DOCSLIB.ORG

PHYLOGENETIC ANALYSIS of Sphaerirostris Picae (ACANTHOCEPHALA: CENTRORHYNCHIDAE) BASED on LARGE and SMALL SUBUNIT RIBOSOMAL DNA GENE

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PHYLOGENETIC ANALYSIS of Sphaerirostris Picae (ACANTHOCEPHALA: CENTRORHYNCHIDAE) BASED on LARGE and SMALL SUBUNIT RIBOSOMAL DNA GENE International Journal of Parasitology Research ISSN: 0975-3702 & E-ISSN: 0975-9182, Volume 4, Issue 2, 2012, pp.-106-110. Available online at http://www.bioinfo.in/contents.php?id=28. PHYLOGENETIC ANALYSIS OF Sphaerirostris picae (ACANTHOCEPHALA: CENTRORHYNCHIDAE) BASED ON LARGE AND SMALL SUBUNIT RIBOSOMAL DNA GENE RADWAN N.A. Department of Zoology, Faculty of Science, University of Tanta, Tanta, Egypt. *Corresponding Author: Email- [email protected] Received: December 10, 2012; Accepted: December 18, 2012 Abstract- The purpose of the present study was to add new 18S and 28S DNA gene sequences data to Sphaerirostris picae (Rudolphi, 1819) Golvan, 1960 and analyze the generated sequences to define the taxonomic placement of genus Sphaerirostris and providing a better resolution inside the Palaeacanthocephala. Two regions: 18S and 28S of nuclear ribosomal DNA of S. picae were amplified using polymerase chain reaction and sequenced following the instructions of GATC German company facility. Mealign module in the DNAStar Lasergene V7 was used to design a forward and reverse primer of 28S DNA gene. 18S and 28S DNA gene sequences of S. picae were aligned with sequences for both genes of Palacanthocephalans retrieved from GenBank. Results were analyzed using distance matrix methods UPGMA. The resulting phylogenetic trees suggest a paraphyletic arrangement of the two Palaeacanthocephala orders; Echi- norhynchida and Polymorphida depending on the placement of the three echinorhynchids, Transvena, Rhadinorhynchus and Gorgorhyn- choides in the polymorphid clade. The present study is the first to generate gene sequences of genus Sphaerirostris and discuss its rela- tionships within Palaeacanthocephala. Further comprehensive studies should be done for other species of genus Sphaerirostris and fami- ly Centrorhynchidae as all based on molecular phylogenetic analysis to solve their taxonomic overlapping. Keywords- Sphaerirostris picae, Acanthocephala, Ribosomal DNA, Degenerate primer, Phylogenetic analysis Citation: Radwan N.A. (2012) Phylogenetic Analysis of Sphaerirostris picae (Acanthocephala: Centrorhynchidae) Based on Large and Small Subunit Ribosomal DNA Gene. International Journal of Parasitology Research, ISSN: 0975-3702 & E-ISSN: 0975-9182, Volume 4, Issue 2, pp.-106-110. Copyright: Copyright©2012 Radwan N.A. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited. Introduction classification based on the structure of the proboscis and shape and number of its hooks is not consistent with phylogenetic rela- Acanthocephalans have been related to Rotifera, Nematoda, tionships [3]. Nematomorpha and Gastrotricha [1]. Most phylogenetic analyses of phylum Acanthocephala, based on structural and molecular Amin, et al. [7] reported that, since the erection of Sphaerirostris data, have focused on its relationships to other invertebrate phyla, (family Centrorhynchidae) as a subgenus of Centrorhynchus Lűhe, however studies deal with the inter-relations between different 1911 [8], its taxonomy has been in a state of confusion and largely Acanthocephala families and species with uncertain taxonomy are dependent on the use of proboscis armature, especially the num- still out of focus. ber of proboscis hooks rows. This character has proven to be ex- tremely variable through the genus, so a good number of synony- Verweyen, et al. [2] reported that the first molecular phylogenetic mies were made. The authors accelerated that this genus is in analyses of Acanthocephala made by Garey, et al. [3] confirmed need to a serious taxonomic revision that will be enhanced by dif- the major taxonomic grouping of the traditional classifications. In ferent types of analyses based on the molecular criteria. this grouping, Palaeacanthocephala is placed close to the Eoacan- thocephala, with the Archiacanthocephala being the most basal The purpose of the present study was to add new 18S and 28S taxon. According to Herlyn, et al. [4], the monophyly of the Pal- DNA gene sequences data to S. picae as a member of the family aeacanthocephala is still a matter of debate. Consequently, the