DOCSLIB.ORG

Characterization of the Complete Mitochondrial Genome of Cavisoma Magnum (Southwell, 1927) (Acanthocephala Palaeacanthocephala)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of the Complete Mitochondrial Genome of Cavisoma Magnum (Southwell, 1927) (Acanthocephala Palaeacanthocephala) Infection, Genetics and Evolution 80 (2020) 104173 Contents lists available at ScienceDirect Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid Research paper Characterization of the complete mitochondrial genome of Cavisoma T magnum (Southwell, 1927) (Acanthocephala: Palaeacanthocephala), first representative of the family Cavisomidae, and its phylogenetic implications ⁎ Nehaz Muhammada, Liang Lib, , Sulemana, Qing Zhaob, Majid A. Bannaic, Essa T. Mohammadc, ⁎ Mian Sayed Khand, Xing-Quan Zhua,e, Jun Maa, a State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu Province 730046, PR China b Key Laboratory of Animal Physiology, Biochemistry and Molecular Biology of Hebei Province, College of Life Sciences, Hebei Normal University, 050024 Shijiazhuang, Hebei Province, PR China c Marine Vertebrate, Marine Science Center, University of Basrah, Basrah, Iraq d Department of Zoology, University of Swabi, Swabi, Khyber Pakhtunkhwa, Pakistan e Jiangsu Co-innovation Centre for the Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou University College of Veterinary Medicine, Yangzhou, Jiangsu Province 225009, PR China ARTICLE INFO ABSTRACT Keywords: The phylum Acanthocephala is a small group of endoparasites occurring in the alimentary canal of all major Acanthocephala lineages of vertebrates worldwide. In the present study, the complete mitochondrial (mt) genome of Cavisoma Echinorhynchida magnum (Southwell, 1927) (Palaeacanthocephala: Echinorhynchida) was determined and annotated, the re- Cavisomidae presentative of the family Cavisomidae with the characterization of the complete mt genome firstly decoded. The Mitochondrial genome mt genome of this acanthocephalan is 13,594 bp in length, containing 36 genes plus two non-coding regions. The Phylogeny positions of trnV and SNCR (short non-coding region) in the mt genome of C. magnum are different comparing to Systematics those of the other acanthocephalan species available in GenBank. Phylogenetic analysis based on amino acid sequences of 12 protein-coding genes using Bayesian inference (BI) supported the class Palaeacanthocephala and its included order Polymorphida to be monophyletic, but rejected monophyly of the order Echinorhynchida. Our phylogenetic results also challenged the validity of the genus Sphaerirostris (Polymorphida: Centrorhynchidae). The novel mt genomic data of C. magnum are very useful for understanding the evolutionary history of this group of parasites and establishing a natural classification of Acanthocephala. 1. Introduction and represented a synonym of Eoacanthocephala (Gazi et al., 2016; Muhammad et al., 2019a,b). The interrelationships of these classes The phylum Acanthocephala is a small group of endoparasites with needs further studies. approximately 1300 species reported from the alimentary tract of var- Among the four classes, Palaeacanthocephala with over 840 species ious vertebrates worldwide (Gazi et al., 2012; Amin, 2013; Gazi et al., placed into three orders Echinorhynchida, Polymorphida and 2015). According to the traditional classification, Acanthocephala was Heteramorphida, has the richest species diversity. In the class classified into four classes, including Eoacanthocephala, Palaea- Palaeacanthocephala, the order Echinorhynchida includes more than canthocephala, Polyacanthocephala and Archiacanthocephala (Amin, 470 species, which are mainly parasitic in teleost fish, and represents 1987, 2013). This morphology-based classification was supported by the largest group (Amin, 1987; Pichelin and Cribb, 2001; Smales, 