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections Dan Van Dyke (Rochester, Minnesota) Education Section Roberta Vanni (Montserrato, Italy) Solid Tumours Section Franck Viguié (Paris, France) Leukaemia Section José Luis Vizmanos (Pamplona, Spain) Leukaemia Section Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7)

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Volume 16, Number 7, July 2012

Table of contents

Gene Section

ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 1) 442 Hisataka Sabe, Yasuhito Onodera, Ari Hashimoto, Shigeru Hashimoto CD38 (CD38 molecule) 445 Silvia Deaglio, Tiziana Vaisitti CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1) 452 Edward J Kelly, Vladimir Yarov-Yarovoy, Allan E Rettie DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25) 458 Chon-Hwa Tsai-Morris, Maria L Dufau EPHB6 (EPH receptor B6) 462 Lokesh Bhushan, Raj P Kandpal FOXF1 (forkhead box F1) 466 Pang-Kuo Lo FXYD3 (FXYD domain containing ion transport regulator 3) 470 Hiroto Yamamoto, Shinji Asano MCAM (melanoma cell adhesion molecule) 475 Guang-Jer Wu MIR100 (microRNA 100) 479 Katia Ramos Moreira Leite MIR145 (microRNA 145) 484 Mohit Sachdeva, Yin Yuan Mo MYCN (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)) 487 Tiangang Zhuang, Mayumi Higashi, Venkatadri Kolla, Garrett M Brodeur PTBP1 (polypyrimidine tract binding protein 1) 491 Laura Fontana SOCS3 (suppressor of cytokine signaling 3) 495 Zoran Culig

Leukaemia Section i(17q) solely in myeloid malignancies 497 Vladimir Lj Lazarevic inv(11)(q13q23) 501 Adrian Mansini, Claus Meyer, Marta Susana Gallego, Jorge Rossi, Patricia Rubio, Adriana Medina, Rolf Marschalek, Maria Felice, Cristina Alonso t(2;9)(q37;q34) 505 Purvi M Kakadia, Stefan K Bohlander

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Solid Tumour Section

Myxoinflammatory fibroblastic sarcoma (MIFS) with t(1;10)(p22;q24) 508 Karolin H Nord

Case Report Section t(17;21)(q11.2;q22) as a sole aberration in acute myelomonocytic leukemia 513 Helena Podgornik, Peter Cernelc

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7)

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Gene Section Review

ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 1) Hisataka Sabe, Yasuhito Onodera, Ari Hashimoto, Shigeru Hashimoto Hokkaido University Graduate School of Medicine, Department of Molecular Biology, Sapporo, Japan (HS, YO, AH, SH)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/ASAP1ID44351ch8q24.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI ASAP1ID44351ch8q24.txt

Identity 131064346. Transcription Other names: AMAP1, CENTB4, DDEF1, KIAA1249, PAG2, PAP, ZG14P Transcription produces 16 different mRNAs, 12 alternatively spliced variants and 4 unspliced forms. HGNC (Hugo): ASAP1 There are 9 probable alternative promotors, 6 non Location: 8q24.21 overlapping alternative last exons and 5 validated alternative polyadenylation sites. DNA/RNA The mRNAs appear to differ by truncation of the 5' end, truncation of the 3' end, presence or absence of Description 15 cassette exons, overlapping exons with different The ASAP1 locus spans 391,75 kb, on the minus boundaries (NCBI). strand of chromosome 8 from 131456099 to

The ASAP1 gene maps on chromosome 8, at 8q24.1-q24.2 according to Entrez Gene (adapted from GeneCards).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 442

ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH Sabe H, et al. domain 1)

proposed to be mediated by its GAP activity Protein towards Arf1 (Furman et al., 2002). ASAP1 was also shown to associate with focal adhesion kinase Description (FAK) and contribute to focal adhesion assembly P. Randazzo's group was the first to identify two (Liu et al., 2002). Hashimoto et al. (2004 and 2005) variants of a 130-kDa phosphatidylinositol 4,5- have shown that AMAP1 and AMAP2 have the bisphosphate (PIP2)-dependent Arf1 GTPase- ability to bind stably with GTP-Arf6, but not GDP- activating protein (GAP), and named them ASAP1a Arf6 or other GTP-/GDP-Arf isoforms, in vitro and and ASAP1b (ArfGAP, SH3, ankyrin repeat, PH in vivo. Through this binding, AMAP1 and protein) (Brown et al., 1998). AMAP2 appear to function as downstream effectors At almost the same time, T. Roberts' group isolated for GTP-Arf6 (Hashimoto et al., 2004; Hashimoto a homologue of ASAP1 from bovine brain as a Src et al., 2005; Onodera et al., 2005). AMAP1 binds to SH3 domain-binding protein, and named it DEF-1 paxillin and cortactin, which are essential (differentiation-enhancing factor-1) because its components of the invadopodia of MDA-MB-231 ectopic expression in fibroblasts resulted in their breast cancer cells, and acts to recruit these proteins differentiation into adipocytes (King et al., 1999). to the sites of Arf6 activation to form invadopodia J. Schlessinger's group also identified a similar (Onodera et al., 2005). AMAP1 is hence essential protein as a Pyk2 binding protein, and named it Pap for invasion and metastasis of some breast cancer (Andreev et al., 1999). Later on, we also isolated cells, while AMAP2 is not a component of several ArfGAPs as paxillin-binding proteins, and invadopodia (Onodera et al., 2005; Hashimoto et tentatively called them paxillin-associated ArfGAPs al., 2006; Nam et al., 2007; Morishige et al., 2008; (PAG1, PAG2 and PAG3) (Kondo et al., 2000; Sabe et al., 2009). AMAP1 appears to be a useful Mazaki et al., 2001; Sabe et al., 2006). ASAPs were diagnostic marker as well as therapeutic target of moreover identified as centaurin β3 and β4. different types of human cancers (see below). To avoid this confusion of naming, it was proposed internationally to unify the names according to Implicated in functional domains that these proteins bear: ASAP1, DEF1, PAG2, centaurin β4 were hence Breast cancer proposed to be called AMAP1 (a multiple-domain Note ArfGAP protein 1); and Pap, DDEF2, PAG3, In primary breast cancers, AMAP1 protein, but not centaurin β3 to be called AMAP2 (a multiple- AMAP2 protein, is abnormally overexpressed in domain ArfGAP protein 2) (Kahn, 2004). Since their significant population in a manner then, we have stopped calling these proteins PAG2 independent of the transcriptional upregulation of and PAG3, and instead now call them AMAP1 and the AMAP1 gene, and levels of AMAP1 protein AMAP2. expression correlates well with the malignant Then after, the HUGO Gene Nomenclature phenotypes (Onodera et al., 2005). Committee has nevertheless decided to call Melanoma AMAP1 as ASAP1, and AMAP2 as ASAP2. We hereby call these proteins and genes according to Note names used in the original reports. With the name DDEF1, this gene was identified to be located in an amplified region of chromosome Expression 8q24.12, and the amplification of chromosome 8q Epithelial cells, fibroblasts, macrophages, brain (for in uveal melanomas was found to correlate most references see above), and endothelial cells strongly with the expression of this gene in (Hashimoto et al., 2011). Not determined with the melanomas (Ehlers et al., 2005). other types of cells. Colorectal cancer Localisation Note Intracellular tubulovesicular structures and vesicles, Protein expression of ASAP1 is upregulated in plasma membrane protrusions and leading edges, colorectal cancer cells, and this expression and invadopodia/podosome structures (Hashimoto correlates with poor metastasis-free survival and et al., 2004; Hashimoto et al., 2005; Onodera et al., prognosis in colorectal cancer patients (Müller et 2005). al., 2010). Function It is worth noting, on the other hand, that a previous study on the copy number changes at 8q11-24 in ASAP1 has an ArfGAP zinc-finger domain and colorectal carcinomas showed that although the exhibits phosphatidylinositol 4,5-bisphosphate- MYC gene, located at 8q24.12-q24.13, is indeed dependent GAP activities for Arf1 and Arf5 but 2 3 amplified and correlates with the advanced stages 10 - to 10 -fold less activity for Arf6 (Brown et al., of colorectal carcinoma, the DDEF1 gene was not 1998; Andreev et al., 1999). ASAP1 was shown to amplified (Buffart et al., 2005). enhance cell motility, and this activity was

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 443

ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH Sabe H, et al. domain 1)

Prostate cancer Hashimoto S, Hashimoto A, Yamada A, Kojima C, Yamamoto H, Tsutsumi T, Higashi M, Mizoguchi A, Yagi Note R, Sabe H. A novel mode of action of an ArfGAP, Additional gene copies of ASAP1 were also AMAP2/PAG3/Papa lpha, in Arf6 function. J Biol Chem. 2004 Sep 3;279(36):37677-84 detected in a large population of primary prostate cancers, and ASAP1 protein staining was found to Kahn RA.. The ARF Family. ARF Family GTPases, R.A. be elevated in 80% of primary prostate cancers with Kahn ed., Kluwer Acadmic Publishers, 2004. substantially higher amounts observed in metastatic Buffart TE, Coffa J, Hermsen MA, Carvalho B, van der Sijp lesions compared with benign prostate tissue (Lin et JR, Ylstra B, Pals G, Schouten JP, Meijer GA.. DNA copy number changes at 8q11-24 in metastasized colorectal al., 2008). cancer. Cell Oncol. 2005;27(1):57-65. Pancreatic ductal adenocarcinoma Ehlers JP, Worley L, Onken MD, Harbour JW.. DDEF1 is Note located in an amplified region of chromosome 8q and is overexpressed in uveal melanoma. Clin Cancer Res. 2005 DDEF1 gene was found to be frequently amplified, May 15;11(10):3609-13. most likely to be oncogenic, in pancreatic ductal Hashimoto S, Hashimoto A, Yamada A, Onodera Y, Sabe adenocarcinomas, accompanied by enhanced H.. Assays and properties of the ArfGAPs, AMAP1 and expression of this gene (Harada et al., 2009). AMAP2, in Arf6 function. Methods Enzymol. 2005;404:216- VEGF- and tumor-induced 31. angiogenesis Onodera Y, Hashimoto S, Hashimoto A, et al... Expression of AMAP1, an ArfGAP, provides novel targets to inhibit Note breast cancer invasive activities. EMBO J. 2005 Mar AMAP1 protein is highly expressed in endothelial 9;24(5):963-73. Epub 2005 Feb 17. cells upon their treatment with vascular endothelial Sabe H, Onodera Y, Mazaki Y, Hashimoto S.. ArfGAP growth factor (VEGF), and an essential component family proteins in cell adhesion, migration and tumor of VEGF- and tumor-induced angiogenesis, and invasion. Curr Opin Cell Biol. 2006 Oct;18(5):558-64. Epub 2006 Aug 9. (REVIEW) also choroidal neovascularization (Hashimoto et al., 2011). Nam JM, Onodera Y, Mazaki Y, Miyoshi H, Hashimoto S, Sabe H.. CIN85, a Cbl-interacting protein, is a component of AMAP1-mediated breast cancer invasion machinery. References EMBO J. 2007 Feb 7;26(3):647-56. Epub 2007 Jan 25. Brown MT, Andrade J, Radhakrishna H, Donaldson JG, Lin D, Watahiki A, Bayani J, Zhang F, Liu L, et al.. ASAP1, Cooper JA, Randazzo PA. ASAP1, a phospholipid- a gene at 8q24, is associated with prostate cancer dependent arf GTPase-activating protein that associates metastasis. Cancer Res. 2008 Jun 1;68(11):4352-9. with and is phosphorylated by Src. Mol Cell Biol. 1998 Dec;18(12):7038-51 Morishige M, Hashimoto S, Ogawa E, Toda Y, et al.. GEP100 links epidermal growth factor receptor signalling Andreev J, Simon JP, Sabatini DD, Kam J, Plowman G, to Arf6 activation to induce breast cancer invasion. Nat Randazzo PA, Schlessinger J. Identification of a new Pyk2 Cell Biol. 2008 Jan;10(1):85-92. Epub 2007 Dec 16. target protein with Arf-GAP activity. Mol Cell Biol. 1999 Mar;19(3):2338-50 Harada T, Chelala C, Crnogorac-Jurcevic T, Lemoine NR.. Genome-wide analysis of pancreatic cancer using King FJ, Hu E, Harris DF, Sarraf P, Spiegelman BM, microarray-based techniques. Pancreatology. 2009;9(1- Roberts TM. DEF-1, a novel Src SH3 binding protein that 2):13-24. Epub 2008 Dec 12. (REVIEW) promotes adipogenesis in fibroblastic cell lines. Mol Cell Biol. 1999 Mar;19(3):2330-7 Sabe H, Hashimoto S, Morishige M, Ogawa E, Hashimoto A, Nam JM, Miura K, Yano H, Onodera Y.. The EGFR- Kondo A, Hashimoto S, Yano H, Nagayama K, Mazaki Y, GEP100-Arf6-AMAP1 signaling pathway specific to breast Sabe H. A new paxillin-binding protein, cancer invasion and metastasis. Traffic. 2009 PAG3/Papalpha/KIAA0400, bearing an ADP-ribosylation Aug;10(8):982-93. Epub 2009 Apr 21. (REVIEW) factor GTPase-activating protein activity, is involved in paxillin recruitment to focal adhesions and cell migration. Muller T, Stein U, Poletti A, Garzia L, Rothley M, Mol Biol Cell. 2000 Apr;11(4):1315-27 Plaumann D, Thiele W, Bauer M, Galasso A, Schlag P, Pankratz M, Zollo M, Sleeman JP.. ASAP1 promotes Mazaki Y, Hashimoto S, Okawa K, Tsubouchi A, tumor cell motility and invasiveness, stimulates metastasis Nakamura K, Yagi R, Yano H, Kondo A, Iwamatsu A, formation in vivo, and correlates with poor survival in Mizoguchi A, Sabe H. An ADP-ribosylation factor GTPase- colorectal cancer patients. Oncogene. 2010 Apr activating protein Git2-short/KIAA0148 is involved in 22;29(16):2393-403. Epub 2010 Feb 15. subcellular localization of paxillin and actin cytoskeletal organization. Mol Biol Cell. 2001 Mar;12(3):645-62 Hashimoto A, Hashimoto S, Ando R, Noda K, Ogawa E, Kotani H, Hirose M, Menju T, Morishige M, Manabe T, Furman C, Short SM, Subramanian RR, Zetter BR, Toda Y, Ishida S, Sabe H.. GEP100-Arf6-AMAP1-cortactin Roberts TM. DEF-1/ASAP1 is a GTPase-activating protein pathway frequently used in cancer invasion is activated by (GAP) for ARF1 that enhances cell motility through a GAP- VEGFR2 to promote angiogenesis. PLoS One. dependent mechanism. J Biol Chem. 2002 Mar 2011;6(8):e23359. Epub 2011 Aug 15. 8;277(10):7962-9 This article should be referenced as such: Liu Y, Loijens JC, Martin KH, Karginov AV, Parsons JT. The association of ASAP1, an ADP ribosylation factor- Sabe H, Onodera Y, Hashimoto A, Hashimoto S. ASAP1 GTPase activating protein, with focal adhesion kinase (ArfGAP with SH3 domain, ankyrin repeat and PH domain contributes to the process of focal adhesion assembly. Mol 1). Atlas Genet Cytogenet Oncol Haematol. 2012; Biol Cell. 2002 Jun;13(6):2147-56 16(7):442-444.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 444

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Gene Section Review

CD38 (CD38 molecule) Silvia Deaglio, Tiziana Vaisitti Department of Genetics, Biology and Biochemistry, University of Turin, Turin, Italy (SD, TV)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/CD38ID978ch4p15.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI CD38ID978ch4p15.txt

responsible for the upregulation of CD38 Identity expression induced by all-trans retinoic acid (Nata Other names: T10 et al., 1997; Ferrero and Malavasi, 1999). The 5'- HGNC (Hugo): CD38 end of the intron 1 contains also a C→ G single nucleotide polymorphism (SNP), rs6449182, that Location: 4p15.32 leads to the presence or absence of a PvuII restriction site (see below). The SNP is located DNA/RNA within a putative E-box, a region of binding of the Description E proteins with a consequent regulation of gene transcription. In the B cell compartment a relevant The genomic DNA of CD38 extends for 71172 base role is played by E2A, that controls the expression pairs with 8 exons, starting at 15779898 bp and of several B lineage genes. E2A was demonstrated ending at 15851069 bp. The CD38 gene is located to bind to the E-box of the CD38 gene, regulating at 4p15.32. The 5'-flanking promoter region of the its expression, and the binding of the protein is gene contains a CpG island that is ~900 bp long and influenced by the CD38 genotype, with the G allele includes exon 1 and the 5'-end of the intron 1. This resulting in a stronger binding of E2A (Saborit- region contains a binding site for the transcription Villarroya et al., 2011). factor Sp1 and several potential binding for other factors such as interleukins, interferon and Transcription hormones. A critical region in the CD38 gene is the The mRNA of CD38 (NM_001775.2) contains retinoic acid responsive element (RARE) 1494 bp.

Gene structure of CD38. Colored boxes represent the 8 exons; the total length, the starting and ending base pair of the gene are indicated.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 445

CD38 (CD38 molecule) Deaglio S, Vaisitti T

CD38 protein structure. CD38 is a transmembrane molecule of 300 aa. The intracellular (IC), the transmembrane (TM) and the extracellular domains are indicated in the diagram. The different portions of the aminoacidic chain are shown as coded by the different exons.

Indeed, the positions of residues Glu226, Trp125, Protein and Trp189, which are essential for the enzyme's catalytic activity are highly conserved; Trp125 and Description Trp189 are suggested as the residues for Human CD38 is made up of a single chain of 300 recognizing and positioning the substrate by aa with a corresponding molecular weight of hydrophobic interactions, while Glu226 is the approximately 45 kDa. It is characterized by a short catalytic residue that takes part in the formation of cytoplasmic tail (21 aa), a small transmembrane the catalytic intermediate) (Munshi et al., 2000; Liu domain (23 aa) and a large extracellular domain et al., 2005). (256 aa). CD38 is a glycoprotein comprising 2 to 4 Expression N-linked oligosaccharide chains containing sialic acid residues. The overall structure of the CD38 Human CD38 is surface expressed by various cells molecule is stabilized by six pairs of disulphide of both hematopoietic and non-hematopoietic bonds. lineages. In the T cell compartment, CD38 is Besides the monomeric membrane-bound form of expressed by a significant fraction of human CD38, a soluble form of CD38 of approximately 78 thymocytes, mainly at the double-positive stage. In kDa (p78) (Mallone et al., 1998) and a high- B cells, the expression is tightly regulated during molecular weight form of 190 kDa (p190) (Umar et cell ontogenesis, being present at high levels in al., 1996), have been described. The latter fits with bone marrow precursors and in terminally a tetrameric conformation of the molecule, both differentiated plasma cells. CD38 is expressed also displaying enzymatic activities. in circulating monocytes, but not in resident The carboxyl-terminal of the molecule harbors the macrophages, and in circulating and residential NK catalytic site (CD38 is defined as an ecto-enzyme) cells and granulocytes. and the binding site for CD31, the non-substrate CD38 is also present in many tissues other than CD38 ligand (Deaglio et al., 1998). haematopoietic cells, including normal prostatic The overall structure of the CD38 molecule, epithelial cells, pancreatic islet cells and the brain, obtained by crystallographic analyses, is "L"- where it is detected in perikarya and dendrites of shaped and can be divided into two separate many neurons, such as the cerebellar Purkinje cells, in rat astrocytes and in perivascular autonomic domains. The N-terminal domain, formed by a + bundle of α helices (α1, α2, α3, α5, α6) and two nerve terminals. Other CD38 cells include smooth short β strands (β1, β3), and the C-terminal domain, and striated muscle cells, renal tubules, retinal formed by four-stranded parallel β sheet (β2, β4, gangliar cells and cornea (Malavasi et al., 2008). β5, and β6) surrounded by two long (α8 and α9) Localisation and two short α helices (α4 and α7). These two CD38 is a type II transmembrane protein expressed distinct domains are connected by a hinge region on plasma and nuclear membranes. composed of three peptide chains. The enzyme's overall topology is similar to the related proteins Function CD157 and the Aplysia ADP-ribosyl cyclase, with CD38 is a multifunctional ecto-enzyme involved in the exception of important structural changes at the signal transduction, cell adhesion and calcium two termini. The extended positively charged N signaling. The binding to the ligand CD31, initiates terminus has lateral associations with the other a signaling cascade that includes phosphorylation of CD38 molecule in the crystallographic asymmetric sequential intracellular targets and increases unit. The analysis of the CD38 substrate binding cytoplasmic Ca2+ levels, mediating different models revealed three key residues that may be biological events depending on the cells type (e.g., critical in controlling CD38 enzimatic functions. activation, proliferation, apoptosis, cytokines

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 446

CD38 (CD38 molecule) Deaglio S, Vaisitti T

secretion and homing). As an enzyme, CD38 RS is a highly aggressive syndrome with a median metabolizes NAD+/NADP+, generating cADPR, overall survival of 5 to 8 months (Hallek et al., ADP-ribose and NAADP (Lee, 2006). These 2008). Several molecular markers have been products bind different receptors and channels (IP3 identified with a prognostic significance to receptors IP3R, Ryanodine receptor RyR and distinguish among the different groups of patients. Transient receptor potential cation channel The most credited molecular indicators are the subfamily M member 2 TRPM2) and are involved absence of mutations in the IgVH genes and the in the regulation of intracellular Ca2+ and activation expression of CD38 and Zap70 (Cramer and of critical signaling pathways connected to the Hallek, 2011). control of cell metabolism, genomic stability, Cytogenetics apoptosis, cell signaling, inflammatory response CLL is associated with chromosomal deletions and and stress tolerance (Guse, 2005). amplifications: the most frequent is trisomy of Homology chromosome 12 (+12; 16%) and deletion of The CD38 gene is conserved in human, chromosomal regions 11q (18%), 17p (7%) and chimpanzee, dog, mouse, rat and chicken. Human 13q14 (55%). The molecular consequences of CD38 shares a 25-30% homology in amino acid trisomy 12 are unknown, but probably related to an sequence to the Aplysia ADP ribosyl cyclase and it elevated gene dosage of a proto-oncogene. is highly homologous to CD157 (BST-1), Del(11)(q22-q23) comprise ataxia teleangectasia originated by gene duplication (Ferrero and (ATM) gene, a gene related to genomic instability Malavasi, 1997; Ferrero and Malavasi, 1999). and DNA-repair and associated with a predisposition to lymphoid malignancies. The Mutations inability to repair DNA-damage due to ATM- deficiency contributes to CLL pathogenesis, Germinal allowing accumulation of additional genetic mutations during cellular proliferation. A similar Not yet reported. pathogenetic mechanism occurs in CLL with del(17p13) that include the TP53 tumor suppressor Implicated in gene. The del(13q14) mono- or bi-allelic involves Chronic lymphocytic leukemia (CLL) two microRNAs, miR-15a and miR16-1, that can be two potential candidate tumor suppressor genes, Disease even though their targets are still unknown (Klein CLL is the most common adult leukemia in the and Dalla-Favera, 2010; Zenz et al., 2010). United States and Europe that results from the accumulation of small B lymphocytes expressing Oncogenesis CD19/CD5/CD23 in blood, bone marrow, lymph In CLL, elevated expression of CD38 is associated nodes and other lymphoid tissues (Chiorazzi and with several adverse prognostic factors such as Ferrarini, 2003). The latter districts represent advanced disease stage, higher incidence of permissive niches where lymphocytes can lymphadenopathy, high-risk cytogenetics, shorter proliferate in response to microenvironmental lymphocytes doubling time (LDT), shorter time to signals (Malavasi et al., 2011). The incidence rates initiation of first treatment (TFT) and poorer in men are nearly twice as high as women and it is response to therapy. Besides being a prognostic less common among people of African or Asian marker, CD38 is a key element in the pathogenesis origin. Advanced age and a family history of of CLL, as a component of a molecular network leukemia and lymphoma are additional risk factors delivering growth and survival signals to CLL cells (Dores, 2007). (Deaglio et al., 2005). CD38 performs as a receptor on leukemic cells following the binding to its ligand Prognosis CD31 and the signals are mediated by Zap70, CLL is currently categorized into prognostic groups another negative prognosticator for the disease and based on the clinical staging systems developed by a limiting factor for the activation of the CD38- Rai and Binet (Rai et al., 1975; Binet et al., 1981). mediated pathway (Deaglio et al., 2003; Deaglio et The disease is heterogenous from the clinical point al., 2007). CD38 can work in association with of view with at least three group of patients. chemokines and their receptors, mainly Approximately one-third of CLL patients are CXCL12/CXCR4, influencing the migratory affected by an indolent form of disease that does responses and contributing to the recirculation of not require treatment. Another third of patients neoplastic cells from blood to lymphoid organs presents with a leukemia that will require iterative (Vaisitti et al., 2010) and with specific adhesion therapies, affecting their quality and length of life. molecules, belonging to the integrin family A small fraction of CLL patients will develop (Zucchetto et al., 2009; Zucchetto et al., 2012). An Richter syndrome (RS), represented in most cases important role in the oncogenesis of CLL is likely by diffuse large B-cell lymphoma (DLBCL) arising by the CD38 SNP (see above) that has been from the transformation of the original CLL clone. recently described as an independent risk factor for

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 447

CD38 (CD38 molecule) Deaglio S, Vaisitti T

Richter syndrome (RS) transformation. The (IgG), IgA and/or light chains. Rearrangements frequency of the G allele is significantly higher in a involving the switch regions of immunoglobulin subset of CLL patients characterized by clinical and heavy chain (IgH) gene at the 14q32 with various molecular markers of poor prognosis, with the partner genes (t(4;14), t(14;16), t(11;14)) represent highest allele frequency scored by patients with RS the most common structural abnormalities in MM. (Aydin, 2008). The same G allele was Several chromosomal aberrations are acquired independently reported as a susceptibility factor for during disease progression, involving MYC CLL development in a Polish population rearrangements, chromosome 13 (del(13q)), 17 (Jamroziak et al., 2009). The presence of the rare G (del(17p)) and 1p deletions. These chromosomal allele is not correlated to a higher expression of abnormalities are associated to specific oncogenes, CD38 by CLL cells, but is responsible for the such as c-myc that develop early in the course of ability to modulate CD38 expression in response to plasma cell tumors, while changes in other environmental signals. oncogenes such as N-ras and K-ras are more often Multiple myeloma (MM) found in MM after BM relapse. Abnormalities are also described for tumor suppressor genes such as Disease TP53, associated with spread to other organs. Multiple myeloma is a malignancy of the immune (Sawyer, 2011). system characterized by accumulation of plasma Oncogenesis cells in the bone marrow (BM), by a high CD38 is predominantly expressed by BM precursor concentration of monoclonal Ig in serum or urine cells and terminally differentiated plasma cells. and lytic bone lesions arising from osteolytic MM cells show moderate to high expression levels activity of plasma cell-activated osteoclasts. The of CD38. The need for improved MM therapy has proliferation of plasma cells in MM may interfere stimulated the development of monoclonal with the normal production of blood cells, resulting antibodies (mAbs) targeting either MM cells or in leukopenia, anemia and thrombocytopenia. The cells of the BM microenvironment. CD38 is one of aberrant antibodies that are produced lead to the candidates: recently, a human anti-CD38 impaired humoral immunity and patients have a (HuMax-CD38 or Daratunumab) antibody was high prevalence of infection. It is diagnosed with generated and preclinical studies indicated that it is blood tests, microscopic examination of the bone highly effective in killing primary CD38+CD138+ marrow (bone marrow biopsy) and radiographs of patients MM cells and a range of MM/lymphoid commonly involved bones. cell lines by both Antibody-dependent cellular Prognosis cytotoxicity (ADCC) and complement-dependent MM is characterized by neoplastic proliferation of cytotoxicity (CDC). Moreover, in a SCID mouse plasma cells involving more than 10% of the BM. animal model, this antibody inhibited CD38+ tumor Increasing evidence suggests that the BM cell growth (Stevenson et al., 2006; de Weers et al., microenvironment of tumor cells plays a pivotal 2011; Tai and Anderson, 2011). Another fully role in the pathogenesis of myeloma. MM is a human anti-CD38 mAb (MorphoSysAG) was heterogenous disease, with survival ranging from 1 reported to efficiently trigger ADCC against CD38+ year to more than 10 years. The 5-year relative MM cell lines and patients MM cells in vitro as survival rate is around 40%. Survival is higher in well as in vivo in a xenograft mouse model younger people. The tumor burden (based on C- (Stevenson et al., 2006). reactive protein CRP and beta-2-microglobulin β2m) and the proliferation rate are the two key Acute myeloid leukemia (AML) indicators for the prognosis in patients with MM Disease (Palumbo and Anderson, 2011). Acute myelogenous leukemia (AML) is a cancer of Cytogenetics the myeloid lineage, characterized by the rapid MM is characterized by very complex cytogenetic growth of abnormal white blood cells that and molecular genetic aberrations. The accumulate in the bone marrow and interfere with chromosome number is usually either hyperdiploid the production of normal blood cells (maturational with multiple trisomies or hypodiploid with one of arrest of bone marrow cells in the earliest stages of several types of immunoglobulin heavy chain (Ig) development due to the activation of abnormal translocations. The chromosome status and Ig genes through chromosomal translocations and rearrangements are two genetic criteria to stratify other genetic abnormalities). patients into a specific prognostic group. The Prognosis malignant cells of MM are the most mature cells of AML has several subtypes: 5-year survival rates the B lineage. B cell maturation is associated with a vary from 15% to 70% and relapse rates vary from programmed rearrangement of DNA sequence in 33 to 78% depending on subtype. The French- the process encoding the structure of mature American-British (FAB) classification system immunoglobulins. Indeed, MM is characterized by divides AML into 8 subtypes, M0 through M7, over-production of monoclonal immunoglobulin G based on the type of cell from which the leukemia

