DOCSLIB.ORG

Microsatellites from Fosterella Christophii

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Microsatellites from Fosterella Christophii Microsatellites from Fosterella christophii (Bromeliaceae) by de Novo Transcriptome Sequencing on the Pacific Biosciences RS Platform Author(s): Tina Wöhrmann, Bruno Huettel, Natascha Wagner and Kurt Weising Source: Applications in Plant Sciences, 4(1) Published By: Botanical Society of America DOI: http://dx.doi.org/10.3732/apps.1500084 URL: http://www.bioone.org/doi/full/10.3732/apps.1500084 BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder. BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. Applications in Plant Sciences 2016 4(1): 1500084 Applications in Plant Sciences PRIMER NOTE MICROSATELLITES FROM FOSTERELLA CHRISTOPHII (BROMELIACEAE) BY DE NOVO TRANSCRIPTOME SEQUENCING ON 1 THE PACIFIC BIOSCIENCES RS PLATFORM TINA WÖHRMANN2,4, BRUNO HUETTEL3, NATASCHA WAGNER2, AND KURT WEISING2 2Systematics and Morphology of Plants, Institute of Biology, University of Kassel, Heinrich-Plett-Str. 40, 34132 Kassel, Germany; and 3Max Planck-Genome-centre Cologne, Max Planck Institute for Plant Breeding Research, Carl-von-Linné-Weg 10, 50829 Cologne, Germany • Premise of the study: Microsatellite markers were developed in Fosterella christophii (Bromeliaceae) to investigate the genetic diversity and population structure within the F. micrantha group, comprising F. christophii, F. micrantha, and F. villosula. • Methods and Results: Full-length cDNAs were isolated from F. christophii and sequenced on a Pacific Biosciences RS plat- form. A total of 1590 high-quality consensus isoforms were assembled into 971 unigenes containing 421 perfect microsatel- lites. Thirty primer sets were designed, of which 13 revealed a high level of polymorphism in three populations of F. christophii, with four to nine alleles per locus. Each of these 13 loci cross-amplified in the closely related species F. micrantha and F. villosula, with one to six and one to 11 alleles per locus, respectively. • Conclusions: The new markers are promising tools to study the population genetics of F. christophii and to discover species boundaries within the F. micrantha group. Key words: Bromeliaceae; Fosterella christophii; microsatellites; Pacific Biosciences; single-molecule real-time (SMRT) sequencing; transcriptome. Fosterella christophii Ibisch, R. Vásquez & J. Peters, F. METHODS AND RESULTS micrantha (Lindl.) L. B. Sm., and F. villosula (Harms) L. B. Sm. form a well-circumscribed species group within the ge- Total RNA was isolated from fresh leaves of one F. christophii plant nus Fosterella L. B. Sm., known as the F. micrantha group (NW09.030-11) using the RNeasy Plus Micro Kit (QIAGEN, Venlo, The Neth- (Pitcairnioideae; Bromeliaceae) (Wagner et al., 2013). The erlands). RNA quality and quantity were assessed by capillary electrophoresis three species are morphologically very similar terrestrial on a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, California, USA). Polyadenylated RNA was isolated with the NEBNext Poly(A) mRNA Mag- rosette plants with small, whitish, insect-pollinated flowers netic Isolation Module (New England Biolabs, Ipswich, Massachusetts, USA), (Peters, 2009). Such high levels of similarity are surprising, followed by an integrity check via capillary electrophoresis. An aliquot of 1 ng given that F. micrantha is endemic to Central America, whereas of poly(A) RNA was selected as an input for cDNA synthesis with a SMARTer the other two species reside in the Bolivian Andes. Controlled