Centrorhynchidae (Paleacanthocephala). Such data may help in assumed phylogeny of taxa within the Acanthocephala varies, plac- understanding and defining the taxonomic placement of genus ing either archiacanthocephalans [1,5] or palaeacanthocephalans Sphaerirostris and providing a better resolution inside the Pal- [6] at the base of the taxon. aeacanthocephala. The phylogenetic relationships of S. picae were examined with 21 acanthocephalan species belonging to 9 related Molecular data using 18S and/or 28S DNA gene sequences of families that all are belongings to the class Palaeacanthocephala, family Centrorhynchidae are very limited and has indicated that the International Journal of Parasitology Research ISSN: 0975-3702 & E-ISSN: 0975-9182, Volume 4, Issue 2, 2012 || Bioinfo Publications || 106 Phylogenetic Analysis of Sphaerirostris picae (Acanthocephala: Centrorhynchidae) Based on Large and Small Subunit Ribosomal DNA Gene. as inferred from partial 18S and 28S DNA sequences. The study forward.5´ GGGCCGTAGACGACCAAGTGTT -3´ and used an algorithm ClustalW2 for designing degenerate primers reverse. 5´GGAAAGCGCTCGCCAAGTTATT 3´ [2]. which are of particular value in amplifying homologous genes from The second is 28S DNA gene using degenerate designed primers: different organisms. forward 5´GTAA\G CGGCGAGTGAACTGGGAAG\TA -3´ and Materials and Methods reserve 5´TA\CACACTCGGACTAGAA A\C C A\C CA 3´. Specimen and DNA Isolation PCR mixture (50µl) contained 25µl Maxima Hot Start PCR Master S. picae was collected from the small intestine of the Hooded crow Mix (Fermentas), 1μl final concentration of each primer, 17μl nucle- Corvus corone cornix, Linnaeus 1758, which is a common resident ase-free and 6μl of template DNA solution. PCR cycling parameter inhibiting cultivated land and wooded terrain in Nile Delta and val- for 18S DNA gene included initial denaturation period at 95°C for ley in Egypt. For identification, worms were preserved in 70% etha- 10 min, annealing at 58°C for 1 min and extension at 72°C for 45 nol, stained with Mayer’s carmine, mounted in Canada balsam [9] seconds followed by another 35 cycles at the same denaturation, and identified according to Dimitrova, et al. [10,11]. Specimens annealing and extension temperatures and finished with a 10 min were stored at -20°C until nucleic acid was extracted. DNA extrac- final extension at 72°C (after the modification of Garey, et al. [2]). A tion followed Chloroform-Isoamyl alcohol method [12]. Three repli- negative control (no template) was also performed for every PCR ca each of one worm were homogenized on ice in TE buffer (10 run to determine any potential contamination of the PCR products. mM Tris–HCl, pH 7.5, 10 mM NaCl, 1 mM EDTA) and digested by PCR products were evaluated by electrophoresis of 4µl PCR mix- adding 400µl of TE buffer, 40µl 10% sodium dodecyl sulphate ture through 1% agarose gel against I Kb ladder (Fementas), and (SDS) and 10µl of 20mg/ml protienase K, then incubated in 55°C cleaned up using Gene JET™ PCR purification Kit (fermentas) and overnight. The supernatant was extracted twice with buffered phe- the purified DNA was stored at -20°C. 2µl of PCR product was nol (pH 8.0) and once with chloroform/isoamyl alcohol (24:1). The sequenced using an ABI big dye terminator kit following the instruc- aqueous layer (~ 400µl) was collected and 16µl of 5 M NaCl and tions of GATC German company facility and an ABI 3730xl DNA 420µl ice cold isopropanaol were added. The sample was cooled sequencer . in the refrigerator at -20°C for 10 min and centrifuged for 5 min at 15,000 rpm. The supernatant was poured off and after complete Phylogenetic Analysis drying of the pellet, 50µ of the TE buffer was added and left for 30 In addition to the 18S and 28S DNA gene sequences generated in min to complete dissolving. The sample was stored at -20°C till this study, additional 21 sequences for 18S DNA and 16 for 28S use. DNA genes of other Paleacanthocephalans and one out group Designing the Degenerate Primers of 28S DNA Gene were obtained from the GenBank [Table-1]. The ClustalW2 algo- rithm was used to visualize the consensus sequences and the The DNA sequences of 28S DNA gene of 23 species accession dendogram. The dendograms were built depending on the molecu- numbers from AB500157.1 to AB500179.1 were retrieved from the lar based evolution set by Pearson and Lipman [15]. The matrix sequence database of