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 448

CD38 (CD38 molecule) Deaglio S, Vaisitti T

developed and its degree of maturation expression of CD38 on leukemic cells enhances (morphology of the neoplastic cells and cytogenetic their propensity to interact with CD31, expressed analysis to characterize chromosomal by lung endothelial cells, resulting in a local abnormalities). The M3 subtype, also known as production of inflammatory cytokines, apoptosis of acute promyelocytic leukemia (APL), is caused by endothelial cells and development of RAS (Gao et an arrest of leukocyte differentiation at the al., 2007). promyelocyte stage. Various clinical regimens combining anthracyclines, retinoic acid (RA), that To be noted induces APL differentiation, and arsenic trioxide, that triggers apoptosis and differentiation, results in Note a remission of 80-90% of patients (de Thé and The human CD38 gene contains a well defined bi- Chen, 2010; Kamimura et al., 2011). allelic polymorphism that can be identified by the restriction endonuclease PvuII (PvuII site: Cytogenetics CAGCTG). The polymorphic site is located at the Cytogenetics is the single most important 5' end of the first intron of the CD38 gene and prognostic factor in AML. About 50% of AML marks a C→G variation at position 184. The gene patients have a normal cytogenetics; certain frequencies in the healthy population are 0,78 and cytogenetic abnormalities are associated with good 0,22 for the C and G allele respectively (CC 61%, outcomes (t(15;17) in acute promyelocytic GC 33% and GG 6%). The analysis of this leukemia), while other cytogenetic abnormalities polymorphism in a large cohort of CLL patients are associated with a poor prognosis and a high risk indicate that the G allele is significantly associated of relapse after treatment. APL is characterized by a with molecular markers of unfavourable prognosis reciprocal translocation, t(15;17), that results in a and represents a significant risk factor for RS fusion oncogene, PML (promyelocytic leukemia)- transformation (Aydin et al., 2008). The correlation RARα (retinoic acid receptor α) with a consequent between this polymorphism and genetic block of the normal myeloid differentiation susceptibility has been studied also for other program and increased self-renewal of leukemic diseases, including Systemic Lupus Erythematosus progenitors cells. (SLE), where the CC genotype causes susceptibility Oncogenesis and the CG genotype confers protection for discoid Retinoic acid (RA), the vitamin A derivative plays rash development (Gonzales-Escribano et al., a critical role during the differentiation of myeloid 2004). Recently, a role for CD38 in mediating progenitors towards the neutrophil lineage. This oxytocin (OT) release in the brain has been role is primarily mediated by binding of RA to described (Jin et al., 2007). Mice deficient in CD38 RARalpha (RARα, a nuclear receptor that lack short term social memory, a defect that has modulates the expression of multiple downstream been associated to the autism spectrum disorders targets via retinoic acid response elements. (ASD) in humans. Several polymorphism across Biochemical evidence suggests RARα performs CD38 gene (rs6449197, rs3796863 and rs1800561) two opposing functions, one as a repressor of gene are associated with ASD (Lerer et al., 2010; expression in the absence of ligand, the second as a Munesue et al., 2010) and a correlation between transcriptional activator in the presence of ligand, CD38 expression and measure of social function in each controlled by multimeric complexes of ASD observed (Riebold et al., 2011). Indeed, a transcription corepressors and coactivators. The reduced expression of CD38 in lymphoblast from fusion gene product PML-RARα causes the ASD patients compared to parental lymphoblastoid chimeric receptor to bind more tightly to the cell lines has been reported. Lower CD38 nuclear corepressor factor. Therefore, the gene expression and consequently lower level of cannot be activated with physiologic doses of activation of its enzymatic functions in ASD can be retinoic acid. RA induces the differentiation of linked to a dysfunction in OT transmission in this leukemic cells into mature granulocytes and disorder (Higashida et al., 2007; Salmina et al., complete remissions in a majority of patients with 2010; Higashida et al., 2010). APL. Although well tolerated, this therapeutic regimen may be associated with a toxic side effect References known as retinoic acid syndrome (RAS), Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, characterized by fever, dyspnea, pulmonary edema Pasternack BS. Clinical staging of chronic lymphocytic and infiltrates. The increased production of leukemia. Blood. 1975 Aug;46(2):219-34 inflammatory cytokines (IFN-γ and IL-1β) by Binet JL, Auquier A, Dighiero G, Chastang C, Piguet H, myeloid cells and an aberrant interaction between Goasguen J, Vaugier G, Potron G, Colona P, Oberling F, maturating granulocytes and host tissues contribute Thomas M, Tchernia G, Jacquillat C, Boivin P, Lesty C, to RAS pathogenesis. Normal granulocytes do not Duault MT, Monconduit M, Belabbes S, Gremy F. A new express CD38, while RA-treated APL/AML cells prognostic classification of chronic lymphocytic leukemia derived from a multivariate survival analysis. Cancer. 1981 express high amounts of this molecule (Drach et al., Jul 1;48(1):198-206 1994; Mehta and Cheema, 1999). The aberrant

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 449

CD38 (CD38 molecule) Deaglio S, Vaisitti T

Drach J, McQueen T, Engel H, Andreeff M, Robertson KA, Guse AH. Second messenger function and the structure- Collins SJ, Malavasi F, Mehta K. Retinoic acid-induced activity relationship of cyclic adenosine diphosphoribose expression of CD38 antigen in myeloid cells is mediated (cADPR). FEBS J. 2005 Sep;272(18):4590-7 through retinoic acid receptor-alpha. Cancer Res. 1994 Apr 1;54(7):1746-52 Liu Q, Kriksunov IA, Graeff R, Munshi C, Lee HC, Hao Q. Crystal structure of human CD38 extracellular domain. Di Noto R, Lo Pardo C, Schiavone EM, Ferrara F, Manzo Structure. 2005 Sep;13(9):1331-9 C, Vacca C, Del Vecchio L. All-trans retinoic acid (ATRA) and the regulation of adhesion molecules in acute myeloid Lee HC. Structure and enzymatic functions of human leukemia. Leuk Lymphoma. 1996 Apr;21(3-4):201-9 CD38. Mol Med. 2006 Nov-Dec;12(11-12):317-23 Umar S, Malavasi F, Mehta K. Post-translational Stevenson GT. CD38 as a therapeutic target. Mol Med. modification of CD38 protein into a high molecular weight 2006 Nov-Dec;12(11-12):345-6 form alters its catalytic properties. J Biol Chem. 1996 Jul Deaglio S, Vaisitti T, Aydin S, Bergui L, D'Arena G, Bonello 5;271(27):15922-7 L, Omedé P, Scatolini M, Jaksic O, Chiorino G, Efremov D, Ferrero E, Malavasi F. Human CD38, a leukocyte receptor Malavasi F. CD38 and ZAP-70 are functionally linked and and ectoenzyme, is a member of a novel eukaryotic gene mark CLL cells with high migratory potential. Blood. 2007 family of nicotinamide adenine dinucleotide+-converting Dec 1;110(12):4012-21 enzymes: extensive structural homology with the genes for Dores GM, Anderson WF, Curtis RE, Landgren O, murine bone marrow stromal cell antigen 1 and aplysian Ostroumova E, Bluhm EC, Rabkin CS, Devesa SS, Linet ADP-ribosyl cyclase. J Immunol. 1997 Oct 15;159(8):3858- MS. Chronic lymphocytic leukaemia and small lymphocytic 65 lymphoma: overview of the descriptive epidemiology. Br J Nata K, Takamura T, Karasawa T, Kumagai T, Hashioka Haematol. 2007 Dec;139(5):809-19 W, Tohgo A, Yonekura H, Takasawa S, Nakamura S, Gao Y, Camacho LH, Mehta K. Retinoic acid-induced Okamoto H. Human gene encoding CD38 (ADP-ribosyl CD38 antigen promotes leukemia cells attachment and cyclase/cyclic ADP-ribose hydrolase): organization, interferon-gamma/interleukin-1beta-dependent apoptosis nucleotide sequence and alternative splicing. Gene. 1997 of endothelial cells: implications in the etiology of retinoic Feb 28;186(2):285-92 acid syndrome. Leuk Res. 2007 Apr;31(4):455-63 Deaglio S, Morra M, Mallone R, Ausiello CM, Prager E, Higashida H, Salmina AB, Olovyannikova RY, Hashii M, Garbarino G, Dianzani U, Stockinger H, Malavasi F. Yokoyama S, Koizumi K, Jin D, Liu HX, Lopatina O, Amina Human CD38 (ADP-ribosyl cyclase) is a counter-receptor S, Islam MS, Huang JJ, Noda M. Cyclic ADP-ribose as a of CD31, an Ig superfamily member. J Immunol. 1998 Jan universal calcium signal molecule in the nervous system. 1;160(1):395-402 Neurochem Int. 2007 Jul-Sep;51(2-4):192-9 Mallone R, Ferrua S, Morra M, Zocchi E, Mehta K, Jin D, Liu HX, Hirai H, Torashima T, Nagai T, Lopatina O, Notarangelo LD, Malavasi F. Characterization of a CD38- Shnayder NA, Yamada K, Noda M, Seike T, Fujita K, like 78-kilodalton soluble protein released from B cell lines Takasawa S, Yokoyama S, Koizumi K, Shiraishi Y, Tanaka derived from patients with X-linked agammaglobulinemia. J S, Hashii M, Yoshihara T, Higashida K, Islam MS, Yamada Clin Invest. 1998 Jun 15;101(12):2821-30 N, Hayashi K, Noguchi N, Kato I, Okamoto H, Matsushima Ferrero E, Malavasi F. The metamorphosis of a molecule: A, Salmina A, Munesue T, Shimizu N, Mochida S, Asano from soluble enzyme to the leukocyte receptor CD38. J M, Higashida H. CD38 is critical for social behaviour by Leukoc Biol. 1999 Feb;65(2):151-61 regulating oxytocin secretion. Nature. 2007 Mar 1;446(7131):41-5 Ferrero E, Saccucci F, Malavasi F. The human CD38 gene: polymorphism, CpG island, and linkage to the Aydin S, Rossi D, Bergui L, D'Arena G, Ferrero E, Bonello CD157 (BST-1) gene. Immunogenetics. 1999 Jul;49(7- L, Omedé P, Novero D, Morabito F, Carbone A, Gaidano 8):597-604 G, Malavasi F, Deaglio S. CD38 gene polymorphism and chronic lymphocytic leukemia: a role in transformation to Mehta K, Cheema S. Retinoid-mediated signaling Richter syndrome? Blood. 2008 Jun 15;111(12):5646-53 pathways in CD38 antigen expression in myeloid leukemia cells. Leuk Lymphoma. 1999 Feb;32(5-6):441-9 Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero G, Döhner H, Hillmen P, Keating MJ, Montserrat Munshi C, Aarhus R, Graeff R, Walseth TF, Levitt D, Lee E, Rai KR, Kipps TJ. Guidelines for the diagnosis and HC. Identification of the enzymatic active site of CD38 by treatment of chronic lymphocytic leukemia: a report from site-directed mutagenesis. J Biol Chem. 2000 Jul the International Workshop on Chronic Lymphocytic 14;275(28):21566-71 Leukemia updating the National Cancer Institute-Working Group 1996 guidelines. Blood. 2008 Jun 15;111(12):5446- Chiorazzi N, Ferrarini M. B cell chronic lymphocytic 56 leukemia: lessons learned from studies of the B cell antigen receptor. Annu Rev Immunol. 2003;21:841-94 Malavasi F, Deaglio S, Funaro A, Ferrero E, Horenstein AL, Ortolan E, Vaisitti T, Aydin S. Evolution and function of Deaglio S, Capobianco A, Bergui L, Dürig J, Morabito F, the ADP ribosyl cyclase/CD38 gene family in physiology Dührsen U, Malavasi F. CD38 is a signaling molecule in B- and pathology. Physiol Rev. 2008 Jul;88(3):841-86 cell chronic lymphocytic leukemia cells. Blood. 2003 Sep 15;102(6):2146-55 Jamroziak K, Szemraj Z, Grzybowska-Izydorczyk O, Szemraj J, Bieniasz M, Cebula B, Giannopoulos K, González-Escribano MF, Aguilar F, Torres B, Sánchez- Balcerczak E, Jesionek-Kupnicka D, Kowal M, Kostyra A, Román J, Núñez-Roldán A. CD38 polymorphisms in Calbecka M, Wawrzyniak E, Mirowski M, Kordek R, Robak Spanish patients with systemic lupus erythematosus. Hum T. CD38 gene polymorphisms contribute to genetic Immunol. 2004 Jun;65(6):660-4 susceptibility to B-cell chronic lymphocytic leukemia: Deaglio S, Vaisitti T, Bergui L, Bonello L, Horenstein AL, evidence from two case-control studies in Polish Tamagnone L, Boumsell L, Malavasi F. CD38 and CD100 Caucasians. Cancer Epidemiol Biomarkers Prev. 2009 lead a network of surface receptors relaying positive Mar;18(3):945-53 signals for B-CLL growth and survival. Blood. 2005 Apr Zucchetto A, Benedetti D, Tripodo C, Bomben R, Dal Bo 15;105(8):3042-50 M, Marconi D, Bossi F, Lorenzon D, Degan M, Rossi FM,

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 450

CD38 (CD38 molecule) Deaglio S, Vaisitti T

Rossi D, Bulian P, Franco V, Del Poeta G, Deaglio S, de Weers M, Tai YT, van der Veer MS, Bakker JM, Vink T, Gaidano G, Tedesco F, Malavasi F, Gattei V. CD38/CD31, Jacobs DC, Oomen LA, Peipp M, Valerius T, Slootstra JW, the CCL3 and CCL4 chemokines, and CD49d/vascular cell Mutis T, Bleeker WK, Anderson KC, Lokhorst HM, van de adhesion molecule-1 are interchained by sequential events Winkel JG, Parren PW. Daratumumab, a novel therapeutic sustaining chronic lymphocytic leukemia cell survival. human CD38 monoclonal antibody, induces killing of Cancer Res. 2009 May 1;69(9):4001-9 multiple myeloma and other hematological tumors. J Immunol. 2011 Feb 1;186(3):1840-8 de Thé H, Chen Z. Acute promyelocytic leukaemia: novel insights into the mechanisms of cure. Nat Rev Cancer. Kamimura T, Miyamoto T, Harada M, Akashi K. Advances 2010 Nov;10(11):775-83 in therapies for acute promyelocytic leukemia. Cancer Sci. 2011 Nov;102(11):1929-37 Klein U, Dalla-Favera R. New insights into the pathogenesis of chronic lymphocytic leukemia. Semin Malavasi F, Deaglio S, Damle R, Cutrona G, Ferrarini M, Cancer Biol. 2010 Dec;20(6):377-83 Chiorazzi N. CD38 and chronic lymphocytic leukemia: a decade later. Blood. 2011 Sep 29;118(13):3470-8 Lerer E, Levi S, Israel S, Yaari M, Nemanov L, Mankuta D, Nurit Y, Ebstein RP. Low CD38 expression in Palumbo A, Anderson K. Multiple myeloma. N Engl J Med. lymphoblastoid cells and haplotypes are both associated 2011 Mar 17;364(11):1046-60 with autism in a family-based study. Autism Res. 2010 Dec;3(6):293-302 Riebold M, Mankuta D, Lerer E, Israel S, Zhong S, Nemanov L, Monakhov MV, Levi S, Yirmiya N, Yaari M, Munesue T, Yokoyama S, Nakamura K, Anitha A, Yamada Malavasi F, Ebstein RP. All-trans retinoic acid upregulates K, Hayashi K, Asaka T, Liu HX, Jin D, Koizumi K, Islam reduced CD38 transcription in lymphoblastoid cell lines MS, Huang JJ, Ma WJ, Kim UH, Kim SJ, Park K, Kim D, from Autism spectrum disorder. Mol Med. 2011;17(7- Kikuchi M, Ono Y, Nakatani H, Suda S, Miyachi T, Hirai H, 8):799-806 Salmina A, Pichugina YA, Soumarokov AA, Takei N, Mori N, Tsujii M, Sugiyama T, Yagi K, Yamagishi M, Sasaki T, Saborit-Villarroya I, Vaisitti T, Rossi D, D'Arena G, Yamasue H, Kato N, Hashimoto R, Taniike M, Hayashi Y, Gaidano G, Malavasi F, Deaglio S. E2A is a transcriptional Hamada J, Suzuki S, Ooi A, Noda M, Kamiyama Y, Kido regulator of CD38 expression in chronic lymphocytic MA, Lopatina O, Hashii M, Amina S, Malavasi F, Huang leukemia. Leukemia. 2011 Mar;25(3):479-88 EJ, Zhang J, Shimizu N, Yoshikawa T, Matsushima A, Sawyer JR. The prognostic significance of cytogenetics Minabe Y, Higashida H. Two genetic variants of CD38 in and molecular profiling in multiple myeloma. Cancer subjects with autism spectrum disorder and controls. Genet. 2011 Jan;204(1):3-12 Neurosci Res. 2010 Jun;67(2):181-91 Tai YT, Anderson KC. Antibody-based therapies in multiple Salmina AB, Lopatina O, Ekimova MV, Mikhutkina SV, myeloma. Bone Marrow Res. 2011;2011:924058 Higashida H. CD38/cyclic ADP-ribose system: a new player for oxytocin secretion and regulation of social Zucchetto A, Vaisitti T, Benedetti D, Tissino E, Bertagnolo behaviour. J Neuroendocrinol. 2010 May;22(5):380-92 V, Rossi D, Bomben R, Dal Bo M, Del Principe MI, Gorgone A, Pozzato G, Gaidano G, Del Poeta G, Malavasi Vaisitti T, Aydin S, Rossi D, Cottino F, Bergui L, D'Arena F, Deaglio S, Gattei V. The CD49d/CD29 complex is G, Bonello L, Horenstein AL, Brennan P, Pepper C, physically and functionally associated with CD38 in B-cell Gaidano G, Malavasi F, Deaglio S. CD38 increases chronic lymphocytic leukemia cells. Leukemia. 2012 CXCL12-mediated signals and homing of chronic Jun;26(6):1301-12 lymphocytic leukemia cells. Leukemia. 2010 May;24(5):958-69 This article should be referenced as such: Zenz T, Mertens D, Küppers R, Döhner H, Stilgenbauer S. Deaglio S, Vaisitti T. CD38 (CD38 molecule). Atlas Genet From pathogenesis to treatment of chronic lymphocytic Cytogenet Oncol Haematol. 2012; 16(7):445-451. leukaemia. Nat Rev Cancer. 2010 Jan;10(1):37-50 Cramer P, Hallek M. Prognostic factors in chronic lymphocytic leukemia-what do we need to know? Nat Rev Clin Oncol. 2011 Jan;8(1):38-47

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 451

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Gene Section Review

CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1) Edward J Kelly, Vladimir Yarov-Yarovoy, Allan E Rettie Department of Pharmaceutics, University of Washington, Seattle, USA (EJK), Department of Physiology and Membrane Biology, Department of Biochemistry and Molecular Medicine, School of Medicine, University of California, Davis, USA (VYY), Department of Medicinal Chemistry, University of Washington, Seattle, USA (AER)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/CYP4B1ID40253ch1p33.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI CYP4B1ID40253ch1p33.txt

Identity Transcription Other names: CYPIVB1, P-450HP Two major transcripts are known to derive from alternative splicing (NM_000779.3, HGNC (Hugo): CYP4B1 NM_001099772.1). Isoform 1 encodes a 511 amino Location: 1p33 acid protein, while isoform 2 encodes a 512 amino acid protein with a Ser206 insertion. DNA/RNA It should be noted that this is a complicated locus with many other possibilities for alternative Description splicing. The CYP4B1 gene has 12 exons resulting in an Pseudogene open reading frame of 1533 bp (isoform 1). The CYP4B1 locus is depicted in figure 1 (NCBI). No pseudogene is known for CYP4B1.

Figure 1. Localization of the CYP4B1 locus to chromosome 1p33 and sites (exons 5, 8 and 9) of polymorphic variants that describe the 7 allelic variants of CYP4B1 (see table 1 for details).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 452

CYP4B1 (cytochrome P450, family 4, subfamily B, Kelly EJ, et al. polypeptide 1)

linkage at the C-5 methyl group of the heme Protein (Henne et al., 2001). Note The function of the unusual modification has not CYP4B1 belongs to the mammalian CYP4 enzyme been established, although it may serve to rigidify family that also includes CYP4A, 4F and the the enzyme's active site and modulate the substrate recently discovered CYP 4V, 4X and 4Z sub- selectivity of CYP4B1. families (Rettie and Kelly, 2008). P450 enzymes The CYP4B1 enzyme is highly conserved across usually function as monooxygenases in that they species - see figure 2 below that also highlights the incorporate one atom of molecular oxygen into their position of the cysteinyl ligand and the I-helix substrates and reduce the other to water. glutamate. CYP4 enzymes typically catalyze fatty acid ω- Expression hydroxylase reactions. CYP4B1 mRNA and/or protein are found typically Description at the highest levels in lung and airway tissue. Structurally, P450 enzymes all share a similar fold Liver levels of the enzyme are usually much lower, featuring a β-sheet rich N-terminus and an α-helix but inducible by phenobarbital. rich C-terminus. Expression of the enzyme in mouse kidney is The hydrophobic N-terminus of eukaryotic P450s regulated by androgens. CYP4B1 is highly functions as membrane anchor, whereas the C- expressed in several cancer types, including colon, terminal region houses the cysteinyl heme (iron adrenal gland, lung and gastric cancers. protoporphyrin IX) cofactor that binds and activates Localisation molecular oxygen. CYP4B1 is located in the ER membrane, although Many CYP4 enzymes, including CYP4B1, possess one report suggests that the rat enzyme may be a a unique post-translational modification at the heme secreted protein in respiratory mucosa (Genter et active center, wherein a conserved glutamate al., 2006). residue in the core I-helix forms a covalent, ester

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 453

CYP4B1 (cytochrome P450, family 4, subfamily B, Kelly EJ, et al. polypeptide 1)

Figure 2. Multiple sequence alignment of vertebrate CYP4B proteins. The covalently heme-linked glutamate residue is indicated in bold italics and the heme-coordinating cysteinyl ligand depicted in bold underline. The Pro>Ser substitution at position 427 in human CYP4B1 is depicted in italics. Alignments determined using the ClustalW2 multiple sequence alignment program available online at EMBL-EBI.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 454

CYP4B1 (cytochrome P450, family 4, subfamily B, Kelly EJ, et al. polypeptide 1)

mRNA has been found in human urothelial cells Mutations (Roos et al., 2006). Peripheral blood mononuclear Note cell CYP4B1 mRNA expression correlated with Seven alleles (CYP4B1*1-*7) are listed at human liver expression and therefore has been http://www.cypalleles.ki.se/cyp4b1.htm and suggested as a surrogate marker for hepatic summarized in table 1 below. The CYP4B1*1 allele bioactivation of environmental pro-toxins is described by a composition of the major alleles (Furukawa et al., 2004). An increased risk of shown in table 1. CYP4B1*2 contains the bladder cancer (OR of 1.03-2.95) has been reported haplotype of the 294 frameshift along with M331I, in Japanese patients carrying the CYP4B1*2 allele R340C and R375C. CYP4B1*7 is the same (Sasaki et al., 2008). One potential explanation haplotype minus the R375C variant. CYP4B1*3/4/5 could be that CYP4B1 is known to play a role in are described by the R173W, S322G and M331I aromatic amine bioactivation (Windmill et al., polymorphisms, respectively. CYP4B1*6 is 1997) and these compounds are known bladder R173W in combination with V345I. carcinogens and present in cooked meats (Jägerstad and Skog, 2005) and cigarette smoke (Smith et al., Nucleotide Protein Heterozygosity1 1997), among other sources. However, no Change, Coding association was found between lung cancer risk and cDNA Sequence CYP4B1*1-*7 polymorphisms in Japanese (Tamaki position Change et al., 2011). 517C>T R173W 0.28 Angiogenesis 881_882ΔAT 294 0.34 Note frameshift (STOP) Studies conducted in a rabbit model of corneal 964A>G S322G 0.02 wound healing have implicated that CYP4B1 may 993G>A M331I 0.40 play a role in production of inflammatory 1018C>T R340C 0.22 eicosanoids and corneal neovascularization 1033G>A V345I ND (Mastyugin et al., 2001). 1123C>T R375C 0.26 These observations are corroborated by findings in mice, whereby heme oxygenase-I induction Table 1. CYP4B1 polymorphic variants including nucleotide changes and effect on protein coding sequences. 1 The attenuates corneal inflammation and is associated values for heterozygosity of the minor alleles are taken from with a lack of CYP4B1 induction (and eicosanoid NCBI. ND: not determined. production) (Patil et al., 2008). Recent exome sequencing has revealed Conversely, retinoic acid (RA) has been shown to considerable additional polymorphism (>75 total increase CYP4B1 gene expression in ocular organ SNPs) in the human CYP4B1 gene (search at cultures, resulting in increased metabolism of Exome Variant Server). arachidonic acid to 12-HETE and 12-HETrE (Ashkar et al., 2004). These effects were shown to Implicated in be mediated, at least in part, by transcriptional regulation of the rabbit CYP4B1 promoter, which Various cancers contains several RAR/RXR binding motifs (Ashkar Note et al., 2004). While RA is typically associated with CYP4B1 mRNA and/or protein are highly corneal wound healing, the induction of CYP4B1 expressed in some cancer types. In particular by RA suggests it may also have a pro- Imaoka et al. demonstrated increased CYP4B1 in inflammatory role in wound healing. This is bladder tumor tissue at both the mRNA and protein supported by the observation that systemic level (Imaoka et al., 2000). This finding is also treatment with 13-cis-retinoic acid (Accutane™) for consistent with rodent studies demonstrating cystic acne is associated with conjunctivitis, eyelid localization of CYP4B1 in mouse and rat bladder inflammation and keratitis, along with other ocular tissue (Imaoka et al., 1997; Imaoka et al., 2001). effects (Lebowitz and Berson, 1988). However, Czerwinski et al. observed down Further evidence that CYP4B1 is important in regulation of CYP4B1 mRNA in lung tumors ocular inflammation, eicosanoid production and relative to normal lung (Czerwinski et al., 1994). neovascularization is shown in a study by Seta et With breast cancer, there does not appear to be any al., using in vivo siRNA targeting of CYP4B1 in a difference in expression of CYP4B1 when rabbit model of corneal wound healing. comparing tumor tissue with surrounding healthy It was found that down-regulation of CYP4B1 tissue, but these studies did not use disease-free inhibited production of 12- HETrE and VEGF in subjects as a comparator (Iscan et al., 2001). addition to decreasing neovascularization (Seta et Relatively high expression of constitutive CYP4B1 al., 2007).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 455

CYP4B1 (cytochrome P450, family 4, subfamily B, Kelly EJ, et al. polypeptide 1)

Colitis mainstream cigarette smoke. Food Chem Toxicol. 1997 Oct-Nov;35(10-11):1107-30 Note Windmill KF, McKinnon RA, Zhu X, Gaedigk A, Grant DM, Several recent studies have implicated a potential McManus ME. The role of xenobiotic metabolizing role for CYP4B1 in inflammatory bowel disease enzymes in arylamine toxicity and carcinogenesis: (IBD). In a mouse model of dextran sodium sulfate functional and localization studies. Mutat Res. 1997 May (DSS)-induced colitis, Ye et al. found that caffeic 12;376(1-2):153-60 acid treatment decreased disease severity and this Rainov NG, Dobberstein KU, Sena-Esteves M, Herrlinger was associated with increased expression of U, Kramm CM, Philpot RM, Hilton J, Chiocca EA, Breakefield XO. New prodrug activation gene therapy for Cyp4b1 in affected tissues (Ye et al., 2009). In a cancer using cytochrome P450 4B1 and 2- subsequent study looking at the role of caffeic acid aminoanthracene/4-ipomeanol. Hum Gene Ther. 1998 Jun bioavailability in this model, they found that mice 10;9(9):1261-73 treated with DSS alone had lower colonic Cyp4b1 Zheng YM, Fisher MB, Yokotani N, Fujii-Kuriyama Y, expression when compared to DSS plus caffeic acid Rettie AE. Identification of a meander region proline treated mice (Ye et al., 2011). In a different mouse residue critical for heme binding to cytochrome P450: model of IBD, Liu et al. also found evidence that implications for the catalytic function of human CYP4B1. Biochemistry. 1998 Sep 15;37(37):12847-51 Cyp4b1 gene expression is altered in this disease state (Liu et al., 2009). It was found that IBD Imaoka S, Yoneda Y, Sugimoto T, Hiroi T, Yamamoto K, induced by infection with Helicobacter bilis Nakatani T, Funae Y. CYP4B1 is a possible risk factor for bladder cancer in humans. Biochem Biophys Res resulted in changes in mucosal gene expression Commun. 2000 Nov 2;277(3):776-80 patterns. Using microarray analysis, it was found Henne KR, Kunze KL, Zheng YM, Christmas P, Soberman that H. bilis infection resulted in decreased RJ, Rettie AE. Covalent linkage of prosthetic heme to expression of Cyp4b1. These authors also examined CYP4 family P450 enzymes. Biochemistry. 2001 Oct mice with IBD induced by DSS and, akin to Liu et 30;40(43):12925-31 al., found decreased expression of Cyp4b1 in Imaoka S, Yoneda Y, Sugimoto T, Ikemoto S, Hiroi T, diseased tissue. These findings suggest an anti- Yamamoto K, Nakatani T, Funae Y. Androgen regulation inflammatory role for CYP4B1 in IBD, but these of CYP4B1 responsible for mutagenic activation of bladder preclinical studies must be weighed against what is carcinogens in the rat bladder: detection of CYP4B1 mRNA by competitive reverse transcription-polymerase known about gastrointestinal expression of chain reaction. Cancer Lett. 2001 May 26;166(2):119-23 CYP4B1 and human IBD. While rodents and Iscan M, Klaavuniemi T, Coban T, Kapucuoglu N, rabbits and other species are known to expression Pelkonen O, Raunio H. The expression of cytochrome CYP4B1 in the gut, there are species-specific P450 enzymes in human breast tumours and normal differences, with humans expressing little CYP4B1 breast tissue. Breast Cancer Res Treat. 2001 in this tissue (McKinnon et al., 1994). Whether the Nov;70(1):47-54 CYP4B1 gene plays any role in IBD is unclear, Mastyugin V, Mosaed S, Bonazzi A, Dunn MW, particularly in light of the functionality of the Schwartzman ML. Corneal epithelial VEGF and Pro427Ser human protein (Zheng et al., 1998). cytochrome P450 4B1 expression in a rabbit model of closed eye contact lens wear. Curr Eye Res. 2001 Finally, in considering risk of developing IBD, a Jul;23(1):1-10 genome wide association study by The Wellcome Trust examining 2000 cases of Crohn's with 3000 Ashkar S, Mesentsev A, Zhang WX, Mastyugin V, Dunn MW, Laniado-Schwartzman M. Retinoic acid induces controls, found no significant association between corneal epithelial CYP4B1 gene expression and stimulates CYP4B1 genetic variants and disease incidence the synthesis of inflammatory 12-hydroxyeicosanoids. J (Wellcome Trust Case Control Consortium, 2007). Ocul Pharmacol Ther. 2004 Feb;20(1):65-74 Furukawa M, Nishimura M, Ogino D, Chiba R, Ikai I, Ueda References N, Naito S, Kuribayashi S, Moustafa MA, Uchida T, Sawada H, Kamataki T, Funae Y, Fukumoto M. Lebowitz MA, Berson DS. Ocular effects of oral retinoids. J Cytochrome p450 gene expression levels in peripheral Am Acad Dermatol. 1988 Jul;19(1 Pt 2):209-11 blood mononuclear cells in comparison with the liver. Cancer Sci. 2004 Jun;95(6):520-9 Czerwinski M, McLemore TL, Gelboin HV, Gonzalez FJ. Quantification of CYP2B7, CYP4B1, and CYPOR Jägerstad M, Skog K. Genotoxicity of heat-processed messenger RNAs in normal human lung and lung tumors. foods. Mutat Res. 2005 Jul 1;574(1-2):156-72 Cancer Res. 1994 Feb 15;54(4):1085-91 Genter MB, Yost GS, Rettie AE. Localization of CYP4B1 in McKinnon RA, Burgess WM, Gonzalez FJ, Gasser R, the rat nasal cavity and analysis of CYPs as secreted McManus ME. Species-specific expression of CYP4B1 in proteins. J Biochem Mol Toxicol. 2006;20(3):139-41 rabbit and human gastrointestinal tissues. Pharmacogenetics. 1994 Oct;4(5):260-70 Roos PH, Belik R, Föllmann W, Degen GH, Knopf HJ, Bolt HM, Golka K. Expression of cytochrome P450 enzymes Imaoka S, Yoneda Y, Matsuda T, Degawa M, Fukushima CYP1A1, CYP1B1, CYP2E1 and CYP4B1 in cultured S, Funae Y. Mutagenic activation of urinary bladder transitional cells from specimens of the human urinary tract carcinogens by CYP4B1 and the presence of CYP4B1 in and from urinary sediments. Arch Toxicol. 2006 bladder mucosa. Biochem Pharmacol. 1997 Sep Jan;80(1):45-52 15;54(6):677-83 Sansen S, Yano JK, Reynald RL, Schoch GA, Griffin KJ, Smith CJ, Livingston SD, Doolittle DJ. An international Stout CD, Johnson EF. Adaptations for the oxidation of literature survey of "IARC Group I carcinogens" reported in

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 456

CYP4B1 (cytochrome P450, family 4, subfamily B, Kelly EJ, et al. polypeptide 1)

polycyclic aromatic hydrocarbons exhibited by the MJ.. Mucosal gene expression profiles following the structure of human P450 1A2. J Biol Chem. 2007 May colonization of immunocompetent defined-flora C3H mice 11;282(19):14348-55 with Helicobacter bilis: a prelude to typhlocolitis. Microbes Infect. 2009 Mar;11(3):374-83. Epub 2009 Jan 14. Seta F, Patil K, Bellner L, Mezentsev A, Kemp R, Dunn MW, Schwartzman ML. Inhibition of VEGF expression and Ye Z, Liu Z, Henderson A, Lee K, Hostetter J, corneal neovascularization by siRNA targeting cytochrome Wannemuehler M, Hendrich S.. Increased CYP4B1 mRNA P450 4B1. Prostaglandins Other Lipid Mediat. 2007 is associated with the inhibition of dextran sulfate sodium- Nov;84(3-4):116-27 induced colitis by caffeic acid in mice. Exp Biol Med (Maywood). 2009 Jun;234(6):605-16. Epub 2009 Mar 23. . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. Nature. Tamaki Y, Arai T, Sugimura H, Sasaki T, Honda M, Muroi 2007 Jun 7;447(7145):661-78 Y, Matsubara Y, Kanno S, Ishikawa M, Hirasawa N, Hiratsuka M.. Association between cancer risk and drug- Patil K, Bellner L, Cullaro G, Gotlinger KH, Dunn MW, metabolizing enzyme gene (CYP2A6, CYP2A13, CYP4B1, Schwartzman ML. Heme oxygenase-1 induction SULT1A1, GSTM1, and GSTT1) polymorphisms in cases attenuates corneal inflammation and accelerates wound of lung cancer in Japan. Drug Metab Pharmacokinet. healing after epithelial injury. Invest Ophthalmol Vis Sci. 2011;26(5):516-22. Epub 2011 Jul 26. 2008 Aug;49(8):3379-86 Ye Z, Hong CO, Lee K, Hostetter J, Wannemuehler M, Rettie A E, Kelly EJ.. The CYP4 Family Issues in Hendrich S.. Plasma caffeic acid is associated with Toxicology. Cytochome P450: Role in the metabolism and statistical clustering of the anticolitic efficacy of caffeic acid toxicity of drugs and other xenobiotics; Ioannides C. Ed, in dextran sulfate sodium-treated mice. J Nutr. 2011 Royal Society of Chemistry, London, 2008. Nov;141(11):1989-95. Epub 2011 Sep 14. Sasaki T, Horikawa M, Orikasa K, Sato M, Arai Y, Mitachi Y, Mizugaki M, Ishikawa M, Hiratsuka M.. Possible This article should be referenced as such: relationship between the risk of Japanese bladder cancer Kelly EJ, Yarov-Yarovoy V, Rettie AE. CYP4B1 cases and the CYP4B1 genotype. Jpn J Clin Oncol. 2008 (cytochrome P450, family 4, subfamily B, polypeptide 1). Sep;38(9):634-40. Epub 2008 Aug 19. Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):452- Liu Z, Henderson AL, Nettleton D, Wilson-Welder JH, 457. Hostetter JM, Ramer-Tait A, Jergens AE, Wannemuehler

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 457

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Gene Section Review

DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25) Chon-Hwa Tsai-Morris, Maria L Dufau Section on Molecular Endocrinology, Program in Developmental Endocrinology and Genetics, NICHD, National Institutes of Health, Bethesda, MD 20892-4510, USA (CHTM, MLD)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/DDX25ID46826ch11q24.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI DDX25ID46826ch11q24.txt

Identity Transcription The GRTH gene belongs to the TATA-less/non- Other names: GRTH initiator class (Tsai-Morris et al., 2004). A single HGNC (Hugo): DDX25 transcript of 1,6 Kb is expressed in the testis (Tang et al., 1999). Gonadotropin-induced androgen Location: 11q24.2 increases cause autocrine stimulation of GRTH Note gene transcription in Leydig cells through a non- Gonadotropin Regulated Testicular RNA Helicase classical half-site element residing at -827/-822 5' (GRTH), a member of the Glu-Asp-Ala-Glu from the initiation codon (Tang et al., 1999; Tsai- (DEAD)-box protein family, is a testis-specific Morris et al., 2010; Villar et al., 2012). The gonadotropin/androgen-regulated RNA Helicase. induction of the GRTH gene expression in germ cells (meiotic spermatocytes, round and elongated DNA/RNA spermatids) presumbably results from paracrine actions of androgen through cognate receptors in Description Sertoli cells (adjacent to germinal cells). Human GRTH gene contains 12 exons and all but one of its conserved helicase motifs are contained Pseudogene within single exon (Tsai-Morris et al., 2004). Motif One related pseudo DDX25 (LOC100421309) was ARG-D resides in exon 10/11. found in chromosome 5.