2012; some molecular phylogenetic analyses based on 18S/28S or Amin, 2013). The monophyly of Palaeacanthocephala and Poly- 18S + 28S + cox1 genetic data, respectively (García-Varela et al., morphida was strongly supported by some phylogenetic studies based 2002; García-Varela and Nadler, 2006; Verweyen et al., 2011). How- on mitochondrial (mt) genomic data (Gazi et al., 2015; Gazi et al., ever, recent mitogenomic phylogenetic results suggested that Poly- 2016; Muhammad et al., 2019a,b; Song et al., 2019), but some regarded acanthocephala should be considered as a member of Eoacanthocephala Palaeacanthocephala as paraphyly based on 18S genetic data (Herlyn ⁎ Corresponding authors. E-mail addresses: [email protected] (L. Li), [email protected] (J. Ma). https://doi.org/10.1016/j.meegid.2020.104173 Received 30 August 2019; Received in revised form 26 December 2019; Accepted 2 January 2020 Available online 07 January 2020 1567-1348/ © 2020 Published by Elsevier B.V. N. Muhammad, et al. Infection, Genetics and Evolution 80 (2020) 104173 et al., 2003). The non-monophyly of Echinorhynchida was reported by Table 1 many previous phylogenetic studies based on morphological characters Primers used for amplification and sequencing of the complete mitochondrial (Monks, 2001) and/or molecular data (Near et al., 1998; García-Varela genome of Cavisoma magnum. et al., 2000, 2002; Near, 2002; García-Varela and Nadler, 2005; García- Primers Sequence (5′ → 3′) Gene/Region Size (bp) Varela and Nadler, 2006; Verweyen et al., 2011; Gazi et al., 2015; García-Varela et al., 2019). CMF1 GACTGCGCTAAGGTAGCGTG 16S 328 CMR1 GGTCTAAACTCAGATCACGTAC The taxanomy and classification of C. magnum has gone through CMF2 GAGTTACTTAAGGGTTAACAG 16S - nad5 4583 numerous revision for nearly a century. It was originally placed in fa- CMR2 CTGCTAAATACACACCTCAC mily Echinorhynchidae, genus Oligoterorhynchus Monticelli, 1914 CMF3 CATGATGGTTTTGTTGTTATG nad5 305 (Southwell, 1927). Then a new family Oligoterorhynchidae and genus CMR3 GTGGGAGCAGCTATAGCAAG Cavisoma was established containing C. magnum (Van Cleave, 1931). CMF4 AGAGTTTTGTTTAGCTTTAG nad5 - cytb 1725 CMR4 AACCGACTTAAAGACCACAC Subsequently, genus Cavisoma was elevated to a sub-family level as CMF5 GGTTATGTATTGCCTTGAGG cytb 426 Cavisominae and moved into family Echinorhynchidae (Meyer, 1932). CMR5 CTCTGGCTTAATGTGGATAG Cavisoma/Cavisominae was regarded as a separated family CMF6 GGTATTACATTTTTGTTCAACC cytb - 12S 1643 (Petrochenko, 1956). However, Golvan suggested Cavisoma should be CMR6 AACACTATTACACAGGTATC CMF7 CTCTATTTCAGATAAAGTCTG 12S 395 placed in family Fessisentidae (Golvan, 1969). Later, genus Cavisoma CMR7 GTGTTGACGGGCGATATGTAC was retained in family Cavisomidae within the order Echinorhynchida CMF8 GTTTATCGTATGATTGTTAGTGC 12S - 16S 5336 (Amin, 1985; Arthur et al., 1995; Amin, 2013; Amin et al., 2018). CMR8 GTGTTAATACAACTAACACC The family Cavisomidae is a small group of acanthocephalans in order Echinorhynchida (Meyer, 1932) which mainly parasitizes in fishes, which currently includes ten genera (Amin, 2013). Recently, 2.2. Molecular procedures molecular phylogenetic results considered this family to be a para- phyletic group based on sequenced cox1 data (Lisitsyna et al., 2019). For molecular studies, the genomic DNA was extracted from one Among the 10 genera in Cavisomidae, genus Cavisoma contains only specimen (preserved in ethanol) using small-scale sodium dodecyl-sul- one species C. magnum (Southwell, 1927), commonly occurring in the fate /proteinase K solution with column purification system (Wizard_SV marine fishes of the orders Perciformes, Mugiliformes and Gonor- Genomic DNA Purification Kit, Promega, Madison, USA) according to ynchiformes in Pacific Ocean (Amin et al., 2018). the operation manual (Gasser et al., 2006). Long PCR reactions were The mt genomic data are