NCBI. FASTA file format of the previous methods UPGMA (Unweighted-Pair-Group Methods with Arithmetic sequences was used in the algorithm type of the Blast (Basic local Mean) was used to present the dendrograms and the relation be- alignment search tool). Expected values (E-values) was calculated tween homologous sequences based on the produced multiple to infer homology and distance of similarity between the sequences sequence alignment [16]. [13]. Results The mealign module implentend in the DNAStar Lasergene V7 used the Clustal W2 algorithm for alignment collected sequences DNA Sequencing and Data Set and produced the conserved blocks, which were used to design the degeneracy primers. All primer characteristics were adjusted. Pri- The sequence obtained for 18S DNA is a 385 nucleotides long mer Blast tool [14] was used to detect the homology
Load more

Recommended publications
  • Acanthocephala: Rhadinorhynchidae) from the Red Porgy Pagrus Pagrus (Teleostei: Sparidae) of the Red Sea, Egypt: a Morphological Study
    Acta Parasitologica Globalis 9 (3): 133-140 2018 ISSN 2079-2018 © IDOSI Publications, 2018 DOI: 10.5829/idosi.apg.2018.133.140 Serrasentis Sagittifer Linton, 1889 (Acanthocephala: Rhadinorhynchidae) from the Red Porgy Pagrus pagrus (Teleostei: Sparidae) of the Red Sea, Egypt: A Morphological Study 11Nahed Saed, Mahrashan Abdel-Gawad, 2Sahar El-Ganainy, 21Manal Ahmed, Kareem Morsy and 3Asmaa Adel 1Zoology Department, Faculty of Science, Cairo University, Cairo, Egypt 2Zoology Department, Faculty of Science, Minia University, Minya, Egypt 3Zoology Department, Faculty of Science, South Valley University, Qena, Egypt Abstract: In the present study, an acanthocephalan parasite was recovered from the intestine of the red porgy Pagrus pagrus (Sparidae) captured from water locations along the Red Sea at Hurghada coasts, Egypt. The parasite was observed attached to the wall of the host intestine by an armed proboscis equipped by recurved hooks. 14 out of 40 fish specimens (35.0%) were found to be infected during winter season only. The mean intensity ranged from 4-10 parasites/infected fish. The recovered worms were creamy white, elongated with narrow posterior end. Light and scanning electron microscopy showed that the parasite has distinctive rows of spines (combs) on the ventral surface. Body was 3.55±0.02 (3.33-3.58) mm long. Width at the base of probocis was 0.10±0.02 (0.08-0.12) mm. Proboscis club-shaped with a broad anterior end, euipped by longitudinal rows of hooks, each with 15-19 of curved hooks. Neck smooth, the double-walled receptacle was attached to the proboscis wall. Trunk was spinose anteriorly, spines arranged in 7-10 collar rows, each was equipped with 15-18 spines.
    [Show full text]
  • Luth Wfu 0248D 10922.Pdf
    SCALE-DEPENDENT VARIATION IN MOLECULAR AND ECOLOGICAL PATTERNS OF INFECTION FOR ENDOHELMINTHS FROM CENTRARCHID FISHES BY KYLE E. LUTH A Dissertation Submitted to the Graduate Faculty of WAKE FOREST UNIVERSITY GRADAUTE SCHOOL OF ARTS AND SCIENCES in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY Biology May 2016 Winston-Salem, North Carolina Approved By: Gerald W. Esch, Ph.D., Advisor Michael V. K. Sukhdeo, Ph.D., Chair T. Michael Anderson, Ph.D. Herman E. Eure, Ph.D. Erik C. Johnson, Ph.D. Clifford W. Zeyl, Ph.D. ACKNOWLEDGEMENTS First and foremost, I would like to thank my PI, Dr. Gerald Esch, for all of the insight, all of the discussions, all of the critiques (not criticisms) of my works, and for the rides to campus when the North Carolina weather decided to drop rain on my stubborn head. The numerous lively debates, exchanges of ideas, voicing of opinions (whether solicited or not), and unerring support, even in the face of my somewhat atypical balance of service work and dissertation work, will not soon be forgotten. I would also like to acknowledge and thank the former Master, and now Doctor, Michael Zimmermann; friend, lab mate, and collecting trip shotgun rider extraordinaire. Although his need of SPF 100 sunscreen often put our collecting trips over budget, I could not have asked for a more enjoyable, easy-going, and hard-working person to spend nearly 2 months and 25,000 miles of fishing filled days and raccoon, gnat, and entrail-filled nights. You are a welcome camping guest any time, especially if you do as good of a job attracting scorpions and ants to yourself (and away from me) as you did on our trips.