Genomic organization of the Human GRTH gene. Exons presented by boxes. The positions of the translation initiation ATG and termination TGA codon are indicated. Conserved domains of DEAD-box family of the RNA helicase are presented above its respective exon.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 458

DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25) Tsai-Morris CH, Dufau ML

Protein Chromatoid Body of round spermatids. Expression Description GRTH (484 aa) is highly expressed in the testis: GRTH contains three ATG in frame codons with somatic (Leydig cells) and germinal (meiotic the potential for generation of multiple protein spermatocytes, round spermatids and elongated species (61/56, 48/43 and 33 kDa) (Sheng et al., spermatids) cells (Sheng et al., 2003; Tsai-Morris, 2003). The 61/56 kDa proteins are the major et al., 2004). species observed in the human testis (Tang et al., GRTH is genetically close to DBP5/DDX19b (63% 1999; Tsai-Morris et al., 2007). overall aa homology) involved in mRNA export GRTH 56- and 61-kDa species are present in (Schmitt et al., 1999). nucleus and cytoplasm (Sheng et al., 2006), respectively. Localisation Based on the mouse model, the 56 kDa nuclear GRTH is localized in the nucleus and at species interacts with CRM1 and participates in cytoplasmic sites in polyribosomes and the mRNA transport in the human testis and the Chromatoid Body (CB) of round spermatids (Tsai- phosphorylated 61 kDa species associates with Morris et al., 2004; Sheng et al., 2006; Sato et al., mRNAs at polysomal sites and also within the 2010; Tsai-Morris et al., 2012).

Model of GRTH action in male germ cells during development (derived from mouse studies). 56 kDa GRTH species enters the nucleus (1), where it binds messages and associates with CRM1 (2) as mRNP complex to export messages through nuclear pores via the CRM1 pathway to the cytoplasm (3a) and to the chromatoid body (CB), either directly (via nuclear pores adjacent to or associated with the CB) (3b) or indirectly via the cytoplasmic route (4b). It is phosphorylated at cytoplasmic sites, and participates in translation at polyribosomes (4a). In the CB, messages are potentially regulated via si/mi/pi RNA pathway (5a and b). Stored messages are subsequently translated in polyribosomes (4a and 6) at specific times during spermatogenesis.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 459

DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25) Tsai-Morris CH, Dufau ML

GRTH is essential for spermatid development and completion of spermatogenesis (derived from studies of GRTH-/- mouse model). Top panel: Diagram of spermatogenic progression. Representative germ cells during spermatogenesis are shown in the diagram above. Cells expressing GRTH are boxed in red. The regulation of gene expression during the developmental process is governed in a precise temporal sequence. Lower panel: I. GRTH dependent expression of proteins. II. Schematic germ-cell development. Unlike the wild type (WT) showing progression to mature sperm, germ cells of GRTH knockout mice fail to elongate at step 8 of round spermatids (RS).

Function cells, GRTH prevents overstimulation of gonadotropin-induced androgen pathway by GRTH is a multifunctional protein essential for promoting degradation of StAR protein (Fukushima completion of spermatogenesis as a post- et al., 2011). transcriptional regulator of relevant genes during germ cells development (Tsai-Morris et al., 2004; Sheng et al., 2006; Dufau and Tsai-Morris, 2007; Implicated in Tsai-Morris et al., 2010). It contains ATPase Azoospermia activity (ATP/Mg dependent), and is a bi- directional RNA helicase. As a translational Note regulator it participates in the in vitro and in vivo A missense mutation (R242H) in exon 8 identified translation of RNA templates. GRTH is a shuttling in 5% of an infertile Japanese patient population protein that exports germ cell specific RNA as with non-obstructive azoospermia (NOA) abrogated mRNP particles from nucleus to cytoplasm via the the generation of the 61 kDa phosphorylated-GRTH CRM1-dependent pathway. A specific set of species (Tsai-Morris et al., 2007; Tsai-Morris et al., testicular gene transcripts, including those of 2008). A silent mutation located in exon 10 chromatin-remodeling proteins (Tp1 and Tp2, Prm1 (C1194T, nt) identified in Chinese patients with and PRM2), cytoskeletal structural proteins idiopathic azoospermia was proposed to increase (Fsc1/Odf1) and tACE are associated with GRTH the risk of impaired spermatogenesis (Zhoucun et protein. GRTH also selectively binds mRNAs of al., 2006). This could result from its location in the pro-apoptotic and anti-apoptotic genes, the death binding motif of splicing factor 2 through affecting receptor and proteins involved in the NF-kB pre-RNA splicing of the GRTH gene and ultimately pathways to mediate anti-apoptotic regulation its expression. However, such mutation was not (Gutti et al., 2008). GRTH is required to maintain observed in the infertile Japanese patients with non- the structural integrity of the chromatoid body obstructive azoospermia (Tsai-Morris et al., 2008), (storage/processing organelle of mRNAs that which indicated segregration of the mutation to the contains members of the small miRNA RISC- Chinese population. complex) during spermatogenesis (Sato et al., 2010). GRTH also participates in the regulation of References microRNA biogenesis in germ cells (Dai et al., Schmitt C, von Kobbe C, Bachi A, Panté N, Rodrigues JP, 2011) and associates with polyribosome for Boscheron C, Rigaut G, Wilm M, Séraphin B, Carmo- translational initiation of target genes. In Leydig Fonseca M, Izaurralde E. Dbp5, a DEAD-box protein

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 460

DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25) Tsai-Morris CH, Dufau ML

required for mRNA export, is recruited to the cytoplasmic Tsai-Morris CH, Koh E, Dufau ML. Differences in fibrils of nuclear pore complex via a conserved interaction gonadotropin-regulated testicular helicase (GRTH/DDX25) with CAN/Nup159p. EMBO J. 1999 Aug 2;18(15):4332-47 single nucleotide polymorphism between Japanese and Chinese populations. Hum Reprod. 2008 Nov;23(11):2611- Tang PZ, Tsai-Morris CH, Dufau ML. A novel 3 gonadotropin-regulated testicular RNA helicase. A new member of the dead-box family. J Biol Chem. 1999 Dec Sato H, Tsai-Morris CH, Dufau ML. Relevance of 31;274(53):37932-40 gonadotropin-regulated testicular RNA helicase (GRTH/DDX25) in the structural integrity of the chromatoid Dufau ML, Tsai-Morris C, Tang P, Khanum A. Regulation body during spermatogenesis. Biochim Biophys Acta. 2010 of steroidogenic enzymes and a novel testicular RNA May;1803(5):534-43 helicase. J Steroid Biochem Mol Biol. 2001 Jan-Mar;76(1- 5):187-97 Tsai-Morris CH, Sheng Y, Gutti R, Li J, Pickel J, Dufau ML. Gonadotropin-regulated testicular RNA helicase Sheng Y, Tsai-Morris CH, Dufau ML. Cell-specific and (GRTH/DDX25) gene: cell-specific expression and hormone-regulated expression of gonadotropin-regulated transcriptional regulation by androgen in transgenic mouse testicular RNA helicase gene (GRTH/Ddx25) resulting from testis. J Cell Biochem. 2010 Apr 15;109(6):1142-7 alternative utilization of translation initiation codons in the rat testis. J Biol Chem. 2003 Jul 25;278(30):27796-803 Tsai-Morris CH, Sheng Y, Gutti RK, Tang PZ, Dufau ML. Gonadotropin-regulated testicular RNA helicase Tsai-Morris CH, Lei S, Jiang Q, Sheng Y, Dufau ML. (GRTH/DDX25): a multifunctional protein essential for Genomic organization and transcriptional analysis of spermatogenesis. J Androl. 2010 Jan-Feb;31(1):45-52 gonadotropin-regulated testicular RNA helicase-- GRTH/DDX25 gene. Gene. 2004 Apr 28;331:83-94 Dai L, Tsai-Morris CH, Sato H, Villar J, Kang JH, Zhang J, Dufau ML. Testis-specific miRNA-469 up-regulated in Tsai-Morris CH, Sheng Y, Lee E, Lei KJ, Dufau ML. gonadotropin-regulated testicular RNA helicase Gonadotropin-regulated testicular RNA helicase (GRTH/DDX25)-null mice silences transition protein 2 and (GRTH/Ddx25) is essential for spermatid development and protamine 2 messages at sites within coding region: completion of spermatogenesis. Proc Natl Acad Sci U S A. implications of its role in germ cell development. J Biol 2004 Apr 27;101(17):6373-8 Chem. 2011 Dec 30;286(52):44306-18 A Z, Zhang S, Yang Y, Ma Y, Lin L, Zhang W. Single Dufau ML, Sato H, Gutti R, Tsai-Morris CH. Gonadotropin- nucleotide polymorphisms of the gonadotrophin-regulated regulated testicular helicase (GRTH/DDX25): a master testicular helicase (GRTH) gene may be associated with post-transcriptional regulator of spermatogenesis. Adv Exp the human spermatogenesis impairment. Hum Reprod. Med Biol. 2011;707:23-9 2006 Mar;21(3):755-9 Fukushima M, Villar J, Tsai-Morris CH, Dufau ML. Sheng Y, Tsai-Morris CH, Gutti R, Maeda Y, Dufau ML. Gonadotropin-regulated testicular RNA helicase Gonadotropin-regulated testicular RNA helicase (GRTH/DDX25), a negative regulator of (GRTH/Ddx25) is a transport protein involved in gene- luteinizing/chorionic gonadotropin hormone-induced specific mRNA export and protein translation during steroidogenesis in Leydig cells: central role of spermatogenesis. J Biol Chem. 2006 Nov steroidogenic acute regulatory protein (StAR). J Biol 17;281(46):35048-56 Chem. 2011 Aug 26;286(34):29932-40 Dufau ML, Tsai-Morris CH. Gonadotropin-regulated Tsai-Morris CH, Sato H, Gutti R, Dufau ML. Role of testicular helicase (GRTH/DDX25): an essential regulator gonadotropin regulated testicular RNA helicase of spermatogenesis. Trends Endocrinol Metab. 2007 (GRTH/Ddx25) on polysomal associated mRNAs in mouse Oct;18(8):314-20 testis. PLoS One. 2012;7(3):e32470 Tsai-Morris CH, Koh E, Sheng Y, Maeda Y, Gutti R, Villar J, Tsai-Morris CH, Dai L, Dufau ML. Androgen- Namiki M, Dufau ML. Polymorphism of the GRTH/DDX25 induced activation of gonadotropin-regulated testicular gene in normal and infertile Japanese men: a missense RNA helicase (GRTH/Ddx25) transcription: essential role mutation associated with loss of GRTH phosphorylation. of a nonclassical androgen response element half-site. Mol Mol Hum Reprod. 2007 Dec;13(12):887-92 Cell Biol. 2012 Apr;32(8):1566-80 Gutti RK, Tsai-Morris CH, Dufau ML. Gonadotropin- regulated testicular helicase (DDX25), an essential This article should be referenced as such: regulator of spermatogenesis, prevents testicular germ cell Tsai-Morris CH, Dufau ML. DDX25 (DEAD (Asp-Glu-Ala- apoptosis. J Biol Chem. 2008 Jun 20;283(25):17055-64 Asp) box helicase 25). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):458-461.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 461

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Gene Section Review

EPHB6 (EPH receptor B6) Lokesh Bhushan, Raj P Kandpal Department of Basic Medical Sciences, Western University of Health Sciences, Pomona, CA 91766, USA (LB, RPK)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/EPHB6ID40471ch7q34.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI EPHB6ID40471ch7q34.txt

Identity Description Other names: HEP, MGC129910, MGC129911 Size: 16056 bases. Orientation: plus strand. HGNC (Hugo): EPHB6 Transcription Location: 7q34 EphB6 mRNA size is 4044 bp. DNA/RNA Pseudogene Note Not reported. EphB6 is located on chromosome 7q33-q35.

The chromosomal location of EPHB6 is indicated at interval q33-q35. Adapted from GeneCards.

Schematic representation of various domains in EphB6 protein.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 462

EPHB6 (EPH receptor B6) Bhushan L, Kandpal RP

Protein Function A variety of Eph receptors and their ligands are Note involved in regulating cell pattern formation during The crystal structure of EphB6 has not yet been organogenesis (Xu and Wilkinson, 1997; Flanagan determined. However, based on amino acid and Vanderhaeghen, 1998; Holmberg et al., 2000; sequence and domain arrangement it is classified as Leighton et al., 2001; Kullander et al., 2001; Gerlai, a type I transmembrane protein. 2001). EphB6 has been shown to facilitate T-cell It has a highly conserved N-terminal domain in the activation (Luo et al., 2002). Metastasis/invasion extracellular region that is involved in ligand suppressor role of EphB6 in non-small cell lung recognition and binding (Labrador et al., 1997). The carcinoma and breast carcinoma (Müller-Tidow et N-terminal domain is followed by a cysteine rich al., 2005; Fox and Kandpal, 2009) suggests its region and two fibronectin type-III repeats. These involvement in cell adhesion and migration. repeats are involved in mediating protein-protein interactions and receptor dimerization (Lackmann Homology et al., 1998). Amino acid homology between EphB6 and other The intracellular region contains a juxtamembrane EphB family members varies between 47% and domain, a conserved kinase domain, a sterile α- 60%. Mouse and human homologs of EphB6 share motif (SAM) domain and a PSD95/Dlg/ZO1 (PDZ) greater than 90% amino acid identity (Gurniak and domain (Kalo and Pasquale, 1999). Berg, 1996; Matsuoka et al., 1997). The kinase Description domain in EphB6 is mutated. Eph (erythropoietin producing hepatocellular Implicated in carcinoma) receptors belong to a family of receptor tyrosine kinases, which are activated by binding to Non-small cell lung cancer ephrin ligands. Note These receptors are involved in a diverse array of Altered levels and loss of EphB6 expression have signal transduction processes in humans. been found in non-small cell lung carcinoma (Tang Such diversity of signaling and the resulting et al., 1999a; Müller-Tidow et al., 2005; Yu et al., functional output is partly attributed to differential 2010). expression and interactions among these receptors. Based on sequence homology and affinity for Breast cancer ephrin ligands, Eph receptors are classified into A Note and B groups. EphB6 is a kinase-deficient receptor EphB6 silencing has been observed in breast (Gurniak and Berg, 1996) that has been shown to carcinoma cell lines and some tumors (Fox and interact with two kinase-active receptors, namely, Kandpal, 2004; Fox and Kandpal, 2006; Fox and EphB2 and EphA2 (Fox and Kandpal, 2011). Kandpal, 2009; Truitt et al., 2010). Molecular Ephrin B2 has been reported as a ligand for this profiling of breast carcinoma cells with or without receptor (Munthe et al., 2000). EphB6 expression has revealed significant changes The loss of EphB6 expression in breast carcinoma in proteins as well as miRNAs (Kandpal, 2010; cell lines has been correlated to their invasiveness Bhushan and Kandpal, 2011). However, elevated (Fox and Kandpal, 2004; Fox and Kandpal, 2006), levels of EphB6 have also been reported in breast and its role as a tumor suppressor has also been tumor specimens (Brantley-Sieders et al., 2011). reported (Fox and Kandpal, 2009; Yu et al., 2010). Melanoma Expression Note Eph receptors are expressed in a wide variety of The progression of melanoma to metastasis has tissues and cells (Andres et al., 1994; Fox et al., been correlated to progressive decrease of EphB6 1995; Ciossek et al., 1995; Lickliter et al., 1996; expression (Hafner et al., 2003). Muñoz et al., 2002). In addition to other tissues and cells, EphB6 receptor expression has been shown in Neuroblastoma breast, prostate, thymus, mature T-cells and Note leukemia cells (Shimoyama et al., 2000; Luo et al., The levels of EphB6 have been characterized as 2001; Luo et al., 2002; Fox and Kandpal, 2004; Fox prognostic indicators in neuroblastoma (Tang et al., et al., 2006). EphB6 deficient mice develop 1999b; Tang et al., 2000). normally and do not display any abnormality in their general appearance (Shimoyama et al., 2002). Leukemia and T-cell development Localisation Note EphB6 expression has been implicated in T-cell Cellular. EphB6 is a transmembrane protein. development, and altered levels of this protein have

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 463

EPHB6 (EPH receptor B6) Bhushan L, Kandpal RP

been observed in leukemia and lymphoma cells Holmberg J, Clarke DL, Frisén J. Regulation of repulsion (Shimoyama et al., 2000). versus adhesion by different splice forms of an Eph receptor. Nature. 2000 Nov 9;408(6809):203-6 Colorectal and colon cancer Munthe E, Rian E, Holien T, Rasmussen A, Levy FO, Note Aasheim H. Ephrin-B2 is a candidate ligand for the Eph In familial colorectal cancer EphB6 gene shows two receptor, EphB6. FEBS Lett. 2000 Jan 21;466(1):169-74 missense mutations in germline. These two Shimoyama M, Matsuoka H, Tamekane A, Ito M, Iwata N, mutations include change of alanine to proline at Inoue R, Chihara K, Furuya A, Hanai N, Matsui T. T-cell- specific expression of kinase-defective Eph-family receptor position 321 (A321P) and glycine to valine protein, EphB6 in normal as well as transformed (G914V) at position 914 (Gylfe et al., 2010). hematopoietic cells. Growth Factors. 2000;18(1):63-78 Deletions of EphB6 gene locus have also been Tang XX, Zhao H, Robinson ME, Cohen B, Cnaan A, reported in colon cancer (Ashktorab et al., 2010). London W, Cohn SL, Cheung NK, Brodeur GM, Evans AE, Ikegaki N. Implications of EPHB6, EFNB2, and EFNB3 References expressions in human neuroblastoma. Proc Natl Acad Sci U S A. 2000 Sep 26;97(20):10936-41 Andres AC, Reid HH, Zürcher G, Blaschke RJ, Albrecht D, Gerlai R. Eph receptors and neural plasticity. Nat Rev Ziemiecki A. Expression of two novel eph-related receptor Neurosci. 2001 Mar;2(3):205-9 protein tyrosine kinases in mammary gland development and carcinogenesis. Oncogene. 1994 May;9(5):1461-7 Kullander K, Mather NK, Diella F, Dottori M, Boyd AW, Klein R. Kinase-dependent and kinase-independent Ciossek T, Lerch MM, Ullrich A. Cloning, characterization, functions of EphA4 receptors in major axon tract formation and differential expression of MDK2 and MDK5, two novel in vivo. Neuron. 2001 Jan;29(1):73-84 receptor tyrosine kinases of the eck/eph family. Oncogene. 1995 Nov 16;11(10):2085-95 Leighton PA, Mitchell KJ, Goodrich LV, Lu X, Pinson K, Scherz P, Skarnes WC, Tessier-Lavigne M. Defining brain Fox GM, Holst PL, Chute HT, Lindberg RA, Janssen AM, wiring patterns and mechanisms through gene trapping in Basu R, Welcher AA. cDNA cloning and tissue distribution mice. Nature. 2001 Mar 8;410(6825):174-9 of five human EPH-like receptor protein-tyrosine kinases. Oncogene. 1995 Mar 2;10(5):897-905 Luo H, Wan X, Wu Y, Wu J. Cross-linking of EphB6 resulting in signal transduction and apoptosis in Jurkat Gurniak CB, Berg LJ. A new member of the Eph family of cells. J Immunol. 2001 Aug 1;167(3):1362-70 receptors that lacks protein tyrosine kinase activity. Oncogene. 1996 Aug 15;13(4):777-86 Luo H, Yu G, Wu Y, Wu J. EphB6 crosslinking results in costimulation of T cells. J Clin Invest. 2002 Lickliter JD, Smith FM, Olsson JE, Mackwell KL, Boyd AW. Oct;110(8):1141-50 Embryonic stem cells express multiple Eph-subfamily receptor tyrosine kinases. Proc Natl Acad Sci U S A. 1996 Muñoz JJ, Alonso-C LM, Sacedón R, Crompton T, Vicente Jan 9;93(1):145-50 A, Jiménez E, Varas A, Zapata AG. Expression and function of the Eph A receptors and their ligands ephrins A Labrador JP, Brambilla R, Klein R. The N-terminal globular in the rat thymus. J Immunol. 2002 Jul 1;169(1):177-84 domain of Eph receptors is sufficient for ligand binding and receptor signaling. EMBO J. 1997 Jul 1;16(13):3889-97 Shimoyama M, Matsuoka H, Nagata A, Iwata N, Tamekane A, Okamura A, Gomyo H, Ito M, Jishage K, Matsuoka H, Iwata N, Ito M, Shimoyama M, Nagata A, Kamada N, Suzuki H, Tetsuo Noda T, Matsui T. Chihara K, Takai S, Matsui T. Expression of a kinase- Developmental expression of EphB6 in the thymus: defective Eph-like receptor in the normal human brain. lessons from EphB6 knockout mice. Biochem Biophys Res Biochem Biophys Res Commun. 1997 Jun 27;235(3):487- Commun. 2002 Oct 18;298(1):87-94 92 Hafner C, Bataille F, Meyer S, Becker B, Roesch A, Xu Q, Wilkinson DG. Eph-related receptors and their Landthaler M, Vogt T. Loss of EphB6 expression in ligands: mediators of contact dependent cell interactions. J metastatic melanoma. Int J Oncol. 2003 Dec;23(6):1553-9 Mol Med (Berl). 1997 Aug;75(8):576-86 Fox BP, Kandpal RP. Invasiveness of breast carcinoma Flanagan JG, Vanderhaeghen P. The ephrins and Eph cells and transcript profile: Eph receptors and ephrin receptors in neural development. Annu Rev Neurosci. ligands as molecular markers of potential diagnostic and 1998;21:309-45 prognostic application. Biochem Biophys Res Commun. Lackmann M, Oates AC, Dottori M, Smith FM, Do C, 2004 Jun 11;318(4):882-92 Power M, Kravets L, Boyd AW. Distinct subdomains of the Müller-Tidow C, Diederichs S, Bulk E, Pohle T, Steffen B, EphA3 receptor mediate ligand binding and receptor Schwäble J, Plewka S, Thomas M, Metzger R, Schneider dimerization. J Biol Chem. 1998 Aug 7;273(32):20228-37 PM, Brandts CH, Berdel WE, Serve H. Identification of Kalo MS, Pasquale EB. Signal transfer by Eph receptors. metastasis-associated receptor tyrosine kinases in non- Cell Tissue Res. 1999 Oct;298(1):1-9 small cell lung cancer. Cancer Res. 2005 Mar 1;65(5):1778-82 Tang XX, Brodeur GM, Campling BG, Ikegaki N. Coexpression of transcripts encoding EPHB receptor Fox BP, Kandpal RP. Transcriptional silencing of EphB6 protein tyrosine kinases and their ephrin-B ligands in receptor tyrosine kinase in invasive breast carcinoma cells human small cell lung carcinoma. Clin Cancer Res. 1999a and detection of methylated promoter by methylation Feb;5(2):455-60 specific PCR. Biochem Biophys Res Commun. 2006 Feb 3;340(1):268-76 Tang XX, Evans AE, Zhao H, Cnaan A, London W, Cohn SL, Brodeur GM, Ikegaki N. High-level expression of Fox BP, Tabone CJ, Kandpal RP. Potential clinical EPHB6, EFNB2, and EFNB3 is associated with low tumor relevance of Eph receptors and ephrin ligands expressed stage and high TrkA expression in human neuroblastomas. in prostate carcinoma cell lines. Biochem Biophys Res Clin Cancer Res. 1999b Jun;5(6):1491-6 Commun. 2006 Apr 21;342(4):1263-72

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 464

EPHB6 (EPH receptor B6) Bhushan L, Kandpal RP

Fox BP, Kandpal RP. EphB6 receptor significantly alters Müller-Tidow C. The EPHB6 receptor tyrosine kinase is a invasiveness and other phenotypic characteristics of metastasis suppressor that is frequently silenced by human breast carcinoma cells. Oncogene. 2009 Apr promoter DNA hypermethylation in non-small cell lung 9;28(14):1706-13 cancer. Clin Cancer Res. 2010 Apr 15;16(8):2275-83 Ashktorab H, Schäffer AA, Daremipouran M, Smoot DT, Bhushan L, Kandpal RP. EphB6 receptor modulates micro Lee E, Brim H. Distinct genetic alterations in colorectal RNA profile of breast carcinoma cells. PLoS One. cancer. PLoS One. 2010 Jan 26;5(1):e8879 2011;6(7):e22484 Gylfe AE, Sirkiä J, Ahlsten M, Järvinen H, Mecklin JP, Brantley-Sieders DM, Jiang A, Sarma K, Badu-Nkansah A, Karhu A, Aaltonen LA. Somatic mutations and germline Walter DL, Shyr Y, Chen J. Eph/ephrin profiling in human sequence variants in patients with familial colorectal breast cancer reveals significant associations between cancer. Int J Cancer. 2010 Dec 15;127(12):2974-80 expression level and clinical outcome. PLoS One. 2011;6(9):e24426 Kandpal RP. Tyrosine kinase-deficient EphB6 receptor- dependent alterations in proteomic profiles of invasive Fox BP, Kandpal RP. A paradigm shift in EPH receptor breast carcinoma cells as determined by difference gel interaction: biological relevance of EPHB6 interaction with electrophoresis. Cancer Genomics Proteomics. 2010 Sep- EPHA2 and EPHB2 in breast carcinoma cell lines. Cancer Oct;7(5):253-60 Genomics Proteomics. 2011 Jul-Aug;8(4):185-93

Truitt L, Freywald T, DeCoteau J, Sharfe N, Freywald A. This article should be referenced as such: The EphB6 receptor cooperates with c-Cbl to regulate the behavior of breast cancer cells. Cancer Res. 2010 Feb Bhushan L, Kandpal RP. EPHB6 (EPH receptor B6). Atlas 1;70(3):1141-53 Genet Cytogenet Oncol Haematol. 2012; 16(7):462-465. Yu J, Bulk E, Ji P, Hascher A, Tang M, Metzger R, Marra A, Serve H, Berdel WE, Wiewroth R, Koschmieder S,

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 465

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Gene Section Review

FOXF1 (forkhead box F1) Pang-Kuo Lo Department of Biological Sciences, University of South Carolina, Columbia, South Carolina 29208, USA (PKL)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/FOXF1ID40628ch16q24.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI FOXF1ID40628ch16q24.txt

forkhead family which is characterized by a unique Identity forkhead DNA-binding domain. The function of Other names: ACDMPV, FKHL5, FREAC1 this gene is implicated in regulation of embryonic HGNC (Hugo): FOXF1 development and organ morphogenesis. The cellular role of this gene has been found to Location: 16q24.1 regulate cell cycle progression and epithelial-to- Local order: mesenchymal transition (EMT). According to the NCBI Map Viewer, genes Dysregulation of FOXF1 gene expression has been flanking FOXF1 in centromere to telomere linked to various cancers and genomic deletions or direction on 16q24 are: mutations at this gene locus have been discovered - LOC401864 (chloride intracellular channel 1 to be associated with congenital abnormalities. pseudogene); The role of FOXF1 in cancer has been proposed to - FLJ34515 (uncharacterized LOC400550); act as either an oncogene or a tumor suppressor - FOXF1 (forkhead box F1); gene depending on cell types and disease stages. - RPL7AP63 (ribosomal protein L7a pseudogene 63); DNA/RNA - MTHFSD (methenyltetrahydrofolate synthetase domain containing); Description - FLJ30679 (uncharacterized protein FLJ30679); The FOXF1 gene is composed of two exons with - FOXC2 (forkhead box C2, mesenchyme forkhead sizes of 1022 and 1540 bp, respectively. 1); Transcription - FOXL1 (forkhead box L1). The FOXF1 gene expresses 2,58 kb mRNA with Note the 1140 bp open reading frame. This gene encodes a transcription factor of the

The pink boxes indicate the open reading frame and the sky blue boxes indicate the untranslated mRNA region.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 466