important and useful genetic markers for conducted in a total volume of 30 μl, containing 13.5 μl PrimeSTAR phylogenetic studies to determine the evolutionary relationships of Max DNA polymerase (Takara, Dalian, China), 13.5 μl ddH2O, 1.5 μl of high taxa in Acanthocephala (Gazi et al., 2012; Weber et al., 2013; Gazi total genomic DNA and 1.5 μl of each primer (25 pmol) (Table 1). Long et al., 2015, 2016; Muhammad et al., 2019a,b; Song et al., 2019). PCR reactions were performed with an initial denaturation at 96 °C for However, our present knowledge regarding mt genome sequences of 1 min, 12 cycles for 15 s at 96 °C, 25 s at 52–56 °C, 0.5–5 min at 60 °C. acanthocephalans is still very limited. To date, only three species of Then the denaturation were performed at 94 °C for 2 min, 22 cycles of Echinorhynchida have been reported, namely Leptorhynchoides thecatus 15 s at 96 °C, 25 s at 52–56 °C, 0.5–5 min at 66 °C. The 68 °C final- Linton, 1891 (Rhadinorhynchidae), Echinorhynchus truttae Schrank, extension was conducted for 10 min. 1788 (Echinorhynchidae) and Brentisentis yangtzensis Yu and Wu, 1989 The amplified fragments were cloned in pMD19-T vector, andpo- (Illiosentidae) (Steinauer et al., 2005; Weber et al., 2013; Song et al., sitive clones were sequenced by Sangon Company (Shanghai, China) 2019). The lack of mt genomic data of representatives belonging to and Genewiz (Beijing, China) using primer walking strategy (Table 1). different family-level taxa embarrassed to establish a natural classifi- For checking the chromatograms the Chromas v.1.62. was used. The cation of Acanthocephala based on mitogenomic phylogenetic analysis. sequences were assembled using DNASTAR (https://www.dnastar. In the present study, the complete mt genome of C. magnum was com). The codon usage and nucleotide composition were analyzed sequenced for the first time based on specimens collected from the using MEGA7 (Kumar et al., 2016). The boundaries
Load more

Recommended publications
  • Macracanthorhynchus Hirudinaceus</Emphasis>
    ©2006 Parasitological Institute of SAS, Košice DOI 10.2478/s11687-006-0017-x HELMINTHOLOGIA, 43, 2: 86 – 91, JUNE 2006 Very highly prevalent Macracanthorhynchus hirudinaceus infection of wild boar Sus scrofa in Khuzestan province, south-western Iran G. R. MOWLAVI1, J. MASSOUD1, I. MOBEDI1, S. SOLAYMANI-MOHAMMADI1, M. J. GHARAGOZLOU2, S. MAS-COMA3 1Department of Medical Parasitology and Mycology, School of Public Health and Institute of Public Health Research, Tehran University of Medical Sciences, P.O. Box 6446, Tehran 14155, Iran, E-mail: [email protected]; 2Department of Pathology, Faculty of Veterinary Medicine, University of Tehran, P.O. Box 6453, Tehran 14155, Iran; 3Departamento de Parasitología, Facultad de Farmacia, Universidad de Valencia, Av. Vicent Andrés Estellés s/n, 46100 Burjassot, Valencia, Spain, E-mail: [email protected] Summary ..... ... An epidemiological and pathological study of Macracan- Although no accurate estimate of the Iranian wild boar po- thorhynchus hirudinaceus infection in a total of 50 wild pulation is available at present, it is evident that this animal boars Sus scrofa attila from cane sugar fields of Iranian is a frequent inhabitant of regions of dense forests in the Khuzestan was performed. The total prevalence of 64.0 % north, north-west, west and south-west of this country ow- detected is the highest hitherto known by this acanthocep- ing to the abundance of diet. Of omnivorous characteristics halan species in wild boars and may reflect a very high and high adaptation capacity, this animal includes seeds, contamination of the farm lands studied as the consequen- fruits, mushrooms, reptiles, amphibians, insect larvae, ce of the crowding of the wild boar population in cane su- birds and their eggs, small rodents and even carrion in its gar fields.
