Frequent Aberrant Methylation of the CDH4 Gene Promoter in Human Colorectal and Gastric Cancer

[CANCER RESEARCH 64, 8156–8159, November 15, 2004] Advances in Brief

Elena Miotto,1,2 Silvia Sabbioni,1 Angelo Veronese,2 George A. Calin,3 Sergio Gullini,4 Alberto Liboni,5 Laura Gramantieri,6 Luigi Bolondi,6 Eros Ferrazzi,7 Roberta Gafa`,1 Giovanni Lanza,1 and Massimo Negrini1,8 1Department of Experimental and Diagnostic Medicine, University of Ferrara, Ferrara, Italy; 2Istituto Oncologico Veneto, International Cancer Center, Molecular Biology Laboratories, Rovigo, Italy; 3Kimmel Cancer Institute, Thomas Jefferson University, Philadelphia, Pennsylvania; 4Department of Medicine, Section of Gastroenterology, University Hospital of Ferrara, Ferrara, Italy; 5Department of Surgical, Anesthesiology and Radiology Sciences, University of Ferrara, Ferrara, Italy; 6Department of Internal Medicine and Gastroenterology, University of Bologna, Bologna, Italy; 7Division of Medical Oncology, Hospital S. Maria della Misericordia, Rovigo, Italy; and 8Interdepartment Center for Cancer Research, University of Ferrara, Ferrara, Italy

Abstract adhesion-mediated signaling, which may enhance cell migration and proliferation, leading to cell invasion and metastasis. Gene promoter methylation causes loss of tumor suppressor genes Two members of the cadherin family have been linked to human function in human cancer. Here, we show that the CDH4 gene, a member tumorigenesis by mechanisms of functional inactivation: the epithelial of the cadherin family encoding for R-cadherin, contains a CpG island cadherin (E-cadherin) or cadherin-1 (CDH1) and the heart cadherin located at the 5؅ of the first exon, which functions as a promoter element (H-cadherin) or cadherin-13 (CDH13). Mutations in the CDH1 gene and is frequently affected by methylation in human cancer. By using methylation-specific PCR and reverse transcription-PCR in human can- have been observed in human gastric carcinoma cell lines, lobular cer cell lines, promoter methylation could be directly linked to loss of gene breast cancer, and familial gastric cancer (2, 3). Mutations in one expression. After treatment with the demethylating agent 5-aza-2-deoxy- allele of CDH1 is associated with a deletion in the other allele, cytidine, expression could be restored. Analysis of human primary tumors consistent with a two-hit mechanism of a classical tumor suppressor revealed that the CDH4 gene is methylated in 78% (38 of 49) of colorectal gene. Silencing E-cadherin expression in tumor cells is also achieved and 95% (20 of 21) of gastric carcinomas. CDH4 methylation was not by methylation of the CDH1 gene promoter, which has been observed detected in nonneoplastic colonic (0 of 10) and stomach (0 of 10) tissues or in human breast, lung, head and neck, colorectal, gastric, prostate, in peripheral blood (0 of 17). CDH4 methylation was detected in histolog- bladder, hepatocellular tumors, and hematopoietic malignancies (3– ically normal tissues located in proximity of the neoplasms, indicating that 5). Studies on cellular models and tumor samples revealed an invasion CDH4 methylation is an early event in gastrointestinal tumor progression. suppressor function for E-cadherin (6). The second member of the We also proved that CDH4 methylation can be revealed in the peripheral cadherin gene family silenced by promoter methylation is the CDH13 blood of cancer patients. Our results indicate that CDH4 may act as a gene, which encodes for the heart cadherin (H-cadherin). Aberrant tumor suppressor gene in human gastrointestinal tumors and can poten- methylation of the CDH13 promoter has been observed in human tially be used as an early diagnostic marker for gastrointestinal tumori- breast, lung, colorectal, cervical, cutaneous tumors, and chronic my- genesis. eloid leukemia (7–10). Here, we report that a third member of this family, the CDH4 gene, Introduction encoding for the retinal cadherin (R-cadherin), is frequently silenced Classical cadherins are membrane proteins characterized by five by promoter methylation in human gastrointestinal tumors, suggesting tandemly repeated extracellular cadherin domains and a well- that it may play a previously unsuspected function of tumor suppres- conserved cytoplasmic domain that interact with the catenins ␤-cate- sor gene. nin/Armadillo and p120ctn/␦-catenin. ␤-Catenin is connected to ␣- catenin, which in turn links the cadherin-catenin complex to the actin Materials and Methods cytoskeleton. Classical cadherins mediate cell-to-cell adhesion, and in Cell Lines. The cell lines used in this study (see Supplemental Table 1) Ͼ humans, 20 members with established or inferred function are were obtained from the American Type Culture Collection and grown in known. Cell adhesion is mediated through calcium-dependent ho- Iscove’s modified Dulbecco’s medium (Sigma-Aldrich, Milan, Italy) supple-