PCR cDNA Synthesis Kit (Clontech Laboratories, Mountain View, California, pollination experiments indicated that all three species are USA). A SMRTbell library was prepared as recommended by Pacific Biosci- self-compatible but also form viable hybrids (Wagner et al., ences (PacBio, Menlo Park, California, USA). The amplified cDNA was size- fractionated on agarose gels, and fragments with insert sizes >1.5 kb were 2015). To investigate the genetic diversity and differentiation recovered. SMRTbell templates were bound to polymerases using the PacBio in this closely related species complex, we used Pacific Bio- DNA/polymerase binding kit P4 and v2 primers. Polymerase-template com- sciences’ single-molecule real-time (SMRT) technology (Eid plexes were bound to magnetic beads using a MagBead Kit (PacBio, part #100- et al., 2009) to develop a set of genic microsatellite markers in 133-600). Sequencing was carried out on the PacBio RS II sequencer using C2 F. christophii. sequencing reagents with a movie length of 180 min. Full-length cDNAs were identified with the PacBio SMRT analysis software (version 2.2.0). High-quality sequences were achieved by running the protocol with a filter for a minimum of three full passes of a cDNA and discarding all non–full length cDNAs and chimeric products. The read output was further trimmed and assembled into unigenes using CAP3 (Huang and Madan, 1999). 1 Manuscript received 18 July 2015; revision accepted 24 September A total of 1590 high-quality consensus isoforms with an average size of 2015. 1322 bp were assembled into 971 unigenes. BatchPrimer3 (You et al., 2008) The authors thank the Botanical Gardens of Hannover and Heidelberg, was applied to detect perfect microsatellites, accepting minimum thresholds of Dr. Jule Peters (University of Kassel, Kassel, Germany), Dr. Nicole Schütz seven repeat units for di-, six for tri-, five for tetra-, and four for penta- and (Stuttgart State Museum of Natural History, Stuttgart, Germany), and Dr. hexanucleotide repeats, respectively. A total of 421 microsatellites were pres- Ivón Ramírez-Morillo (Centro de Investigación Científica de Yucatán, ent in 275 unigenes. Motif types are compiled in Appendix S1. Flanking se- Mérida, Yucatán, Mexico) for kindly providing plant material and Sascha quences of appropriate quality and length were present at 335 microsatellite Herwig for assistance in the laboratory. loci. 4 Author for correspondence: [email protected] Microsatellite-flanking primers were designed using the BatchPrimer3 interface (You et al., 2008), applying the following criteria: length ranging doi:10.3732/apps.1500084 from 18 to 23 nucleotides, product size ranging from 100 to 300 bp, annealing Applications in Plant Sciences 2016 4(1): 1500084; http://www.bioone.org/loi/apps © 2016 Wöhrmann et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons Attribution License (CC-BY-NC-SA). 1 of 4 Applications in Plant Sciences 2016 4(1): 1500084 Wöhrmann et al.—Fosterella christophii microsatellites doi:10.3732/apps.1500084 TABLE 1. Characteristics of 22 microsatellite loci and flanking primer pairs developed for Fosterella christophii. Allele GenBank SSR a,b c Locus Primer sequences (5′–3′) Repeat motif size (bp) Ta (°C) accession no. BLASTX description % location Foc_01 F: CCTCACTATCGCTCACTACAT (AG)15 146 55.2 KT036677 PREDICTED: cinnamoyl-CoA reductase 1-like isoform 80 5′UTR R: GTCACGCACACCAACTTC X1 [Phoenix dactylifera] Foc_02 F: GAGGCATTGGGTTTTTCT (TC)17 147 55.3 KT036678 No match found — — R: AGATCTGCGGCTACATCTC Foc_03 F: CCTTATTCCCCAAATCATAAA (AG)17 148 