    [Show full text]
  • Studies on the Systematics and Life History of Polymorphous Altmani (Perry)
    Louisiana State University LSU Digital Commons LSU Historical Dissertations and Theses Graduate School 1967 Studies on the Systematics and Life History of Polymorphous Altmani (Perry). John Edward Karl Jr Louisiana State University and Agricultural & Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_disstheses Recommended Citation Karl, John Edward Jr, "Studies on the Systematics and Life History of Polymorphous Altmani (Perry)." (1967). LSU Historical Dissertations and Theses. 1341. https://digitalcommons.lsu.edu/gradschool_disstheses/1341 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Historical Dissertations and Theses by an authorized administrator of LSU Digital Commons. For more information, please contact [email protected]. This dissertation has been microfilmed exactly as received 67-17,324 KARL, Jr., John Edward, 1928- STUDIES ON THE SYSTEMATICS AND LIFE HISTORY OF POLYMORPHUS ALTMANI (PERRY). Louisiana State University and Agricultural and Mechanical College, Ph.D., 1967 Zoology University Microfilms, Inc., Ann Arbor, Michigan Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. © John Edward Karl, Jr. 1 9 6 8 All Rights Reserved Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. -STUDIES o n t h e systematics a n d LIFE HISTORY OF POLYMQRPHUS ALTMANI (PERRY) A Dissertation 'Submitted to the Graduate Faculty of the Louisiana State University and Agriculture and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The Department of Zoology and Physiology by John Edward Karl, Jr, Mo S«t University of Kentucky, 1953 August, 1967 Reproduced with permission of the copyright owner.
    [Show full text]
  • Chapter 9 in Biology of the Acanthocephala]
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications from the Harold W. Manter Laboratory of Parasitology Parasitology, Harold W. Manter Laboratory of 1985 Epizootiology: [Chapter 9 in Biology of the Acanthocephala] Brent B. Nickol University of Nebraska - Lincoln, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/parasitologyfacpubs Part of the Parasitology Commons Nickol, Brent B., "Epizootiology: [Chapter 9 in Biology of the Acanthocephala]" (1985). Faculty Publications from the Harold W. Manter Laboratory of Parasitology. 505. https://digitalcommons.unl.edu/parasitologyfacpubs/505 This Article is brought to you for free and open access by the Parasitology, Harold W. Manter Laboratory of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Publications from the Harold W. Manter Laboratory of Parasitology by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Nickol in Biology of the Acanthocephala (ed. by Crompton & Nickol) Copyright 1985, Cambridge University Press. Used by permission. 9 Epizootiology Brent B. Nickol 9.1 Introduction In practice, epizootiology deals with how parasites spread through host populations, how rapidly the spread occurs and whether or not epizootics result. Prevalence, incidence, factors that permit establishment ofinfection, host response to infection, parasite fecundity and methods of transfer are, therefore, aspects of epizootiology. Indeed, most aspects of a parasite could be related in sorne way to epizootiology, but many ofthese topics are best considered in other contexts. General patterns of transmission, adaptations that facilitate transmission, establishment of infection and occurrence of epizootics are discussed in this chapter. When life cycles are unknown, little progress can be made in under­ standing the epizootiological aspects ofany group ofparasites.
    [Show full text]
  • THE LARGER ANIMAL PARASITES of the FRESH-WATER FISHES of MAINE MARVIN C. MEYER Associate Professor of Zoology University of Main
    THE LARGER ANIMAL PARASITES OF THE FRESH-WATER FISHES OF MAINE MARVIN C. MEYER Associate Professor of Zoology University of Maine PUBLISHED BY Maine Department of Inland Fisheries and Game ROLAND H. COBB, Commissioner Augusta, Maine 1954 THE LARGER ANIMAL PARASITES OF THE FRESH-WATER FISHES OF MAINE PART ONE Page I. Introduction 3 II. Materials 8 III. Biology of Parasites 11 1. How Parasites are Acquired 11 2. Effects of Parasites Upon the Host 12 3. Transmission of Parasites to Man as a Result of Eating Infected Fish 21 4. Control Measures 23 IV. Remarks and Recommendations 27 V. Acknowledgments 30 PART TWO VI. Groups Involved, Life Cycles and Species En- countered 32 1. Copepoda 33 2. Pelecypoda 36 3. Hirudinea 36 4. Acanthocephala 37 5. Trematoda 42 6. Cestoda 53 7. Nematoda 64 8. Key, Based Upon External Characters, to the Adults of the Different Groups Found Parasitizing Fresh-water Fishes in Maine 69 VII. Literature on Fish Parasites 70 VIII. Methods Employed 73 1. Examination of Hosts 73 2. Killing and Preserving 74 3. Staining and Mounting 75 IX. References 77 X. Glossary 83 XI. Index 89 THE LARGER ANIMAL PARASITES OF THE FRESH-WATER FISHES OF MAINE PART ONE I. INTRODUCTION Animals which obtain their livelihood at the expense of other animals, usually without killing the latter, are known as para- sites. During recent years the general public has taken more notice of and concern in the parasites, particularly those occur- ring externally, free or encysted upon or under the skin, or inter- nally, in the flesh, and in the body cavity, of the more important fresh-water fish of the State.