FOXF1 (forkhead box F1) Lo PK

factor 1-C2 (NF1-C2) whose expression is lost Protein during mammary tumor progression and is almost absent from lymph node metastases (Nilsson et al., Description 2010). FOXF1 is preferentially expressed in breast Human FOXF1 is a 379 amino acid protein cancer cell lines with a mesenchymal phenotype functioning as a transcription factor. The FOXF1 and its ectopic overexpression in mammary protein contains a forkhead domain (or called epithelial cells induces mesenchymal traits, winged helix, 48-125 amino acids) engaged in increased invasiveness in vitro and enhanced binding to B-DNA (Kim et al., 2005). According to xenograft tumorigenesis in vivo (Nilsson et al., the information from the NCBI reference sequence 2010). Hence FOXF1 is proposed to promote NP_001442 for the FOXF1 protein, amino acids 84, invasion and metastasis. 85, 94, 97, 98 and 118 are involved in interaction The oncogenic role of FOXF1 in lung cancer- with nucleotides of DNA. In addition to the associated fibroblasts: FOXF1 is found to be forkhead DNA-binding domain, the C-terminal of expressed in cancer-associated fibroblasts of human FOXF1 possesses characteristics of the lung cancer and associated with activation of transcriptional activation domain (Mahlapuu et al., hedgehog signaling (Saito et al., 2010). Gain- and 1998). However, its region has not yet been loss-of-function studies of FOXF1 in fibroblasts convincingly defined. The studies have shown that show that FOXF1 is implicated in regulating the FOXF1 transcripitionally modulates expression of contractility of fibroblasts and abilities of tissue-specific genes (e.g. lung, intestine) (Hellqvist fibroblasts to produce hepatocyte growth factor as et al., 1996; Mahlapuu et al., 1998; Costa et al., well as fibroblast growth factor-2 and to stimulate 2001; Ormestad et al., 2006; Madison et al., 2009). migration of lung cancer epithelial cells (Saito et al., 2010). The expression status of FOXF1 in Expression fibroblasts positively correlates with the ability of According to published literature, the FOXF1 fibroblasts to enhance xenograft tumor growth transcription factor has been identified to be highly (Saito et al., 2010). These findings suggest that expressed in the normal human prostate transition hedgehog-dependent FOXF1 is a clinically relevant zone and benign prostate hyperplasia (BPH), but factor to grant oncogenic abilities to cancer- decreasingly expressed in prostate cancer (Watson associated fibroblasts for propelling development of et al., 2004; van der Heul-Nieuwenhuijsen et al., lung cancer. 2009). FOXF1 is expressed in normal breast ductal The role of FOXF1 in regulation of cell cycle epithelial cells and basal-like breast cancer cells, progression: FOXF1 has been identified as a target but is silenced in luminal breast cancer cells mainly of epigenetic inactivation in breast cancer (Lo et al., through the epigenetic mechanism (Lo et al., 2010; 2010). Ectopic reexpression of FOXF1 in FOXF1- Nilsson et al., 2010). FOXF1 expression is detected negative breast cancer cells induces cell growth in cancer-associated fibroblasts of human lung arrest by inhibition of the CDK2-RB-E2F cascade cancer and its expression is associated with (Lo et al., 2010). FOXF1 knockdown studies of activation of hedgehog signaling (Saito et al., FOXF1-expressing breast cancer epithelial cells 2010). Upregulation of FOXF1 expression is also revealed that FOXF1 is indispensable for found in PTCH1-associated rhabdomyosarcoma maintaining the stringency of DNA replication and (Wendling et al., 2008). genomic stability by negatively modulating Localisation expression of E2F target genes which are involved in promoting the progression of S and G2 phases Localized in the nucleus. (Lo et al., 2010; Lo et al., 2012). These lines of Function evidence suggest that FOXF1 is an epigenetically The biological roles of forkhead box protein F1 silenced tumor suppressor gene in breast cancer, were mostly studied in murine genetic models and which is essential for maintaining genomic stability are linked to regulate embryogenesis and by regulating the stringency of DNA replication. organogenesis (Mahlapuu et al., 2001a; Costa et al., Homology 2001; Kalinichenko et al., 2001; Mahlapuu et al., - Pan troglodytes (chimpanzee), FOXF1 2001b; Kalinichenko et al., 2002; Lim et al., 2002; (XP_523449.2, 535 aa), 99% identity; Ormestad et al., 2006; Astorga and Carlsson, 2007; - Canis lupus (dog), FOXF1 (XP_546792.2, 354 Yu et al., 2010). However, the functional roles of aa), 95% identity; the human FOXF1 protein are still largely - Bos taurus (cattle), FOXF1 (XP_603148.3, 382 unknown. Some of published studies indicate that aa), 96% identity; FOXF1 participates in regulation of the following - Mus musculus (mouse), Foxf1a (NP_034556.1, normal and abnormal cellular processes: 353 aa), 94% identity; The role of FOXF1 in an Epithelial-to- - Gallus gallus (chicken), FOXF1 (XP_414186.2, Mesenchymal Transition (EMT): FOXF1 has 368 aa), 91% identity; been found to be a direct repressed target of nuclear

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 467

FOXF1 (forkhead box F1) Lo PK

- Danio rerio (zebrafish), Foxf1 (NP_001073655.1, functional studies of FOXF1 in fibroblasts (Saito et 380 aa), 81% identity. al., 2010), suggest that FOXF1 plays an oncogenic role in CAF-stimulated lung tumorigenesis. Mutations Prostate cancer Note Oncogenesis Four different heterozygous mutations (frameshift, FOXF1 expression is lost or downregulated in nonsense, and non-stop) have been identified in the prostate cancer compared with normal prostate FOXF1 gene in unrelated patients with sporadic tissue (Watson et al., 2004; van der Heul- ACD/MPV (alveolar capillary dysplasia with Nieuwenhuijsen et al., 2009). This suggests that misalignment of pulmonary veins) and MCA FOXF1 is a putative tumor suppressor gene in (multiple congenital anomalies) (Stankiewicz et al., prostate cancer. 2009). The point mutations identified in the FOXF1 Nevoid basal cell carcinoma gene are associated with bowel malrotation, annular pancreas, duodenal stenosis, congenital short syndrome bowel, small omphalocele and Meckel's Disease diverticulum (Stankiewicz et al., 2009). Patients with nevoid basal cell carcinoma syndrome (NBCCS) carry germline mutation in the tumor Implicated in suppressor gene Patched 1 (PTCH1) and are predisposed to develop basal cell carcinoma (BCC), Breast cancer medulloblastoma (MB) and rhabdomyosarcoma Oncogenesis (RMS). Loss or downregulation of FOXF1 expression is Oncogenesis found to be associated with FOXF1 promoter FOXF1 expression is found to be aberrantly hypermethylation in breast cancer cell lines and in upregulated in NBCCS-associated tumors breast invasive ductal carcinomas (Lo et al., 2010). compared with the respective non-neoplastic tissue According to analysis of 117 invasive ductal (Wendling et al., 2008). Overexpression of FOXF1 carcinoma (IDC) cases, FOXF1 promoter was is accompanied by increased levels of the hedgehog hypermethylated in 37,6% of examined IDC cases, target Gli1 as well as the putative FOXF1 targets which was associated with high tumor grade (Lo et Bmi1 and Notch2 in NBCCS-associated tumors al., 2010). The gain- and loss-of-function studies of (Wendling et al., 2008). These findings suggest a FOXF1 in breast cancer cells indicate that FOXF1 key role for FOXF1 in hedgehog-associated plays an imperative role in maintaining the tumorigenesis. stringency of DNA replication for sustaining genomic stability (Lo et al., 2010; Lo et al., 2012). Idiopathic interstitial pneumonias These clinical correlation and cellular functional Disease studies suggest that FOXF1 is a potential tumor The idiopathic interstitial pneumonias (IIP) suppressor gene which is epigenetically silenced in represent a set of diffuse parenchymal lung breast cancer. disorders and are sub-classified into usual Lung cancer interstitial pneumonitis (UIP), nonspecific interstitial pneumonitis (NSIP) and the fibrotic Oncogenesis variant of NSIP (NSIP-F). Immunohistochemical (IHC) staining of FOXF1 is Examination of surgical and autopsy specimens found to be positive in nuclei of lung cancer- from 13 patients with either UIP or NSIP-F has associated fibroblasts (CAFs) (Saito et al., 2010). revealed that all of UIP cases exhibited a pattern of The frequency of positivity of FOXF1 IHC staining strong SHH (a hedgehog ligand) expression with in CAFs is 110 (44,5%) out of 247 cases examined weak FOXF1 expression and NSIP-F cases (Saito et al., 2010). The IHC studies exhibited displayed a complementary expression of SHH and stronger FOXF1 staining in the stromal cells FOXF1 (Coon et al., 2006). These studies suggest adjacent to lung tumor cells compared with those that morphogenetic genes (e.g. FOXF1) may further apart from the tumor cells. FOXF1 participate differentially in the pathogenesis of UIP expression in CAFs is not significantly associated and NSIP-F. with any particular histologic subtypes of lung cancer and also does not correlate with survival in Alveolar capillary dysplasia with the overall population. However, lung cancer misalignment of pulmonary veins patients from the female population or from the Disease large cell lung cancer population show positive Alveolar capillary dysplasia with misalignment of correlation between FOXF1 expression in CAFs pulmonary veins (ACD/MPV) is a rare, neonatally and predicted poor prognosis (Saito et al., 2010). lethal developmental disorder of the lung with These IHC studies, in combination with in vitro defining histologic abnormalities typically

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 468

FOXF1 (forkhead box F1) Lo PK

associated with multiple congenital anomalies identifies underlying candidate tumor suppressor genes in (MCA). Infants with ACD/MPV develop prostate cancer. Oncogene. 2004 Apr 22;23(19):3487-94 respiratory distress and severe pulmonary Kim IM, Zhou Y, Ramakrishna S, Hughes DE, Solway J, hypertension within the first two days of life. Costa RH, Kalinichenko VV. Functional characterization of evolutionarily conserved DNA regions in forkhead box f1 ACD/MPV-affected infants mostly can not survive gene locus. J Biol Chem. 2005 Nov 11;280(45):37908-16 within the first month of life due to no sustained response to supportive measures and respiratory Coon DR, Roberts DJ, Loscertales M, Kradin R. Differential epithelial expression of SHH and FOXF1 in failure. More than 80% of infants with ACD/MPV usual and nonspecific interstitial pneumonia. Exp Mol have additional malformations occurring in the Pathol. 2006 Apr;80(2):119-23 cardiac, gastrointestinal, and genitourinary systems. Ormestad M, Astorga J, Landgren H, Wang T, Johansson Intestinal malrotation is the most commonly BR, Miura N, Carlsson P. Foxf1 and Foxf2 control murine observed of these anomalies, and hypoplastic left gut development by limiting mesenchymal Wnt signaling heart together with hypoplasia or coarctation of the and promoting extracellular matrix production. aortic arch are the most common associated Development. 2006 Mar;133(5):833-43 cardiovascular abnormalities. Of almost 200 Astorga J, Carlsson P. Hedgehog induction of murine reported ACD/MPV cases, approximately 10% vasculogenesis is mediated by Foxf1 and Bmp4. have a familial association. Four distinct Development. 2007 Oct;134(20):3753-61 heterozygous mutations (frameshift, nonsense, and Wendling DS, Lück C, von Schweinitz D, Kappler R. no-stop) were identified in the FOXF1 gene in Characteristic overexpression of the forkhead box transcription factor Foxf1 in Patched-associated tumors. Int unrelated 18 patients with sporadic ACD/MPV and J Mol Med. 2008 Dec;22(6):787-92 MCA (Stankiewicz et al., 2009), suggesting that an Madison BB, McKenna LB, Dolson D, Epstein DJ, impairment in the FOXF1 function might lead to Kaestner KH. FoxF1 and FoxL1 link hedgehog signaling these observed developmental disorders. and the control of epithelial proliferation in the developing stomach and intestine. J Biol Chem. 2009 Feb References 27;284(9):5936-44 Stankiewicz P, Sen P, Bhatt SS, Storer M, Xia Z, et al.. Hellqvist M, Mahlapuu M, Samuelsson L, Enerbäck S, Genomic and genic deletions of the FOX gene cluster on Carlsson P. Differential activation of lung-specific genes by 16q24.1 and inactivating mutations of FOXF1 cause two forkhead proteins, FREAC-1 and FREAC-2. J Biol alveolar capillary dysplasia and other malformations. Am J Chem. 1996 Feb 23;271(8):4482-90 Hum Genet. 2009 Jun;84(6):780-91 Mahlapuu M, Pelto-Huikko M, Aitola M, Enerbäck S, van der Heul-Nieuwenhuijsen L, Dits NF, Jenster G. Gene Carlsson P. FREAC-1 contains a cell-type-specific expression of forkhead transcription factors in the normal transcriptional activation domain and is expressed in and diseased human prostate. BJU Int. 2009 epithelial-mesenchymal interfaces. Dev Biol. 1998 Oct Jun;103(11):1574-80 15;202(2):183-95 Lo PK, Lee JS, Liang X, Han L, Mori T, Fackler MJ, Sadik Costa RH, Kalinichenko VV, Lim L. Transcription factors in H, Argani P, Pandita TK, Sukumar S. Epigenetic mouse lung development and function. Am J Physiol Lung inactivation of the potential tumor suppressor gene FOXF1 Cell Mol Physiol. 2001 May;280(5):L823-38 in breast cancer. Cancer Res. 2010 Jul 15;70(14):6047-58 Kalinichenko VV, Lim L, Stolz DB, Shin B, et al.. Defects in Nilsson J, Helou K, Kovács A, Bendahl PO, Bjursell G, pulmonary vasculature and perinatal lung hemorrhage in Fernö M, Carlsson P, Kannius-Janson M. Nuclear Janus- mice heterozygous null for the Forkhead Box f1 activated kinase 2/nuclear factor 1-C2 suppresses transcription factor. Dev Biol. 2001 Jul 15;235(2):489-506 tumorigenesis and epithelial-to-mesenchymal transition by Mahlapuu M, Enerbäck S, Carlsson P. Haploinsufficiency repressing Forkhead box F1. Cancer Res. 2010 Mar of the forkhead gene Foxf1, a target for sonic hedgehog 1;70(5):2020-9 signaling, causes lung and foregut malformations. Saito RA, Micke P, Paulsson J, Augsten M, Peña C, Development. 2001a Jun;128(12):2397-406 Jönsson P, Botling J, Edlund K, Johansson L, Carlsson P, Mahlapuu M, Ormestad M, Enerbäck S, Carlsson P. The Jirström K, Miyazono K, Ostman A. Forkhead box F1 forkhead transcription factor Foxf1 is required for regulates tumor-promoting properties of cancer-associated differentiation of extra-embryonic and lateral plate fibroblasts in lung cancer. Cancer Res. 2010 Apr mesoderm. Development. 2001b Jan;128(2):155-66 1;70(7):2644-54 Kalinichenko VV, Zhou Y, Bhattacharyya D, Kim W, Shin Yu S, Shao L, Kilbride H, Zwick DL. Haploinsufficiencies of B, Bambal K, Costa RH. Haploinsufficiency of the mouse FOXF1 and FOXC2 genes associated with lethal alveolar Forkhead Box f1 gene causes defects in gall bladder capillary dysplasia and congenital heart disease. Am J development. J Biol Chem. 2002 Apr 5;277(14):12369-74 Med Genet A. 2010 May;152A(5):1257-62 Lim L, Kalinichenko VV, Whitsett JA, Costa RH. Fusion of Lo PK, Lee JS, Sukumar S. The p53-p21WAF1 checkpoint lung lobes and vessels in mouse embryos heterozygous pathway plays a protective role in preventing DNA for the forkhead box f1 targeted allele. Am J Physiol Lung rereplication induced by abrogation of FOXF1 function. Cell Mol Physiol. 2002 May;282(5):L1012-22 Cell Signal. 2012 Jan;24(1):316-24

Watson JE, Doggett NA, Albertson DG, et al.. Integration This article should be referenced as such: of high-resolution array comparative genomic hybridization analysis of chromosome 16q with expression array data Lo PK. FOXF1 (forkhead box F1). Atlas Genet Cytogenet refines common regions of loss at 16q23-qter and Oncol Haematol. 2012; 16(7):466-469.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 469

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Gene Section Review

FXYD3 (FXYD domain containing ion transport regulator 3) Hiroto Yamamoto, Shinji Asano Department of Molecular Physiology, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga 525-8577, Japan (HY, SA)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/FXYD3ID43704ch19q13.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI FXYD3ID43704ch19q13.txt

FXYD3 has two splicing variants (FXYD3a and Identity FXYD3b). FXYD3a and 3b are short and long Other names: MAT8, PLML isoforms of FXYD3, respectively. HGNC (Hugo): FXYD3 Description Location: 19q13.12 DNA contains 8494 bp composed of 9 (FXYD3a) Local order: Centromere, SCN1B, HPN, FXYD3, or 8 (FXYD3b) exons. LGI4, FXYD1, FXYD7, FXYD5, Telomere. Transcription Note The FXYD3a mRNA has an in-frame deletion of 78 FXYD3 is a member of the FXYD family proteins, nucleotides in the coding sequence compared to the which regulate Na+,K+-ATPase activity to FXYD3b mRNA. precisely adjust the physiological ion balance of the FXYD3a mRNA is a major transcript product tissue. expressed in normal tissues as well as in breast, colon, stomach and pancreas cancer cells. DNA/RNA Transcription of FXYD3 mRNA was down- regulated by TGF-b signaling in human mammary Note epithelial cells (Yamamoto et al., 2011). Morrison and Leder (1994) originally found that FXYD3 mRNA was overexpressed in murine breast Pseudogene cancer induced by neu or ras oncogenes, but not by No pseudogenes reported. c-myc or int-2.

Red boxes represent shared exons between FXYD3a and FXYD3b, and a white box represents an exon specific for FXYD3b

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 470

FXYD3 (FXYD domain containing ion transport regulator 3) Yamamoto H, Asano S

Amino acid alignments of human FXYD3a and 3b proteins. An underline represents the FXYD (Phe-Xaa-Tyr-Asp) motif. A box represents the transmembrane segment. FXYD3b protein has 26 more amino acids in the cytoplasmic domain compared to FXYD3a protein. . the pump activity of Na+,K+-ATPase was Protein maintained (Bibert et al., 2011). FXYD3 is Description responsible for cancer cell proliferation. Suppression of FXYD3 expression caused a FXYD3 is a member of the "FXYD" family significant decrease in cellular proliferation of proteins, which consist of seven members of small breast, prostate and pancreatic cancer cell lines. proteins and share a signature sequence of four In colon cancer cell line Caco-2, silencing of amino acids "FXYD" located in the ectodomain FXYD3 mRNA with shRNA specific for FXYD3 close to the transmembrane segment. increased the apoptosis rate and inhibited the Human FXYD3 protein contains a hydrophobic differentiation to enterocyte-like phenotype (Bibert domain at the N terminus encoding a cleavable et al., 2009). signal peptide, and adopts a type I topology. On the other hand, mouse FXYD3 may have two Homology transmembrane domains because of the lack of FXYD family proteins have invariant amino acids cleavable signal peptide. in a signature sequence of FXYD motif and two Expression conserved glycines and a serine residue (Sweadner and Rael, 2000). Mammary gland, lung, stomach, pancreas and In mammals, this family contains seven members intestine. including FXYD1 (phospholemman), FXYD2 (the Localisation gamma-subunit of Na+,K+-ATPase), FXYD3 (Mat- Plasma membrane and intracellular membrane 8), FXYD4 (corticosteroid hormone-induced compartment. factor), FXYD5 (dysadherin), FXYD6 (phosphohippolin) and FXYD7. FXYD family Function proteins are expressed in specific tissues to regulate FXYD family proteins perform fine tuning of ion Na+,K+-ATPase activity, and precisely adjust the transport by associating with and modulating the physiological ion balance of the tissues. pump activity of Na+,K+-ATPase molecules and modifying the activity of ion channels (Geering, Mutations 2006). FXYD3a slightly decreased the apparent affinity Somatic both for intracellular Na+ (up to 40%) and Okudela et al. (2009) showed that somatic mutation extracellular K+ (15 to 40%) of Na+,K+-ATPase (D19H) occurred only in a lung cancer cell line, whereas FXYD3b slightly increased the apparent H2087. affinity for intracellular Na+ (about 15%) and This mutation is very rare in lung cancer cell lines decreased the apparent affinity for extracellular K+ and primary lung cancers. (up to 50%). Exogenous expression of wild-type FXYD3, but Both FXYD3 isoforms induced a not the mutant (FXYD3/D19H), enhanced the hyperpolarization-activated chloride current in cortical actin density in a lung cancer cell line, Xenopus oocytes (Bibert et al., 2006). Two cysteine H1299. residues at cytoplasmic domain of FXYD3 were FXYD3/D19H distorted the outline of nuclear glutathionylated by oxidative stress. envelope in H1299 cells, suggesting that loss of As a result, glutathionylation of Na+,K+-ATPase FXYD3 function attenuates the integrity of the beta1 subunit by oxidative stress was prevented and nuclear envelope and the cytoskeleton.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 471

FXYD3 (FXYD domain containing ion transport regulator 3) Yamamoto H, Asano S

Implicated in Prognosis Martin-Aguilera et al. (2008) reported that a Breast cancer combination of FXYD3 and KRT20 (a member of the keratin family) genes yielded a 100% sensitivity Note and specificity differentiating lymph nodes with Down-regulation of FXYD3 mRNA via siRNA for bladder UC dissemination from controls. However, FXYD3 decreased the proliferation of MCF-7 there was no significantly worse survival of patients breast cancer cells. presenting qRT-PCR positive compared to negative Disease lymph nodes after a median follow-up of 35 Yamamoto et al. (2009) reported that FXYD3 months. protein was overexpressed in human breast cancer Lung cancer specimens; invasive ductal carcinomas and intra- ductal carcinomas compared with surrounding Disease normal mammary glands. On the other hand, Okudela et al. (2009) reported that FXYD3 mRNA FXYD3 expression was low in benign lesion and protein levels were down-regulated in some specimens; mastopathy, fibroadenoma and lung cancer cell lines. Epigenetic modifications phyllodes tumors. Distribution pattern of FXYD3 such as DNA methylation and histone acethylation expression was divided into two groups. In one seem to affect FXYD3 expression. In normal lung group, expression was observed mainly in the epithelial cells, FXYD3 protein was extensively cytoplasm. In the other group, expression was expressed on the basolateral membrane of bronchial observed both in the cytoplasm and at the cell epithelial cells, and in cytoplasm where it was surface. concentrated at the perinuclear site of alveolar epithelial cells. In lung cancer, particularly in Pancreas cancer poorly differentiated cancers, FXYD3 expression Note was low or faint. Down-regulation of FXYD3 was Down-regulation of FXYD3 mRNA by stable more prominent in large cell carcinomas and small antisense transfection decreased the proliferation of cell carcinomas than in adenocarcinomas. FXYD3 T3M4 pancreatic cancer cells. expression was decreased significantly as the Disease histological grade of squamous cell carcinoma Kayed et al. (2006) reported that FXYD3 was progressed from well to poorly differentiated. overexpressed in pancreatic cancer, and contributed Prostate cancer to its proliferative activity and malignancy. There Note was no significant difference in FXYD3 mRNA Grzmil et al. (2004) reported that FXYD3 (MAT-8) expression levels between chronic pancreatitis and plays an important role in cellular growth of normal pancreatic tissues whereas FXYD3 mRNA prostate carcinomas. In prostate tumors (6 out of levels were 3.9-fold increased in pancreatic ductal 11), FXYD3 mRNA expression was increased (> 2 adenocarcinoma cells compared to normal ductal times) up to 35-fold compared to normal tissues. cells. FXYD3 protein expression was almost absent FXYD3 mRNA was also expressed in prostate in normal pancreatic tissues. In contrast, chronic cancer cell lines, PC3, DU-145 and LNCaP. pancreatitis and pancreatic ductal adenocarcinoma Silencing of FXYD3 mRNA via siRNA specific for tissues showed up-regulation of FXYD3 protein FXYD3 led to significant decrease in proliferation which was expressed in cytoplasm and plasma of PC3 and LNCaP. membrane. Pancreas cancer cells that had metastasized to the liver and regional lymph nodes Colon cancer also exhibited strong expression of FXYD3 protein. Disease Urothelial carcinoma Kayed et al. (2006) showed that FXYD3 mRNA Disease expression was decreased in colon cancers (n=40) compared to normal colon tissues (n=27). Widegren Zhang et al. (2011) reported FXYD3 mRNA as a et al. (2009) reported that FXYD3 seems to be promising prognosis marker of renal and bladder involved in the development of the relatively earlier urothelial carcinoma (UC). Microarray gene stages of colorectal cancers. FXYD3 protein expression data showed that FXYD3 mRNA was expression was significantly higher in primary increased in UC whereas it was not observed in tumor compared to adjacent normal mucosa in the normal kidney tissues and other type of tumors matched cases, while there was no significant including papillary, oncocytoma, chromophobe, difference in the expression between primary tumor and clear cell renal carcinoma. FXYD3 protein was and metastasis in the lymph nodes. FXYD3 protein expressed in about 90% of UC from renal pelvis, expression was positively related to the expression and 63% of UC from bladder, however, it was not of Ras, P53, Legumain and proliferative cell expressed in normal kidney and bladder stromal nuclear antigen. Although FXYD3 expression in tissues.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 472

FXYD3 (FXYD domain containing ion transport regulator 3) Yamamoto H, Asano S

Dukes stage A-C tumors was higher than that in Grzmil M, Voigt S, Thelen P, Hemmerlein B, Helmke K, stage D tumors, there was no relationship between Burfeind P. Up-regulated expression of the MAT-8 gene in prostate cancer and its siRNA-mediated inhibition of FXYD3 expression and survival in the whole group expression induces a decrease in proliferation of human of the patients. prostate carcinoma cells. Int J Oncol. 2004 Jan;24(1):97- Prognosis 105 Loftas et al. (2009) reported that in rectal cancers, Crambert G, Li C, Claeys D, Geering K. FXYD3 (Mat-8), a FXYD3 expression was a prognosis factor new regulator of Na,K-ATPase. Mol Biol Cell. 2005 May;16(5):2363-71 independent of tumor stage and differentiation in patients receiving preoperative radiotherapy: strong Bibert S, Roy S, Schaer D, Felley-Bosco E, Geering K. Structural and functional properties of two human FXYD3 expression was associated with an unfavorable (Mat-8) isoforms. J Biol Chem. 2006 Dec prognosis. In the primary tumors, FXYD3 22;281(51):39142-51 expression was increased compared with normal Geering K. FXYD proteins: new regulators of Na-K- mucosa. There were less tumor necrosis and a ATPase. Am J Physiol Renal Physiol. 2006 higher rate of developing distant metastasis after Feb;290(2):F241-50 radiotherapy in tumors with high FXYD3 Kayed H, Kleeff J, Kolb A, Ketterer K, Keleg S, Felix K, expression. Giese T, Penzel R, Zentgraf H, Büchler MW, Korc M, Friess H. FXYD3 is overexpressed in pancreatic ductal Gastric cancer adenocarcinoma and influences pancreatic cancer cell Disease growth. Int J Cancer. 2006 Jan 1;118(1):43-54 Zhu et al. (2010) reported that up-regulation of Marín-Aguilera M, Mengual L, Burset M, Oliver A, Ars E, FXYD3 protein expression seems to be involved in Ribal MJ, Colomer D, Mellado B, Villavicencio H, Algaba F, tumorigenesis and invasion of gastric Alcaraz A. Molecular lymph node staging in bladder urothelial carcinoma: impact on survival. Eur Urol. 2008 adenocarcinoma. FXYD3 protein was present in the Dec;54(6):1363-72 cytoplasm of normal gastric epithelial cells as well as gastric cancer cells. The rate of FXYD3 strong Bibert S, Aebischer D, Desgranges F, Roy S, Schaer D, Kharoubi-Hess S, Horisberger JD, Geering K. A link expression was significantly higher in cancer (51% between FXYD3 (Mat-8)-mediated Na,K-ATPase of 51) than in normal mucosa (10% of 29). FXYD3 regulation and differentiation of Caco-2 intestinal epithelial was expressed strongly in ulcerative/infiltrating cells. Mol Biol Cell. 2009 Feb;20(4):1132-40 types of cancers compared to polypoid/fungating Loftås P, Onnesjö S, Widegren E, Adell G, Kayed H, Kleeff ones. However, FXYD3 expression was not J, Zentgraf H, Sun XF. Expression of FXYD-3 is an correlated with patient's gender, age, tumor size, independent prognostic factor in rectal cancer patients with preoperative radiotherapy. Int J Radiat Oncol Biol Phys. lymph node status and histological grade. 2009 Sep 1;75(1):137-42 Glioma Okudela K, Yazawa T, Ishii J, Woo T, Mitsui H, Bunai T, Disease Sakaeda M, Shimoyamada H, Sato H, Tajiri M, Ogawa N, Masuda M, Sugimura H, Kitamura H. Down-regulation of Wang et al. (2009) reported that FXYD3 expression FXYD3 expression in human lung cancers: its mechanism seems to be involved in glioma development. The and potential role in carcinogenesis. Am J Pathol. 2009 frequency of strong FXYD3 expression was higher Dec;175(6):2646-56 in the primary tumors compared to normal brain Wang MW, Gu P, Zhang ZY, Zhu ZL, Geng Y, Kayed H, tissues. FXYD3 expression was significantly more Zentgraf H, Sun XF. FXYD3 expression in gliomas and its increased in females than males, and in multiple clinicopathological significance. Oncol Res. site gliomas than single sites. There was no 2009;18(4):133-9 difference of FXYD3 expression regarding age, Widegren E, Onnesjö S, Arbman G, Kayed H, Zentgraf H, tumor location, size, histological type, and tumor Kleeff J, Zhang H, Sun XF. Expression of FXYD3 protein in relation to biological and clinicopathological variables in grade. colorectal cancers. Chemotherapy. 2009;55(6):407-13 Yamamoto H, Okumura K, Toshima S, Mukaisho K, References Sugihara H, Hattori T, Kato M, Asano S. FXYD3 protein Morrison BW, Leder P. neu and ras initiate murine involved in tumor cell proliferation is overproduced in mammary tumors that share genetic markers generally human breast cancer tissues. Biol Pharm Bull. 2009 absent in c-myc and int-2-initiated tumors. Oncogene. Jul;32(7):1148-54 1994 Dec;9(12):3417-26 Zhu ZL, Zhao ZR, Zhang Y, Yang YH, Wang ZM, Cui DS, Morrison BW, Moorman JR, Kowdley GC, Kobayashi YM, Wang MW, Kleeff J, Kayed H, Yan BY, Sun XF. Jones LR, Leder P. Mat-8, a novel phospholemman-like Expression and significance of FXYD-3 protein in gastric protein expressed in human breast tumors, induces a adenocarcinoma. Dis Markers. 2010;28(2):63-9 chloride conductance in Xenopus oocytes. J Biol Chem. Bibert S, Liu CC, Figtree GA, Garcia A, Hamilton EJ, 1995 Feb 3;270(5):2176-82 Marassi FM, Sweadner KJ, Cornelius F, Geering K, Sweadner KJ, Rael E. The FXYD gene family of small ion Rasmussen HH. FXYD proteins reverse inhibition of the transport regulators or channels: cDNA sequence, protein Na+-K+ pump mediated by glutathionylation of its beta1 signature sequence, and expression. Genomics. 2000 Aug subunit. J Biol Chem. 2011 May 27;286(21):18562-72 15;68(1):41-56 Yamamoto H, Mukaisho K, Sugihara H, Hattori T, Asano S. Down-regulation of FXYD3 is induced by transforming