    [Show full text]
  • Phylogeny, Biogeography, and Host Specificity
    bioRxiv preprint doi: https://doi.org/10.1101/2021.05.20.443311; this version posted May 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Cryptic diversity within the Poecilochirus carabi mite 2 species complex phoretic on Nicrophorus burying 3 beetles: phylogeny, biogeography, and host specificity 4 Julia Canitz1, Derek S. Sikes2, Wayne Knee3, Julia Baumann4, Petra Haftaro1, 5 Nadine Steinmetz1, Martin Nave1, Anne-Katrin Eggert5, Wenbe Hwang6, Volker 6 Nehring1 7 1 Institute for Biology I, University of Freiburg, Hauptstraße 1, Freiburg, Germany 8 2 University of Alaska Museum, University of Alaska Fairbanks, Fairbanks, Alaska, 9 99775, USA 10 3 Canadian National Collection of Insects, Arachnids, and Nematodes, Agriculture and 11 Agri-Food Canada, 960 Carling Avenue, K.W. Neatby Building, Ottawa, Ontario, 12 K1A 0C6, Canada 13 4 Institute of Biology, University of Graz, Universitätsplatz 2, 8010 Graz, Austria 14 5 School of Biological Sciences, Illinois State University, Normal, IL 61790-4120, USA 15 6 Department of Ecology and Environmental Resources, National Univ. of Tainan, 33 16 Shulin St., Sec. 2, West Central Dist, Tainan 70005, Taiwan 17 Correspondence: [email protected] 1 1/50 bioRxiv preprint doi: https://doi.org/10.1101/2021.05.20.443311; this version posted May 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Proceedings of the Helminthological Society of Washington 43(2) 1976
    Volume July 1976 Number 2 PROCEEDINGS '* " ' "•-' ""' ' - ^ \~ ' '':'-'''' ' - ~ .•' - ' ' '*'' '* ' — "- - '• '' • The Helminthologieal Society of Washington ., , ,; . ,-. A semiannual journal of research devoted io He/m/nfho/ogy and aJ/ branches of Parasifo/ogy ''^--, '^ -^ -'/ 'lj,,:':'--' •• r\.L; / .'-•;..•• ' , -N Supported in partly the % BraytonH. Ransom :Memorial Trust Fund r ;':' />•!',"••-•, .' .'.• • V''' ". .r -,'"'/-..•" - V .. ; Subscription $15.00 x« Volume; Foreign, $15J50 ACHOLONU, AtEXANDER D. Hehnihth Fauria of Saurians from Puertox Rico>with \s on the liife Cycle of Lueheifr inscripta (Weslrurrib, 1821 ) and Description of Allopharynx puertoficensis sp. n ....... — — — ,... _.J.-i.__L,.. 106 BERGSTROM, R. C., L. R. tE^AKi AND B. A. WERNER. ^JSmall Dung , Beetles as Biolpgical Control Agents: laboratory Studies of Beetle Action on Tricho- strongylid Eggs in Sheep and Cattle Feces „ ____ ---i.--— .— _..r-..........,_: ______ .... ,171 ^CAKE, EDVWN W., JR. A Key" to Iiarval;Cestodes of Shallow-water, Benthic , ~ . Mollusks of the Northern Gulf 'bf Mexico ... .„'„_ „». -L......^....:,...^;.... _____ ..1.^..... 160 DAVIDSON, WILLIAM R. Endopa'rasjites of Selected Populations of Gray Squir- rels ( Sciurus carolinensis) in the Southeastern United States „;.„.„ ____ i ____ .... 211 DORAN, D. J. AND P: C. AUGUSTINE. / Eimeria tenella: Comparative Oocyst ;> i; Production in Primary Cultures of Chicken Kidney Cells Maintained in •\s Media Systems ^.......^.L...,.....J..^hL.. ____; C.^i,.^^..... ____ ..7._u......;. 126 cEssER,^R. P., V. Q.^PERRY AND A. L. TAYLOR. A '-Diagnostic Compendium of the _ Genus Meloidogyne ([Nematoda: Heteroderidae ) .... .... ... y— ..L_^...-...,_... ___ ...v , 138 EISCHTHAL, JACOB H. AND .ALEXANDER D. AciiOLONy. Some Digenetic Trem- ' atodes from the Atlantic UHawksbill Turtle,' Eretmochdys inibricata ^ /irribrieaia (L.), from Puerto Rico ~L^ _____ ,:,.......„._: ____ , _______ .