mophilic interactions between their extracellular domains. The stabil- mented with 10% fetal bovine serum (Sigma-Aldrich) at 37°C in 5% CO2 ity of these adhesive junctions is ensured by binding of the intra- atmosphere. cellular cadherin domains to the actin cytoskeleton (1). These 5-Aza-dC and Trichostatin Treatment. Treatment of cells with 5-aza-2- ␮ interactions are required for maintaining tissue architecture and cell deoxycytidine (Sigma-Aldrich) was carried out for 72 hours at 1 mol/L polarity and can limit cell movement and proliferation. Expression concentration. Drug was replaced every 24 hours. Trichostatin treatment was for 24 hours at 500 nmol/L. When combined with 5-aza-2-deoxycytidine, down-regulation of cadherin family members induces changes in the trichostatin treatment was added during the last 24 hours. Immediately after organization of the cytoskeleton, decreased adhesion, and aberrant treatments completion, cells were harvested for DNA and RNA purification. Tumor and Normal Primary Samples. Samples from primary tumors and Received 8/20/04; revised 9/14/04; accepted 10/8/04. nonneoplastic specimens were from colorectal, gastric, and blood tissues. Grant support: The Associazione Italiana per la Ricerca sul Cancro, the Italian Unselected gastric carcinomas and histologic normal mucosas in proximity of Ministero dell’Istruzione, dell’Universita`e della Ricerca, and the Regione Veneto Ricerca carcinoma were collected from 21 patients. Colorectal carcinomas were col- Sanitaria. The costs of publication of this article were defrayed in part by the payment of page lected from 49 patients. For 17 patients, mucosa located in proximity of tumor charges. This article must therefore be hereby marked advertisement in accordance with was available, and for 21 patients, peripheral blood was available. For an 18 U.S.C. Section 1734 solely to indicate this fact. additional 25 colorectal carcinoma patients, peripheral blood, but not primary Requests for reprints: Massimo Negrini, Dipartimento di medicina Sperimentale e tumor, was available. Additional tumor samples included 10 colon adenomas. Diagnostica, Universita` di Ferrara, Via Luigi Borsari 46, 44100 Ferrara, Italy. Phone: 39-0532-291399; Fax: 39-0532-247618; E-mail: [email protected]. Normal controls included biopsies of stomach mucosa from 10 patients with ©2004 American Association for Cancer Research. gastric ulcers and colon mucosa from 10 patients with diverticulosis. All 8156

Table 1 Oligonucleotides for methylation-specific PCR at the CDH4 gene promoter Primer forward Nucleotide sequence Primer reverse Nucleotide sequence Product size (bp) Annealing Temp. (°C) Cycles cdh4_MF CGTTTTTAAGGTTCGCGTCG cdh4_MR GAAAACCCGCTCCCTACC 336 57 42 cdh4_M3F TTTGTAGTTTCGAGCGCGC cdh4_MR GAAAACCCGCTCCCTACC 245 57 40 cdh4_UF GTGTTTTTAAGGTTTGTGTTGG cdh4_UR AAAAACCCACTCCCTACC 327 55 40