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 473

FXYD3 (FXYD domain containing ion transport regulator 3) Yamamoto H, Asano S

growth factor-β signaling via ZEB1/δEF1 in human This article should be referenced as such: mammary epithelial cells. Biol Pharm Bull. 2011 Mar;34(3):324-9 Yamamoto H, Asano S. FXYD3 (FXYD domain containing ion transport regulator 3). Atlas Genet Cytogenet Oncol Zhang Z, Pang ST, Kasper KA, Luan C, Wondergem B, Lin Haematol. 2012; 16(7):470-474. F, Chuang CK, Teh BT, Yang XJ. FXYD3: A Promising Biomarker for Urothelial Carcinoma. Biomark Insights. 2011 Feb 15;6:17-26

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 474

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Gene Section Review

MCAM (melanoma cell adhesion molecule) Guang-Jer Wu Department of Microbiology and Immunology, Emory University School of Medicine, 1510, Clifton Rd NE, Atlanta, GA 30322, USA; Department of Bioscience Technology, Chung Yuan Christian University, 200 Chung Pei Rd, 32023 Taiwan, Republic of China (GJW)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/MCAMID41314ch11q23.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MCAMID41314ch11q23.txt

level than the major Identity form in various cancer cell lines (Wu, unpublished Other names: CD146, METCAM, MUC18, observation). Interestingly, a truncated form with a Gicerin deletion in some portion of the cytoplasmic domain HGNC (Hugo): MCAM has been found in a prostate cancer specimen X9479, a cell line derived from specimens of Location: 11q23.3 nasopharyngeal carcinomas and other cancers (Wu, unpublished observations). DNA/RNA Further systematic search for the function of this Description minor form should be carried out. Human METCAM (huMETCAM), a CAM in the Pseudogene immunoglobulin-like gene superfamily, is an METCAM/MUC18 may not have a pseudogene. integral membrane glycoprotein. Alternative names for METCAM are MUC18 (Lehmann et al., 1987), Protein CD146 (Anfosso et al., 2001), MCAM (Xie et al., 1997), MelCAM (Shih et al., 1994a), A32 (Shih et Note al., 1994b), and S-endo 1 (Bardin et al., 1996). Human METCAM/MUC18 cDNA encodes 646 To avoid confusion with mucins and to reflect its amino acids, about 115-150 kDa protein. biological functions, we have renamed MUC18 as Description METCAM (metastasis CAM), which means an The huMETCAM has 646 amino acids that include immunoglobulin-like CAM that affects or regulates a N-terminal extra-cellular domain of 558 amino metastasis, (Wu, 2005). METCAM/MUC18 gene is acids, which has 28 amino acids characteristics of a located on human chromosome 11q23.3. signal peptide sequence at its N-terminus, a Transcription transmembrane domain of 24 amino acids (amino The major transcript of the gene in most human acids 559-583), and a cytoplasmic domain of 64 epithelial cancer cell lines is about 3,3 kb (Wu et amino acids at the C-terminus. HuMETCAM has al., 2001a). eight putative N-glycosylation sites (Asn-X- A distinct short form resulting from alternative Ser/Thr), of which six are conserved, and are splicing of the gene of gicerin, the chicken homolog heavily glycosylated and sialylated resulting in an of METCAM, has been found (Taira et al., 1995). apparent molecular weight of 113000-150000.The Though the expression of a short form of extra-cellular domain of the protein comprises five METCAM has been briefly mentioned in human immunoglobulin-like domains (V-V-C2-C2-C2) melanoma cells (Lehmann et al., 1987), its function (Lehmann et al., 1987; Wu et al., 2001a; Wu, 2005) is not known since it is expressed at a much lower and an X domain (Wu et al., 2001a; Wu, 2005).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 475

MCAM (melanoma cell adhesion molecule) Wu GJ

HuMETCAM protein structure. SP stands for signal peptide sequence, V1, V2, C2, C2', C2'' for five Ig-like domains (each held by a disulfide bond) and X for one domain (without any disulfide bond) in the extracellular region, and TM for transmembrane domain. P stands for five potential phosphorylation sites (one for PKA, three for PKC, and one for CK2) in the cytoplasmic tail. The six conserved N-glycosylation sites are shown as wiggled lines in the extracellular domains of V1, between C2' and C2'', C2'', and X. The cytoplasmic tail contains peptide sequences Function that will potentially be phosphorylated by protein kinase A (PKA), protein kinase C (PKC), and Similar to other cell adhesion molecules (CAMs), casein kinase 2 (CK 2) (Lehmann et al., 1987; Wu METCAM/MUC18 does not merely act as a et al., 2001a; Wu, 2005). My lab has also cloned molecular glue to hold together homotypic cells in a and sequenced the mouse METCAM specific tissue or to facilitate interactions of (moMETCAM) cDNA, which contains 648 amino heterotypic cells; It also actively governs the social acids with a 76,2% identity with huMETCAM, behaviors of cells by affecting the adhesion status suggesting that moMETCAM is likely to have of cells and modulating cell signaling (Cavallaro biochemical properties and biological functions and Christofori, 2004). similar to the human counter part (Yang et al., It controls cell motility and invasiveness by 2001; Wu, 2005). mediating the remodeling of cytoskeleton The structure of the huMETCAM protein is (Cavallaro and Christofori, 2004). depicted in figure above, suggesting that It also actively mediates the cell-to-cell and cell-to- METCAM, similar to most CAMs, plays an active extracellular matrix interactions to allow cells to role in mediating cell-cell and cell-extracellular constantly respond to physiological fluctuations and interactions, crosstalk with many intracellular to alter/remodel the surrounding microenvironment signaling pathways, and modulating the social for survival (Chambers et al., 2002). behaviors of cells (Cavallaro and Christofori, 2004; It does so by crosstalk with cellular surface growth Wu, 2005). Recent work supports an emerging factor receptors, which interact with growth factors novel function of METCAM in tumor angiogenesis that may be secreted from stromal cells or released and perhaps it plays an important role in the from circulation and embedded in the extracellular metastasis of tumor cells (Wu, 2010; Wu, 2012). matrix (Chambers et al., 2002; Cavallaro and Christofori, 2004). Expression Thus an altered expression of METCAM/MUC18 HuMETCAM is expressed in a limited number of affects the motility and invasiveness of many normal tissues, such as hair follicular cells, smooth epithelial tumor cells in vitro and metastasis in vivo muscle cells, endothelial cells, cerebellum, normal (Chambers et al., 2002; Cavallaro and Christofori, mammary epithelial cells, basal cells of the lung, 2004; Wu, 2005). METCAM/MUC18 may also activated T cells, intermediate trophoblast (Shih, play an important role in the favorable soil that 1999), and normal nasopharyngeal epithelial cells provides a proper microenvironment at a suitable (Lin et al., 2012). period to awaken the dormant metastatic tumor Localisation cells to enter into an aggressive growth phase. Evidence have been documented that aberrant HuMETCAM is a cytoplasmic membrane protein. expression of huMETCAM/MUC18 actually affects Most of the protein is located on the cell membrane the motility and invasiveness of many tumor cells in normal tissues. However, increasing presence of in vitro and metastasis in vivo. the protein in the cytoplasm appears to be related to Thus HuMETCAM/MUC18 plays an important the higher pathological grades and malignant role in promoting the malignant progression of cancers of prostate and breast, and melanoma and many cancer types (Cavallaro and Christofori, nasopharyngeal carcinoma (Wu et al., 2001b). 2004; Wu, 2005).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 476

MCAM (melanoma cell adhesion molecule) Wu GJ

Homology Oncogenesis Human METCAM/MUC18 protein shares high METCAM/MUC18 promotes the oncogenesis of homology with the mouse METCAM/MUC18 (Wu human prostate cancer cells (Wu et al., 2001a; Wu et al., 2001a; Yang et al., 2001) and other Ig-like et al., 2001b; Wu, 2004; Wu et al., 2004; Wu et al., CAMs, especially the NCAMs (Lehmann et al., 2011). 1987). Melanoma Note Mutations Over-expression of huMETCAM has been shown Note to promote metastasis, but not the tumorigenesis, of Several point mutations have been found in human melanoma (Xie et al., 1997; Schlagbauer- huMETCAM/MUC18 protein from human cancers Wadl et al., 1999) and mouse melanoma cells (Wu et al., 2001a). (Yang et al., 2001; Wu et al., 2008) in immunodeficent nude mice. Implicated in Prognosis Over-expression of huMETCAM/MUC18 has been Various cancers implicated in a poor prognosis of melanoma Note (Lehmann et al., 1987; Shih, 1999). The protein is overly expressed in most (67%) Oncogenesis malignant melanoma cells (Lehmann et al., 1987), METCAM does not appear to promote the and in most (more than 80%) pre-malignant oncogenesis of human and most melanoma cells prostate epithelial cells (PIN), high-grade prostatic (Wu et al., 2008). carcinoma cells, and metastatic lesions (Wu et al., 2001b; Wu, 2004). HuMETCAM is also expressed References in other cancers, such as gestational trophoblastic tumors, leiomyosarcoma, angiosarcoma, Lehmann JM, Riethmüller G, Johnson JP. MUC18, a marker of tumor progression in human melanoma, shows haemangioma, Kaposi's sarcoma, schwannoma, sequence similarity to the neural cell adhesion molecules some lung squamous and small cell carcinomas, of the immunoglobulin superfamily. Proc Natl Acad Sci U S some breast cancer, some neuroblastoma (Shih, A. 1989 Dec;86(24):9891-5 1999), and also nasopharyngeal carcinoma (Lin et Shih IM, Elder DE, Hsu MY, Herlyn M. Regulation of Mel- al., 2012) and ovarian cancer (Wu et al., 2012). CAM/MUC18 expression on melanocytes of different stages of tumor progression by normal keratinocytes. Am J Breast cancer Pathol. 1994a Oct;145(4):837-45 Note Shih IM, Elder DE, Speicher D, Johnson JP, Herlyn M. Over-expression of huMETCAM has been shown Isolation and functional characterization of the A32 to promote tumorigenesis of four breast cancer cell melanoma-associated antigen. Cancer Res. 1994b May lines in athymic nude mice and perhaps the 1;54(9):2514-20 malignant progression of breast cancer cells (Zeng Taira E, Nagino T, Taniura H, Takaha N, Kim CH, Kuo CH, et al., 2011; Zeng et al., 2012). Li BS, Higuchi H, Miki N. Expression and functional analysis of a novel isoform of gicerin, an immunoglobulin Prognosis superfamily cell adhesion molecule. J Biol Chem. 1995 Over-expression of huMETCAM/MUC18 has been Dec 1;270(48):28681-7 implicated in a poor prognosis of breast cancer. Bardin N, George F, Mutin M, Brisson C, Horschowski N, Francés V, Lesaule G, Sampol J. S-Endo 1, a pan- Prostate cancer endothelial monoclonal antibody recognizing a novel Note human endothelial antigen. Tissue Antigens. 1996 Nov;48(5):531-9 Over-expression of huMETCAM has been shown to promote tumorigenesis and metastasis of human Xie S, Luca M, Huang S, Gutman M, Reich R, Johnson JP, Bar-Eli M. Expression of MCAM/MUC18 by human prostate cancer LNCaP cells in athymic nude mice melanoma cells leads to increased tumor growth and (Wu et al., 2001a; Wu et al., 2001b; Wu, 2004; Wu metastasis. Cancer Res. 1997 Jun 1;57(11):2295-303 et al., 2004; Wu et al., 2011). Schlagbauer-Wadl H, Jansen B, Müller M, Polterauer P, Disease Wolff K, Eichler HG, Pehamberger H, Konak E, Johnson Human prostate cancer (Wu et al., 2001a; Wu et al., JP. Influence of MUC18/MCAM/CD146 expression on human melanoma growth and metastasis in SCID mice. Int 2001b; Wu, 2004; Wu et al., 2004; Wu et al., 2011) J Cancer. 1999 Jun 11;81(6):951-5 and the TRAMP models (Wu et al., 2005). Shih IM. The role of CD146 (Mel-CAM) in biology and Prognosis pathology. J Pathol. 1999 Sep;189(1):4-11 Over-expression of huMETCAM/MUC18 has been Anfosso F, Bardin N, Vivier E, Sabatier F, Sampol J, implicated in a poor prognosis of prostate cancer Dignat-George F. Outside-in signaling pathway linked to (Wu et al., 2001a; Wu et al., 2001b, Wu, 2004). CD146 engagement in human endothelial cells. J Biol Chem. 2001 Jan 12;276(2):1564-9

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 477

MCAM (melanoma cell adhesion molecule) Wu GJ

Wu GJ, Wu MW, Wang SW, Liu Z, Qu P, Peng Q, Yang H, Wu GJ, Fu P, Wang SW, Wu MW.. Enforced expression of Varma VA, Sun QC, Petros JA, Lim SD, Amin MB. MCAM/MUC18 increases in vitro motility and invasiveness Isolation and characterization of the major form of human and in vivo metastasis of two mouse melanoma K1735 MUC18 cDNA gene and correlation of MUC18 over- sublines in a syngeneic mouse model. Mol Cancer Res. expression in prostate cancer cell lines and tissues with 2008 Nov;6(11):1666-77. malignant progression. Gene. 2001a Nov 14;279(1):17-31 Wu GJ.. METCAM/MUC18, a cell adhesion molecule, Wu GJ, Varma VA, Wu MW, Wang SW, Qu P, Yang H, plays positive or negative roles in the progression of Petros JA, Lim SD, Amin MB. Expression of a human cell different cancers. Current topics in Genetics 2010; 4:79- adhesion molecule, MUC18, in prostate cancer cell lines 93. (REVIEW) and tissues. Prostate. 2001b Sep 15;48(4):305-15 Wu GJ, Wu MW, Wang C, Liu Y.. Enforced expression of Yang H, Wang S, Liu Z, Wu MH, McAlpine B, Ansel J, METCAM/MUC18 increases tumorigenesis of human Armstrong C, Wu G. Isolation and characterization of prostate cancer LNCaP cells in nude mice. J Urol. 2011 mouse MUC18 cDNA gene, and correlation of MUC18 Apr;185(4):1504-12. Epub 2011 Feb 19. expression in mouse melanoma cell lines with metastatic ability. Gene. 2001 Mar 7;265(1-2):133-45 Zeng GF, Cai SX, Wu GJ.. Up-regulation of METCAM/MUC18 promotes motility, invasion, and Chambers AF, Groom AC, MacDonald IC. Dissemination tumorigenesis of human breast cancer cells. BMC Cancer. and growth of cancer cells in metastatic sites. Nat Rev 2011 Mar 30;11:113. Cancer. 2002 Aug;2(8):563-72 Lin JC, Chiang CF, Wang SW, Wang WY, Kwan PC, Wu Cavallaro U, Christofori G. Cell adhesion and signalling by GJ.. Decreased expression of METCAM/MUC18 correlates cadherins and Ig-CAMs in cancer. Nat Rev Cancer. 2004 with the appearance of, but its increased expression with Feb;4(2):118-32 metastasis of nasopharyngeal carcinoma. 2012, (submitted). Wu GJ.. The role of MUC18 in prostate carcinoma. Immunohistochemistry and in situ hybridization of human Wu GJ.. Dual roles of METCAM in the progression of carcinoma. Vol 1. Molecular pathology, lung carcinoma, different cancers. J Oncology 2012; in press. (REVIEW) breast carcinoma, and prostate carcinoma. Hayat, M.A. (Ed.), Elsevier Science/Academic Press. 2004; Chapter Wu GJ, Son ES, Dickerson EB, McDonald JF, Cohen C, 7:347-358. Sanjay L, Wu MWH.. METCAM/MUC18 over-expression in human ovarian cancer tissues and metastatic lesions is Wu GJ, Peng Q, Fu P, Wang SW, Chiang CF, Dillehay DL, associated with clinical progression. 2012, (submitted). Wu MW.. Ectopical expression of human MUC18 increases metastasis of human prostate cancer cells. Zeng G, Cai S, Liu Y, Wu GJ.. METCAM/MUC18 Gene. 2004 Mar 3;327(2):201-13. augments migration, invasion, and tumorigenicity of human breast cancer SK-BR-3 cells. Gene. 2012 Jan Wu GJ.. METCAM/MUC18 expression and cancer 15;492(1):229-38. Epub 2011 Oct 26. metastasis. Current Genomics. 2005; 6:333-349. (REVIEW) This article should be referenced as such: Wu GJ, Fu P, Chiang CF, Huss WJ, Greenberg NM, Wu Wu GJ. MCAM (melanoma cell adhesion molecule). Atlas MW.. Increased expression of MUC18 correlates with the Genet Cytogenet Oncol Haematol. 2012; 16(7):475-478. metastatic progression of mouse prostate adenocarcinoma in the TRAMP model. J Urol. 2005 May;173(5):1778-83.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 478

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Gene Section Review

MIR100 (microRNA 100) Katia Ramos Moreira Leite Laboratory of Medical Research, Urology Department, LIM55, University of Sao Paulo Medical School, Brazil (KRML)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR100ID51447ch11q24.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MIR100ID51447ch11q24.txt

microRNAs. It represents approximately 4,4% of Identity the human genome. There are hundreds of disorders Other names: hsa-mir-100, MIRN100, miR-100 currently attributed to the chromosome, including HGNC (Hugo): MIR100 cancer susceptibility loci. miR-100 is part of the family miR-99, that Location: 11q24.1 comprehends: Local order hsa-miR-100 - microRNA 125b-1 (AACCCGUAGAUCCGAACUUGUG) - BH3-like motif containing, cell death inducer hsa-miR-99a - microRNA let-7a-2 (AACCCGUAGAUCCGAUCUUGUG) - microRNA 100 hsa-miR-99b - Glutamate-ammonia ligase (glutamine synthetase) (CACCCGUAGAACCGACCUUGCG). pseudogene 3 Their predicted targets are: - Ubiquitin associated and SH3 domain containing SMARCD1, SMARCA5, mTOR, PPFIA3 (Sun et B al., 2011; Nagaraja et al., 2010), PLK1 (Petrelli et Note al., 2012; Peng et al., 2012; Feng et al., 2011; Ugras Human chromosome 11 (HSA11), is one of the et al., 2011; Li et al., 2011; Shi et al., 2010), most gene- and disease-rich chromosomes in CTDSPL (RBSP3) (Zeng et al., 2012), β-tubulin humans with a gene density of 11,6 genes per (Lobert et al., 2011), ATM (Ng et al., 2010), megabase, including 1524 protein-coding, and 69 PPP3CA (Sylvius et al., 2011), FGFR3 (Cato et al., 2009).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 479

MIR100 (microRNA 100) Leite KRM

DNA/RNA Implicated in Prostate cancer Disease miR-100 is down-regulated during the prostate cancer progression, from high grade prostate intraepithelial neoplasia through metastasis (Leite et

RNA - stem-loop. al., 2011a; Leite et al., 2011b). The same result was posteriorly confirmed by Sun D et al. (2011) that Description found miR-100 down-expressed in C4-2B, an DNA sequence: hsa-mir-100 MI0000102. advanced prostate cancer cell line in comparison CCUGUUGCCACAAACCCGUAGAUCCGAAC with LNCaP an androgen-dependent prostate cancer UUGUGGUAUUAGUCCGCACAAGCUUGUAU cell line. Porkka KP et al. have previously related CUAUAGGUAUGUGUCUGUUAGG. down-expression of miR-100 with hormone- Transcription refractory tumors (Porkka et al., 2007). Prognosis Mature sequence: 13 - aacccguagauccgaacuugug - 34. Contradictorily, lower levels of miR-100 was related to lower rates of biochemical recurrence in Protein patients with localized adenocarcinoma treated with radical prostatectomy in a mean follow up of 58,8 Note months (Leite et al., 2011c). microRNAs are not translated into amino acids. Hepatocellular carcinoma Mutations Disease miR-100 is involved with HCC carcinogenesis Note being down-regulated early, since the pre- Gene mutations have not been described. neoplastic lesions. A paralleled increase in polo like

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 480

MIR100 (microRNA 100) Leite KRM

kinase 1 (PLK1) suggests this gene as a target of Thyroid cancer this miR-100 (Petrelli et al., 2012). Prognosis Ovarian cancer miRNA profile was used to differentiate benign and Disease malignant thyroid tumors in specimens obtained by In a microarray study of 74 ovarian cancer tissue fine-needle aspiration biopsy. Diagnostic accuracy and cell lines miR-100 was shown to be down- of differentially expressed genes was determined by regulated in cancer specimens against normal tissue analyzing receiver operating characteristics (ROC). together with miR-199a, miR-140, miR-145, and miR-100 was overexpressed in malignant follicular miR-125b1 (Iorio et al., 2007). neoplasia and in Hurthle cell carcinomas (Vriens et al., 2011). Prognosis miR-100 is significantly down-expressed in Pancreatic cancer epithelial ovarian cancer and related to FIGO stage, Disease lymph node metastasis, higher CA125 serum levels miR-100 was shown to be over-expressed in and shorter overall survival (Peng et al., 2012). chronic pancreatitis when compared with normal Experimental studies with clear cell type ovarian pancreas and also over-expressed in pancreatic cancer, an aggressive variant of the tumor showed cancer versus pancreatitis (Bloomston et al., 2007). that over-expression of miR-100 enhanced sensitivity to the rapamycin analog RAD001 Breast cancer (everolimus), confirming the key relationship Note between mir-100 and the mTOR pathway (Nagaraja Drug resistance - Taxanes bind to β subunit of the et al., 2010). tubulin heterodimer and reduce microtubule Lung cancer dynamics leading to cell cycle arrest in G2/M. miR- 100 is involved in the regulation of the expression Note of β-tubulin class II and V, and a down-expression Drug resistance - miR-100 was shown to be down- of miR-100 is related to increase in the expression regulated in docetaxel-resistant SPC-A1/DTX cells of these isoforms of β-tubulin conferring MCF7 compared with parenteral SPC-A1 cells. breast cancer cell line resistance to paclitaxel The ectopic miR-100 re-sensitized tumor cells to (Lobert et al., 2011). docetaxel by suppression of cell proliferation, Disease G2/M arrest and induction to apoptosis. miR-100 has been described as down-regulated in Similar effect was identified knocking down PLK1, breast cancer, including male breast cancer (Fassan reinforcing this mRNA as a miR-100 target (Feng et al., 2011). et al., 2011). Leukemia Bladder cancer Disease Disease Down-regulation of miR-100 has been described in In acute myeloid leukemia (AML) miR-100 was urothelial carcinomas, having as a main target the found to promote cell proliferation of mRNA of FGFR3. FGFR3 mutation is promyelocytic blasts and arrest the differentiation characteristics of low-grade, non-invasive urothelial to granulocyte/monocyte lineages. RBSP3, a carcinoma, and another possible pathway for phosphatase-like tumor suppressor, important in bladder cancer development would be the loss of cell differentiation is a target of miR-100. miR-100 regulation of FGFR3 by down-expression of miR- regulates G1/S transition and blocks the terminal 100 (Dip et al., 2012 in press; Song et al., 2010; differentiation of cells targeting RBSP3 which in Catto et al., 2009). turn modulates pRB/E2F1 (Zeng et al., 2012). Prognosis Head and neck squamous cell Differently in acute lymphoblastic leukemia (ALL) carcinoma miR-100 is down-regulated when compared to Note normal samples. Drug resistance - Down-regulation of miR-100 Also the down-expression is related to higher count together with miR-130a and miR-197 was related to of white blood cells and hyperdiploid karyotypes. resistance of UMSCC-1 and SQ20B cell lines to Increase in miR-100 expression is related to cisplatin, 5-fluorouracil, paclitaxel, methotrexate, t(12;21), biological feature associated to better and doxorubicin (Dai et al., 2010). outcome (de Oliveira et al., 2012). On the other hand miR-100 over-expression has Glioma been related to vincristine and daunorubicin Note resistance (Schotte et al., 2011). Radio resistance - Higher expression of miR-100

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 481

MIR100 (microRNA 100) Leite KRM

confers radio-sensitivy to M059J and M059K Fassan M, Baffa R, Palazzo JP, Lloyd J, Crosariol M, Liu human malignant glioma cells, targeting ATM (Ng CG, Volinia S, Alder H, Rugge M, Croce CM, Rosenberg A. MicroRNA expression profiling of male breast cancer. et al., 2010). Breast Cancer Res. 2009;11(4):R58 Uterine cervix squamous carcinoma Dai Y, Xie CH, Neis JP, Fan CY, Vural E, Spring PM.. Disease MicroRNA expression profiles of head and neck squamous cell carcinoma with docetaxel-induced multidrug The miR-100 expression was shown to be resistance. Head Neck. 2010 Nov 29. [Epub ahead of print] significantly and gradually reduced from low-grade Nagaraja AK, Creighton CJ, Yu Z, Zhu H, Gunaratne PH, CIN, high-grade CIN to cervical cancer tissues. It Reid JG, Olokpa E, Itamochi H, Ueno NT, Hawkins SM, was also reduced in HPV positive cervical cancer Anderson ML, Matzuk MM.. A link between mir-100 and cell lines. miR-100 down-expression influenced cell FRAP1/mTOR in clear cell ovarian cancer. Mol Endocrinol. proliferation, cycle and apoptosis, and the probable 2010 Feb;24(2):447-63. Epub 2010 Jan 15. mechanism is the loss of control of PLK1 protein Ng WL, Yan D, Zhang X, Mo YY, Wang Y.. Over- (Li et al., 2011). expression of miR-100 is responsible for the low- expression of ATM in the human glioma cell line: M059J. Laminin A/C - related muscular DNA Repair (Amst). 2010 Nov 10;9(11):1170-5. dystrophy Shi W, Alajez NM, Bastianutto C, Hui AB, Mocanu JD, Ito E, Busson P, Lo KW, Ng R, Waldron J, O'Sullivan B, Liu Note FF.. Significance of Plk1 regulation by miR-100 in human Physiopathology - miR-100, toghether with miR- nasopharyngeal cancer. Int J Cancer. 2010 May 192, and miR-335 participate in muscle 1;126(9):2036-48. differentiation and proliferation and are probably Song T, Xia W, Shao N, Zhang X, Wang C, Wu Y, Dong J, involved in the development of the disease. miR- Cai W, Li H.. Differential miRNA expression profiles in 100 expression induces up-regulation of myogenin bladder urothelial carcinomas. Asian Pac J Cancer Prev. and α-actin and down-regulates Ki-67 a protein 2010;11(4):905-11. related to proliferation. Sylvius et al. (2011) show Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, that miR-100 is involved with muscle Zhang W, Bowcock AM.. Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis differentiation by targeting PPP3CA the calcineurin miRNAome. Hum Mol Genet. 2011 Oct 15;20(20):4025-40. gene. Calcineurin is a component of the calcium- Epub 2011 Aug 1. dependent signaling pathways and has been shown Leite KR, Sousa-Canavez JM, Reis ST, Tomiyama AH, to be involved in the regulation of skeletal muscle Camara-Lopes LH, Sanudo A, Antunes AA, Srougi M.. differentiation, hypertrophy, and fiber-type Change in expression of miR-let7c, miR-100, and miR-218 specification. from high grade localized prostate cancer to metastasis. Urol Oncol. 2011a May-Jun;29(3):265-9. Epub 2009 Apr Psoriasis 16. Note Leite KR, Tomiyama A, Reis ST, Sousa-Canavez JM, Physiopathology - mir-100 has been described as Sanudo A, Camara-Lopes LH, Srougi M.. MicroRNA down-regulated in psoriasis skin. It is probably expression profiles in the progression of prostate cancer- from high-grade prostate intraepithelial neoplasia to involved in the disease by repressing mTOR and metastasis. Urol Oncol. 2011b Aug 29. [Epub ahead of inhibiting angiogenesis. In this context, miR-100 print] has been called as a anti-angiomiR (Calin et al., Leite KR, Tomiyama A, Reis ST, Sousa-Canavez JM, 2011). Sanudo A, Dall'Oglio MF, Camara-Lopes LH, Srougi M.. MicroRNA-100 expression is independently related to References biochemical recurrence of prostate cancer. J Urol. 2011c Mar;185(3):1118-22. Epub 2011 Jan 21. Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder H, Li BH, Zhou JS, Ye F, Cheng XD, Zhou CY, Lu WG, Xie Hagan JP, Liu CG, Bhatt D, Taccioli C, Croce CM. X.. Reduced miR-100 expression in cervical cancer and MicroRNA expression patterns to differentiate pancreatic precursors and its carcinogenic effect through targeting adenocarcinoma from normal pancreas and chronic PLK1 protein. Eur J Cancer. 2011 Sep;47(14):2166-74. pancreatitis. JAMA. 2007 May 2;297(17):1901-8 Epub 2011 Jun 1. Iorio MV, Visone R, Di Leva G, Donati V, Petrocca F, Lobert S, Jefferson B, Morris K.. Regulation of beta-tubulin Casalini P, Taccioli C, Volinia S, Liu CG, Alder H, Calin isotypes by micro-RNA 100 in MCF7 breast cancer cells. GA, Ménard S, Croce CM. MicroRNA signatures in human Cytoskeleton (Hoboken). 2011 Jun;68(6):355-62. doi: ovarian cancer. Cancer Res. 2007 Sep 15;67(18):8699- 10.1002/cm.20517. Epub 2011 Jun 14. 707 Schotte D, De Menezes RX, Moqadam FA, Khankahdani Porkka KP, Pfeiffer MJ, Waltering KK, Vessella RL, LM, Lange-Turenhout E, Chen C, Pieters R, Den Boer Tammela TL, Visakorpi T. MicroRNA expression profiling ML.. MicroRNA characterize genetic diversity and drug in prostate cancer. Cancer Res. 2007 Jul 1;67(13):6130-5 resistance in pediatric acute lymphoblastic leukemia. Catto JW, Miah S, Owen HC, Bryant H, Myers K, Dudziec Haematologica. 2011 May;96(5):703-11. Epub 2011 Jan E, Larré S, Milo M, Rehman I, Rosario DJ, Di Martino E, 17. Knowles MA, Meuth M, Harris AL, Hamdy FC. Distinct Sun D, Lee YS, Malhotra A, Kim HK, Matecic M, Evans C, microRNA alterations characterize high- and low-grade Jensen RV, Moskaluk CA, Dutta A.. miR-99 family of bladder cancer. Cancer Res. 2009 Nov 1;69(21):8472-81 MicroRNAs suppresses the expression of prostate-specific

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 482

MIR100 (microRNA 100) Leite KRM

antigen and prostate cancer cell proliferation. Cancer Res. Feng B, Wang R, Chen LB.. MiR-100 resensitizes 2011 Feb 15;71(4):1313-24. Epub 2011 Jan 6. docetaxel-resistant human lung adenocarcinoma cells (SPC-A1) to docetaxel by targeting Plk1. Cancer Lett. Sylvius N, Bonne G, Straatman K, Reddy T, Gant TW, 2012 Apr 28;317(2):184-91. Epub 2011 Nov 25. Shackleton S.. MicroRNA expression profiling in patients with lamin A/C-associated muscular dystrophy. FASEB J. Peng DX, Luo M, Qiu LW, He YL, Wang XF.. Prognostic 2011 Nov;25(11):3966-78. Epub 2011 Aug 12. implications of microRNA-100 and its functional roles in human epithelial ovarian cancer. Oncol Rep. 2012 Ugras S, Brill E, Jacobsen A, Hafner M, Socci ND, Apr;27(4):1238-44. doi: 10.3892/or.2012.1625. Epub 2012 Decarolis PL, Khanin R, O'Connor R, Mihailovic A, Taylor Jan 11. BS, Sheridan R, Gimble JM, Viale A, Crago A, Antonescu CR, Sander C, Tuschl T, Singer S.. Small RNA sequencing Petrelli A, Perra A, Schernhuber K, Cargnelutti M, Salvi A, and functional characterization reveals MicroRNA-143 Migliore C, Ghiso E, Benetti A, Barlati S, Ledda- tumor suppressor activity in liposarcoma. Cancer Res. Columbano GM, Portolani N, De Petro G, Columbano A, 2011 Sep 1;71(17):5659-69. Epub 2011 Jun 21. Giordano S.. Sequential analysis of multistage hepatocarcinogenesis reveals that miR-100 and PLK1 Vriens MR, Weng J, Suh I, Huynh N, Guerrero MA, Shen dysregulation is an early event maintained along tumor WT, Duh QY, Clark OH, Kebebew E.. MicroRNA progression. Oncogene. 2012 Jan 16. doi: expression profiling is a potential diagnostic tool for thyroid 10.1038/onc.2011.631. [Epub ahead of print] cancer. Cancer. 2011 Oct 17. doi: 10.1002/cncr.26587. [Epub ahead of print] Zheng YS, Zhang H, Zhang XJ, Feng DD, Luo XQ, Zeng CW, Lin KY, Zhou H, Qu LH, Zhang P, Chen YQ.. MiR-100 de Oliveira JC, Scrideli CA, Brassesco MS, Morales AG, regulates cell differentiation and survival by targeting Pezuk JA, Queiroz Rde P, Yunes JA, Brandalise SR, Tone RBSP3, a phosphatase-like tumor suppressor in acute LG.. Differential miRNA expression in childhood acute myeloid leukemia. Oncogene. 2012 Jan 5;31(1):80-92. doi: lymphoblastic leukemia and association with clinical and 10.1038/onc.2011.208. Epub 2011 Jun 6. biological features. Leuk Res. 2012 Mar;36(3):293-8. Epub 2011 Nov 17. This article should be referenced as such: Dip N, Reis ST, Timozczuk LS, Abe DK, Dall'Oglio M, Leite KRM. MIR100 (microRNA 100). Atlas Genet Srougi M, Leite K.. Under-expression of miR-100 may be a Cytogenet Oncol Haematol. 2012; 16(7):479-483. new Carcinogenic pathway for low-grade pTa Bladder Urothelial Carcinomas. J Mole Biomark Diag. 2012 in press.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 483

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Gene Section Short Communication

MIR145 (microRNA 145) Mohit Sachdeva, Yin Yuan Mo Department of Radiation Oncology, Duke University Medical center, Durham, North Carolina-27710, USA (MS), Department of Medical Microbiology, Immunology and Cell Biology, Southern Illinois University School of Medicine, Springfield, IL 62794, USA (YYM)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR145ID50927ch5q32.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MIR145ID50927ch5q32.txt

miRNA sequence, which is first processed to pre- Identity miRNA (~88 bp long) involving RNA cutting and Other names: MIRN145, miR-145, miRNA145 exporting, and finally to mature miR-145. miR-145 HGNC (Hugo): MIR145 is a p53-regulated gene. Location: 5q32 Several reports suggest that miR-145 can be induced transcriptionally by p53 in response to DNA/RNA stress such as serum starvation or anticancer drugs (Sachdeva et al., 2009; Spizzo et al., 2010). Description Interestingly, another report showed a novel miR-145 is located on chromosome 5 (5q32-33) mechanism of posttranscriptional regulation of within a 4.09 kb region (miRBase). miR-145 that occurs via p53-mediated RNA The pri-microRNA structure of miR-145 has not processing (Suzuki et al., 2009). been identified, yet it is suggested that it co- Recently, a study demonstrates that activated Ras transcribed with miR-143. can suppress miR-143/145 cluster through Ras- This gene has been implicated as both tumor and responsive element-binding protein (RREB1), metastasis suppressor in multiple tumor types which represses the miR-143/145 promoter (Kent et (Sachdeva and Mo, 2010a). al., 2010). Transcription Pseudogene miR-145 is transcribed by RNA pol-II into pri- There is no pseudogene reported for this gene.

