DOCSLIB.ORG

Proximal Dominant Hereditary Motor and Sensory Neuropathy Association with Mutation in the TRK-Fused Gene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Proximal Dominant Hereditary Motor and Sensory Neuropathy Association with Mutation in the TRK-Fused Gene Supplementary Online Content Lee S-S, Lee HJ, Park J-M, et al. Proximal dominant hereditary motor and sensory neuropathy association with mutation in the TRK-fused gene. JAMA Neurol. Published online March 18, 2013. doi:10.1001/jamaneurol.2013.1250. eTable 1. Sample list in FC457 family eTable 2. Microsatellites used for chromosomal mapping of 3q1-q2 and their primers for PCR eTable 3. Nonsynonymous variants which are present in three affected individuals (III-23, -27, -29), but not in an unaffected individual (III-25) eTable 4. Nonsynonymous variants found in CMT genes from the proband (III-27) exome data eFigure 1. Diagram of chromosome 3 mapping region for HMSN-P eFigure 2. TFG expression in the distal sural nerve eReferences. This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 eTable 1. Sample list in FC457 family Samples Sex/age Affected Onset DNA testingb CMT Statusa age(year) phenotype (A/U) II-6 F/89 U - No, L - II-16 M/72 U - No - III-3 F/69 U - No - III-4 F/67 U - No - III-7 F/65 U - No, L - III-12 F/68 U - No, L - III-16 F/52 U - No, L - III-18 F/62 U - No, L - III-23 M/56 A 45 Yes, L, E HMSN-P III-25 M/55 U - No, L, E - III-27 M/51 A 48 Yes, L, E HMSN-P III-28 F/48 U - No, L - III-29 F/48 A 46 Yes, L, E HMSN-P III-30 M/50 U - No, L - III-32 M/59 U - No - III-34 F/58 U - No - IV-1 F/50 U - No - IV-4 M/45 U - No - IV-8 F/34 U - No - IV-9 F/32 C/U - No - IV-10 F/33 C/U - No - IV-11 M/31 A 29 Yes, L HMSN-P IV-12 F/28 C/U - Yes - IV-13 M/27 U - No - IV-17 M/23 C/U - Yes, L - IV-18 F/20 U - No, L - IV-19 M/27 A 27 Yes, L HMSN-P IV-20 M/21 U - No, L - aA: affected, U: unaffected, C/U: clinically unaffected. bSamples with TFG (P285L) mutation (Yes) or without mutation (No), linkage analyzed for 3q (L), and exome studied (E). © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 eTable 2. Microsatellites used for chromosomal mapping of 3q1-q2 and their primers for PCR Marker Position (bp)a Repeat Forward primer Reverse primer D3S0490i 81,376,314-81,376,660 GT TTGTATCAAAGCATCTTGTGTA GCCTTAATATTTGTTCTCCAAC D3S1496i 90,151,487-90,151,710 GT TGAGGTTGGGAGATTCATTAC TGTCTAGCTGAGTATTTGCACAC D3S1488i 97,819,999-97,820,344 ATCT CTTAGGCTCCTTAATTCCAAAC TGGATAATTAGGTCAAGAGCTATC MK447017 99,591,050-99,591,260 GT CATCAGAACAGCAAACATTCA TGGATCAGATGACCTCCATT D3S1592i 100,330,045-100,330,474 TTCC CCTCATTTAAAGGACATACTTCAC AGCTGGTATGCCTCTATTGTTAG D3S3652 102,003,622-102,003,945 CA GAAAAATAGTCTCCAGTCAAGTAGC ATGCCCATCAATCAATGAGT D3S1083i 105,165,297-105,165,656 CA CAGTTGCACTATGGAGTATAAATC GATCAACTCCTGTAGATTCTACAG D3S0532i 105,834,654-105,835,054 GT GTAAACAATCTTGTGCATCAAG AGTTAAGTACTGTTACTTGGCCTC D3S1271 100,734,730-100,734,966 CA TGATTGGAGGTGGTAGAGGT AGCTATCATGTAGAAAAGCAGCA D3S2495 108,136,425-108,136,792 CA ATCTGTAAGNTCTGCTTTGTGAAT AAATATTGTATGCGATGTGATTTA GATA146G09 111,062,838-111,063,230 CTAT AGTCATTGTCAGGCATTGGT ATATGACCTTGGGCAACAAA D3S1278 115,124,154-115,124,458 CA GGACACATGCTCCTGGAA TGCACTACAGGGCAGTTG D3S1303 118,158,274-118,158,597 CA CAGACAATGGCTTCCAAAAGTA CAAACTTAGGGTTGTTCCTCAC D3S3576 122,245,333-122,245,473 CA GATCTAGTTGGCAAGGCGT TTGGACTCGAGCAATCC D3S1587 130,798,818-130,799,234 CA TACAGTTCTATAAGGGCAGCC AGGGAGACAGAGTGATGGATT D3S1309 140,726,314-140,726,687 CA CTTTGGGGAATCATTAGTCTGT ATGAGAATTGTCATGGTGC D3S3531 154,213,339-154,213,674 CA AAGAGCCTAAATTAGGAAAATAAAA AAACAAAGCAAGACTCCATC D3S3580 159,618,270-159,618,613 CA GCCATTGCAGAGAAGTTTGA TGGGGCTACAGTTACAAGGG D3S1258 165,925,381-165,925,702 CA CGAAGAGGCACTTGCAC TGGCTGAATAAAATGATAACAC © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 