    [Show full text]
  • Studies on the Systematics and Life History of Polymorphous Altmani (Perry)
    Louisiana State University LSU Digital Commons LSU Historical Dissertations and Theses Graduate School 1967 Studies on the Systematics and Life History of Polymorphous Altmani (Perry). John Edward Karl Jr Louisiana State University and Agricultural & Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_disstheses Recommended Citation Karl, John Edward Jr, "Studies on the Systematics and Life History of Polymorphous Altmani (Perry)." (1967). LSU Historical Dissertations and Theses. 1341. https://digitalcommons.lsu.edu/gradschool_disstheses/1341 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Historical Dissertations and Theses by an authorized administrator of LSU Digital Commons. For more information, please contact [email protected]. This dissertation has been microfilmed exactly as received 67-17,324 KARL, Jr., John Edward, 1928- STUDIES ON THE SYSTEMATICS AND LIFE HISTORY OF POLYMORPHUS ALTMANI (PERRY). Louisiana State University and Agricultural and Mechanical College, Ph.D., 1967 Zoology University Microfilms, Inc., Ann Arbor, Michigan Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. © John Edward Karl, Jr. 1 9 6 8 All Rights Reserved Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. -STUDIES o n t h e systematics a n d LIFE HISTORY OF POLYMQRPHUS ALTMANI (PERRY) A Dissertation 'Submitted to the Graduate Faculty of the Louisiana State University and Agriculture and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The Department of Zoology and Physiology by John Edward Karl, Jr, Mo S«t University of Kentucky, 1953 August, 1967 Reproduced with permission of the copyright owner.
    [Show full text]
  • Vol. 25 No. 1 March, 2000 H a M a D R Y a D V O L 25
    NO.1 25 M M A A H D A H O V D A Y C R R L 0 0 0 2 VOL. 25NO.1 MARCH, 2000 2% 3% 2% 3% 2% 3% 2% 3% 2% 3% 2% 3% 2% 3% 2% 3% 2% 3% 4% 5% 4% 5% 4% 5% 4% 5% 4% 5% 4% 5% 4% 5% 4% 5% 4% 5% HAMADRYAD Vol. 25. No. 1. March 2000 Date of issue: 31 March 2000 ISSN 0972-205X Contents A. E. GREER & D. G. BROADLEY. Six characters of systematic importance in the scincid lizard genus Mabuya .............................. 1–12 U. MANTHEY & W. DENZER. Description of a new genus, Hypsicalotes gen. nov. (Sauria: Agamidae) from Mt. Kinabalu, North Borneo, with remarks on the generic identity of Gonocephalus schultzewestrumi Urban, 1999 ................13–20 K. VASUDEVAN & S. K. DUTTA. A new species of Rhacophorus (Anura: Rhacophoridae) from the Western Ghats, India .................21–28 O. S. G. PAUWELS, V. WALLACH, O.-A. LAOHAWAT, C. CHIMSUNCHART, P. DAVID & M. J. COX. Ethnozoology of the “ngoo-how-pak-pet” (Serpentes: Typhlopidae) in southern peninsular Thailand ................29–37 S. K. DUTTA & P. RAY. Microhyla sholigari, a new species of microhylid frog (Anura: Microhylidae) from Karnataka, India ....................38–44 Notes R. VYAS. Notes on distribution and breeding ecology of Geckoella collegalensis (Beddome, 1870) ..................................... 45–46 A. M. BAUER. On the identity of Lacerta tjitja Ljungh 1804, a gecko from Java .....46–49 M. F. AHMED & S. K. DUTTA. First record of Polypedates taeniatus (Boulenger, 1906) from Assam, north-eastern India ...................49–50 N. M. ISHWAR. Melanobatrachus indicus Beddome, 1878, resighted at the Anaimalai Hills, southern India .............................