Figure 1: A) Genomic localization of miR-145 gene on chromosome 5q32. B) Stem-loop structure of miR-145 (Red: mature miR- 145 sequence).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 484

MIR145 (microRNA 145) Sachdeva M, Mo YY

Protein Vascular smooth muscle cells Note Note The role of miR-145 in differentiation of vascular Non-coding RNA. smooth muscle cell (VSMC) has been recently investigated. A report demonstrated that miR-145 is Mutations the most enriched microRNA in arteries and its Note expression is significantly downregulated in No mutations have been found in mature miR-145 vascular walls with neointimal lesions (Chen et al., sequence; however, a study suggests that OVCAR8 2004). Similarly, another group, using transgenic (ovary) and NCI-H727 (lung) cells harbor mouse model with miR-145 promoter fused to β- mutations in pri-miR-145, i.e., C-133A/pri- galactosidase gene, found that miR-145 is cardiac- microRNA/homozygous and G-5R (G/A)/pri- specific and smooth-muscle specific microRNA microRNA/heterozygous, respectively. Yet, these regulated by serum response factor, myocardin and mutations do not have any effect on microRNA Nkx2-5 (NK2 transcription factor related, locus 5) processing (Diederichs and Haber, 2006). (Cordes et al., 2009). Further evidence from the miR-43/miR-145 KO rats suggests that this Implicated in microRNA cluster is expressed mostly in the SMC compartment in vessels and SMC-containing Cancer organs and their loss induces an incomplete differentiation of VSMCs (Elia et al., 2009). Note Downregulation of miR-145 has been found in 5q syndrome cancers of many tissue types including colon, Note breast, prostate, pancreas, etc. (Sachdeva et al., A comprehensive study using clinical samples 2009; Bandres et al., 2006; Michael et al., 2003). combined with mouse models have found that For example, in situ hybridization detected deletion of chromosome 5q correlates with loss of accumulation of miR-145 in normal colon epithelia two miRNAs that are abundant in hematopoietic with no signal from adenocarcinomas cells. Loss of stem/progenitor cells (HSPCs), miR-145 and miR- miR-145 in various tumors suggests its role as a 146a. In addition, they observed that miR-145 is tumor suppressor. In fact, miR-145 has been well highly expressed in primitive lin- (mouse) and documented as a tumor suppressor gene in multiple CD34+ (human) bone marrow cells than committed tumor types because of its anti-proliferative and cells and stable knockdown of miR-145 in these pro-apoptotic effects. It is shown that miR-145 can cells in mouse marrow results in 5-q syndrome negatively regulate multiple oncogenes such as (Starczynowski et al., 2010). Similar work from MYC, Kras, IRS-1, ERK5, etc. involved in cell another group in patients with del (5q) have proliferation and survival (Sachdeva et al., 2009; decreased expression of miR-145 and increased Kent et al., 2010; Shi et al., 2007; Ibrahim et al., expression of Fli-1 (Kumar et al., 2011). They 2011). found that miR-145 functions through repression of Metastasis Fli-1, a megakaryocyte and erythroid regulatory transcription factor and thus, cells lacking miR-145 Note have impaired megakaryocyte and erythroid Several reports suggest that miR-145 is a differentiation. suppressor of metastasis. For example, mir-145 negatively regulates MUC1 and suppresses References invasion and metastasis of the breast cancer cells (Sachdeva and Mo, 2010b). Similar findings in Michael MZ, O' Connor SM, van Holst Pellekaan NG, prostate cancer and in gliomas have further Young GP, James RJ. Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res. 2003 confirmed the role of miR-145 as a metastasis Oct;1(12):882-91 suppressor by targeting genes including FASCN1 and SOX2, respectively (Fang et al., 2011; Chen CZ, Li L, Lodish HF, Bartel DP. MicroRNAs modulate hematopoietic lineage differentiation. Science. 2004 Jan Watahiki et al., 2011; Leite et al., 2011). 2;303(5654):83-6 Stem cells and differentiation Bandrés E, Cubedo E, Agirre X, Malumbres R, Zárate R, Note Ramirez N, Abajo A, Navarro A, Moreno I, Monzó M, García-Foncillas J. Identification by Real-time PCR of 13 A study has shown that miR-145 is induced during mature microRNAs differentially expressed in colorectal differentiation, and it directly silences the stem cell cancer and non-tumoral tissues. Mol Cancer. 2006 Jul self renewal and pluripotency program by 19;5:29 suppressing multiple pluripotent genes such as Diederichs S, Haber DA. Sequence variations of OCT4, SOX2 and KLF4 (Xu et al., 2009). microRNAs in human cancer: alterations in predicted

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 485

MIR145 (microRNA 145) Sachdeva M, Mo YY

secondary structure do not affect processing. Cancer Res. Spizzo R, Nicoloso MS, Lupini L, Lu Y, Fogarty J, Rossi S, 2006 Jun 15;66(12):6097-104 Zagatti B, Fabbri M, Veronese A, Liu X, Davuluri R, Croce CM, Mills G, Negrini M, Calin GA. miR-145 participates Shi B, Sepp-Lorenzino L, Prisco M, Linsley P, deAngelis T, with TP53 in a death-promoting regulatory loop and targets Baserga R. Micro RNA 145 targets the insulin receptor estrogen receptor-alpha in human breast cancer cells. Cell substrate-1 and inhibits the growth of colon cancer cells. J Death Differ. 2010 Feb;17(2):246-54 Biol Chem. 2007 Nov 9;282(45):32582-90 Starczynowski DT, Kuchenbauer F, Argiropoulos B, Sung Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, S, Morin R, Muranyi A, Hirst M, Hogge D, Marra M, Wells Muth AN, Lee TH, Miano JM, Ivey KN, Srivastava D. miR- RA, Buckstein R, Lam W, Humphries RK, Karsan A. 145 and miR-143 regulate smooth muscle cell fate and Identification of miR-145 and miR-146a as mediators of the plasticity. Nature. 2009 Aug 6;460(7256):705-10 5q- syndrome phenotype. Nat Med. 2010 Jan;16(1):49-58 Elia L, Quintavalle M, Zhang J, Contu R, Cossu L, Fang X, Yoon JG, Li L, Yu W, Shao J, Hua D, Zheng S, Latronico MV, Peterson KL, Indolfi C, Catalucci D, Chen J, Hood L, Goodlett DR, Foltz G, Lin B. The SOX2 response Courtneidge SA, Condorelli G. The knockout of miR-143 program in glioblastoma multiforme: an integrated ChIP- and -145 alters smooth muscle cell maintenance and seq, expression microarray, and microRNA analysis. BMC vascular homeostasis in mice: correlates with human Genomics. 2011 Jan 6;12:11 disease. Cell Death Differ. 2009 Dec;16(12):1590-8 Ibrahim AF, Weirauch U, Thomas M, Grünweller A, Sachdeva M, Zhu S, Wu F, Wu H, Walia V, Kumar S, Elble Hartmann RK, Aigner A. MicroRNA replacement therapy R, Watabe K, Mo YY. p53 represses c-Myc through for miR-145 and miR-33a is efficacious in a model of colon induction of the tumor suppressor miR-145. Proc Natl Acad carcinoma. Cancer Res. 2011 Aug 1;71(15):5214-24 Sci U S A. 2009 Mar 3;106(9):3207-12 Kumar MS, Narla A, Nonami A, Mullally A, Dimitrova N, Suzuki HI, Yamagata K, Sugimoto K, Iwamoto T, Kato S, Ball B, McAuley JR, Poveromo L, Kutok JL, Galili N, Raza Miyazono K. Modulation of microRNA processing by p53. A, Attar E, Gilliland DG, Jacks T, Ebert BL. Coordinate loss Nature. 2009 Jul 23;460(7254):529-33 of a microRNA and protein-coding gene cooperate in the Xu N, Papagiannakopoulos T, Pan G, Thomson JA, Kosik pathogenesis of 5q- syndrome. Blood. 2011 Oct KS. MicroRNA-145 regulates OCT4, SOX2, and KLF4 and 27;118(17):4666-73 represses pluripotency in human embryonic stem cells. Leite KR, Tomiyama A, Reis ST, Sousa-Canavez JM, Cell. 2009 May 15;137(4):647-58 Sañudo A, Camara-Lopes LH, Srougi M. MicroRNA Kent OA, Chivukula RR, Mullendore M, Wentzel EA, expression profiles in the progression of prostate cancer- Feldmann G, Lee KH, Liu S, Leach SD, Maitra A, Mendell from high-grade prostate intraepithelial neoplasia to JT. Repression of the miR-143/145 cluster by oncogenic metastasis. Urol Oncol. 2011 Aug 29; Ras initiates a tumor-promoting feed-forward pathway. Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Genes Dev. 2010 Dec 15;24(24):2754-9 Gleave M, Gout PW, Wang Y. MicroRNAs associated with Sachdeva M, Mo YY. miR-145-mediated suppression of metastatic prostate cancer. PLoS One. 2011;6(9):e24950 cell growth, invasion and metastasis. Am J Transl Res. 2010a Mar 25;2(2):170-80 This article should be referenced as such: Sachdeva M, Mo YY. MicroRNA-145 suppresses cell Sachdeva M, Mo YY. MIR145 (microRNA 145). Atlas invasion and metastasis by directly targeting mucin 1. Genet Cytogenet Oncol Haematol. 2012; 16(7):484-486. Cancer Res. 2010b Jan 1;70(1):378-87

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 486

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Gene Section Review

MYCN (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)) Tiangang Zhuang, Mayumi Higashi, Venkatadri Kolla, Garrett M Brodeur Children's Hospital of Philadelphia, Oncology Research, CTRB Rm 3018, 3501 Civic Center Blvd, Philadelphia, PA 19104, USA (TZ, MH, VK, GMB)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/NMYC112.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI NMYC112.txt

This article is an update of : Huret JL. MYCN (myc myelocytomatosis viral related oncogene, neuroblastoma derived). Atlas Genet Cytogenet Oncol Haematol 1998;2(2)

Identity DNA/RNA Other names: bHLHe37, N-myc, MODED, ODED Description HGNC (Hugo): MYCN 3 exons. Location: 2p24.3 Local order: Centromeric to DDX1.

Fluorescence in-situ hybridization of MYCN probe to metaphase and interphase nuclei of a primary neuroblastoma with MYCN amplification (Courtesy Garrett M. Brodeur, Children's Hospital of Philadelphia).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 487

MYCN (v-myc myelocytomatosis viral related oncogene, Zhuang T, et al. neuroblastoma derived (avian))

MYCN (2p24). Fluorescence in-situ hybridization of MYCN probe to metaphase spread (Courtesy Mariano Rocchi, Resources for Molecular Cytogenetics).

tumor progression; transgenic mice that Protein overexpress MYCN in neuroectodermal cells Description develop neuroblastoma. 464 amino acids; contains a phosphorylation site, Implicated in an acidic domain, an HLH motif, and a leucine zipper in C-term; forms heterodimers with MAX Neuroblastoma and binds to an E-box DNA recognition sequence. Note The consensus sequence for the E-box element is CANNTG, with a palindromic canonical sequence Neuroblastoma karyotypes frequently reveal the of CACGTG. cytogenetic hallmarks of gene amplification, namely DMs or HSRs. Schwab (Schwab et al., Expression 1983) and Kohl (Kohl et al., 1983) originally MYCN is expressed in brain, eye, heart, kidney, identified the MYC-related oncogene MYCN as the lung, muscle, ovary, placenta and thymus. target of this amplification event. It is also expressed highly in several tumors: MYCN is located on the distal short arm of glioma, lung tumor, primitive neuroectodermal chromosome 2 (2p24), but in cells with MYCN tumor, retinoblastoma (EST Profile). amplification, the extra copies reside within these DMs or HSRs (Schwab et al., 1984). Localisation Additional genes may be coamplified with MYCN Nuclear. in a subset of cases (DDX1, NAG, ALK), but Function MYCN is the only gene that is consistently amplified from this locus. The magnitude of Probable transcription factor; possible role during MYCN amplification varies, but it averages 100- tissue differentiation. 200 copies per cell (range 5-500+ copies).The Homology overall prevalence of MYCN amplification is 18- With members of the myc family of helix-loop- 20%. Amplification of MYCN is associated with helix transcription factors. advanced stages of disease, unfavorable biological features, and a poor outcome (Brodeur et al., 1984; Mutations Seeger et al., 1985), but it is also associated with poor outcome in otherwise favorable patient groups Somatic (such as infants, and patients with lower stages of Amplification, either in extrachromosomal double disease), underscoring its biological importance minutes (DMs) or in homogeneously staining (Seeger et al., 1985; Look et al., 1991; Tonini et al., regions within chromosomes (there is amplification 1997; Katzenstein et al., 1998; Bagatell et al., 2005; when, for example, 10 to 1000 copies of a gene are George et al., 2005; Schneiderman et al., 2008). present in a cell); found amplified in a variety of Therefore, the status of the MYCN gene is human tumors, in particular in neuroblastoma and routinely determined from neuroblastoma samples also in retinoblastoma, small cell lung carcinoma, obtained at diagnosis to assist in therapy planning astrocytoma; level of amplification related to the (Look et al., 1991; Schwab et al., 2004).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 488

MYCN (v-myc myelocytomatosis viral related oncogene, Zhuang T, et al. neuroblastoma derived (avian))

Indeed, because of the dramatic degree of MYCN subset of Wilms tumors. However, Williams and amplification and consequent overexpression in a colleagues (Williams et al., 2011) found focal gain subset of aggressive neuroblastomas, it should be of MYCN in a substantial number of both an attractive therapeutic target (Pession and Tonelli, anaplastic and favorable histologies in a survey of 2005; Bell et al., 2010). over 400 tumors, suggesting that other genomic Weiss and colleagues (Weiss et al., 1997) created a changes may account for differences in clinical transgenic mouse model of neuroblastoma, with behavior. MYCN expression driven in adrenergic cells by the Other tumors (retinoblastoma, small tyrosine hydroxylase promoter (TH-MYCN mouse). Genomic changes in neuroblastomas cell lung cancer, glioblastoma arising in TH-MYCN mice closely parallel the multiforme) genomic changes found characteristically in human Note tumors (Hackett et al., 2003). Thus, the TH-MYCN About 3-5% of primary retinoblastomas have mouse model appears to be a tractable model to MYCN amplification, whereas it is much more study neuroblastoma development, progression and common (27%) in established retinoblastoma cell therapy (Chessler and Weiss, 2011). lines (Bowles et al., 2007; Kim et al., 2008). Medulloblastoma MYCN is amplified in 15-25% of small cell lung cancers, and it may be more common in tumors at Note relapse (Johnson et al., 1987; Johnson et al., 1992). MYCN amplification is less common in MYCN amplification rarely occurs in other lung medulloblastoma, a neural brain tumor of cancer histologies (Yokota et al., 1988). MYCN childhood, but it is also associated with a worse amplification occurs in a substantial number of clinical outcome (Pfister et al., 2009). However, glioblastoma multiformes (Hui et al., 2001; recent evidence suggests that MYCN Hodgson et al., 2008), but it is rarely found in lower overexpression is much more common in grade gliomas and astrocytomas. medulloblastomas, compared to normal cerebellum (Swartling et al., 2010), and it may drive the References initiation or progression of medulloblastomas independent of the sonic hedgehog (SHH) pathway. Kohl NE, Kanda N, Schreck RR, Bruns G, Latt SA, Gilbert Indeed, MYCN amplification is found in both F, Alt FW. Transposition and amplification of oncogene- related sequences in human neuroblastomas. Cell. 1983 SHH-driven and non-SHH-driven Dec;35(2 Pt 1):359-67 medulloblastomas, but each subtype is associated with other genetic features, suggesting they Schwab M, Alitalo K, Klempnauer KH, Varmus HE, Bishop JM, Gilbert F, Brodeur G, Goldstein M, Trent J. Amplified represent genetically distinct subtypes with DNA with limited homology to myc cellular oncogene is different prognoses (Korshunov et al., 2011). shared by human neuroblastoma cell lines and a neuroblastoma tumour. Nature. 1983 Sep 15- Rhabdomyosarcoma (RMS) 21;305(5931):245-8 Note Brodeur GM, Seeger RC, Schwab M, Varmus HE, Bishop MYCN amplification also occurs in a subset of JM. Amplification of N-myc in untreated human RMS, the most common pediatric soft tissue neuroblastomas correlates with advanced disease stage. sarcoma, although it tends to be at a lower level (4- Science. 1984 Jun 8;224(4653):1121-4 20 fold) than is found in neuroblastomas. Seeger RC, Brodeur GM, Sather H, Dalton A, Siegel SE, Amplification is found predominantly in the Wong KY, Hammond D. Association of multiple copies of the N-myc oncogene with rapid progression of alveolar subsest of RMS, and it is rarely found in neuroblastomas. N Engl J Med. 1985 Oct the more common form, called embryonal RMS 31;313(18):1111-6 (Driman et al., 1994). However, MYCN expression Johnson BE, Ihde DC, Makuch RW, Gazdar AF, Carney is found in the vast majority of RMS tumors, DN, Oie H, Russell E, Nau MM, Minna JD. myc family regardless of histology, at least in primary tumors oncogene amplification in tumor cell lines established from (Toffolatti et al., 2002). For this reason, small cell lung cancer patients and its relationship to clinical status and course. J Clin Invest. 1987 Morgenstern and Anderson have suggested that it Jun;79(6):1629-34 would be an attractive therapeutic target for this disease (Morgenstern and Anderson, 2006). Yokota J, Wada M, Yoshida T, Noguchi M, Terasaki T, Shimosato Y, Sugimura T, Terada M. Heterogeneity of Wilms tumor lung cancer cells with respect to the amplification and rearrangement of myc family oncogenes. Oncogene. 1988 Note Jun;2(6):607-11 Wilms tumor may occasionally show amplification Look AT, Hayes FA, Shuster JJ, Douglass EC, Castleberry of the MYCN protooncogene (Schaub et al., 2007). RP, Bowman LC, Smith EI, Brodeur GM. Clinical relevance MYCN amplification is consistently associated of tumor cell ploidy and N-myc gene amplification in with overexpression, at least at the mRNA level. childhood neuroblastoma: a Pediatric Oncology Group Initially, MYCN amplification was associated study. J Clin Oncol. 1991 Apr;9(4):581-91 almost exclusively with the unfavorable, anaplastic

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 489

MYCN (v-myc myelocytomatosis viral related oncogene, Zhuang T, et al. neuroblastoma derived (avian))

Johnson BE, Brennan JF, Ihde DC, Gazdar AF. myc family retinoblastoma beyond loss of RB1. Genes Chromosomes DNA amplification in tumors and tumor cell lines from Cancer. 2007 Feb;46(2):118-29 patients with small-cell lung cancer. J Natl Cancer Inst Monogr. 1992;(13):39-43 Schaub R, Burger A, Bausch D, Niggli FK, Schäfer BW, Betts DR. Array comparative genomic hybridization reveals Driman D, Thorner PS, Greenberg ML, Chilton-MacNeill S, unbalanced gain of the MYCN region in Wilms tumors. Squire J. MYCN gene amplification in rhabdomyosarcoma. Cancer Genet Cytogenet. 2007 Jan 1;172(1):61-5 Cancer. 1994 Apr 15;73(8):2231-7 Kim JH, Choi JM, Yu YS, Kim DH, Kim JH, Kim KW. N- Tonini GP, Boni L, Pession A, Rogers D, Iolascon A, myc amplification was rarely detected by fluorescence in Basso G, Cordero di Montezemolo L, Casale F, Pession A, situ hybridization in retinoblastoma. Hum Pathol. 2008 Perri P, Mazzocco K, Scaruffi P, Lo Cunsolo C, Marchese Aug;39(8):1172-5 N, Milanaccio C, Conte M, Bruzzi P, De Bernardi B. MYCN oncogene amplification in neuroblastoma is associated Schneiderman J, London WB, Brodeur GM, Castleberry with worse prognosis, except in stage 4s: the Italian RP, Look AT, Cohn SL. Clinical significance of MYCN experience with 295 children. J Clin Oncol. 1997 amplification and ploidy in favorable-stage neuroblastoma: Jan;15(1):85-93 a report from the Children's Oncology Group. J Clin Oncol. 2008 Feb 20;26(6):913-8 Weiss WA, Aldape K, Mohapatra G, Feuerstein BG, Bishop JM. Targeted expression of MYCN causes Hodgson JG, Yeh RF, Ray A, Wang NJ, Smirnov I, Yu M, neuroblastoma in transgenic mice. EMBO J. 1997 Jun Hariono S, Silber J, Feiler HS, Gray JW, Spellman PT, 2;16(11):2985-95 Vandenberg SR, Berger MS, James CD. Comparative analyses of gene copy number and mRNA expression in Katzenstein HM, Bowman LC, Brodeur GM, Thorner PS, glioblastoma multiforme tumors and xenografts. Neuro Joshi VV, Smith EI, Look AT, Rowe ST, Nash MB, Oncol. 2009 Oct;11(5):477-87 Holbrook T, Alvarado C, Rao PV, Castleberry RP, Cohn SL. Prognostic significance of age, MYCN oncogene Pfister S, Remke M, Benner A, Mendrzyk F, Toedt G, amplification, tumor cell ploidy, and histology in 110 infants Felsberg J, Wittmann A, Devens F, Gerber NU, Joos S, with stage D(S) neuroblastoma: the pediatric oncology Kulozik A, Reifenberger G, Rutkowski S, Wiestler OD, group experience--a pediatric oncology group study. J Clin Radlwimmer B, Scheurlen W, Lichter P, Korshunov A. Oncol. 1998 Jun;16(6):2007-17 Outcome prediction in pediatric medulloblastoma based on DNA copy-number aberrations of chromosomes 6q and Hui AB, Lo KW, Yin XL, Poon WS, Ng HK. Detection of 17q and the MYC and MYCN loci. J Clin Oncol. 2009 Apr multiple gene amplifications in glioblastoma multiforme 1;27(10):1627-36 using array-based comparative genomic hybridization. Lab Invest. 2001 May;81(5):717-23 Bell E, Chen L, Liu T, Marshall GM, Lunec J, Tweddle DA. MYCN oncoprotein targets and their therapeutic potential. Toffolatti L, Frascella E, Ninfo V, Gambini C, Forni M, Carli Cancer Lett. 2010 Jul 28;293(2):144-57 M, Rosolen A. MYCN expression in human rhabdomyosarcoma cell lines and tumour samples. J Swartling FJ, Grimmer MR, Hackett CS, Northcott PA, Fan Pathol. 2002 Apr;196(4):450-8 QW, Goldenberg DD, Lau J, Masic S, Nguyen K, Yakovenko S, Zhe XN, Gilmer HC, Collins R, Nagaoka M, Hackett CS, Hodgson JG, Law ME, Fridlyand J, Osoegawa Phillips JJ, Jenkins RB, Tihan T, Vandenberg SR, James K, de Jong PJ, Nowak NJ, Pinkel D, Albertson DG, Jain A, CD, Tanaka K, Taylor MD, Weiss WA, Chesler L. Jenkins R, Gray JW, Weiss WA. Genome-wide array CGH Pleiotropic role for MYCN in medulloblastoma. Genes Dev. analysis of murine neuroblastoma reveals distinct genomic 2010 May 15;24(10):1059-72 aberrations which parallel those in human tumors. Cancer Res. 2003 Sep 1;63(17):5266-73 Chesler L, Weiss WA. Genetically engineered murine models--contribution to our understanding of the genetics, Schwab M. MYCN in neuronal tumours. Cancer Lett. 2004 molecular pathology and therapeutic targeting of Feb 20;204(2):179-87 neuroblastoma. Semin Cancer Biol. 2011 Oct;21(4):245-55 Bagatell R, Rumcheva P, London WB, Cohn SL, Look AT, Williams RD, Al-Saadi R, Natrajan R, Mackay A, Chagtai Brodeur GM, Frantz C, Joshi V, Thorner P, Rao PV, T, Little S, Hing SN, Fenwick K, Ashworth A, Grundy P, Castleberry R, Bowman LC. Outcomes of children with Anderson JR, Dome JS, Perlman EJ, Jones C, Pritchard- intermediate-risk neuroblastoma after treatment stratified Jones K. Molecular profiling reveals frequent gain of by MYCN status and tumor cell ploidy. J Clin Oncol. 2005 MYCN and anaplasia-specific loss of 4q and 14q in Wilms Dec 1;23(34):8819-27 tumor. Genes Chromosomes Cancer. 2011 Dec;50(12):982-95 George RE, London WB, Cohn SL, Maris JM, Kretschmar C, Diller L, Brodeur GM, Castleberry RP, Look AT. Korshunov A, Remke M, Kool M, Hielscher T, Northcott Hyperdiploidy plus nonamplified MYCN confers a favorable PA, Williamson D, Pfaff E, Witt H, Jones DT, Ryzhova M, prognosis in children 12 to 18 months old with Cho YJ, Wittmann A, Benner A, Weiss WA, von Deimling disseminated neuroblastoma: a Pediatric Oncology Group A, Scheurlen W, Kulozik AE, Clifford SC, Peter Collins V, study. J Clin Oncol. 2005 Sep 20;23(27):6466-73 Westermann F, Taylor MD, Lichter P, Pfister SM. Biological and clinical heterogeneity of MYCN-amplified Pession A, Tonelli R. The MYCN oncogene as a specific medulloblastoma. Acta Neuropathol. 2012 Apr;123(4):515- and selective drug target for peripheral and central 27 nervous system tumors. Curr Cancer Drug Targets. 2005 Jun;5(4):273-83 This article should be referenced as such: Morgenstern DA, Anderson J. MYCN deregulation as a Zhuang T, Higashi M, Kolla V, Brodeur GM. MYCN (v-myc potential target for novel therapies in rhabdomyosarcoma. myelocytomatosis viral related oncogene, neuroblastoma Expert Rev Anticancer Ther. 2006 Feb;6(2):217-24 derived (avian)). Atlas Genet Cytogenet Oncol Haematol. Bowles E, Corson TW, Bayani J, Squire JA, Wong N, Lai 2012; 16(7):487-490. PB, Gallie BL. Profiling genomic copy number changes in

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 490

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Gene Section Review

PTBP1 (polypyrimidine tract binding protein 1) Laura Fontana Department of Medicine, Surgery and Dentistry, Medical Genetics, Universita degli Studi di Milano, Italy (LF)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/PTBP1ID46504ch19p13.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI PTBP1ID46504ch19p13.txt

PTB-T has been reported to result from alternative Identity splicing of exons 2-10 (Sawicka et al., 2004). Other names: HNRNP-I, HNRNPI, HNRPI, PTB, Pseudogene PTB-1, PTB-T, PTB2, PTB3, PTB4, pPTB PTBP1P (polypyrimidine tract binding protein 1 HGNC (Hugo): PTBP1 pseudogene), chromosome location 14q23.3, starts Location: 19p13.3 at 65745938 and ends at 65748375 bp from pter (according to hg19-Feb_2009). DNA/RNA Protein Description The PTBP1 locus spans 14936 bases on the short Description arm of chromosome 19 and is composed of 14 57 kDa protein belonging to the heterogeneous exons. nuclear ribonucleoprotein family (hnRNP). PTBP1 Transcription has four RNA recognition motifs (RRMs) and a conserved N-terminal domain that harbors both PTBP1 results from skipping of exon 9 (3203 bp nuclear localisation and export signals (NLS and mRNA and 531 amino acid protein). Three NES). additional isoforms are generated by alternative Through the RRMs, PTBP1 binds to the transcript splicing: PTBP2 (3260 bp mRNA and 550 amino at multiple sites within large pyrimidine tracts acid protein) and PTBP4 (3281 mRNA protein and leading to conformational changes suitable for 557 amino acid protein) derive from exon 9 functional mRNA processing (Sawicka et al., inclusion using two alternative 3' splice sites, while 2004).

Shematic representation of PTB mRNA alternative splicing. Alternative splicing of PTB mRNA, as described below, originates four isoforms. Green boxes represent exons and thin black lines represent introns (not to scale).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 491

PTBP1 (polypyrimidine tract binding protein 1) Fontana L

Schematic representation of PTBP1 protein structure. Each RNA recognition motif (RRM) has different binding affinity for pyrimidine-rich sequences on mRNA. The N-terminal domain encloses partially overlapping nuclear localisation (NLS) and export signals (NES). Blue boxes representing RRMs are not drawn to scale.