    [Show full text]
  • Acanthocephalan Fauna of Marine Fish in Taiwan and the Differentiation of Three Species by Ribosomal DNA Sequences
    Taiwania, 55(2): 123-127, 2010 Acanthocephalan Fauna of Marine Fish in Taiwan and the Differentiation of Three Species by Ribosomal DNA Sequences Hsiu-Hui Shih(1,2*), Hui-Yu Chen(2) and Chew-Yuen Lee(1) 1. Department of Life Science, National Taiwan University, 1, Sec. 4, Roosevelt Road, Taipei 10617 Taiwan. 2. Institute of Zoolog, National Taiwan University, 1, Sec. 4, Roosevelt Road, Taipei 10617 Taiwan. * Corresponding author. Tel: +886-2-3366-2504; Email: [email protected] (Manuscript received 2 December 2009; accepted 9 March 2010) ABSTRACT: Three Acanthocephala species were recovered and identified from three species of fish host. They are Neoechinorhynchus agilis collected from grey mullet, (Mugil cephalus), Neorhadinorhynchus macrospinosus from rabbit fish (Siganus fuscescens), and Rhadinorhynchus pristis from spotted mackerel (Scomber australasicus). All are new locality records. Scanning electron microscopy and light microscopy were used to describe the morphological characters. In addition, these three acanthocephalans were characterized genetically using a molecular approach. The nuclear ribosomal DNA region spanning the first internal transcribed spacer (ITS-1), the 5.8S gene and the second internal transcribed spacer (ITS-2) was amplified and the sizes of PCR products derived were different in length. They are 450 bp for N. agilis, 800 bp for N. macrospinosus, and 600 bp for R. pristis. KEY WORDS: Acanthocephalans, marine fish, Neoechinorhynchus, Neorhadinorhynchus, Rhadinorhynchus. Adult acanthocephalans that infect fish as definitive INTRODUCTION hosts belong to two Classes, Eoacanthocephala and Acanthocephalans, known as thorny-headed worms Palaeacanthocephala. The former includes two Orders: or spiny-headed worms, characterized by the presence of Cyracanthocephala and Neoacanthocephala; and the latter an evertable proboscis, armed with spines, which they consists of two Orders: Echinorhynchidea and use to pierce and hold the gut wall of their gnathostome Polymorphida (Amin, 1987).
    [Show full text]
  • Canada Canadian Manuscript Report of Fisheries and Aquatic Sciences
    Report of the 4th DFO Atlantic Parasitologist's Workshop 29 September, 1994 Northwest Atlantic Fisheries Centre St. John's, Newfoundland Editor J. Richard Arthur Fish and Marine Mammals Division Department of Fisheries and Oceans Maurice Lamontagne Institute P.0 Box 1000 Mont-Joli, Quebec G5H 3Z4 Canadian Manuscript Report of Fisheries and Aquatic Science 231 6 Pêches Fisheries * et Ockans and Oc6ans Canada Canadian Manuscript Report of Fisheries and Aquatic Sciences Manuscript reports contain scientific and technical information that contributes to existing knowledge but which deals with national or regional problems. Distribu- tion is restricted to institutions or individuals located in particular regions of Canada. However, no restriction is placed on subject matter, and the series reflects the broad interests and policies of the Department of Fisheries and Oceans, namely, fisheries and aquatic sciences. Manuscript reports may be cited as full publications. The correct citation appears above the abstract of each report. Each report is abstracted in Aquatic Sciences and Fisheries Abstracts and indexed in the Department's annual index to scientific and technical publications. Numbers 1-900 in this series were issued as Manuscript Reports (Biological Series) of the Biological Board of Canada, and subsequent to 1937 when the name of the Board was changed by Act of Parliament, as Manuscript Reports (Biological Series) of the Fisheries Research Board of Canada. Numbers 901-1425 were issued as Manuscript Reports of the Fisheries Research Board of Canada. Numbers 1426-1550 were issued as Department of Fisheries and the Environment, Fisheries and Marine Service Manuscript Reports. The current series name was changed with report number 1551.