    [Show full text]
  • Anxiété Et Manipulation Parasitaire Chez Un Invertébré Aquatique : Approches Évolutive Et Mécanistique Marion Fayard
    Anxiété et manipulation parasitaire chez un invertébré aquatique : approches évolutive et mécanistique Marion Fayard To cite this version: Marion Fayard. Anxiété et manipulation parasitaire chez un invertébré aquatique : approches évolutive et mécanistique. Biodiversité et Ecologie. Université Bourgogne Franche-Comté, 2020. Français. NNT : 2020UBFCI006. tel-02940949v1 HAL Id: tel-02940949 https://tel.archives-ouvertes.fr/tel-02940949v1 Submitted on 16 Sep 2020 (v1), last revised 17 Sep 2020 (v2) HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THESE DE DOCTORAT DE L’ETABLISSEMENT UNIVERSITE BOURGOGNE FRANCHE-COMTE PREPAREE A L’UNITE MIXTE DE RECHERCHE CNRS 6282 BIOGEOSCIENCES Ecole doctorale n°554 Environnement, Santé Doctorat des Sciences de la Vie Spécialité Ecologie Evolutive Par Fayard Marion _______________________________________________________________________________________ ANXIETE ET MANIPULATION PARASITAIRE CHEZ UN INVERTEBRE AQUATIQUE : APPROCHES EVOLUTIVE ET MECANISTIQUE Thèse présentée et soutenue à Dijon, le 28 Août 2020 Composition
    [Show full text]
  • Pseudoacanthocephalus
    Kent Academic Repository Full text document (pdf) Citation for published version Smales, Lesley R and Allain, Steven J. R. and Wilkinson, John W. and Harris, Eileen (2020) A new species of Pseudoacanthocephalus (Acanthocephala: Echinorhynchidae) from the guttural toad, Sclerophrys gutturalis (Bufonidae), introduced into Mauritius, with comments on the implications of the introductions of toads and their parasites into the UK. Journal of Helminthology, 94 . DOI Link to record in KAR https://kar.kent.ac.uk/80268/ Document Version Publisher pdf Copyright & reuse Content in the Kent Academic Repository is made available for research purposes. Unless otherwise stated all content is protected by copyright and in the absence of an open licence (eg Creative Commons), permissions for further reuse of content should be sought from the publisher, author or other copyright holder. Versions of research The version in the Kent Academic Repository may differ from the final published version. Users are advised to check http://kar.kent.ac.uk for the status of the paper. Users should always cite the published version of record. Enquiries For any further enquiries regarding the licence status of this document, please contact: [email protected] If you believe this document infringes copyright then please contact the KAR admin team with the take-down information provided at http://kar.kent.ac.uk/contact.html Journal of Helminthology A new species of Pseudoacanthocephalus (Acanthocephala: Echinorhynchidae) from cambridge.org/jhl the guttural toad, Sclerophrys gutturalis (Bufonidae), introduced into Mauritius, Research Paper with comments on the implications of the Cite this article: Smales LR, Allain SJR, Wilkinson JW, Harris E (2020).