55.8 KT036679 PREDICTED: tetraspanin-3-like [Musa acuminata 80 5′UTR R: CTACCTCCTCTTCCTCTTCCT subsp. malaccensis] Foc_04 F: GCCATTGAGTTCACCAAGT (AG)20 145 55.5 KT036680 PREDICTED: tricetin 3′,4′,5′-O-trimethyltransferase 77 3′UTR R: ACAACCCAAGCAATAATAACA [Phoenix dactylifera] Foc_05 F: CTTCTCCTTCTCCTCCATCT (TCG)7 136 55.4 KT036681 PREDICTED: ribonuclease 2 [Musa acuminata 78 5′UTR R: AATAGGTCAGAGGATTTGAGC subsp. malaccensis] Foc_06 F: CGTCAATCTCAATCCCTTC (CCT)7 138 55.3 KT036682 PREDICTED: secretory carrier-associated membrane 88 5′UTR R: ACCTGCACTACTCAGAGGAA protein 2-like isoform X1 [Elaeis guineensis] Foc_07 F: TTCATCGCCTCTCGTTTAT (CTC)7 130 57.9 KT036683 PREDICTED: uncharacterized protein LOC103707719 86 5′UTR R: CTTCGCCGTACCTCCAGTAG isoform X2 [Phoenix dactylifera] Foc_09* F: TAAAGGGAGAGAGAGGAAGAA (AGA)8 168 55.3 KT581625 PREDICTED: phosphoribulokinase, chloroplastic 93 5′UTR R: GATGAGCTGCTGCTTCTG [Pyrus ×bretschneideri] Foc_10* F: CTCCTTTTTCCTTTTCCTTTA (AGG)8 140 54.6 KT581626 Ubiquitin-conjugating enzyme 32 [Theobroma cacao] 87 5′UTR R: CCGTGTTCTTCTTGTTGTACT Foc_11* F: GAGGGTAAATTTCTCTGCTTC (GAA)9 204 55.2 KT581627 Best match <75% sequence similarity — — R: TACGATGTACAGCTAGGGATG Foc_12 F: CACAAATGTGCTCTTCTGG (TCT)14 153 55.0 KT036684 Best match <75% sequence similarity — — R: CGTGGGATCTCTATCGTG Foc_15* F: GAGGACTTCGGTGTAATTTGT (ATTTT)4 185 55.2 KT581628 Best match <75% sequence similarity — — R: CCAACGGAAGAGTTCATAATA Foc_16** F: CTCAGCTGAACAATTCTGAG (GAAGA)5 194 54.3 KT581629 PREDICTED: sec-independent protein translocase 90 5′UTR R: ACTTGGAGATGGAAGATAAGG protein TATC, chloroplastic-like [Oryza brachyantha] Foc_17* F: GCCATTGTCCAGAAGTCC (TCCTC)4 153
Load more

Recommended publications
  • Diversity and Levels of Endemism of the Bromeliaceae of Costa Rica – an Updated Checklist
    A peer-reviewed open-access journal PhytoKeys 29: 17–62Diversity (2013) and levels of endemism of the Bromeliaceae of Costa Rica... 17 doi: 10.3897/phytokeys.29.4937 CHECKLIST www.phytokeys.com Launched to accelerate biodiversity research Diversity and levels of endemism of the Bromeliaceae of Costa Rica – an updated checklist Daniel A. Cáceres González1,2, Katharina Schulte1,3,4, Marco Schmidt1,2,3, Georg Zizka1,2,3 1 Abteilung Botanik und molekulare Evolutionsforschung, Senckenberg Forschungsinstitut Frankfurt/Main, Germany 2 Institut Ökologie, Evolution & Diversität, Goethe-Universität Frankfurt/Main, Germany 3 Biodive rsität und Klima Forschungszentrum (BiK-F), Frankfurt/Main, Germany 4 Australian Tropical Herbarium & Center for Tropical Biodiversity and Climate Change, James Cook University, Cairns, Australia Corresponding author: Daniel A. Cáceres González ([email protected]) Academic editor: L. Versieux | Received 1 March 2013 | Accepted 28 October 2013 | Published 11 November 2013 Citation: González DAC, Schulte K, Schmidt M, Zizka G (2013) Diversity and levels of endemism of the Bromeliaceae of Costa Rica – an updated checklist. PhytoKeys 29: 17–61. doi: 10.3897/phytokeys.29.4937 This paper is dedicated to the late Harry Luther, a world leader in bromeliad research. Abstract An updated inventory of the Bromeliaceae for Costa Rica is presented including citations of representa- tive specimens for each species. The family comprises 18 genera and 198 species in Costa Rica, 32 spe- cies being endemic to the country. Additional 36 species are endemic to Costa Rica and Panama. Only 4 of the 8 bromeliad subfamilies occur in Costa Rica, with a strong predominance of Tillandsioideae (7 genera/150 spp.; 75.7% of all bromeliad species in Costa Rica).