    [Show full text]
  • Helmintos Parásitos De Peces (Platyhelminthes, Acanthocephala Y Nematoda)
    CAPITULO 3 HELMINTOS PARÁSITOS DE PECES (PLATYHELMINTHES, ACANTHOCEPHALA Y NEMATODA) Guillermo Salgado Maldonado Instituto de Biología, Universidad Nacional Autónoma de México Introducción Reconocemos como helmintos a los gusanos parásitos de los phyla Platyhelminthes (Clases Trematoda, Monogenoidea y Cestoda), Acanthocephala y Nematoda. Cada grupo presenta características biológicas distintivas. Los platelmintos son los gusanos planos, generalmente de tamaño pequeño. Los tremátodos se distinguen por su forma foliosa y la presencia de ventosas para fijarse a los tejidos del hospedero. Los monogéneos son más pequeños, y los céstodos tienen el cuerpo estrobilado como las “solitarias” (“tenias”) del hombre. Los acantocéfalos son gusanos que presentan una proboscis armada de ganchos en su extremo anterior con la cual se fijan a la mucosa intestinal de sus hospederos. En tanto que los nemátodos son cilíndricos de extremos afilados, cubiertos por una cutícula muy resistente. Las descripciones morfológicas y la biología de estos grupos puede consultarse en la biliografía (Lamothe-Argumedo, 1983; Schmidt y Roberts, 1989; Bush et al. 2001). Biología Los monogéneos son ectoparásitos, sobre la piel, las aletas, las branquias o los nostrilos de los peces y en la vejiga urinaria de anfibios. Otras especies de helmintos parasitan los ojos, el cerebro, la cavidad del cuerpo, la grasa, mesenterios, riñones, hígado, pulmones, musculatura, sangre o huesos de todos los grupos de vertebrados. Si bien, los parásitos intestinales son los más evidentes, cualquier órgano puede albergar helmintos. Las formas de infección son también muy diversas. Los monogéneos tienen ciclos de vida directos, algunos de ellos son incluso vivíparos, y la infección es de pez a 1 pez.
    [Show full text]
  • Survey of Southern Amazonian Bird Helminths Kaylyn Patitucci
    University of North Dakota UND Scholarly Commons Theses and Dissertations Theses, Dissertations, and Senior Projects January 2015 Survey Of Southern Amazonian Bird Helminths Kaylyn Patitucci Follow this and additional works at: https://commons.und.edu/theses Recommended Citation Patitucci, Kaylyn, "Survey Of Southern Amazonian Bird Helminths" (2015). Theses and Dissertations. 1945. https://commons.und.edu/theses/1945 This Thesis is brought to you for free and open access by the Theses, Dissertations, and Senior Projects at UND Scholarly Commons. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of UND Scholarly Commons. For more information, please contact [email protected]. SURVEY OF SOUTHERN AMAZONIAN BIRD HELMINTHS by Kaylyn Fay Patitucci Bachelor of Science, Washington State University 2013 Master of Science, University of North Dakota 2015 A Thesis Submitted to the Graduate Faculty of the University of North Dakota in partial fulfillment of the requirements for the degree of Master of Science Grand Forks, North Dakota December 2015 This thesis, submitted by Kaylyn F. Patitucci in partial fulfillment of the requirements for the Degree of Master of Science from the University of North Dakota, has been read by the Faculty Advisory Committee under whom the work has been done and is hereby approved. __________________________________________ Dr. Vasyl Tkach __________________________________________ Dr. Robert Newman __________________________________________ Dr. Jefferson Vaughan
    [Show full text]
  • Parasites Chilean Variable Hawk