    [Show full text]
  • THE LARGER ANIMAL PARASITES of the FRESH-WATER FISHES of MAINE MARVIN C. MEYER Associate Professor of Zoology University of Main
    THE LARGER ANIMAL PARASITES OF THE FRESH-WATER FISHES OF MAINE MARVIN C. MEYER Associate Professor of Zoology University of Maine PUBLISHED BY Maine Department of Inland Fisheries and Game ROLAND H. COBB, Commissioner Augusta, Maine 1954 THE LARGER ANIMAL PARASITES OF THE FRESH-WATER FISHES OF MAINE PART ONE Page I. Introduction 3 II. Materials 8 III. Biology of Parasites 11 1. How Parasites are Acquired 11 2. Effects of Parasites Upon the Host 12 3. Transmission of Parasites to Man as a Result of Eating Infected Fish 21 4. Control Measures 23 IV. Remarks and Recommendations 27 V. Acknowledgments 30 PART TWO VI. Groups Involved, Life Cycles and Species En- countered 32 1. Copepoda 33 2. Pelecypoda 36 3. Hirudinea 36 4. Acanthocephala 37 5. Trematoda 42 6. Cestoda 53 7. Nematoda 64 8. Key, Based Upon External Characters, to the Adults of the Different Groups Found Parasitizing Fresh-water Fishes in Maine 69 VII. Literature on Fish Parasites 70 VIII. Methods Employed 73 1. Examination of Hosts 73 2. Killing and Preserving 74 3. Staining and Mounting 75 IX. References 77 X. Glossary 83 XI. Index 89 THE LARGER ANIMAL PARASITES OF THE FRESH-WATER FISHES OF MAINE PART ONE I. INTRODUCTION Animals which obtain their livelihood at the expense of other animals, usually without killing the latter, are known as para- sites. During recent years the general public has taken more notice of and concern in the parasites, particularly those occur- ring externally, free or encysted upon or under the skin, or inter- nally, in the flesh, and in the body cavity, of the more important fresh-water fish of the State.
    [Show full text]
  • Acanthocephalan Fauna of Marine Fish in Taiwan and the Differentiation of Three Species by Ribosomal DNA Sequences
    Taiwania, 55(2): 123-127, 2010 Acanthocephalan Fauna of Marine Fish in Taiwan and the Differentiation of Three Species by Ribosomal DNA Sequences Hsiu-Hui Shih(1,2*), Hui-Yu Chen(2) and Chew-Yuen Lee(1) 1. Department of Life Science, National Taiwan University, 1, Sec. 4, Roosevelt Road, Taipei 10617 Taiwan. 2. Institute of Zoolog, National Taiwan University, 1, Sec. 4, Roosevelt Road, Taipei 10617 Taiwan. * Corresponding author. Tel: +886-2-3366-2504; Email: [email protected] (Manuscript received 2 December 2009; accepted 9 March 2010) ABSTRACT: Three Acanthocephala species were recovered and identified from three species of fish host. They are Neoechinorhynchus agilis collected from grey mullet, (Mugil cephalus), Neorhadinorhynchus macrospinosus from rabbit fish (Siganus fuscescens), and Rhadinorhynchus pristis from spotted mackerel (Scomber australasicus). All are new locality records. Scanning electron microscopy and light microscopy were used to describe the morphological characters. In addition, these three acanthocephalans were characterized genetically using a molecular approach. The nuclear ribosomal DNA region spanning the first internal transcribed spacer (ITS-1), the 5.8S gene and the second internal transcribed spacer (ITS-2) was amplified and the sizes of PCR products derived were different in length. They are 450 bp for N. agilis, 800 bp for N. macrospinosus, and 600 bp for R. pristis. KEY WORDS: Acanthocephalans, marine fish, Neoechinorhynchus, Neorhadinorhynchus, Rhadinorhynchus. Adult acanthocephalans that infect fish as definitive INTRODUCTION hosts belong to two Classes, Eoacanthocephala and Acanthocephalans, known as thorny-headed worms Palaeacanthocephala. The former includes two Orders: or spiny-headed worms, characterized by the presence of Cyracanthocephala and Neoacanthocephala; and the latter an evertable proboscis, armed with spines, which they consists of two Orders: Echinorhynchidea and use to pierce and hold the gut wall of their gnathostome Polymorphida (Amin, 1987).