    [Show full text]
  • Cytotype Associations, Ecological Divergence and Genetic Variation in the Apomictic Complex Paspalum Intermedium Munro Ex Morong (Poaceae)
    Cytotype Associations, Ecological Divergence and Genetic Variation in the Apomictic Complex Paspalum intermedium Munro Ex Morong (Poaceae) Dissertation for the award of the degree “Doctor of Philosophy” Ph.D. Division of Mathematics and Natural Sciences of the Georg-August-Universität Göttingen within the doctoral program Biology of the Georg-August University School of Science (GAUSS) Submitted by Piyal Karunarathne Göttingen, 2018 THESIS COMMITTEE Prof. Dr. Elvira Hörandl Department of Systematics, Biodiversity and Evolution of Plants (with herbarium) Albrecht-von-Haller Institute for Plant Sciences University of Göttingen, Germany Prof. Dr. Holger Kreft Department of Biodiversity, Macroecology & Biogeography Faculty of Forest Sciences and Forest Ecology University of Göttingen, Germany Dr. Diego Hojsgaard Department of Systematics, Biodiversity and Evolution of Plants (with herbarium) Albrecht-von-Haller Institute for Plant Sciences University of Göttingen, Germany MEMBERS OF THE EXAMINATION BOARD Reviewer Prof. Dr. Elvira Hörandl Department of Systematics, Biodiversity and Evolution of Plants (with herbarium), Albrecht-von-Haller Institute for Plant Sciences University of Göttingen, Germany Second Prof. Dr. Holger Kreft reviewer Department of Biodiversity, Macroecology & Biogeography Faculty of Forest Sciences and Forest Ecology University of Göttingen, Germany Further members of the Examination Board Prof. Dr. Stefan Scheu J.F. Blumenbach Institute of Zoology and Anthropology University of Göttingen Prof. Dr. Mark Maraun J.F. Blumenbach Institute of Zoology and Anthropology University of Göttingen Prof. Dr. Thomas Friedl Dept. EPSAG University of Göttingen Dr. Sven Bradler J.F. Blumenbach-Institut für Zoologie und Anthropologie University of Göttingen ii Acknowledgments I would like to place on record my sincere gratitude to Dr. Diego Hojsgaard for choosing me to carry out this research project, his excellent supervision, tremendous help and advice, and for remaining unflappable despite my various crisis.
    [Show full text]
  • Hechtia Klotzsch (Bromeliaceae: Hechtioideae)
    Centro de Investigación Científica de Yucatán, A.C. Posgrado en Ciencias Biológicas CARACTERIZACIÓN MORFOLÓGICA DEL POLEN EN EL GÉNERO HECHTIA KLOTZSCH (BROMELIACEAE: HECHTIOIDEAE) Tesis que presenta ESTHER ELIZABETH HERRERA CANTO En opción al título de MAESTRA EN CIENCIAS (Ciencias Biológicas: Opción Recursos Naturales) Mérida, Yucatán, México 2016 DECLARACIÓN DE PROPIEDAD Declaro que la información contenida en la sección de Materiales y Métodos Experimentales, los Resultados y Discusión de este documento proviene de las actividades de experimentación realizadas durante el período que se me asignó para desarrollar mi trabajo de tesis, en las Unidades y Laboratorios del Centro de Investigación Científica de Yucatán, A.C., y que a razón de lo anterior y en contraprestación de los servicios educativos o de apoyo que me fueron brindados, dicha información, en términos de la Ley Federal del Derecho de Autor y la Ley de la Propiedad Industrial, le pertenece patrimonialmente a dicho Centro de Investigación. Por otra parte, en virtud de lo ya manifestado, reconozco que de igual manera los productos intelectuales o desarrollos tecnológicos que deriven o pudieran derivar de lo correspondiente a dicha información, le pertenecen patrimonialmente al Centro de Investigación Científica de Yucatán, A.C., y en el mismo tenor, reconozco que si derivaren de este trabajo productos intelectuales o desarrollos tecnológicos, en lo especial, estos se regirán en todo caso por lo dispuesto por la Ley Federal del Derecho de Autor y la Ley de la Propiedad Industrial, en el tenor de lo expuesto en la presente Declaración. Firma: ________________________________ Nombre: ESTHER ELIZABETH HERRERA CANTO Este trabajo se llevó a cabo en la Unidad de Recursos Naturales del Centro de Investigación Científica de Yucatán, y forma parte del proyecto titulado Filogenia, Evolución y Biogeografía de Hechtia Klotszch (Hechtiodeae: Bromeliaceae), clave 60224 en el que participé bajo la dirección de la Doctora Ivón Mercedes Ramírez Morillo.