Expression tropomiosin, α-actinin, GABAAγ2 (gamma- aminobutyric acid γ2), c-src and FGFR2 PTBP1 is ubiquitously expressed in human tissues A (fibroblast growth factor receptor 2) (Li et al., 2007; emerging as a pleiotropic splicing regulator. PTBP1 Spellman et al., 2005). Recent evidences indicate expression levels have been associated with that PTBP1 may also favour exon inclusion myoblast and neural precursor differentiation depending on the position of its binding sites through specific modulation of the splicing pattern relative to the target exon. Upon binding to the (Clower et al., 2010). In the brain, in particular, the upstream intron and/or within the exon, PTBP1 switch from PTBP1 to nPTB expression drives the represses exon inclusion, while by binding to the differentiation towards the neuronal lineage: downstream intron, it activates exon inclusion. The PTBP1 is expressed in neural precursors and glial PTBP1 position-dependent activity relies on the cells, while post-mitotic neurons express only splice site features: in particular included exons nPTB (Boutz et al., 2007). Recently a strong show weaker 5' splice sites, whereas skipped exons PTBP1 expression has been found in embryonic have longer polypyrimidine tracts (Llorian et al., stem cells, particularly those in the brain cortex and 2010). subventricular zone, where PTBP1 appears PTBP1 pre-mRNA undergoes PTBP1-mediated essential for cell division after implantation alternative splicing too, as part of an autoregulatory (Shibayama et al., 2009; Suckale et al., 2011). feedback loop: high levels of PTBP1 induce Localisation skipping of exon 11 and hence mRNA degradation PTBP1 shuttles between the nucleus and the via the nonsense-mediated mRNA decay (Spellman cytoplasm. Cytoplasmic localisation is mainly et al., 2005). achieved by PKA-mediated phosphorylation of a 3'-end processing: PTBP1 both promotes and specific serine residue (Ser-16) within the nuclear inhibits the mRNA 3'-end cleavage required for localisation signal. Cytoplasmic accumulation of polyadenylation. PTBP1 may prevent mRNA PTB occurs during cell stress (Sawicka et al., polyadenylation through competition with the 2008). PTBP1 has also been identified as a key cleavage stimulating factor (CstF), or stimulate component in maintaining the integrity of the polyadenylation by binding to pyrimidine-rich perinucleolar compartment, a sub-nuclear structure upstream elements (USEs). predominantly found in transformed cells (Wang et mRNA transport: evidences for a role of PTBP1 al., 2003). in mRNA transport come from experiments in Xenopus, where the PTBP1 homologue (VgRBP60) Function is involved in the localisation of the Vg1 mRNA. In PTB was originally identified as a regulator of vertebrates PKA-activated PTBP1 is involved in α- alternative splicing (Garcia-Blanco et al., 1989) but actin mRNA localisation at neurite terminals. other roles in mRNA processing have been mRNA stability: PTBP1 increases the stability of described (Sawicka et al., 2008). specific transcript by binding to the untranslated Alternative splicing regulation: PTBP1 regions of mRNA and consequently competing with commonly acts as repressor of alternative splicing factors involved in mRNA degradation. Transcripts favouring skipping of alternative exons. Different with PTB-mediated increased stability include models of PTBP1 activity have been proposed those of insulin, VEGF (vascular endothelial (Spellman and Smith, 2006): 1) binding growth factor), CD154 (cluster of differentiation competition with the splicing factor U2AF65 at the 154) and iNOS (inducible nitric oxide synthase). 3' splice site of alternative exons; 2) polymerization Viral translation and replication: PTBP1 acts as of PTBP1 molecules on the alternative exon an ITAF (IRES -internal ribosomal entry site- trans- masking splicing enhancer sequences; and 3) acting factor) for mRNA translation of virus looping out of alternative exon by PTBP1 binding belonging to the Picornaviridae family and lacking of flanking intronic sequences. Targets of PTBP1- cap structure. PTBP1 seems to have a role as a viral mediated repression of exon inclusion comprise α- RNA chaperone that stabilizes or alters IRES

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 492

PTBP1 (polypyrimidine tract binding protein 1) Fontana L

structure to direct ribosomes to the correct start exon 9. In transformed cells PKM2 promotes codon. aerobic glycolysis and proliferation. Recently c- IRES-mediated translation: PTBP1 favours cap- Myc overexpression has been demonstrated to independent translation of few cellular RNAs under upregulate PTBP1 transcription in transformed glial cell stress, apoptosis or infection through ribosome cells (David et al., 2010). recruitment to IRES. In this case, PTBP1 USP5 (ubiquitin specific peptidase 5): PTBP1 cytoplasmic relocalisation is required. overexpression in GBM forces the expression of Homology USP5 isoform 2, a protein involved in ubiquitination. USP5 isoform 2 has a low activity PTBP1 shares 70-80% homology with two other and favours cell growth and migration (Izaguirre et proteins: nPTB (neural PTB), expressed in adult al., 2011). brain, muscle and testis, and ROD1 (regulator of differentiation 1) only expressed in hematopoietic Ovarian tumour cells. PTB also regulates alternative splicing of its Note homologues, in particular the nonsense-mediated PTBP1 is overexpressed in the majority of decay of nPTB transcripts and the non-productive epithelial ovarian tumours and deregulates cell splicing of ROD1 (Sawicka et al., 2008). proliferation, anchorage-dependent growth and invasiveness. PTBP1 targets in ovarian transformed Mutations cells have not yet been identified (He et al., 2007). Somatic Alzheimer's disease (AD) Three synonymous mutations have been reported in Note cancer samples: c.510C>T (p.A170A) in kidney Recent evidences delineate PTBP1 as a regulator of carcinoma (Dalgliesh et al., 2010), c.1416C>T the amyloid precursor protein (APP) in neurons. In (p.F472F) in melanoma (Wei et al., 2011) and particular, PTBP1 altered expression in neuronal c.501G>A (p.S167S) in squamous cell carcinoma cells, likely mediated by miR-124, enhances the of the mouth (Stransky et al., 2011). Moreover five expression of APP isoforms including exon 7 missense mutations have been identified in other and/or 8. These isoforms have been found enriched cancer samples: c.932C>T (p.A311V) in ovarian in AD patients and associated with β-amyloid carcinoma (Cancer Genome Atlas Research production (Smith et al., 2011). Network, 2011), c.413C>T (p.T138I) in skin squamous cell carcinoma (Durinck et al., 2011), References c.212C>T (p.T71M), c.666C>G (p.F222L) and García-Blanco MA, Jamison SF, Sharp PA. Identification c.928G>A (p.G310R) in squamous cell carcinomas and purification of a 62,000-dalton protein that binds of the mouth and larynx (Durinck et al., 2011; specifically to the polypyrimidine tract of introns. Genes Stransky et al., 2011). Dev. 1989 Dec;3(12A):1874-86 Jin W, McCutcheon IE, Fuller GN, Huang ES, Cote GJ. Implicated in Fibroblast growth factor receptor-1 alpha-exon exclusion and polypyrimidine tract-binding protein in glioblastoma Glioma multiforme tumors. Cancer Res. 2000 Mar 1;60(5):1221-4 Note Wang C, Politz JC, Pederson T, Huang S. RNA polymerase III transcripts and the PTB protein are PTBP1 is aberrantly overexpressed in glioma with essential for the integrity of the perinucleolar compartment. expression levels correlated with glial cell Mol Biol Cell. 2003 Jun;14(6):2425-35 transformation. The increased expression of PTBP1 McCutcheon IE, Hentschel SJ, Fuller GN, Jin W, Cote GJ. contributes to gliomagenesis by deregulating the Expression of the splicing regulator polypyrimidine tract- alternative splicing of genes involved in cell binding protein in normal and neoplastic brain. Neuro proliferation and migration (McCutcheon et al., Oncol. 2004 Jan;6(1):9-14 2004; Cheung et al., 2006; Cheung et al., 2009). Spellman R, Rideau A, Matlin A, Gooding C, Robinson F, FGFR-1 (fibroblast growth factor receptor-1): McGlincy N, Grellscheid SN, Southby J, Wollerton M, Smith CW. Regulation of alternative splicing by PTB and PTBP1 overexpression increases FGFR-1 α-exon associated factors. Biochem Soc Trans. 2005 Jun;33(Pt skipping and hence the synthesis of a receptor with 3):457-60 higher affinity for fibroblast growth factor, Cheung HC, Corley LJ, Fuller GN, McCutcheon IE, Cote favouring transformed cell growth (Jin et al., 2000). GJ. Polypyrimidine tract binding protein and Notch1 are PKM (pyruvate kinase): PTBP1 overexpression independently re-expressed in glioma. Mod Pathol. 2006 leads to the re-expression of the embryonic Aug;19(8):1034-41 pyruvate kinase isoform, PKM2, in transformed Spellman R, Smith CW. Novel modes of splicing glial cells. The switch from PKM1, normally repression by PTB. Trends Biochem Sci. 2006 expressed in terminally differentiated cells, to Feb;31(2):73-6 PKM2 is achieved through the PTBP1-mediated Boutz PL, Stoilov P, Li Q, Lin CH, Chawla G, Ostrow K, inclusion in the PKM mRNA of exon 10, instead of Shiue L, Ares M Jr, Black DL. A post-transcriptional

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 493

PTBP1 (polypyrimidine tract binding protein 1) Fontana L

regulatory switch in polypyrimidine tract-binding proteins . Integrated genomic analyses of ovarian carcinoma. reprograms alternative splicing in developing neurons. Nature. 2011 Jun 29;474(7353):609-15 Genes Dev. 2007 Jul 1;21(13):1636-52 Durinck S, Ho C, Wang NJ, Liao W, Jakkula LR, Collisson He X, Pool M, Darcy KM, Lim SB, Auersperg N, Coon JS, EA, Pons J, Chan SW, Lam ET, Chu C, Park K, Hong SW, Beck WT. Knockdown of polypyrimidine tract-binding Hur JS, Huh N, Neuhaus IM, Yu SS, Grekin RC, Mauro protein suppresses ovarian tumor cell growth and TM, Cleaver JE, Kwok PY, Leboit PE, Getz G, Cibulskis K, invasiveness in vitro. Oncogene. 2007 Jul 26;26(34):4961- Aster JC, Huang H, Purdom E, Li J, Bolund L, Arron ST, 8 Gray JW, Spellman PT, Cho RJ. Temporal Dissection of Tumorigenesis in Primary Cancers. Cancer Discov. 2011 Li Q, Lee JA, Black DL. Neuronal regulation of alternative Jul;1(2):137-143 pre-mRNA splicing. Nat Rev Neurosci. 2007 Nov;8(11):819-31 Izaguirre DI, Zhu W, Hai T, Cheung HC, Krahe R, Cote GJ. PTBP1-dependent regulation of USP5 alternative RNA Sawicka K, Bushell M, Spriggs KA, Willis AE. splicing plays a role in glioblastoma tumorigenesis. Mol Polypyrimidine-tract-binding protein: a multifunctional Carcinog. 2011 Oct 4; RNA-binding protein. Biochem Soc Trans. 2008 Aug;36(Pt 4):641-7 Smith P, Al Hashimi A, Girard J, Delay C, Hébert SS. In vivo regulation of amyloid precursor protein neuronal Cheung HC, Hai T, Zhu W, Baggerly KA, Tsavachidis S, splicing by microRNAs. J Neurochem. 2011 Krahe R, Cote GJ. Splicing factors PTBP1 and PTBP2 Jan;116(2):240-7 promote proliferation and migration of glioma cell lines. Brain. 2009 Aug;132(Pt 8):2277-88 Stransky N, Egloff AM, Tward AD, Kostic AD, Cibulskis K, Sivachenko A, Kryukov GV, Lawrence MS, Sougnez C, Shibayama M, Ohno S, Osaka T, Sakamoto R, Tokunaga McKenna A, Shefler E, Ramos AH, Stojanov P, Carter SL, A, Nakatake Y, Sato M, Yoshida N. Polypyrimidine tract- Voet D, Cortés ML, Auclair D, Berger MF, Saksena G, binding protein is essential for early mouse development Guiducci C, Onofrio RC, Parkin M, Romkes M, Weissfeld and embryonic stem cell proliferation. FEBS J. 2009 JL, Seethala RR, Wang L, Rangel-Escareño C, Nov;276(22):6658-68 Fernandez-Lopez JC, Hidalgo-Miranda A, Melendez-Zajgla Clower CV, Chatterjee D, Wang Z, Cantley LC, Vander J, Winckler W, Ardlie K, Gabriel SB, Meyerson M, Lander Heiden MG, Krainer AR. The alternative splicing ES, Getz G, Golub TR, Garraway LA, Grandis JR. The repressors hnRNP A1/A2 and PTB influence pyruvate mutational landscape of head and neck squamous cell kinase isoform expression and cell metabolism. Proc Natl carcinoma. Science. 2011 Aug 26;333(6046):1157-60 Acad Sci U S A. 2010 Feb 2;107(5):1894-9 Suckale J, Wendling O, Masjkur J, Jäger M, Münster C, David CJ, Chen M, Assanah M, Canoll P, Manley JL. Anastassiadis K, Stewart AF, Solimena M. PTBP1 is HnRNP proteins controlled by c-Myc deregulate pyruvate required for embryonic development before gastrulation. kinase mRNA splicing in cancer. Nature. 2010 Jan PLoS One. 2011 Feb 17;6(2):e16992 21;463(7279):364-8 This article should be referenced as such: Llorian M, Schwartz S, Clark TA, Hollander D, Tan LY, Spellman R, Gordon A, Schweitzer AC, de la Grange P, Fontana L. PTBP1 (polypyrimidine tract binding protein 1). Ast G, Smith CW. Position-dependent alternative splicing Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):491- activity revealed by global profiling of alternative splicing 494. events regulated by PTB. Nat Struct Mol Biol. 2010 Sep;17(9):1114-23

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 494

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Gene Section Short Communication

SOCS3 (suppressor of cytokine signaling 3) Zoran Culig Experimental Urology, Department of Urology, Innsbruck Medical University, Anichstrasse 35, A- 6020 Innsbruck, Austria (ZC)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/SOCS3ID44124ch17q25.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI SOCS3ID44124ch17q25.txt

Identity functions. Localisation Other names: ATOD4, CIS3, Cish3, MGC71791, SOCS-3, SSI-3, SSI3 Cytoplasm. HGNC (Hugo): SOCS3 Function Location: 17q25.3 SOCS is a negative regulator of cytokines that signal through the JAK/STAT pathway. It binds to DNA/RNA tyrosine kinase receptors such as gp130 subunit of receptors. Description It interacts with cytokine receptors or JAK kinases Size: 3300 bases. and interaction with growth factor receptors (insulin-like growth factor-I, insulin, fibroblast Transcription growth factor). It inhibits JAK2 kinase activity. 2 introns. Part of the ubiquitin-protein ligase complex which Transcription generates 3 different mRNAs, 2 contains elongin, RNF7, and CUL5. spliced variants and 1 unspliced form. Binding to leptin. Tumor promoting or tumor suppressive functions. Protein Antagonizing cAMP-antiproliferative effects. SOCS3 suppresses erythropoietin in fetal liver and Description IL-6 signaling in vivo. 225 amino acids, 24770 Da. Expression Mutations Widely expressed in normal and tumor tissues. Note Expression in tumors is variable due to its different Mutations not detected.

KIR = kinase inhibitory region.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 495

SOCS3 (suppressor of cytokine signaling 3) Culig Z

Implicated in Various cancers Lung cancer Prognosis Loss of protein expression and promoter Note hypermethylation occur in lung, liver cancer, head SOCS-3 acts as a tumor suppressor and is and neck squamous cell cancer. Overexpression frequently lost in the disease. Its transient occurs in melanoma and prostate cancer. transfection in lung cancer cell lines leads to a decrease in proliferation. References Liver cancer Brender C, Nielsen M, Kaltoft K, Mikkelsen G, Zhang Q, Note Wasik M, Billestrup N, Odum N. STAT3-mediated constitutive expression of SOCS-3 in cutaneous T-cell SOCS-3 is silenced by methylation. SOCS-3 is a lymphoma. Blood. 2001 Feb 15;97(4):1056-62 tumor suppressor in this malignancy. It is He B, You L, Uematsu K, Zang K, Xu Z, Lee AY, Costello implicated in regulation of migration of cancer JF, McCormick F, Jablons DM. SOCS-3 is frequently cells. SOCS-3 deletion enhances JAK/STAT and silenced by hypermethylation and suppresses cell growth FAK signaling. in human lung cancer. Proc Natl Acad Sci U S A. 2003 Nov 25;100(24):14133-8 Barret's adenocarcinoma Niwa Y, Kanda H, Shikauchi Y, Saiura A, Matsubara K, Note Kitagawa T, Yamamoto J, Kubo T, Yoshikawa H. SOCS-3 is methylated. It is considered as a tumor Methylation silencing of SOCS-3 promotes cell growth and suppressor. migration by enhancing JAK/STAT and FAK signalings in human hepatocellular carcinoma. Oncogene. 2005 Sep Glioblastoma multiforme 22;24(42):6406-17 Note Weber A, Hengge UR, Bardenheuer W, Tischoff I, Sommerer F, Markwarth A, Dietz A, Wittekind C, SOCS-3 expression is lost through promoter Tannapfel A. SOCS-3 is frequently methylated in head and methylation. neck squamous cell carcinoma and its precursor lesions and causes growth inhibition. Oncogene. 2005 Oct Head and neck squamous cell cancer 6;24(44):6699-708 Note Bellezza I, Neuwirt H, Nemes C, Cavarretta IT, Puhr M, SOCS-3 is frequently down-regulated as a result of Steiner H, Minelli A, Bartsch G, Offner F, Hobisch A, promoter methylation. It causes a growth inhibition. Doppler W, Culig Z. Suppressor of cytokine signaling-3 antagonizes cAMP effects on proliferation and apoptosis Hematological malignancies and is expressed in human prostate cancer. Am J Pathol. Note 2006 Dec;169(6):2199-208 SOCS-3 inhibits megakaryocytic growth, Komyod W, Böhm M, Metze D, Heinrich PC, Behrmann I. overexpression of SOCS-3 is associated with a Constitutive suppressor of cytokine signaling 3 expression confers a growth advantage to a human melanoma cell decreased survival of patients with follicular line. Mol Cancer Res. 2007 Mar;5(3):271-81 lymphoma. O'Connor JC, Sherry CL, Guest CB, Freund GG. Type 2 Melanoma diabetes impairs insulin receptor substrate-2-mediated phosphatidylinositol 3-kinase activity in primary Note macrophages to induce a state of cytokine resistance to IL- SOCS-3 is a tumor promoter in melanoma and is 4 in association with overexpression of suppressor of constitutively expressed in several cell lines. cytokine signaling-3. J Immunol. 2007 Jun 1;178(11):6886- 93 Prostate cancer Capello D, Deambrogi C, Rossi D, Lischetti T, Piranda D, Note Cerri M, Spina V, Rasi S, Gaidano G, Lunghi M. Epigenetic SOCS-3 stimulates proliferation and inhibits inactivation of suppressors of cytokine signalling in Philadelphia-negative chronic myeloproliferative disorders. apoptosis in prostate cancer cells which do not Br J Haematol. 2008 May;141(4):504-11 express the androgen receptor. Martini M, Pallini R, Luongo G, Cenci T, Lucantoni C, It may also antagonize the effects of fibroblasts Larocca LM. Prognostic relevance of SOCS3 growth factor and mitogen-activated protein hypermethylation in patients with glioblastoma multiforme. kinases. Int J Cancer. 2008 Dec 15;123(12):2955-60 In androgen-sensitive prostate cancer cells, SOCS-3 Puhr M, Santer FR, Neuwirt H, Susani M, Nemeth JA, is induced by androgen and may inhibit androgen- Hobisch A, Kenner L, Culig Z. Down-regulation of stimulated proliferation and secretion. suppressor of cytokine signaling-3 causes prostate cancer cell death through activation of the extrinsic and intrinsic Diabetes apoptosis pathways. Cancer Res. 2009 Sep 15;69(18):7375-84 Note SOCS-3 may antagonize function of insulin-like This article should be referenced as such: growth factors. Culig Z. SOCS3 (suppressor of cytokine signaling 3). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):495-496.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 496

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Leukaemia Section Short Communication i(17q) solely in myeloid malignancies Vladimir Lj Lazarevic Department of Hematology, Skane University Hospital, Lund University, 22185, Lund, Sweden (VLjL)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/i17qID1038.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI i17qID1038.txt

This article is an update of : Bilhou-Nabera C. i(17q) in myeloid malignancies. Atlas Genet Cytogenet Oncol Haematol 2000;4(1)

Identity Clinics and pathology Note Disease An isochromosome 17 results in a loss of the short Myeloproliferative neoplasm/myelodysplastic arm (17p) and duplication of the long arm (17q) syndrome (MPN/MDS) leading to a single copy of 17p and three copies of 17q. Phenotype/cell stem origin An i(17q), usually observed in a complex Previous studies on isolated i(17q) have suggested karyotype, has been reported in solid tumors and in this aberration was associated with chronic myeloid various types of hematological diseases: acute abnormalities with a high rate of progression to myeloid leukemias and chronic myeloid leukemias, AML; a new clinico-pathological entity in which myelodysplastic syndromes and myeloproliferative i(17q) is the sole abnormality has been reported in a neoplasms, acute lymphoid leukemias and chronic mixed myeloproliferative disorder / lymphoid leukemias, and Hodgkin and non- myelodysplastic syndrome with an aggressive Hodgkin lymphomas. course. In chronic myeloid leukemia, i(17q) is a frequent and well known secondary anomaly, either solely in Etiology 10% of cases, or with other additional anomalies , i(17q) as sole cytogenetic aberration represents only in at least another 10% of cases, in particular with 1% of cases in myeloid malignancies. +8. Clinics It is believed that i(17q) as a sole abnormality is a Isolated isochromosome 17q cases can be divided distinctive clinicopathological entity with a high into 2 distinct subgroups based on the presentation: risk to a leukemic progression; a subset may present de novo AML and MDS/MPN. as de novo AML. These neoplasms have distinctive All de novo AML fit into the WHO classification of morphologic features, including multilineage AML with myelodysplasia-related changes (with dysplasia and concurrent myeloproliferative the exception of 1 mixed phenotype acute features. Isochromosome 17q usually occurs at time leukemia), and showed features of both of blast transformation and heralds an aggressive myelodysplasia (pseudo-Pelger-Huet-like clinical course. In the 2008 World Health neutrophils, micromegakaryocytes) and Organization (WHO) classification system, myeloid myeloproliferation (splenomegaly, hypercellularity, neoplasms with isochromosome 17q are only reticulin fibrosis, osteosclerosis). briefly mentioned within the MDS/MPN category.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 497 i(17q) solely in myeloid malignancies Lazarevic VLj

i(17q) G- banding (left) - Courtesy Jean-Luc Lai (top) and Diane H. Norback, Eric B. Johnson, and Sara Morrison-Delap, UW Cytogenetic Services (middle and bottom); and R- banding (right) - top: Editor, bottom: Courtesy Jacques Boyer

Cytology analysis for the detection of isochromosome 17q, and mutational studies of common molecular A severe hyposegmentation of neutrophil nuclei markers seen in myeloid neoplasms. (pseudo-Pelger Huet neutrophils (PHH)) and a Review of the peripheral blood smear and clinical prominence of the monocyte/macrophage lineage records with special attention to the presence of has been noted; other studies have identified an splenomegaly may also be helpful. association between hyposegmented neutrophils and loss of 17p (called 17p- syndrome), always Evolution included in complex karyotypes; the i(17q) Mutational analyses showed rare mutations in appeared to be a part of the malignant clone as NRAS (3 of 10), FLT3 (2 of 16), and JAK2 (1 of demonstrated in cases available for a FISH 18), and no mutations in NPM1 (0 of 15), KIT (0 of analysis: all myeloid cell lines observed contained 4), and CEBPA (0 of 4). the abnormal i(17q), whereas none of the Mutations of JAK2, FLT3, RAS, NPM1, KIT, and lymphocytes were affected. Morphologically, all CEBPA are rare and appear to not play a critical showed myelodysplastic and myeloproliferative role in the pathogenesis of isochromosome 17q features, including pseudo-Pelger-Huet-like leukemia. neutrophils, micromegakaryocytic hyperplasia, Prognosis hypercellularity, fibrosis, and osteosclerosis. Log-rank test, and univariate and multivariate Cox Pathology proportional hazards regression analyses to evaluate We recommend that for cases with morphologic prognostic values of patients' characteristics, features suggestive of isochromosome 17q, such as including age >65 years, sex, leukocytosis, anemia, pseudo-Pelger-Huet-like neutrophils or thrombocytopenia, absolute monocytosis, elevated micromegakaryocytes, a complete workup with lactate dehydrogenase, elevated β2-microglobulin, ancillary studies should be performed to explore splenomegaly, megakaryocytic hyperplasia, features of both myelodysplasia and dysgranulocytes, dyserythrocytes, myeloproliferation to better classify the disease dysmegakaryocytes, increased blasts, bone process, including stains for reticulum and collagen, thickness, cytogenetic evidence of clonal evolution, immunostains using CD61 to reveal mutations of JAK2 V617F, FLT3, or NRAS, and micromegakaryocytes, CD34 and CD117 to stem cell transplantation. In the univariate analysis, quantify the blasts on the core biopsy, iron stain to log-rank test suggested that OS was significantly assess storage iron and ring sideroblasts, butyrate associated with stem cell transplantation and esterase stain to quantify monocytes, and absolute monocytosis. myeloperoxidase stain to determine percentage and Patients with stem cell transplantation had a longer lineage of the blasts, as well as flow cytometry survival (P = 0,042), and absolute monocytosis was immunophenotyping of the blasts, cytogenetic associated with a shorter survival (P = 0,016).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 498 i(17q) solely in myeloid malignancies Lazarevic VLj

Kaplan-Meier curve of overall survival (OS) of patients with myeloid neoplasms and isolated isochromosome 17q is shown. The median OS of de novo acute myeloid leukemia (AML) and of myelodysplastic/myeloproliferative neoplasm (MDS/MPN) was 14,5 months and 11,0 months, respectively.

negative myeloid neoplasms with isolated Cytogenetics isochromosome. Cytogenetics molecular 17q by sequencing, and found no mutation in all 5 cases. Similarly, none of the 14 cases assessed in DNA sequencing of exons 2-11 of the TP53 gene, another series of patients demonstrated TP53 representing the entire coding region. No mutation mutation. These results suggest that there is no was detected in all 14 cases assessed. None of the association between isochromosome 17q and TP53 13 cases tested had bcr-abl1 fusion transcripts. It mutations, and that another oncogene(s) at 17q has been proposed that TP53 deletion/mutation and/or tumor suppressor gene(s) at 17p may play an might be responsible for the unique important role in the pathogenesis of clinicopathologic features of myeloid neoplasms isochromosome 17q-associated myeloid neoplasms. associated with isochromosome 17q. We can The presence of a moderate apoptotic rate also conclude that DNA sequencing showed no mutation suggests that the cytogenetically uninvolved TP53 in the involved TP53 allele. allele is functional. Genes involved and References proteins Borgström GH, Vuopio P, de la Chapelle A. Abnormalities of chromosome No. 17 in myeloproliferative disorders. Note Cancer Genet Cytogenet. 1982 Feb;5(2):123-35 The underlying molecular defect that produces the Testa JR, Cohen BC. Dicentric chromosome 17 in patients isolated i(17q) is unknown: breakage of the with leukemia. Cancer Genet Cytogenet. 1986 proximal p arm (17p11.2) with rejoining of both Sep;23(1):47-52 centromere-containing chromatids and subsequent Becher R, Carbonell F, Bartram CR. Isochromosome 17q inactivation of one centromere; breakpoints could in Ph1-negative leukemia: a clinical, cytogenetic, and involve important genetic material whose molecular study. Blood. 1990 Apr 15;75(8):1679-83 disruption could result in oncogene or tumor Lai JL, Preudhomme C, Zandecki M, Flactif M, suppression gene deregulation. Vanrumbeke M, Lepelley P, Wattel E, Fenaux P. In understanding the specific i(17q) phenotype, loss Myelodysplastic syndromes and acute myeloid leukemia of genes localized on 17p were suggested as p53 with 17p deletion. An entity characterized by specific dysgranulopoïesis and a high incidence of P53 mutations. (17p13.1); a direct correlation between p53 loss and Leukemia. 1995 Mar;9(3):370-81 PHH neutrophils was found in a series of MDS and ANLL with 17p- syndrome. However, Fioretos et Fugazza G, Bruzzone R, Puppo L, Sessarego M. Granulocytes with segmented nucleus retain normal al. assessed TP53 mutations in 5 Philadelphia chromosomes 17 in Philadelphia chromosome-positive

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 499 i(17q) solely in myeloid malignancies Lazarevic VLj

chronic myeloid leukemia with i(17q) and pseudo-Pelger Lazarević V, Djordjević V, Magić Z, Marisavljevic D, anomaly. A case report studied with fluorescence in situ Colović M. Refractory anemia with ring sideroblasts hybridization. Cancer Genet Cytogenet. 1996 associated with i(17q) and mutation of the TP53 gene. Sep;90(2):166-70 Cancer Genet Cytogenet. 2002 Jul 1;136(1):86-9 Kanagal-Shamanna R, Bueso-Ramos CE, Barkoh B, Lu G, Wang S, Garcia-Manero G, Vadhan-Raj S, Hoehn D, Jary L, Mossafa H, Fourcade C, Genet P, Pulik M, Flandrin Medeiros LJ, Yin CC. Myeloid neoplasms with isolated G. The 17p-syndrome: a distinct myelodysplastic isochromosome 17q represent a clinicopathologic entity syndrome entity? Leuk Lymphoma. 1997 Mar;25(1-2):163- associated with myelodysplastic/myeloproliferative 8 features, a high risk of leukemic transformation, and wild- Fioretos T, Strömbeck B, Sandberg T, Johansson B, type TP53. Cancer. 2012 Jun 1;118(11):2879-88 Billström R, Borg A, Nilsson PG, Van Den Berghe H, Hagemeijer A, Mitelman F, Höglund M. Isochromosome This article should be referenced as such: 17q in blast crisis of chronic myeloid leukemia and in other Lazarevic VLj. i(17q) solely in myeloid malignancies. Atlas hematologic malignancies is the result of clustered Genet Cytogenet Oncol Haematol. 2012; 16(7):497-500. breakpoints in 17p11 and is not associated with coding TP53 mutations. Blood. 1999 Jul 1;94(1):225-32

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 500

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Leukaemia Section Short Communication inv(11)(q13q23) Adrian Mansini, Claus Meyer, Marta Susana Gallego, Jorge Rossi, Patricia Rubio, Adriana Medina, Rolf Marschalek, Maria Felice, Cristina Alonso Dept. Hematology and Oncology, Hosp. Pediatria Garrahan, Buenos Aires, Argentina; Agencia Nacional de Promocion Cientifica y Tecnologica, MINCyT, Argentina (AM), Inst. Pharm Biology, Goethe-University, Biocenter/DCAL, Max-von-Laue-Str. 9, D-60438 Frankfurt/Main, Germany (CM), Dept. Genetics, Hosp. Pediatria Garrahan, Buenos Aires, Argentina (MSG), Dept. Immunology, Hosp. Pediatria Garrahan, Buenos Aires, Argentina (JR), Dept. Hematology and Oncology, Hosp. Pediatria Garrahan, Buenos Aires, Argentina (PR, AM, MF, CA), Inst. Pharm Biology, Goethe-University, Biocenter/DCAL, Max-von-Laue-Str. 9, D-60438 Frankfurt/Main, Germany (RM)

Published in Atlas Database: March 2012 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/inv11q13q23ID1585.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI inv11q13q23ID1585.txt

palliative care was administered. Clinics and pathology He died due to progressive disease. Disease Prognosis Infant acute lymphoblastic leukemia (ALL) Infant-ALL with 11q23 abnormality/MLL gene Epidemiology rearrangement has been defined as a type of leukemia with poor prognosis (Pieters et al., 2007). Poorly defined, only one case described to date, a 9- The patient relapsed at +5 months and died due to months-old boy with Pro-B ALL (FAB L1) (Alonso progressive disease. et al., 2010). Evolution Genetics Patient achieved complete remission on day 33 of Note treatment and 5 months since diagnosis presented a Fusion gene MLL-BTBD18 (Alonso et al., 2010) bone marrow relapse. was detected by LDI-PCR, as described (Meyer et The patient had no available compatible donor and al., 2005). he did not receive a second line treatment and

Partial G-banded karyogram for the inv(11)(q13q23), showing both chromosomes 11.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 501 inv(11)(q13q23) Mansini A, et al.