    [Show full text]
  • That Are N O Ttuurito
    THAT AREN O US009802899B2TTUURITO ( 12) United States Patent (10 ) Patent No. : US 9 ,802 , 899 B2 Heilmann et al. ( 45 ) Date of Patent: Oct . 31, 2017 ( 54 ) HETEROCYCLIC COMPOUNDS AS CO7D 401/ 12 ( 2006 .01 ) PESTICIDES C07D 403 /04 (2006 .01 ) CO7D 405 / 12 (2006 . 01) (71 ) Applicant : BAYER CROPSCIENCE AG , C07D 409 / 12 ( 2006 .01 ) Monheim (DE ) C070 417 / 12 (2006 . 01) (72 ) Inventors: Eike Kevin Heilmann , Duesseldorf AOIN 43 /60 ( 2006 .01 ) (DE ) ; Joerg Greul , Leverkusen (DE ) ; AOIN 43 /653 (2006 . 01 ) Axel Trautwein , Duesseldorf (DE ) ; C07D 249 /06 ( 2006 . 01 ) Hans- Georg Schwarz , Dorsten (DE ) ; (52 ) U . S . CI. Isabelle Adelt , Haan (DE ) ; Roland CPC . .. C07D 231/ 40 (2013 . 01 ) ; AOIN 43 / 56 Andree , Langenfeld (DE ) ; Peter ( 2013 .01 ) ; A01N 43 /58 ( 2013 . 01 ) ; AOIN Luemmen , Idstein (DE ) ; Maike Hink , 43 /60 (2013 .01 ) ; AOIN 43 /647 ( 2013 .01 ) ; Markgroeningen (DE ); Martin AOIN 43 /653 ( 2013 .01 ) ; AOIN 43 / 76 Adamczewski , Cologne (DE ) ; Mark ( 2013 .01 ) ; A01N 43 / 78 ( 2013 .01 ) ; A01N Drewes, Langenfeld ( DE ) ; Angela 43/ 82 ( 2013 .01 ) ; C07D 231/ 06 (2013 . 01 ) ; Becker , Duesseldorf (DE ) ; Arnd C07D 231 /22 ( 2013 .01 ) ; C07D 231/ 52 Voerste , Cologne (DE ) ; Ulrich ( 2013 .01 ) ; C07D 231/ 56 (2013 .01 ) ; C07D Goergens, Ratingen (DE ) ; Kerstin Ilg , 249 /06 (2013 . 01 ) ; C07D 401 /04 ( 2013 .01 ) ; Cologne (DE ) ; Johannes -Rudolf CO7D 401/ 12 ( 2013 . 01) ; C07D 403 / 04 Jansen , Monheim (DE ) ; Daniela Portz , (2013 . 01 ) ; C07D 403 / 12 ( 2013 . 01) ; C07D Vettweiss (DE ) 405 / 12 ( 2013 .01 ) ; C07D 409 / 12 ( 2013 .01 ) ; C07D 417 / 12 ( 2013 .01 ) ( 73 ) Assignee : BAYER CROPSCIENCE AG , (58 ) Field of Classification Search Monheim ( DE ) ??? .
    [Show full text]
  • Diet of Neotropic Cormorant (Phalacrocorax Brasilianus) in an Estuarine Environment
    Mar Biol (2008) 153:431–443 DOI 10.1007/s00227-007-0824-8 RESEARCH ARTICLE Diet of Neotropic cormorant (Phalacrocorax brasilianus) in an estuarine environment V. Barquete Æ L. Bugoni Æ C. M. Vooren Received: 3 July 2006 / Accepted: 17 September 2007 / Published online: 10 October 2007 Ó Springer-Verlag 2007 Abstract The diet of the Neotropic cormorant (Phala- temporary changes in diet in terms of food items, abun- crocorax brasilianus) was studied by analysing 289 dance and prey size were detected, revealing a high regurgitated pellets collected from a roosting site at Lagoa ecological plasticity of the species. Individual daily food dos Patos estuary, southern Brazil, between November intake of Neotropic cormorants estimated by pellets and 2001 and October 2002 (except April to June). In total, metabolic equations corresponded to 23.7 and 27.1% of 5,584 remains of prey items from 20 food types were their body mass, falling in the range of other cormorant found. Fish composed the bulk of the diet representing species. Annual food consumption of the population esti- 99.9% by mass and 99.7% by number. The main food items mated by both methods was 73.4 and 81.9 tonnes, were White croaker (Micropogonias furnieri) (73.7% by comprising mainly immature and subadult White croaker frequency of occurrence, 48.9% by mass and 41.2% by and Catfish which are commercially important. Temporal number), followed by Catfish (Ariidae) and anchovies variations in diet composition and fish size preyed (Engraulididae). In Lagoa dos Patos estuary the generalist by Neotropics cormorants, a widespread and generalist Neotropic cormorant fed mainly on the two most abundant species, suggest shifts according to fluctuations in the demersal fishes (White croaker and Catfish), which abundance of prey.
    [Show full text]