    [Show full text]
  • The Bromeliad Society of Queensland Inc Newsletter
    “Broms are addictive” The Bromeliad Society of Queensland Inc Newsletter February 2013 From the President Editor’s Note: John is providing a full report in the next Journal for this meeting. January Meeting John Olsen opened the meeting at 7:30pm. Apologies to Norma Poole in January 2013 Newsletter Norma entered Aechmea orlandiana in the Novice competition and was placed 2nd. Not Betty Sheppard. Our apologies to both contestants, but this was not Fred’s fault. John welcomes Charles Birdsong from Baton Rouge and Michelle Casey. John declared the AGM opened and the minutes approved. The President’s full report will be in the next issue of Bromeliaceae. The financial statement was presented by the Treasurer. John thanked his committee for 2012 for their help – Bruce Dunstan and Bob Cross will not be nominating for the committee this year. Bob Cross has been a committee member for 35years. A big thank you was given to both of these members for their commitment to the society. John also thanked all the volunteers and hoped they would be with us again this year. Our new Committee for 2013 PRESIDENT John Olsen IMMEDIATE PAST PRESIDENT John Olsen VICE-PRESIDENT Barry Kable SECRETARY Glenn Bernoth TREASURER Pam Butler COMMITTEE MEMBERS Peter Ball Mal Cameron Michele Cameron Chris Coulthard Jennifer Coulthard Barbara Murray Rob Murray Fred Thomson Olive Trevor David Vine The AGM was closed and the monthly meeting opened. The Autumn Show dates have been changed. Set up will be on Thursday 11th April from 2pm. Judging will be Friday morning and the area will be closed to the public.
    [Show full text]
  • Download Download
    LUIS ALFONSO CASTILLO-HERNÁNDEZ AND HILDA FLORES-OLVERA* Botanical Sciences 95 (3): 1-25, 2017 Abstract Background: The Bicentenario Reserve (BR) located in Sierra de Zongolica, Veracruz, includes 63 hect- DOI: 10.17129/botsci.1223 ares of cloud forest (cf) which lacks of systematic foristic studies, but the Sierra proposed as an area for bird conservation. Copyright: © 2017 Castillo-Her- Questions: i) Is the foristic composition of the BR taxonomical rich? ii) How the growth forms are repre- nández & Flores-Olvera. This is an open access article distributed under sented in this Reserve ? iii) Has the BR endemic or threatened species? the terms of the Creative Commons Studied species: Vascular plants. Attribution License, which permits Study site and years of study: The BR was explored from March 2011 to October 2012. unrestricted use, distribution, and Methods: Botanical samples from each species considered different were collected and processed accord- reproduction in any medium, provi- ded the original author and source are ing to conventional procedures to be identifed with the use of taxonomic tools, and consults with special- credited. ist. Analysis of the richness, life forms, endemism and threatened species were made. Results: We recorded 401 species, distributed in 272 genera and 102 families, being the most diverse Orchidaceae, Asteraceae, Fabaceae and Piperaceae; whilst Peperomia, Tillandsia, Polypodium, Quercus and Solanum are the genera with the highest number of species. Sixty-nine species are endemic to Mexico, but six are restricted to Veracruz. We found 23 new records for the municipality of Zongolica, Quercus ghiesbreghtii in the cf for the frst time, and Q.