patients included in the study had a histologic confirmed diagnosis. Peripheral Results blood from 17 healthy volunteers was also collected. Informed consent was obtained from each subject included in the study. Human Cancer Cell Lines Methylated at the CDH4 Promoter. DNA Purification and Methylation-specific PCR. Genomic DNA was The region with CDH4 promoter activity (Supplemental Information isolated from cell lines and tissue by standard treatment with SDS and EDTA and Supplemental Fig. 1) presents a dense CpG island spanning about in the presence of 200 ␮g/mL proteinase K, followed by phenol/chloroform 2 kb around the first exon (Fig. 1b). To determine whether aberrant extraction and etomidate precipitation. DNA from peripheral blood was iso- methylation occurs at this region, we analyzed 21 human tumor cell lated with the Wizard genomic DNA purification kit (Promega, Milan, Italy) in lines by methylation-specific PCR with the primer set MF/MR (Table accordance with the manufacturer’s instructions. The methylation status of 1). Fifty-seven percent (12 of 21) of the cell lines revealed methyla- CDH4 promoter was determined by methylation-specific PCR as described by tion at the CDH4 promoter (Fig. 1C and Supplemental Table 1). Herman et al. (11). The oligonucleotides for amplification of CDH4 promoter Nucleotide sequence of PCR products confirmed the methylation of region are shown in Table 1. PCR amplifications were carried out by using all of the cytosines within CpG dinucleotides. We also analyzed the MF/MR or UF/UR for amplifying methylated or nonmethylated alleles, re- expression of the CDH4 gene by reverse transcription-PCR in 10 cell spectively. To increase detection sensitivity, a semi-nested PCR was carried lines: 6 with CDH4 methylation and 4 lacking CDH4 methylation. out on MF/MR PCR product by using M3F/MR primers. PCR reactions were The CDH4 gene was silent in the methylated cell lines, whereas it was performed with the HotStar Taq polymerase (Qiagen, Milan, Italy) in a total expressed in the unmethylated cell lines, implicating a direct relation- ␮ volume of 12 L with the following conditions: 40 cycles of denaturation at ship between promoter methylation and loss of CDH4 gene transcrip- 95°C for 30 seconds, annealing at 57°C for 30 seconds, and extension at 72°C tion (Fig. 1C). To confirm the role of DNA methylation in gene for 1 minute. transcriptional repression, we treated HeLa cells, where CDH4 is RNA Purification and Reverse Transcription-PCR. Total RNA was methylated, with the demethylating agent 5-aza-2-deoxycytidine prepared with the TRIzol Reagent (Invitrogen-Life Technologies, Inc., Carls- bad, CA) in accordance to manufacturer’s instructions. RNA was reverse alone or in combination with trichostatin. Indeed, demethylation of transcribed with Superscript II Reverse Transcriptase (Invitrogen-Life Tech- the CDH4 promoter restored gene transcription, demonstrating that nologies, Inc.) in the presence of oligo-dT and random primers. The primers CDH4 promoter methylation was responsible for gene silencing used for CDH4 cDNA amplification were as follows: cdh4_249F (5Ј-GTT- (Fig. 1D). GGGGCAGATGGGACAGT-3Ј) and cdh4_547R (5Ј-ACGTTGAT- CDH4 Promoter Methylation in Human Primary Gastrointes- GGGCGGGATGAC-3Ј). Expected size of PCR product was 298 nucleotides. tinal Neoplasms. We investigated the presence of aberrant methyla- Nucleotide sequence was performed to confirm specificity of reverse transcription at the CDH4 promoter in primary gastrointestinal neoplasms. tion-PCR products. All PCR reactions were performed with Hot Start Taq Results are summarized in Table 2. By using methylation-specific polymerase (Qiagen) in a total volume of 12 ␮L, with the following conditions: PCR with the MF/MR primer set (Table 1), we analyzed 49 colorectal 35 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 and 21 gastric carcinomas: 78% (38 of 49) of the colon and 95% (20 seconds, and extension at 72°C for 30 seconds. of 21) of the gastric carcinoma samples were methylated at the CDH4

Fig. 1. CDH4 gene promoter methylation in human cancer cell lines correlates with loss of gene transcription. A, CDH4 gene structure. B, CpG island present at the promoter region. The diagram shows the first two exons; the vertical bars indicate the CpG dinucleotides present in the region. The CpG island spans the 5Ј-region, the first exon and intron. The small arrows below the CpG island indicate the sequences amplified by methylation- specific PCR with the MF/MR set of primers or the semi-nested M3F/MR (see Table 1). C, human cell lines analyzed for CDH4 promoter methylation and for gene expression. The cell lines with methylation at the CDH4 promoter (HeLa, SiHa, MCF-7, SkLu-1, BT-20, and RKO) did not express the gene. The cell lines where the CDH4 promoter is not methylated (HEY, G401, 293, and MDA-MB- 231) showed a normal CDH4 transcription. D, expression of the CDH4 gene in HeLa cells after treatment with the demethylating drug 5Ј-aza-2- deoxycytidine (5-Aza-dC) [alone or in combination with trichostatin (TSA)]. Demethylation was detected by the use of the cdh4_UF/UR primer set. Expression was detected by reverse transcription- PCR with primers cdh4_249F/cdh4_547R Dem- ethylation of the CDH4 promoter correlated with restoration of CDH4 expression. Marker, 123 bp ladder.