    ISSN 1984-2961 (Electronic) www.cbpv.org.br/rbpv Braz. J. Vet. Parasitol., Jaboticabal, Ahead of Print, 2019 Doi: https://doi.org/10.1590/S1984-29612019045 Gastrointestinal and external parasites of the Variable hawk Geranoaetus polyosoma (Accipitriformes: Accipitridae) in Chile Parasitas gastrointestinais e externos do Falcão Variável Geranoaetus polyosoma (Accipitriformes: Accipitridae) de Chile Alexandra Grandón-Ojeda1; Patricio Cortés1; Lucila Moreno2; John Mike Kinsella3; Armando Cicchino4; Carlos Barrientos5; Daniel González-Acuña1 1 Laboratorio de Enfermedades y Parásitos de Fauna silvestre, Facultad de Ciencias Veterinarias, Universidad de Concepción, Chillán, Chile 2 Facultad de Ciencias Naturales y Oceanográfcas, Universidad de Concepción, Concepción, Chile 3 Helm West Lab, Missoula, Montana, United States of America 4 Universidad Nacional de Mar del Plata, Mar del Plata, Argentina 5 Escuela de Medicina Veterinaria, Universidad Santo Tomás, Concepción, Chile Received February 7, 2019 Accepted May 5, 2019 Abstract Information about parasites associated with diurnal raptors from Chile is scarce. Between 2006 and 2017, a total of 15 specimens of the Variable hawk, Geranoaetus polyosoma (Quoy & Gaimard, 1824) were collected, 14 of them from diferent localities in the Biobío region and one specimen from the Valparaíso region. An external examination of the plumage was made to collect ectoparasites, and necropsies were performed, focusing primarily on the gastrointestinal tract. Chewing lice (Phthiraptera) were found on fve (33.3%) of the birds corresponding to three species: 97 specimens of Degeeriella fulva (Giebel, 1874), six specimens of Colpocephalum turbinatum Denny, 1842 and nine belonging to an unidentifed species of the genus Craspedorrhynchus Kéler, 1938. Endoparasites found in three (20%) of the birds included round worms (Nematoda) of the genus Procyrnea Chabaud, 1958, and spiny-headed worms (Acanthocephala) of the genus Centrorhynchus Lühe, 1911.
    [Show full text]
  • Lizard Island Research Publications Received in 2016*
    Lizard Island research publications received in 2016* 1. Aguado, M.T., C. Grande, M. Gerth, C. Bleidornc and C. Noreña, 2016. Characterization of the complete mitochondrial genomes from Polycladida (Platyhelminthes) using next-generation sequencing. Gene, 575: 199-205. 2. Ahmadian, R., I. Burghardt and U.L. Shepherd, 2016. Embryonic development of the solar-powered nudibranch Phyllodesmium lizardensis (Gastropoda: Nudibranchia). Molluscan Research, 36(4): 285-289. 3. Allan, B.J.M., 2015. The effects of climate change on predator-prey interactions in coral reef fish. PhD thesis, James Cook University. 4. Álvarez-Noriega, M., A.H. Baird,2, M. Dornelas, J.S. Madin, V.R. Cumbo, and S.R. Connolly, 2016. Fecundity and the demographic strategies of coral morphologies. Ecology, 97(12): 3485-3493. 5. Babcock, R.C., D.A. Milton and M.S. Pratchett, 2016. Relationships between size and reproductive output in the Crown-of-Thorns Starfish. Marine Biology, 163: 234, doi 10.1007/s00227-016-3009-5. 6. Bellwood, D.R., C.H.R. Goatley, J.A. Khan and S.B. Tebbett, 2016. Site fidelity and homing in juvenile rabbitfishes (Siganidae). Coral Reefs 35: 1151-1155. 7. Binning, S.A. and D.G. Roche, 2015. Water flow and fin shape polymorphism in coral reef fishes. Ecology, 96(3): 828-839. 8. Bogdanov, A., C. Hertzer, S. Kehraus, S. Nietzer, S. Rohde, P.J. Schupp, H. Wägele and G.M. König, 2015. Defensive diterpene from the aeolidoidean Phyllodesmium longicirrum. Journal of Natural Products, 79: 611−615. 9. Bok, M.J., M. Capa and D.-E. Nilsson, 2016. Here, there and everywhere: the radiolar eyes of fan worms (Annelida, Sabellidae).