    [Show full text]
  • Florida Council of Bromeliad Societies, Inc
    FLORIDA COUNCIL OF BROMELIAD SOCIETIES, INC. Aechmea mexicana Volume 36 Issue 3 August 2016 2 2 TABLE OF CONTENTS Inside this issue: Table of Contents 2 FCBS Officers and Member Societies 3 I love Bromeliads by Carol Wolfe, Editor 4 Mexican Bromeliad Weevil Report by Teresa M. Cooper 5 Calendar of Events 8 FCBS Minutes of June 25, 2016 (Draft) by Patty Gonzalez 9 Plants that Repel Mosquitoes Naturally 11 Pupa Laxa by Tom Wolfe 12 Windii or Theodore L. Mead? by Jay Thurrott 14 Dirt on Bromeliads by Karen Andreas 17 Aechmea mexicana by Tom Wolfe 18 Morning Coffee and Bromeliads by Carol Wolfe 19 Catopsis — A Quiet Bromeliad by Karen Andreas 20 This newsletter is a quarterly publication of the Florida Council of Bromeliad Societies FCBS TAX DEDUCTIBLE RECEIPTS The Florida Council of Bromeliad Societies, Inc. is a 501 (c) 3 Non-Profit Corporation, Incorporated in the State of Florida Please make your contributions for 2016 year’s tax deductible receipts no later than the end of the year by mailing to: Sudi Hipsley, 6616 Tuscawilla Drive, Leesburg, FL 34748-9190. If you have questions regarding your contribution, please call Sudi at 352-504-6162. Cover Photograph: Aechmea mexicana Photo by Carol Wolfe 2 2016 FCBS Officers Caloosahatchee Bromeliad Society 3 3 Chairman: Vicky Chirnside Vicky Chirnside, Email: [email protected] Vice Chairman: Calandra Thurrott Catherine Peterson, [email protected] Secretary: Patty Gonzalez Treasurer: Sudi Hipsley Florida East Coast Bromeliad Society Parliamentarian: Betsy McCrory Calandra Thurrott Email: [email protected]
    [Show full text]
  • Bromeliad Societ Inc
    Bromelcairns Bimonthly Newsletter of Cairns Bromeliad Societ Inc. 2012 # 1 P.O. Box 28 Cairns Queensland 4870 Austalia President Dave Weston 0740578604 V-President Karen Stevens 0740361086 Secretary Lynn Hudson 0740533913 Treasurer Frances Boyd 0740552550 Librarian Maria Grant 0740370161 Editor Lynn Hudson 0740533913 Editor Assist. Moyneen Charlton 0740337390 Member Concierge Nalda Wilson 0740544825 Popular Vote Steward Karen Cross 0740545497 OIC Raffles Lesley Hepburn 0488788892 Honorary Life Member - Grace Goode O.A.M. Honorary Life Member - Kay Edington Life Member - Lynn Hudson Life Member - Robert (Bob) Hudson ******************************************************************** Aims of the Society Promote and Develop Interest in Bromeliads through Friendship To Co-operate with similar Clubs throughout the World ******************************************************************** Membership Fee: $15 Single, $25 Family, Country Member $25. $7.50 junior (if not in family membership) Meetings start at 1.pm sharp first Saturday of the month. Please bring a cup and a chair. Library: All books & magazines borrowed are to be returned in good order to the following meeting. If not on wait list, they may be rebooked. Plant Display/Sales: To participate, a member must be financial and circumstances permitting, have attended at least three meetings in the past six months. Where the society is charged a stall fee - 20% of sales are deducted for club funds. No charge venue & meetings - 10% of sales is deducted. All plants to be clean, free of disease, named and price tagged. Show Plants: Must be the property of and in the custody of the entrant for the past three months. For Society Shows the entrant must be financial and have attended at least three meetings during the past six months.
    [Show full text]
  • Network Scan Data
    Selbyana 29(2): 195-198. 2008. KEy TO THE SPECIES OF THE GENUS FOSTERELIA (BROMELIACEAE) PIERRE L. IBISCH* Faculty of Forest and Environment, University of Applied Sciences Eberswalde, Alfred-Moller­ Str. 1, 16227 Eberswalde, Germany. Email: [email protected] ROBERT W. READt JULE PETERS Department of Botany, Institute of Biology, University of Kassel, Heinrich-Plett-Str. 40, D-34132 Kassel, Germany. ASSTRACf. An updated key to the species of the genus Fosterella (Bromeliaceae) is presented. It comprises all of the 30 currently accepted species from Argentina, Bolivia, Brazil, Colombia, EI Salvador, Guatemala, Mexico, Paraguay, and Peru. Key words: Bromeliaceae, Pitcaimioideae, Fosterella, taxonomy, synonymy INTRODUCTION l' Flowers white, cream or yellow, much shorter than 20 mm ........................ 2 Keys for the identification of the species of 2 Flowers and fruits spreading ........... 10 Fosterella (Bromeliaceae) so far have been pro­ 2' Flowers and fruits secund .............. 3 3 Leaves glabrous or glabrescent beneath, up to 30 vided by Smith (1934; genus Lindmania), Smith mm wide, narrowed towards base, inflorescence & Downs (1974), and Smith & Read (1992). racemose or paniculate, with lateral branches of Since the publication of the latter, collection ef­ 1st and rarely 2nd order; axis slender, green, forts and taxonomic research have been inten­ sparsely lanate; flowers nutant; floral bracts sified significantly. Since 1992 the number of sparsely lanate; Madeira-Tapaj6s moist forests in described species has doubled, and now, after central Amazon; BRAZIL: State of Para ...... considerable progress of systematic research . .. .. F. batistana based on molecular data, we feel comfortable to 3' Leaves variously but obviously bearing trichomes provide a key to the currently accepted species.
    [Show full text]
  • Pollinic Characterization of Raulinoa Echinata RS Cowan (Rutaceae)
    Acta Biológica Catarinense 2017 Jan-Jun;4(1):71-82 Pollinic characterization of Raulinoa echinata R. S. Cowan (Rutaceae), Dyckia brevifolia Baker and Dyckia ibiramensis Reitz (Bromeliaceae), reophyte and saxicolous endemic species of river Itajaí-Açu, Santa Catarina, Brazil Caracterização polínica de Raulinoa echinata R.S. Cowan (Rutaceae), Dyckia brevifolia Baker e Dyckia ibiramensis Reitz (Bromeliaceae), espécies reófitas e endêmicas do rio Itajaí-Açu, Santa Catarina, Brasil Denise Monique Dubet da Silva MOUGA1, 4; Bruna Tereza POSSAMAI2; Enderlei DEC3 & Sílvio Murilo Cristóvão da SILVA3 ABSTRACT Aiming to contribute with elements about the reproduction of the reophytes Raulinoa Recebido em: 5 maio 2017 echinata, Dyckia brevifolia and Dyckia ibiramensis as well as to support their taxonomic Aceito em: 22 jun. 2017 definition, their pollinic characterization was carried out. Fresh pollen grains were prepared by acetolysis. Observations occurred on a light microscope and a scanning electron microscope. Measures were done of the polar (P) and equatorial diameters (E) and thickness of the exine and are expressed as means in micrometers. R. echinata: monad; radial symmetry; medium size; P=49,07±3,33; E=33,95±3,94; prolate (ratio P / E); ambitus subtriangular; 3-aperturated with long colpi and lalongate endoapertures; exine striated with thickness 1.54 ± 0,32. Dyckia brevifolia: monad; bilateral symmetry; medium size; P=25,16 ± 3,02; E=43,16±3,50 x 28,12±3,26; ambitus elliptical; monoaperturated with one long sulcus; exine reticulate with thickness 1,66 ± 0,31. D. ibiramensis: monad; bilateral symmetry; medium size; P=29,54±3,17; E=42,36±3,60 x 28,43±3,38; ambitus elliptical; monoaperturated with one long sulcus; exine reticulate with thickness 1,73 ± 0,28.
    [Show full text]
  • Bromeliad Flora of Oaxaca, Mexico: Richness and Distribution
    Acta Botanica Mexicana 81: 71-147 (2007) BROMELIAD FLORA OF OAXACA, MEXICO: RICHNESS AND DISTRIBUTION ADOLFO ESPEJO-SERNA1, ANA ROSA LÓPEZ-FERRARI1,NANCY MARTÍNEZ-CORRea1 AND VALERIA ANGÉLICA PULIDO-ESPARZA2 1Universidad Autónoma Metropolitana-Iztapalapa, División de Ciencias Biológicas y de la Salud, Departamento de Biología, Herbario Metropolitano, Apdo. postal 55-535, 09340 México, D.F., México. [email protected] 2El Colegio de la Frontera Sur - San Cristóbal de las Casas, Laboratorio de Análisis de Información Geográfica y Estadística, Chiapas, México. [email protected] ABSTRACT The current knowledge of the bromeliad flora of the state of Oaxaca, Mexico is presented. Oaxaca is the Mexican state with the largest number of bromeliad species. Based on the study of 2,624 herbarium specimens corresponding to 1,643 collections, and a detailed bibliographic revision, we conclude that the currently known bromeliad flora for Oaxaca comprises 172 species and 15 genera. All Mexican species of the genera Bromelia, Fosterella, Greigia, Hohenbergiopsis, Racinaea, and Vriesea are represented in the state. Aechmea nudicaulis, Bromelia hemisphaerica, Catopsis nitida, C. oerstediana, C. wawranea, Pitcairnia schiedeana, P. tuerckheimii, Racinaea adscendens, Tillandsia balbisiana, T. belloensis, T. brachycaulos, T. compressa, T. dugesii, T. foliosa, T. flavobracteata, T. limbata, T. maritima, T. ortgiesiana, T. paucifolia, T. pseudobaileyi, T. rettigiana, T. utriculata, T. x marceloi, Werauhia pycnantha, and W. nutans are recorded for the first time from Oaxaca. Collections from 226 (of 570) municipalities and all 30 districts of the state were studied. Among the vegetation types occurring in Oaxaca, oak forest is the richest with 83 taxa, followed by tropical deciduous forest with 74, and cloud forest with 73 species.
    [Show full text]
  • Nuclear Genes, Matk and the Phylogeny of the Poales
    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2018 Nuclear genes, matK and the phylogeny of the Poales Hochbach, Anne ; Linder, H Peter ; Röser, Martin Abstract: Phylogenetic relationships within the monocot order Poales have been well studied, but sev- eral unrelated questions remain. These include the relationships among the basal families in the order, family delimitations within the restiid clade, and the search for nuclear single-copy gene loci to test the relationships based on chloroplast loci. To this end two nuclear loci (PhyB, Topo6) were explored both at the ordinal level, and within the Bromeliaceae and the restiid clade. First, a plastid reference tree was inferred based on matK, using 140 taxa covering all APG IV families of Poales, and analyzed using parsimony, maximum likelihood and Bayesian methods. The trees inferred from matK closely approach the published phylogeny based on whole-plastome sequencing. Of the two nuclear loci, Topo6 supported a congruent, but much less resolved phylogeny. By contrast, PhyB indicated different phylo- genetic relationships, with, inter alia, Mayacaceae and Typhaceae sister to Poaceae, and Flagellariaceae in a basally branching position within the Poales. Within the restiid clade the differences between the three markers appear less serious. The Anarthria clade is first diverging in all analyses, followed by Restionoideae, Sporadanthoideae, Centrolepidoideae and Leptocarpoideae in the matK and Topo6 data, but in the PhyB data Centrolepidoideae diverges next, followed by a paraphyletic Restionoideae with a clade consisting of the monophyletic Sporadanthoideae and Leptocarpoideae nested within them. The Bromeliaceae phylogeny obtained from Topo6 is insufficiently sampled to make reliable statements, but indicates a good starting point for further investigations.
    [Show full text]
  • POLYPLOIDY in PLANTS IS LINKED to CLIMATE Genomic Evolution and 1 2 2 1 Climate Juraj Paule , Natascha D
    RA 3.2 POLYPLOIDY IN PLANTS IS LINKED TO CLIMATE Genomic Evolution and 1 2 2 1 Climate Juraj Paule , Natascha D. Wagner , Kurt Weising & Georg Zizka 1Senckenberg Research Institute and Natural History Museum Frankfurt, 2Plant Molecular Systematics, Department of Sciences, University of Kassel, Germany Motivation and Results • Cytotype distribution in Fosterella (Bromeliaceae) was found to be climatically differentiated. Due to altered genomic attributes polyploidy is often considered for fitness advantage over • Polyploids preferentially occupy colder and drier habitats than diploids. diploidy in climatically variable habitats • Polyploidizations were dated back to climatically variable Pliocene and Pleistocene periods. (Comai 2005). Ancestral chromosome number reconstructions Distribution of studied Fosterella cytotypes (Paule et al. 2017). 1 in the genus Fosterella. The scale bar below the 2 tree represents time (Mya). Contribution to SGN Program Portfolio • It contributes to the complex view of Earth system interactions by integrating „geo“- and „bio“ perspective. • As a lesson from past it enables to forecast possible genomic responses under climate fluctuations in future. • Concerning future applications, the results may provide new possibilities for breeding of closely related crop species. 3 Scatterplot of individual-based PCA based on 4 Fosterella penduliflora (C.H.Wright) L.B. Smith climatic variables for studied Fosterella. Foto: J. Peters Polyploids are significantly shifted towards colder and drier habitats. Outlook • common garden experiments under controlled conditions • application of genomic and transcriptomic tools to identify the key elements of polyploid adaptability • study additional polyploid complexes and eventually develop a general model of polyploid distribution in the Neotropics Acknowledgements We are grateful to the curators and staff of the botanical gardens of the Goethe University, University of Kassel, University of Heidelberg, University of Vienna, and the Palmengarten Frankfurt for providing and cultivating plant material.
    [Show full text]