8157

Table 2 Methylation of CDH4 locus in tumor and normal tissue blood of healthy donors showed any evidence of CDH4 promoter Sample Percentage methylation. Stomach Carcinoma 95.2 (20/21) Mucosa in proximity of tumor 81.0 (17/21) Discussion Carcinoma 77.5 (38/49) Colon Mucosa in proximity of tumor 29.4 (5/17) Changes in the status of DNA methylation at CpG islands of gene Adenoma 100.0 (10/10) promoters are common molecular alterations found in human Blood 69.6 (32/46) Stomach normal mucosa 0.0 (0/10) neoplasia (12, 13). Tumor suppressor genes, whose promoters are Normal tissue Colon normal mucosa 0.0 (0/10) nonmethylated in normal tissues, are frequently inactivated by Peripheral blood lymphocytes 0.0 (0/17) promoter methylation in human cancer. Here, we report that the CDH4 gene (R-cadherin) is one of the genes most frequently repressed by promoter methylation in human gastrointestinal promoter. To establish whether CDH4 aberrant promoter methylation tumors, suggesting that CDH4 may act as a tumor suppressor gene. is an early event during neoplastic progression, we investigated 10 This report represents the first connection between CDH4 and colorectal adenomas and 38 histologically normal mucosas located in human cancer. Analysis of several cell lines revealed a direct proximity of the analyzed tumors. All adenomas displayed methyla- relation between methylation of the promoter and loss of CDH4 tion of the CDH4 promoter. Among the histologic normal mucosas, gene expression. Indeed, CDH4 promoter demethylation, achieved 17 of 21 gastric (81%) and 5 of 17 colonic mucosas (29%) showed by treatment with the demethylating agent 5Ј-aza-deoxycytidine, evidence of aberrant methylation. As controls, we analyzed 10 DNA restored gene expression. Aberrant CDH4 gene promoter methyl- from biopsies of individuals undergoing gastroscopy or colonscopy ation was not limited to in vitro established tumor cell lines but for clinical conditions not associated with tumors (suspect gastric was also present at high frequency in primary human gastrointes- ulcers and diverticulosis). In all these nonneoplastic samples, we did not tinal tumors. Given that no aberrant methylation was detectable in detect changes in the methylation of the CDH4 promoter (Fig. 2A). normal control tissues, these results strongly suggest an in vivo To verify the usefulness of CDH4 promoter methylation as a potential tumor suppression function for the CDH4 gene. cancer-specific marker detectable in biological fluids, we collected 46 This gene, as a member of the cadherin family, is a cell surface DNA from peripheral blood of colorectal cancer patients. We per- glycoprotein involved in cell adhesion, which makes conceivable that formed the analysis by a semi-nested PCR approach: a primary PCR its loss in gastric and colon cancer may enhance cell migration, with the MF/MR primer set, followed by a secondary PCR with the invasion, and metastasis. Other cadherin family members, as with M3F/MR primer set (Table 1). This analysis revealed the presence of CDH1 encoding for the E-cadherin and CDH13 encoding for the CDH4 methylation in 32 of 46 samples (70%). In 21 patients, we H-cadherin, lose their expression in several types of human cancer by could correlate the observed methylation status in peripheral blood promoter methylation (7, 8). E-cadherin is considered a “cell inva- with that in primary tumors. Results revealed an almost complete sion-suppressor.” Its loss causes the disruption of tight epithelial matching between the two tissues with a 100% specificity and 90% cell-cell contacts, which facilitates the release of cells from primary sensitivity: among the 12 patients with CDH4 methylation in tumors, tumor. Indeed, E-cadherin functional elimination represents a key step 10 displayed methylation in peripheral blood; among the 9 patients in the acquisition of the invasive phenotype for many tumors (7, 8). with tumors negative for CDH4 methylation, none displayed methy- Similarly, loss of H-cadherin expression may have a tumor-suppres- lation in peripheral blood (Fig. 2B). None of 17 DNA from peripheral sive function. H-Cadherin, although it lacks an intracellular domain,

Fig. 2. CDH4 promoter methylation in tumor and normal samples. A, analysis of gastric and colorectal carcinomas, histologic normal tissues located in proximity of the neoplasms, normal mucosas of nonneoplastic patients, and colorectal adenomas. CDH4 methylation was detected by methylation-specific PCR with the MF/MR primers set. B, CDH4 promoter methylation detected in peripheral blood of colorectal cancer patients. Representative results of CDH4 promoter methylation identified in colorectal carcinoma and in peripheral blood of the same patients by using MF/MR, followed by M3F/MR primers sets in a semi-nested PCR reaction. Marker, 123 bp ladder; pos, positive control is here represented by HeLa cells; neg, no DNA, PBL, DNA from peripheral blood lymphocytes. 8158