Split-FISH: The hybridization pattern for the chromosome with the MLL-BTBD18 rearrangement is one red/one green signal, while the yellow signal represents the germline MLL allele.

Cytogenetics Genes involved and Cytogenetics morphological proteins 46,XY,inv(11)(q13q23) as sole abnormality. MLL Cytogenetics molecular Location Split-FISH analysis revealed two signals 11q23 corresponding to the 3' and the 5' probes, both on DNA/RNA the long arm of chromosome 11 (Alonso et al., The Mixed-Lineage Leukemia gene consists of at 2010). least 37 exons, encoding a 3969 amino-acid nuclear Probes protein with a molecular weight of nearly 431 kDa. MLL Dual Color Break Apart Rearrangement Probe.

Schematic diagram of the exon/intron structure of the MLL gene (Nilson et al., 1996).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 502 inv(11)(q13q23) Mansini A, et al.

Fusion sequence of the MLL-BTBD18 fusion transcript.

Schematic diagram of the structure of the predicted MLL-BTBD18 fusion protein.

Protein acids retains a major portion of MLL, including 431 kDa; contains two DNA binding motifs (a AT those domains known to be essential for leukemic hook and Zinc fingers), and a DNA methyl transformation: the AT-hooks and the DNA transferase motif; wide expression; nuclear methyltransferase domain (DNMT). The C-terminal localisation; transcriptional regulatory factor. sequences are derived from the BTBD18 protein, a BTBD18 new fusion partner. The fusion occurred with in the BTB/POZdomain of BTBD18 (Alonso et al., 2010). Location 11q12.1 To be noted Protein Note 712 amino acids; 78 kDa. Additional cases are needed to delineate the epidemiology and prognosis of this entity, even Result of the chromosomal when MLL abnormalities are associated with poor anomaly prognosis, especially when they are identified in infant leukemias (Pieters et al., 2007). Hybrid gene Description References In frame fusion between the truncated MLL exon Nilson I, Löchner K, Siegler G, Greil J, Beck JD, Fey GH, 10 and the truncated BTBD18 exon 3. Marschalek R. Exon/intron structure of the human ALL-1 (MLL) gene involved in translocations to chromosomal Transcript region 11q23 and acute leukaemias. Br J Haematol. 1996 MLL-BTBD18. Jun;93(4):966-72 Detection van Dongen JJ, Macintyre EA, Gabert JA, Delabesse E, RT-PCR (van Dongen et al., 1999; Alonso et al., Rossi V, Saglio G, Gottardi E, Rambaldi A, Dotti G, 2010). Griesinger F, Parreira A, Gameiro P, Diáz MG, Malec M, Langerak AW, San Miguel JF, Biondi A. Standardized RT- Fusion protein PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal Description residual disease. Report of the BIOMED-1 Concerted Fusion protein of 1989 amino acids containing Action: investigation of minimal residual disease in acute 1374 codons from the amino-terminal region of leukemia. Leukemia. 1999 Dec;13(12):1901-28 MLL and 614 codons from the carboxy terminal Meyer C, Schneider B, Reichel M, Angermueller S, Strehl portion of the BTBD18 protein, plus "fusion codon" S, Schnittger S, Schoch C, Jansen MW, van Dongen JJ, Pieters R, Haas OA, Dingermann T, Klingebiel T, consisting of two nucleotides derived from the Marschalek R. Diagnostic tool for the identification of MLL MLL gene sequence and one from BTBD18 gene rearrangements including unknown partner genes. Proc sequence. The chimeric protein of 1989 amino Natl Acad Sci U S A. 2005 Jan 11;102(2):449-54

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 503 inv(11)(q13q23) Mansini A, et al.

Stogios PJ, Downs GS, Jauhal JJ, Nandra SK, Privé GG. Alonso CN, Meyer C, Gallego MS, Rossi JG, Mansini AP, Sequence and structural analysis of BTB domain proteins. Rubio PL, Medina A, Marschalek R, Felice MS. BTBD18: A Genome Biol. 2005;6(10):R82 novel MLL partner gene in an infant with acute lymphoblastic leukemia and inv(11)(q13;q23). Leuk Res. Pieters R, Schrappe M, De Lorenzo P, Hann I, De Rossi 2010 Nov;34(11):e294-6 G, Felice M, Hovi L, LeBlanc T, Szczepanski T, Ferster A, Janka G, Rubnitz J, Silverman L, Stary J, Campbell M, Li This article should be referenced as such: CK, Mann G, Suppiah R, Biondi A, Vora A, Valsecchi MG. A treatment protocol for infants younger than 1 year with Mansini A, Meyer C, Gallego MS, Rossi J, Rubio P, acute lymphoblastic leukaemia (Interfant-99): an Medina A, Marschalek R, Felice M, Alonso C. observational study and a multicentre randomised trial. inv(11)(q13q23). Atlas Genet Cytogenet Oncol Haematol. Lancet. 2007 Jul 21;370(9583):240-50 2012; 16(7):501-504.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 504

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Leukaemia Section Short Communication t(2;9)(q37;q34) Purvi M Kakadia, Stefan K Bohlander Center for Human genetics, Philipps University Marburg, Baldingerstrasse, Marburg, Germany (PMK, SKB)

Published in Atlas Database: March 2012 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0209q37q34ID1577.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t0209q37q34ID1577.txt

Identity Clinics Immature lymphoid blast population CD19+, Other names CD10+, with no co-expression of myeloid markers. INPP5D/ABL1 fusion SHIP1/ABL1 fusion Treatment Treated with Imatinib; a complete remission (CR) Clinics and pathology was obtained. Continued CR after bone marrow transplantation (Follow-up: 15 months). Disease c-ALL Cytogenetics Epidemiology Cytogenetics morphological Only one case known to date, a 18-year-old female Normal karyotype. This translocation would be patient. hard to detect using conventional cytogenetics.

Figure 1: FISH analysis: (I) Interphase nuclei showing four FISH signals for ABL1 (orange) with a commercial BCR/ABL-DCDF probe. (II) Schematic diagram showing the position of the BAC clones corresponding to the 3' and 5' portions of the SHIP1 and ABL1 genes, with the color scheme used for the fluorescent labelling of the SHIP1/ABL1 DCDF probes. The BAC clones for SHIP1 were labelled with FITC and those for ABL1 were labelled with Texas Red. (SHIP1 clones: A: RP13-497I2 and B: RP13- 916J2; ABL1 BAC clones: C: RP11-57C19 and D: RP11-835J22). (III-V) Interphase FISH demonstrating the presence of three fusion signals using the SHIP1-ABL1-DCDF probes (III), two SHIP1-ABL1 fusion signals, when SHIP1-ABL1 fusion specific probes were used (IV) and presence of one reciprocal ABL1/SHIP1 fusion using the ABL1-SHIP1 fusion specific FISH probe (V) in the patient sample. With all three probe combinations one normal copy of each the SHIP1 and ABL1 locus was also confirmed. The probes used for the hybridization are indicated below each image. The fusion signals (yellow) are indicated by arrows.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 505 t(2;9)(q37;q34) Kakadia PM, Bohlander SK

Cytogenetics molecular Domains: An N-terminal SH2 domain, an inositol phosphatase domain and two C-terminal protein ABL1 rearrangement observed in interphase cells interaction domains (Figure 3, upper box). but not on metaphase chromosomes by FISH using Expression: The expression of SHIP1 is restricted commercial BCR-ABL-DCDF probes (Abbott). to hematopoietic cells. FISH using SHIP-ABL-DCDF FISH probes Localization: Cytosol and plasma membrane; the showed two fusion signals indicating the SHIP1- localization of SHIP1 (cytosol vs. plasma ABL1 fusion and one fusion signal for the membrane) is regulated by its SH2 domain which reciprocal fusion on interphase cells. The mediates interaction with tyrosine phosphorylated rearrangement was not observed on the metaphase receptors. chromosomes, possibly because the malignant cells Function: SHIP1 is a phosphatase, which did not go into mitosis. hydrolyzes the 5-phosphates from phosphatidylinositol (3,4,5)-trisphosphate Genes involved and (Ptdins(3,4,5)P3; PIP3) and inositol-1,3,4,5 proteins tetrakisphosphate (Ins(1,3,4,5)P4; PIP4) (Damen et al., 1996), thereby negatively regulating the PI3K INPP5D (phosphoinositide 3-kinase) pathway. Location The PI3K pathway is part of many important 2q37.1 signalling pathways and regulates key cellular functions such as survival, proliferation, cell Note activation and cell migration (Krystal, 2000; Ward Other names: SHIP, SHIP1, SIP-145, hp51CN. and Cantrell, 2001; Ward, 2006). DNA/RNA SHIP1 regulates these important cellular functions Transcript variant 1: NM_001017915.1; 26 exons, by controlling PIP3 levels and Ras activity 4928 bp mRNA. following cytokine stimulation (Batty et al., 1985; Transcript variant 2: NM_005541.3; 26 exons, 4925 Damen et al., 1996). bp mRNA. Homology: Belongs to the inositol-1,4,5- There is also an INPP5D transcript variant trisphosphate 5-phosphatase family. described with 29 exons in the Ensembl database Contains an SH2 domain. (INPP5D-201 ENST00000359570). ABL1 Protein Location Proteins: Variant 1 contains 1189 aa and Variant 2 9q34 contains 1188 aa.

Figure 2: Partial sequence of the PCR product showing an in-frame fusion of SHIP1 with ABL1.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 506 t(2;9)(q37;q34) Kakadia PM, Bohlander SK

Figure 3: The upper two diagrams show the SHIP1 and the ABL1 proteins and the lower diagram depicts the SHIP1/ABL1 fusion protein. The arrows indicate the breakpoints in the individual proteins; numbers indicate amino acid positions. SH2: Src homology-2 domain; SH3: Src homology-3 domain; 5-ptase: Inositol 5-phosphatase domain; INPNY and ENPLY: Target sequences for the phospho tyrosine binding domains of other proteins; TK: Tyrosine kinase domain; DB: DNA binding domain; AD: Actin-binding domain.

Result of the chromosomal References anomaly Batty IR, Nahorski SR, Irvine RF. Rapid formation of inositol 1,3,4,5-tetrakisphosphate following muscarinic Hybrid gene receptor stimulation of rat cerebral cortical slices. Biochem Transcript J. 1985 Nov 15;232(1):211-5 Only SHIP1-ABL1 fusion transcript was detected. Damen JE, Liu L, Rosten P, Humphries RK, Jefferson AB, The reciprocal ABL1-SHIP1 fusion transcript was Majerus PW, Krystal G. The 145-kDa protein induced to associate with Shc by multiple cytokines is an inositol not detected. tetraphosphate and phosphatidylinositol 3,4,5-triphosphate Detection 5-phosphatase. Proc Natl Acad Sci U S A. 1996 Feb The SHIP1-ABL1 fusion transcript can be detected 20;93(4):1689-93 by 5' SHIP1 forward primer (bp 997-1015): 5'- Krystal G. Lipid phosphatases in the immune system. TTGCTGCACGAGGGTCCTG-3' and 3' ABL1 Semin Immunol. 2000 Aug;12(4):397-403 reverse primer (bp 1474-1454): 5'- Ward SG, Cantrell DA. Phosphoinositide 3-kinases in T TCTCCAGACTGTTGACTGGCG-3' resulting in lymphocyte activation. Curr Opin Immunol. 2001 477 bp PCR product. Jun;13(3):332-8 Ward SG. T lymphocytes on the move: chemokines, PI 3- Fusion protein kinase and beyond. Trends Immunol. 2006 Feb;27(2):80-7 Description Kakadia PM, Tizazu B, Mellert G, Harbott J, Röttgers S, The fusion protein leads to the constitutive Quentmeier H, Spiekermann K, Bohlander SK. A novel activation of the ABL1 tyrosine kinase facilitated ABL1 fusion to the SH2 containing inositol phosphatase-1 by the homo-di- and homo-heteromerization of the (SHIP1) in acute lymphoblastic leukemia (ALL). Leukemia. 2011 Oct;25(10):1645-9 fusion protein via the dimerization domain within the N-terminal SHIP1 portion contained in the This article should be referenced as such: fusion protein. Kakadia PM, Bohlander SK. t(2;9)(q37;q34). Atlas Genet Oncogenesis Cytogenet Oncol Haematol. 2012; 16(7):505-507. Constitutive activation of ABL1 tyrosine kinase activity and possibly inactivation of the putative tumor suppressor function of SHIP1.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 507

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Solid Tumour Section Short Communication

Myxoinflammatory fibroblastic sarcoma (MIFS) with t(1;10)(p22;q24) Karolin H Nord Department of Clinical Genetics, University and Regional Laboratories, Skane University Hospital, Lund University, Lund, Sweden (KHN)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Tumors/t0110p22q24MyoInfFibSID6369.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t0110p22q24MyoInfFibSID6369.txt

Identity Clinics and pathology Other names Disease MIFS was originally described as acral MIFS Myxoinflammatory fibroblastic sarcoma (MIFS) (Meis-Kindblom and Kindblom, 1998). Phenotype / cell stem origin Note MIFS is an intermediate malignant soft tissue tumor The origin of the tumor cells is unknown. Their usually located in the subcutaneous tissue of distal fibroblastic/myofibroblastic differentiation extremities (Kindblom et al., 2002). indicates that they derive from a mesenchymal Distant metastases are rare but the tumor has a precursor. propensity for multiple local recurrences. An Etiology identical t(1;10)(p22;q24) has been found in MIFS Unknown. and hemosiderotic fibrolipomatous tumor (HFLT) (Hallor et al., 2009; Antonescu et al., 2011). HFLT Epidemiology is an intermediate malignant tumor of uncertain MIFS is a rare soft tissue tumor which primarily differentiation, morphologically distinct from affects adults without any gender predilection. MIFS. In similarity with MIFS, HFLT has a predilection Clinics for superficial soft tissue of distal extremities and MIFS is an intermediate malignant tumor that present frequent local recurrences. usually presents as a slowly-growing, poorly- Despite their usually distinct morphology, there are delineated mass of the superficial soft tissue of tumors with mixed HFLT/MIFS histology (Elco et distal extremities (Kindblom et al., 2002). It is al., 2010). sometimes associated with pain and decreased These tumors also show a t(1;10) and suggest that mobility. In many cases the growth has been noted there are either different morphological variants or for a relatively long period of time before different levels of tumor progression of a sole diagnosis. MIFS may be confused with biological entity (Antonescu et al., 2011). inflammatory or post-traumatic lesions, benign or other malignant soft tissue tumors. Local Classification recurrences are common but distant metastases are very rare. Note MIFS is an intermediate malignant Pathology fibroblastic/myofibroblastic soft tissue tumor. MIFS show a poorly delineated, multinodular

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 508

Myxoinflammatory fibroblastic sarcoma (MIFS) with Nord KH t(1;10)(p22;q24) growth pattern with alternating myxoid and cellular t(1;10) and amplification of a region in proximal areas (Kindblom et al., 1998). There is a prominent chromosome arm 3p (Antonescu et al., 2011). inflammatory infiltrate that may obscure the neoplastic cells and cause misdiagnoses of a Cytogenetics reactive or inflammatory process. Tumor cells, including large polygonal and bizarre ganglion-like Cytogenetics Morphological cells with prominent inclusion-like nucleoli and The majority of cytogenetically analyzed MIFS variably sized, multivacuolated lipoblast-like cells, present a t(1;10)(p22;q24), or variants thereof may be scattered singly or form coherent clusters. (Mitelman Database of Chromosome Aberrations in Treatment Cancer 2012). Ring and/or giant marker chromosomes as well as The treatment for MIFS is surgical excision. aberrations involving chromosome 3 are also Prognosis associated with this disease. Local recurrences are common and their incidence Cytogenetics Molecular may depend on primary surgical treatment; multiple Fluorescence in situ hybridization analyses, using local recurrences may require eventual amputation probes flanking the genes TGFBR3 in chromosome (Kindblom et al., 2002). Distant metastases are, 1 and MGEA5 in chromosome 10, can be used as a however, exceedingly rare. diagnostic molecular test for MIFS and HFLT (Antonescu et al., 2011). Genetics Amplification of material from chromosome arm 3p Note can be detected by fluorescence in situ MIFS, HFLT and tumors with mixed MIFS/HFLT hybridization analyses and/or array-based genomic histology share the same genetic aberrations; copy number analyses (Hallor et al., 2009).

Partial karyotype with a t(1;10)(p22;q24) and rearrangement of 3p.

Fluorescence in situ hybridization, using probes flanking the TGFBR3 and MGEA5 genes, respectively, can be used to detect the t(1;10)(p22;q24). A normal chromosome 10 show signals from probes located on either side of MGEA5 (labeled in red and yellow). On the der(10)t(1;10) the proximal probe (yellow) is detected while the more distal probe (red) is deleted.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 509

Myxoinflammatory fibroblastic sarcoma (MIFS) with Nord KH t(1;10)(p22;q24)

DNA copy number analysis of a MIFS using array comparative genomic hybridization. A genome-wide copy number profile displays tumor/reference log2 ratios across the genome (top). Individual chromosomes are separated by vertical bars and chromosome 3 is labeled in yellow. The profile shows amplification of material from chromosome 3 and a few additional aberrations. Enlarged view of chromosome 3 shows two separate amplicons, the more proximal of these contains the VGLL3 gene (bottom). chromosomes in MIFS contain amplified material Genes involved and from chromosome 3. proteins The core amplicon harbors the gene VGLL3, which is also highly expressed in affected tumors (Hallor Note et al., 2009). The breaks in chromosomes 1 and 10 seem to occur This abnormality is, however, not specific for in, or close to, the genes TGFBR3 and MGEA5, MIFS/HFLT and have been found in additional respectively, and the translocation juxtaposes FGF8 sarcomas as well as other malignancies (Hélias- in chromosome 10 with TGFBR3 in chromosome 1 Rodzewicz et al., 2010). (Hallor et al., 2009). FGF8 is highly expressed, likely as a result of the VGLL3 rearrangement, in tumors affected by the Location translocation. Ring and giant marker 3p12

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 510

Myxoinflammatory fibroblastic sarcoma (MIFS) with Nord KH t(1;10)(p22;q24)

Fluorescence in situ hybridization analyses suggest that TGFBR3 is translocated from chromosome 1 and positioned in opposite direction next to the MGEA5 gene on the der(10)t(1;10) (Hallor et al., 2009).

Note biological processes (Thisse and Thisse et al., Amplification and high expression of VGLL3 in 2005). FGF8 is transcriptionally silent in most chromosome 3 is found in MIFS and HFLT as well normal adult tissues. However, upregulation of this as other sarcomas. gene has been associated with tumor growth and has been identified in carcinomas of the breast, DNA / RNA prostate, and ovary, as well as in synovial sarcoma VGLL3 is a protein coding gene located at position (Tanaka et al., 1998; Ishibe et al., 2005; Mattila et 86987119-87040269 in chromosome 3 al., 2007). (http://www.ensembl.org; human assembly GRCh37). There are three transcript variants of this Result of the chromosomal gene. The most extensive variant (transcript variant 1) comprises 10400 base pairs and consists of 4 anomaly coding exons. Hybrid Gene Protein VGLL3 encodes the protein vestigial like 3 Note (Drosophila). Translation of VGLL3 transcript The t(1;10) juxtaposes FGF8 in chromosome 10 variant 1 results in a 326 amino acid protein. There with TGFBR3 in chromosome 1 and the is not much known about the function of this rearrangement is associated with high expression of protein. However, it is believed that mammlian FGF8 (Hallor et al., 2009). vestigal like proteins could be involved in Description regulating members of the TEAD transcription The translocation does not result in a conventional factor family (Vaudin et al., 1999; Maeda et al., fusion gene. The functional outcome of the 2002). recurrent aberration seems to be high expression of FGF8 the gene FGF8 (Hallor et al., 2009). The consistent involvement of TGFBR3, but lack of fusion Location transcripts, suggest that regulatory sequences in 10q24 TGFBR3 are crucial for malignant transformation. Note Transcript The translocation between chromosomes 1 and 10 Rearrangements of TGFBR3 and MGEA5. juxtaposes FGF8 in chromosome 10 with TGFBR3 in chromosome 1. In tumors affected by the Detection translocation, FGF8 is highly expressed. Fluorescence in situ hybridization analysis using probes flanking the TGFBR3 and MGEA5 genes DNA / RNA can be applied as a molecular test for detecting FGF8 is a highly conserved gene located at position rearrangements of the genes (Antonescu et al., 103530081-103535827 in chromosome 10 2011). (http://www.ensembl.org; human assembly GRCh37). There are six transcript variants of this References gene and the alternating splicing results in products of 4-6 exons, which in turn encode proteins of 204- Meis-Kindblom JM, Kindblom LG. Acral myxoinflammatory 244 amino acids. The expression of FGF8 is fibroblastic sarcoma: a low-grade tumor of the hands and feet. Am J Surg Pathol. 1998 Aug;22(8):911-24 controlled by several regulatory sequences located both upstream and downstream of the gene Tanaka A, Furuya A, Yamasaki M, Hanai N, Kuriki K, (Beermann et al., 2006; Inoue et al., 2006). Kamiakito T, Kobayashi Y, Yoshida H, Koike M, Fukayama M. High frequency of fibroblast growth factor (FGF) 8 Protein expression in clinical prostate cancers and breast tissues, Fibroblast growth factor 8 belongs to the large immunohistochemically demonstrated by a newly established neutralizing monoclonal antibody against FGF family of fibroblast growth factors. Members of this 8. Cancer Res. 1998 May 15;58(10):2053-6 family are secreted molecules which by activating Vaudin P, Delanoue R, Davidson I, Silber J, Zider A. their receptors are involved in a variety of TONDU (TDU), a novel human protein related to the

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 511

Myxoinflammatory fibroblastic sarcoma (MIFS) with Nord KH t(1;10)(p22;q24)

product of vestigial (vg) gene of Drosophila melanogaster Growth Factor Rev. 2007 Jun-Aug;18(3-4):257-66. Epub interacts with vertebrate TEF factors and substitutes for Vg 2007 May 23. (REVIEW) function in wing formation. Development. 1999 Nov;126(21):4807-16 Hallor KH, Sciot R, Staaf J, Heidenblad M, Rydholm A, Bauer HC, Astrom K, Domanski HA, Meis JM, Kindblom Kindblom LG, Meis-Kindblom JM.. Myxoinflammatory LG, Panagopoulos I, Mandahl N, Mertens F.. Two genetic fibroblastic sarcoma. In Fletcher CDM, Unni KK, Mertens F pathways, t(1;10) and amplification of 3p11-12, in (Eds.). World Health Organization Classification of myxoinflammatory fibroblastic sarcoma, haemosiderotic Tumours. Pathology and Genetics of Tumours of Soft fibrolipomatous tumour, and morphologically similar Tissue and Bone. Lyon: IARC Press, 2002. lesions. J Pathol. 2009 Apr;217(5):716-27. Maeda T, Chapman DL, Stewart AF.. Mammalian vestigial- Elco CP, Marino-Enriquez A, Abraham JA, Dal Cin P, like 2, a cofactor of TEF-1 and MEF2 transcription factors Hornick JL.. Hybrid myxoinflammatory fibroblastic that promotes skeletal muscle differentiation. J Biol Chem. sarcoma/hemosiderotic fibrolipomatous tumor: report of a 2002 Dec 13;277(50):48889-98. Epub 2002 Oct 9. case providing further evidence for a pathogenetic link. Am J Surg Pathol. 2010 Nov;34(11):1723-7. Ishibe T, Nakayama T, Okamoto T, Aoyama T, Nishijo K, Shibata KR, Shima Y, Nagayama S, Katagiri T, Nakamura Helias-Rodzewicz Z, Perot G, Chibon F, Ferreira C, Y, Nakamura T, Toguchida J.. Disruption of fibroblast Lagarde P, Terrier P, Coindre JM, Aurias A.. YAP1 and growth factor signal pathway inhibits the growth of synovial VGLL3, encoding two cofactors of TEAD transcription sarcomas: potential application of signal inhibitors to factors, are amplified and overexpressed in a subset of molecular target therapy. Clin Cancer Res. 2005 Apr soft tissue sarcomas. Genes Chromosomes Cancer. 2010 1;11(7):2702-12. Dec;49(12):1161-71. Thisse B, Thisse C.. Functions and regulations of fibroblast Antonescu CR, Zhang L, Nielsen GP, Rosenberg AE, Dal growth factor signaling during embryonic development. Cin P, Fletcher CD.. Consistent t(1;10) with Dev Biol. 2005 Nov 15;287(2):390-402. Epub 2005 Oct 10. rearrangements of TGFBR3 and MGEA5 in both (REVIEW) myxoinflammatory fibroblastic sarcoma and hemosiderotic fibrolipomatous tumor. Genes Chromosomes Cancer. Beermann F, Kaloulis K, Hofmann D, Murisier F, Bucher P, 2011 Oct;50(10):757-64. doi: 10.1002/gcc.20897. Epub Trumpp A.. Identification of evolutionarily conserved 2011 Jun 29. regulatory elements in the mouse Fgf8 locus. Genesis. 2006 Jan;44(1):1-6. Mitelman F, Johansson B, Mertens F.. Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer. Inoue F, Nagayoshi S, Ota S, Islam ME, Tonou-Fujimori N, Mitelman F, Johansson B and Mertens F (Eds.), 2012. Odaira Y, Kawakami K, Yamasu K.. Genomic organization, http://cgap.nci.nih.gov/Chromosomes/Mitelman alternative splicing, and multiple regulatory regions of the zebrafish fgf8 gene. Dev Growth Differ. 2006 This article should be referenced as such: Sep;48(7):447-62. Nord KH. Myxoinflammatory fibroblastic sarcoma (MIFS) Mattila MM, Harkonen PL.. Role of fibroblast growth factor with t(1;10)(p22;q24). Atlas Genet Cytogenet Oncol 8 in growth and progression of hormonal cancer. Cytokine Haematol. 2012; 16(7):508-512.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 512

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Case Report Section Paper co-edited with the European LeukemiaNet t(17;21)(q11.2;q22) as a sole aberration in acute myelomonocytic leukemia Helena Podgornik, Peter Cernelc University medical center Ljubljana, Department of Haematology, Zaloska 7, 1000 Ljubljana, Slovenia (HP, PC)

Published in Atlas Database: February 2012 Online updated version : http://AtlasGeneticsOncology.org/Reports/t1721q11q22PodgornikID100063.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t1721q11q22PodgornikID100063.txt

Clinics Electron microscopy: Not done Diagnosis: Acute myelomonocytic leukemia Age and sex 87 years old male patient. Survival Previous history Date of diagnosis: 04-2011 No preleukemia, no previous malignancy, no inborn condition of note. Treatment: Symptomatic (antibiotics) Organomegaly Complete remission: no Treatment related death: no No hepatomegaly, nosplenomegaly, no enlarged Relapse : no lymph nodes, no central nervous system involvement. Status: Death Last follow up: 04-2011 Blood Survival: 1 month WBC: 30,6 X 109/l HB: 99 g/dl Karyotype 9 Platelets: 71 X 10 /l Sample: Bone marrow Blasts: 3% Bone marrow: 28% (of blasts) (Hypercellular; Culture time: 24h 28% of blasts; 20% of monocytic lineage, Banding: GTG dispoiesis in megakariocytic lineage and Results diserithropoiesis). 46,XY,t(17;21)(q11.2;q22)[19]/46,XY[1] Other molecular cytogenetics technics Cyto-Pathology FISH; LSI RUNX1/RUNX1T1, LSI MLL (Abbott); Classification WC 17, 21 (Kreatech) Other molecular cytogenetics results Cytology nuc ish(RUNX1T1x2,RUNX1x3)[130/200]; ish Acute myelomonocytic leukemia t(17;21)(WCP17+,WCP21+;WCP17+,WCP21+) Immunophenotype CD4- Other Molecular Studies /CD11c+/CD13+/CD14+/CD15+/CD33+/CD34+↓/ CD45+/ CD64+/CD65+/MPO+↓ Technics: PCR Rearranged Ig Tcr: - Results: FLT3-ITD - negative; NPM1 mutation - Pathology: Not done negative.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 513 t(17;21)(q11.2;q22) as a sole aberration in acute Podgornik H, Cernelc P myelomonocytic leukemia

Figure 1. Partial Karyograme with a balanced translocation t(17;21)(q11.2;q22).

Figure 2. GTG banded metaphase chromosomes.

Figure 3. FISH on previously GTG banded chromosomes (Fig. 2). WC 17 (aqua) and WC 21 (red) (Kreatech).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 514 t(17;21)(q11.2;q22) as a sole aberration in acute Podgornik H, Cernelc P myelomonocytic leukemia

Figure 4. Metaphase FISH by LSI AML1(RUNX1)/ETO(RUNX1T1) DNA probe (Abbott) with split signal for RUNX1 (green). On GTG banded metaphase normal 21 with the strong RUNX1 signal and both derivatives with split RUNX1 signals are indicated.

Comments References We report the first case of t(17;21)(q11.2;q22) as Roulston D, Espinosa R 3rd, Nucifora G, Larson RA, Le the sole anomaly in AML. This rare recurrent Beau MM, Rowley JD. CBFA2(AML1) translocations with novel partner chromosomes in myeloid leukemias: abnormality has been linked to treatment related association with prior therapy. Blood. 1998 Oct leukemia or MDS although it has been also found 15;92(8):2879-85 in de novo leukemia (Roulston et al., 1998; Nadal Kobzev YN, Martinez-Climent J, Lee S, Chen J, Rowley et al., 2008). Our patient had no previous history of JD. Analysis of translocations that involve the NUP98 gene cancer or preleukemia. Cytomorphology of bone in patients with 11p15 chromosomal rearrangements. marrow cells was, however consistent with Genes Chromosomes Cancer. 2004 Dec;41(4):339-52 dysplastic changes typical for s-AML. FISH Nadal N, Stephan JL, Cornillon J, Guyotat D, Flandrin P, analysis with probe specific for RUNX1 has been Campos L. RUNX1 rearrangements in acute myeloblastic done in two previous cases with leukemia relapsing after hematopoietic stem cell transplantation. Cancer Genet Cytogenet. 2008 Jan t(17;21)(q11.2;q22). While in one patient RUNX1 15;180(2):168-9 has been lost (Nadal et al., 2008) our result corresponds to the case of Roulston et al. (Roulston This article should be referenced as such: et al., 1998) where signals from RUNX1 were split Podgornik H, Cernelc P. t(17;21)(q11.2;q22) as a sole by the translocation. Due to his age and poor aberration in acute myelomonocytic leukemia. Atlas Genet physical condition our patient was not treated by Cytogenet Oncol Haematol. 2012; 16(7):513-515. intensive chemotherapy and he died within a month from diagnosis.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 515

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Instructions to Authors Manuscripts submitted to the Atlas must be submitted solely to the Atlas. Iconography is most welcome: there is no space restriction. The Atlas publishes "cards", "deep insights", "case reports", and "educational items". Cards are structured review articles. Detailed instructions for these structured reviews can be found at: http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes, http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias, http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours, http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases. According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews" (between), and "short communications" (texts below 400 words). The latter category may not be accepted for indexing by bibliographic databases. Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length restriction. Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in at least 1 case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings, and 4- with iconography of chromosomes. It is mandatory to use the specific "Submission form for Case reports": see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html. Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French, German, Italian, and Spanish are welcome.

Subscription: The Atlas is FREE!

Corporate patronage, sponsorship and advertising Enquiries should be addressed to [email protected].

Rules, Copyright Notice and Disclaimer Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to editors any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members must disclose any potential conflict. Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If complete anonymity is difficult to achieve, informed consent should be obtained. Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may, nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further the content of their papers published in the Atlas, provided that the source is cited. Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general distribution. All rights are reserved. The information presented is protected under international conventions and under national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty, express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose, and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein. See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical Publication - Updated October 2004": http://www.icmje.org.

http://AtlasGeneticsOncology.org

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS