An Activating B1 Integrin Mutation Increases the Conversion of Benign to Malignant Skin Tumors Manuela Ferreira,1,2 Hironobu Fujiwara,1 Kazumasa Morita,3 and Fiona M
Total Page：16
File Type：pdf, Size：1020Kb
Published OnlineFirst February 3, 2009; DOI: 10.1158/0008-5472.CAN-08-3051 Research Article An Activating B1 Integrin Mutation Increases the Conversion of Benign to Malignant Skin Tumors Manuela Ferreira,1,2 Hironobu Fujiwara,1 Kazumasa Morita,3 and Fiona M. Watt1 1Cancer Research UK Cambridge Research Institute, Cambridge, United Kingdom; 2Ph.D. Programme in Experimental Biology and Biomedicine, Center for Neuroscience and Cell Biology, University of Coimbra, Coimbra, Portugal; and 3Department of Dermatology, Tenri Yorozu Hospital, Tenri, Japan Abstract Integrins are implicated in a variety of epidermal diseases Identifying the physiologic relevance of cancer-associated (1, 11–16). Integrin expression or signaling is often altered in genetic polymorphisms is a major challenge. Several changes squamous cell carcinomas (SCC). In studies of chemically induced in the coding sequence of B integrin subunits have now been skin carcinogenesis, overexpression of integrins in the suprabasal B layers alters susceptibility to tumor development (17–19). described in human tumors. One of these, T188I 1, was h identified as a heterozygous mutation in a poorly differenti- We previously identified a heterozygous mutation in the 1 ated squamous cell carcinoma (SCC) and shown to activate integrin subunit in cells from a poorly differentiated human SCC extracellular matrix adhesion and inhibit keratinocyte differ- of the tongue (20). The mutation, T188I, lies in the specificity loop entiation in vitro. To study its contribution to tumor of the I-like domain (21, 22) and results in constitutive activation of development, we overexpressed the mutant or wild-type ligand binding, thereby stimulating cell spreading at low extracel- (WT) human B1 subunit in the basal layer of mouse epidermis lular matrix concentrations (20). Although expression of the using the keratin 14 promoter. The transgenic integrins were mutation in cultured cells does not affect cell migration or expressed at the cell surface and were functional, with the invasion, it does lead to enhanced activation of Erk/MAPK B signaling (20). In contrast to the wild-type h1 subunit, unligated T188I 1 subunit promoting cell spreading to a greater extent h than WTB1. Epidermal proliferation and differentiation were T188I 1 does not trigger the initiation of terminal differentiation in human keratinocytes (20). unaffected and no expansion of the stem cell compartment h was detected. During chemical carcinogenesis, both trans- Sequencing of the 1 I–like domain in 124 human head and neck SCCs has revealed several additional single nucleotide changes, one genes increased papilloma formation, but only the T188IB1 transgene stimulated the conversion of papillomas to SCCs. of which results in a change in amino acid sequence (A239V; Papillomas bearing the mutation showed increased Erk ref. 23). The same single nucleotide changes are present in normal tissue from patients, indicating germ line polymorphisms. In activity and reduced differentiation. SCCs expressing 4 T188IB1 were less well-differentiated than those expressing addition, sequencing by the Sanger Cancer Genome Project has WTB1. These observations establish that the expression of a identified cancer-associated amino acid changes in the I-like B domain of the h6 and h7 integrin subunits. We conclude that genetic variant in the I-like domain of 1 integrins does not h affect normal epidermal homeostasis, but increases tumor changes in the amino acid sequence of integrin I–like domains susceptibility and influences tumor type. [Cancer Res are found at a low frequency in tumors and that they are probably 2009;69(4):1334–42] polymorphisms rather than somatic mutations. In order to investigate the physiologic role of the T188I mutation, we expressed the human T188Ih1 mutant or the wild-type human Introduction subunit in the epidermis of transgenic mice. Integrin extracellular matrix receptors regulate many aspects of epidermal cell behavior (1). Within the basal layer of the human Materials and Methods epidermis, stem cells express higher levels of integrins than cells Generation of transgenic mice. Human wild-type and T188I mutant h1 that are committed to undergo terminal differentiation (2–4). integrin subunit cDNAs (24) were subcloned into the BamHI restriction site Integrin signaling to Erk/mitogen-activated protein kinase (MAPK) of the keratin 14 (K14) promoter cassette kindly provided by E. Fuchs plays a role in the maintenance of the stem cell compartment (Howard Hughes Medical Institute, Rockefeller University, New York, NY), whereas signaling through Akt is involved in initiation of and were injected into the male pronucleus of day 1–fertilized FVB/N differentiation (5, 6). Studies with cultured human epidermal cells mouse eggs. Potential founder lines were screened by PCR using one primer show that integrin ligation suppresses the onset of terminal specific for h-globin (TACTCTGAGTCCAAACCGGGC) and