    [Show full text]
  • Remarkable Morphological Variation in the Proboscis of Neorhadinorhynchus Nudus
    1 Remarkable morphological variation in the proboscis of Neorhadinorhynchus nudus 2 (Harada, 1938) (Acanthocephala: Echinorhynchida) 3 Liang Li1,*, Matthew Thomas Wayland2, Hui-Xia Chen1, Yue Yang1 41Key Laboratory of Animal Physiology, Biochemistry and Molecular Biology of Hebei Province, 5College of Life Sciences, Hebei Normal University, 050024 Shijiazhuang, Hebei Province, P. R. 6China 7 2Department of Zoology, University of Cambridge, Cambridge, CB2 3EJ, UK 8*Corresponding author: Liang Li, E-mail: [email protected] 9 10 Running title: Morphological variability of Neorhadinorhynchus nudus 11 12 1 1 2 13 14 Abstract The acanthocephalans are characterized by a retractible proboscis, armed with rows 15of recurved hooks, which serves as the primary organ for attachment of the adult worm to the 16intestinal wall of the vertebrate definitive host. Whilst there is considerable variation in the size, 17shape, and armature of the proboscis across the phylum, intraspecific variation is generally 18 regarded to be minimal. Consequently, subtle differences in proboscis morphology are often 19used to delimit congeneric species. In this study, striking variability in proboscis morphology 20 was observed among individuals of Neorhadinorhynchus nudus (Harada, 1938) collected from 21 the frigate tuna Auxis thazard Lacépède (Perciformes: Scombridae) in the South China Sea. 22 Based on the length of the proboscis, and number of hooks per longitudinal row, these 23specimens of N. nudus were readily grouped into three distinct morphotypes, which might be 24considered separate taxa under the morphospecies concept. However, analysis of nuclear and 25 mitochondrial DNA sequences revealed a level of nucleotide divergence typical of an 26 intraspecific comparison. Moreover, the three morphotypes do not represent three separate 27 genetic lineages.
    [Show full text]
  • Description and Molecular Analysis of an Italian Population of Centrorhynchus Globo Caudatus (Zeder, 1800) Lühe, 1911 (Acanthoc
    Journal of Helminthology Description and molecular analysis of an Italian population of Centrorhynchus globo caudatus cambridge.org/jhl (Zeder, 1800) Lühe, 1911 (Acanthocephala: Centrorhynchidae) from Falco tinnunculus Research Paper (Falconidae) and Buteo buteo (Accipitridae) Cite this article: Amin OM, Heckmann RA, Dallarés S, Constenla M, Rubini S (2020). 1 2 3 3 4 Description and molecular analysis of an O.M. Amin , R.A. Heckmann , S. Dallarés , M. Constenla and S. Rubini Italian population of Centrorhynchus globo caudatus (Zeder, 1800) Lühe, 1911 1Institute of Parasitic Diseases, 11445 E Via Linda 2-419, Scottsdale, Arizona 85259, USA; 2Department of Biology, (Acanthocephala: Centrorhynchidae) from Brigham Young University, 1114 MLBM, Provo, Utah 84602, USA; 3Department of Animal Biology, Vegetal Biology Falco tinnunculus (Falconidae) and Buteo and Ecology, Universitat Autònoma de Barcelona, Cerdanyola, 08193 Barcelona, Spain and 4Experimental buteo (Accipitridae). Journal of Helminthology Zooprophylactic Institute of Ferrara, St Modena 483, 44124 Cassana, Ferrara, Italy 94, e207, 1–21. https://doi.org/10.1017/ S0022149X20000887 Abstract Received: 6 August 2020 Accepted: 22 September 2020 Centrorhynchus globocaudatus (Zeder, 1800) Lühe, 1911 (Centrorhynchidae) was reported in birds of prey. Our population from Falco tinnunculus Linnaeus (Falconidae) and Buteo buteo Key words: Linnaeus (Accipitridae) in northern Italy was morphologically distinct from others described Acanthocephala; Centrorhynchus elsewhere. The worms are elongate and cylindrical. Proboscis long, apically truncated and globocaudatus; redescription; Italy; Falco; Buteo; new features; molecular profile bare, with wider base and variably faint constriction at point of attachment of receptacle. Large anterior hooks well rooted; posterior spiniform hooks with reduced roots; transitional Author for correspondence: hooks with scutiform roots in-between.
    [Show full text]