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2004 American Association for Cancer Research. CDH4 PROMOTER METHYLATION IN GASTROINTESTINAL CANCER maintains its adhesive properties, and its ectopic expression in the samples versus normal tissues among 16 known methylation markers human breast cancer cell line MDA-MB-435 was shown to inhibit (24). Here, we show that frequency of CDH4 aberrant methylation is tumor growth in nude mice (14). These findings indicate that the similar to TPEF. It is an early event in tumor progression and can be inactivation of cadherin family genes are critical events in favoring detected with high specificity and sensitivity in circulating DNA, the spreading of tumor cells. indicating that it represents a powerful marker for colorectal and However, cadherins are not always associated with human cancer gastric cancer. Its identification expands the panel of highly inform- by loss-of-function mechanisms. E-Cadherin expression does not al- ative DNA methylation markers that can be used for the early detec- ways indicate a nonaggressive phenotype. For example, ovarian car- tion of cancer by using noninvasive diagnostic approaches. cinomas arising from an epithelium that normally expresses N- Acknowledgments cadherin switch to E-cadherin during malignant transformation (15). Expression of N-cadherin, which becomes up-regulated in various We thank Augusto Bevilacqua, Pietro Zucchini, Annalisa Peverati, and Iva invasive tumor cell lines (16), has been linked to an enhanced invasive Pivanti for the excellent technical assistance. capacity in bladder, breast, and colon tumors (16), possibly by pro- References moting adhesion of tumor cells with the stroma (17). These findings suggested that not only the loss of cadherin expression but also 1. Cavallaro U, Christofori G. Cell adhesion and signalling by cadherins and Ig-CAMs in cancer. Nat Rev Cancer 2004;4:118–32. aberrant expression of normally not expressed cadherins may alter 2. Hirohashi S. Inactivation of the E-cadherin-mediated cell adhesion system in human adhesive properties of epithelial cells and cause an increase in cell cancers. Am J Pathol 1998;153:333–9. motility and invasion (8). 3. Graziano F, Humar B, Guilford P. The role of the E-cadherin gene (CDH1) in diffuse gastric cancer susceptibility: from the laboratory to clinical practice. Ann Oncol R-Cadherin expression has been detected in various tissues, includ- 2003;14:1705–13. ing nervous system, skeletal muscle, smooth muscle, pancreas, gas- 4. Perl AK, Wilgenbus P, Dahl U, Semb H, Christofori G. A causal role for E-cadherin in the transition from adenoma to carcinoma. Nature (Lond.) 1998;392:190–3. trointestinal tract, and kidney (18–20). R-Cadherin has a role in the 5. Van Aken E, De Wever O, Correia da Rocha AS, Mareel M. Defective E-cadherin/ development of brain, kidney, and striated muscle (19, 20). It was catenin complexes in human cancer. Virchows Arch 2001;439:725–51. associated with mesenchymal to epithelial transition in the kidney 6. Vleminckx K, Vakaet L Jr, Mareel M, Fiers W, van Roy F. Genetic manipulation of E-cadherin expression by epithelial tumor cells reveals an invasion suppressor role. (19) and was found to establish an adhesive code for the guidance of Cell 1991;66:107–19. pioneering axons in early brain development (21). It is also notewor- 7. Hajra KM, Fearon ER. Cadherin and catenin alterations in human cancer. Genes thy that expression of R-cadherin in embryonic stem cells lacking Chromosomes Cancer 2002;34:255–68. 8. Hazan RB, Qiao R, Keren R, Badano I, Suyama K. Cadherin switch in tumor E-cadherin can rescue striated muscle and epithelia, implicating an progression. Ann NY Acad Sci 2004;1014:155–63. important role in the formation of these tissues (19). 9. Toyooka S, Toyooka KO, Harada K, et al. Aberrant methylation of the CDH13 (H-cadherin) promoter region in colorectal cancers and adenomas. Cancer Res 2002; In normal gastrointestinal epithelial tissues, R-cadherin appears to 62:3382–6. play an important role in maintaining tissue architecture and cell 10. Takeuchi T, Misaki A, Sonobe H, Liang SB, Ohtsuki Y. Is T-cadherin (CDH13, polarity (18). Hence, R-cadherin loss in tumor samples suggest a H-cadherin) expression related to lung metastasis of osteosarcoma? Histopathology 2000;37:193–4. direct role in the pathogenesis of gastrointestinal neoplasms, possibly 11. Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific in consequence of the reduction of adhesiveness of epithelial cells that PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci normally express R-cadherin. In addition, because R-cadherin can USA 1996;93:9821–6. 12. Baylin SB, Herman JG. DNA hypermethylation in tumorigenesis: epigenetics joins form not only homophylic dimers, but it can also interact with genetics. Trends Genet 2000;16:168–74. N-cadherin (22), it is tempting to speculate that normal R-cadherin 13. Jones PA. DNA methylation and cancer. Oncogene 2002;21:5358–60. 14. Lee SW, Reimer CL, Campbell DB, et al. H-cadherin expression inhibits in vitro expression might function to limit the invasive potential associated invasiveness and tumor formation in vivo. Carcinogenesis (Lond.) 1998;19:1157–9. with epithelial cells expressing N-cadherin and its loss might release 15. Wong AS, Maines-Bandiera SL, Rosen B, et al. Constitutive and conditional cadherin this capability. expression in cultured human ovarian surface epithelium: influence of family history of ovarian cancer. Int J Cancer 1999;81:180–8. Because of the high frequency, the appearance at an early stage of 16. Hazan RB, Phillips GR, Qiao RF, Norton L, Aaronson SA. Exogenous expression of cancer progression and the absence in nonneoplastic tissues, the N-cadherin in breast cancer cells induces cell migration, invasion, and metastasis. CDH4 promoter methylation could be used as an early diagnostic J Cell Biol 2000;148:779–90. 17. Hazan RB, Kang L, Whooley BP, Borgen PI. N-Cadherin promotes adhesion between marker for human gastrointestinal tumors. Methylation changes in invasive breast cancer cells and the stroma. Cell Adhes Commun 1997;4:399–411. circulating DNA represent one of the most promising tools for early 18. Sjodin A, Dahl U, Semb H. Mouse R-cadherin: expression during the organogenesis of pancreas and gastrointestinal tract. Exp Cell Res 1995;221:413–25. diagnosis and risk assessment of cancer patients. By methylation- 19. Rosenberg P, Esni F, Sjodin A, et al. A potential role of R-cadherin in striated muscle specific PCR (11), it is possible to readily reveal 1 methylated allele formation. Dev Biol 1997;187:55–70. in a background of 1000 unmethylated alleles, allowing the detection 20. Dahl U, Sjodin A, Larue L, et al. Genetic dissection of cadherin function during nephrogenesis. Mol Cell Biol 2002;22:1474–87. of neoplastic cells in a background of normal cells. A list of known or 21. Andrews GL, Mastick GS. R-cadherin is a Pax6-regulated, growth-promoting cue for candidate tumor suppressor genes inactivated by promoter methyla- pioneer axons. J Neurosci 2003;23:9873–80. tion is growing, and their detection in serum, plasma, or other body 22. Shan WS, Tanaka H, Phillips GR, et al. Functional cis-heterodimers of N- and R-cadherins. J Cell Biol 2000;148:579–90. fluids of cancer patients has been proven (23). We have recently 23. Laird PW. The power and the promise of DNA methylation markers. Nat Rev Cancer reported that methylation at the transmembrane protein containing 2003;3:253–66. 24. Sabbioni S, Miotto E, Veronese A, et al. Multigene methylation analysis of gastro- epidermal growth factor and follistatin domains (TPEF) gene exhib- intestinal tumors: TPEF emerges as a frequent tumor-specific aberrantly methylated ited the best ratio of discrimination between gastrointestinal tumor marker that can be detected in peripheral blood. Mol Diagn 2003;7:201–7.

8159

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2004 American Association for Cancer Research. Frequent Aberrant Methylation of the CDH4 Gene Promoter in Human Colorectal and Gastric Cancer

Elena Miotto, Silvia Sabbioni, Angelo Veronese, et al.

Cancer Res 2004;64:8156-8159.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/64/22/8156

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2005/01/25/64.22.8156.DC1

Cited articles This article cites 24 articles, 6 of which you can access for free at: http://cancerres.aacrjournals.org/content/64/22/8156.full#ref-list-1

Citing articles This article has been cited by 7 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/64/22/8156.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/64/22/8156. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.