one specific for differentiation, with ligated integrins sending a ‘‘do not differen- the human integrin h1 subunit (CAATTTGGCCCTGCTTGTATACATTC- h tiate’’ signal to the cells (7, 8). In mouse models, epidermal-specific TCCA). K14T188I 1 founder lines were 4826B, 4828B (low), and 4828B h deletion of specific integrins or modulation of integrin function (high). K14WT 1 founders were 4898A and 4837A. Founder lines 4828B (low) and 4837A had lower transgene copy numbers than the other lines. lead to a range of phenotypes, from epidermal blistering to a failure Experimental procedures on mice. Experiments were subject to to maintain the hair follicles (1, 9, 10). Cancer Research UK ethical review and were performed under the terms of a U.K. Government Home Office license. Bromodeoxyuridine (BrdUrd) injections were performed as previously described (25). Requests for reprints: Fiona M. Watt, Cancer Research UK Cambridge Research Institute, Robinson Way, Cambridge CB2 0RE, United Kingdom. Phone: 44-1223- 404400; Fax: 44-1223-404573; E-mail: [email protected]. I2009 American Association for Cancer Research. doi:10.1158/0008-5472.CAN-08-3051 4 http://www.sanger.ac.uk/genetics/CGP/Studies/studies.shtml Cancer Res 2009;69: (4). February 15, 2009 1334 www.aacrjournals.org Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2009 American Association for Cancer Research. Published OnlineFirst February 3, 2009; DOI: 10.1158/0008-5472.CAN-08-3051 b1 Integrin Mutation in Cancer Chemical carcinogenesis experiments were performed on 7-week-old (Tree Star, Inc), excluding dead, 7AAD-positive cells, and differentiated cells female K14WTh1 (line 4898A) and K14T188Ih1 (4828B, high) mice, and with high forward and side scatter. nontransgenic littermates (25 animals/group), essentially as previously Cell adhesion assays. Microtiter plates (96-well) were coated with 50 AL described (17–19). Mice received one topical application of 100 nmol of of human plasma fibronectin (Chemicon) or human placenta laminin (25 Ag) 7,12-dimethylbenz(a)anthracene (DMBA; Sigma-Aldrich) in 200 AL (Sigma-Aldrich) overnight at 4jC and blocked with 1% heat-denatured BSA of acetone followed by twice weekly applications of 6 nmol of (3.7 Ag) 12-O- in PBS. 2 Â 104 cells were added per well and incubated at 37jC for 30 min tetradecanoylphorbol-13-acetate (TPA; Sigma-Aldrich) in 200 AL acetone. As in serum-free medium containing 0.5% BSA. After washing, cells were fixed controls, transgenic and nontransgenic littermates (5–10 animals/group) with 4% PFA in PBS and stained with Diff-Quik (International Reagents, were subjected to the same protocol but substituting DMBA or TPA with Japan). Spread cells (defined as cells in which the long axis was more than acetone. Papillomas and SCC were recorded once a week for up to 54 weeks twice the diameter of the nucleus) were counted in three independent fields after the start of promotion. Tumor sections were graded as described per well. In some experiments, cells were incubated with 10 Ag/mL of P5D2 previously (17). antibody for 20 min at room temperature prior to plating. Tissue processing. For sections, tissue was either fixed in 10% neutral- To visualize filamentous actin, cells were fixed with 4% PFA in PBS for buffered formalin and embedded in paraffin or frozen in liquid nitrogen– 10 min, permeabilized with 0.1% Triton X-100/PBS for 5 min and stained cooled isopentane and then embedded in OCT embedding matrix with phalloidin-conjugated Alexa-555 (Invitrogen, Corp.). (Raymond A Lamb, UK). Epidermal whole mounts of tail skin were Integrin turnover time. Adherent subconfluent keratinocytes were prepared as described previously (25), with minor modifications. surface-labeled with 1 mg/mL of EZ-Link Sulfo-NHS-LC-Biotin (Pierce) in Antibodies. The following monoclonal antibodies were used: AIIB2, PBS (pH 8.0) for 15 min at room temperature. Cells were washed twice TS2/16, DH12, and P5D2 (anti-human h1 integrin subunit; refs. 26, 27); with serum-free, calcium-free FAD medium and incubated in complete LHK15 (anti-keratin 15; ref. 25), anti-BrdUrd (clone 3D4; BD Pharmingen), medium at 37jC for 0, 4, 8, or 20 h. Cells were harvested with trypsin/ MB1.2 (anti-mouse h1 integrins; ref. 25), and GoH3 (anti-integrin a6 EDTA, incubated with P5D2 antibody for 30 min on ice and washed twice chain; BD Pharmingen). Rabbit antibodies were anti-phosphorylated with ice-cold PBS. Pellets containing 4 Â 106 cells were lysed in p44/42 MAPK (Thr202/Tyr204) and anti-p44/42 MAPK (Cell Signaling radioimmunoprecipitation assay (RIPA) buffer [0.1% SDS, 0.5% sodium Technology, Inc.), anti-mouse K14 (Covance Research Products, Inc.), anti- deoxycholate, 1% Nonidet P-40, 50 mmol/L Tris-HCl (pH 8.0), laminin (Sigma-Aldrich), and anti-Ki67 (Neomarkers). AlexaFluor 488– and 150 mmol/L NaCl] with proteinase inhibitors (Roche). Cell lysates or 594–conjugated secondary antibodies were obtained from Invitrogen, were clarified by centrifugation, then 20 AL of a 50% slurry of UltraLink Corp. Donkey anti-rabbit biotin antibody was from The Jackson Immobilized Protein G Plus Gel (Pierce) was added and incubated for Laboratory.