eTable 3. Nonsynonymous variants which are present in three affected individuals (III-23, -27, -29), but not in an unaffected individual (III-25) Positiona Nucleotide Amino acid Other Gene RefSeqb (Chr: position) changec change descriptiond 1: 166944483 ILDR2 NM_199351 c.23G>C W8S Pol 2: 55187450 EML6 NM_001039753 c.4948C>T R1650C Priv 2: 99008386 CNGA3 NM_001298 c.626C>T S209L Pol 2: 113764226 IL36A NM_014440 c.176G>C R59T Pol 2: 130877775 POTEF NM_001099771 c.314G>T C105F Pol 2: 133543219 NCKAP5 NM_207363 c.1165A>G N389D Pol 2: 141946101 LRP1B NM_018557 c.902A>G D301G Priv 2: 179634421 TTN NM_003319 c.8749A>C T2917P Pol 3: 14724702 C3orf20 NM_001184958 c.116C>T S39L Pol 3: 100364791 GPR128 NM_032787 c.949T>C Y317H Priv 3: 100467026 TFG NM_006070 c.854C>T P285L Causative 4: 57316850 PAICS NM_001079524 c.753G>A W251X Priv 10: 30728081 MAP3K8 NM_005204 c.214T>C W72R Pol 15: 42453967 VPS39 NM_015289 c.2465A>G Q822R Pol 15: 45657007 GATM NM_001482 c.1030A>G I344V Priv 15: 52242143 LEO1 NM_138792 c.1660C>T R554C Priv 16: 14234516 MKL2 NM_014048 c.53A>T H18L Priv 16: 19883478 GPRC5B NM_016235 c.690G>T K230N Priv 16: 24953358 ARHGAP17 NM_001006634 c.1440G>C K480N Priv 16: 30980685 SETD1A NM_014712 c.2830C>T R944W Priv 16: 31102595 VKORC1 NM_206824 c.242G>C C81S Pol 12: 57910273 MARS NM_004990 c.2612C>T A871V Pol aReference nucleotide position: UCSC assembly hg19. bGenBank registration number of reference sequence. ccDNA numbering was achieved with +1 corresponding to the A of the ATG initiation codon. dPol: polymorphic variant (identified in controls), Priv: private variants which were not cosegregated with affected individuals, but were not found in 200 or more controls. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 eTable 4. Nonsynonymous variants found in CMT genes from the proband (III-27) exome data Read Mutant Nucleotide Amino acid dbSNP135/ Gene Chr:positiona RefSeqb Descriptione depth allele No changec change 1000Genomed KIF1B 1:10397567 NM_015074.3 40 24 c.3260A>G Y1087C rs2297881/1000g Het, Pol FIG4 6:110064928 NM_014845.4 95 54 c.1090A>T M364L rs2295837/1000g Het, Pol FIG4 6:110107517 NM_014845.4 43 43 c.1961T>C V654A rs9885672/1000g Hom, Pol GARS 7:30634661 NM_002047.2 13 13 c.124C>G P42A rs1049402/1000g Hom, Pol IKBKAP 9:111641825 NM_003640.3 66 30 c.3473C>T P1158L rs1538660/1000g Het, Pol IKBKAP 9:111651620 NM_003640.3 29 11 c.3214T>A C1072S rs3204145/1000g Het, Pol IKBKAP 9:111659483 NM_003640.3 149 81 c.2446A>C I816L rs2230793/1000g Het, Pol LRSAM1 9:130242166 NM_138361.5 44 24 c.952A>G N318D rs1539567/1000g Het, Pol SETX 9:135139826 NM_015046.5 39 16 c.7834A>G S2612G rs3739927/1000g Het, Pol SETX 9:135139901 NM_015046.5 65 65 c.7759A>G I2587V rs1056899/1000g Hom, Pol WNK1 12:994487 NM_014823.2 70 70 c.3776G>C C1259S rs7955371/1000g Hom, Pol WNK1 12:998365 NM_014823.2 61 30 c.4683G>T M1561I rs12828016/1000g Het, Pol SEPT9 17:75494705 NM_006640.4 32 32 c.1672A>G M558V rs2627223/1000g Hom, Pol DNM2 19:10935797 NM_004945.3 115 62 c.1946T>G V649G /1000g Het, Pol PRX 19:40900865 NM_181882.2 59 59 c.3394G>A G1132R rs268674/1000g Hom, Pol aReference nucleotide position: UCSC assembly hg19. bGenBank registration number of reference sequence. ccDNA numbering was achieved with +1 corresponding to the A of the ATG initiation codon. dc.1946T>C (V649G) in DNM2 was reported in 1000genome, but not in dbSNP135. eHet: heterozygous, Hom: homozygous, Pol: polymorphic. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 eFigure 1. Diagram of chromosome 3 mapping region for HMSN-P. Markers with bold letters (from D3S3652 to D3S3531) indicate cosegregating markers in this study. The linkage regions, reported by several previous studies, are indicated by vertical double oriented arrows.1-3 The GPR128 and TFG locate between D3S1592i and D3S3652 within the linkage maps by Maeda et al,1 and Takashima et al,2 as well as map by this study, but deviate slightly from the narrowed map by Takashima et al.3 © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 eFigure 2: TFG expression in the distal sural nerve. Transcriptome was sequenced in three samples: a patient (III-29, F/48) and two controls (F/37, and F/38). The cDNA library was prepared using the TruSeq RNA library kit, and paired-end sequencing was performed using the HiSeq2000 Genome Analyzer (Illumina). The expression levels were indicated by fragments per kilobase per million sequenced reads (FPKM) after normalizing beta-actin gene expression. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 eReferences 1. Maeda K, Kaji R, Yasuno K, et al. Refinement of a locus for autosomal dominant hereditary motor and sensory neuropathy with proximal dominancy (HMSN-P) and genetic heterogeneity. J Hum Genet. 2007;52(11):907-914. 2. Takashima H, Nakagawa M, Nakahara K, et al. A new type of hereditary motor and sensory neuropathy linked to chromosome 3. Ann Neurol. 1997;41(6):771-780. 3. Takashima H, Nakagawa M, Suehara M, et al. Gene for hereditary motor and sensory neuropathy (proximal dominant form) mapped to 3q13.1. Neuromuscul Disord. 1999;9(6-7):368- 371. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021.
Load more

Recommended publications
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • Continuum of Phenotypes in HMSN-P and CMT Patients with TFG Mutation
    1 Continuum of phenotypes in HMSN-P and CMT patients with TFG mutation 2 Marzieh Khani a, Hanieh Taheri a, Hosein Shamshiri b, Henry Houlden c, Stephanie Efthymiou c, 3 Afagh Alavi d Shahriar Nafissi b*, Elahe Elahi a, e* 4 a School of Biology, College of Science, University of Tehran, Tehran, Iran 5 b Dept. of Neurology, Tehran University of Medical Sciences, Tehran, Iran 6 c Dept. of Molecular Neuroscience, UCL Institute of Neurology, London, UK 7 d Genetics Research Center, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran 8 e Dept. of Biotechnology, College of Science, University of Tehran, Tehran, Iran 9 10 11 12 *Corresponding authors: 13 Elahe Elahi 14 Professor, University College of Science, University of Tehran 15 Phone: 0098-9122181251; Fax: 0098-2166405141 16 E-Mail: [email protected], [email protected] 17 Shahriar Nafissi 18 Professor, Dept. of Neurology, Tehran University of Medical Sciences, Tehran, Iran 19 Phone: 0098-9121060727; Fax: 0098-22884420 20 E-Mail: [email protected], [email protected] 21 22 Running head: p.(Gly269Val) in TFG cause of CMT and HMSN-P 23 No. figures: 2 24 No. tables: 4 25 No. supplementary files: 1 26 27 28 29 30 31 32 1 33 Abstract 34 Charcot-Marie-Tooth (CMT) is a common neuropathy, and hereditary motor and sensory neuropathy with 35 proximal predominance (HMSN-P) is a recently described rare neuromuscular disease. Whereas many genes 36 have been implicated for CMT, TFG is the only known HMSN-P causing gene. Within the framework of 37 diagnostic criteria, clinical variation is evident among CMT and also HMSN-P diagnosed individuals.
    [Show full text]
  • The TFG-TEC Oncoprotein Induces Transcriptional Activation of the Human B-Enolase Gene Via Chromatin Modification of the Promoter Region
    MOLECULAR CARCINOGENESIS 55:1411–1423 (2016) The TFG-TEC Oncoprotein Induces Transcriptional Activation of the Human b-Enolase Gene Via Chromatin Modification of the Promoter Region Ah-young Kim, Bobae Lim, JeeHyun Choi, and Jungho Kim* Laboratory of Molecular and Cellular Biology, Department of Life Science, Sogang University, Seoul, Korea Recurrent chromosome translocations are the hallmark of many human cancers. A proportion of human extraskeletal myxoid chondrosarcomas (EMCs) are associated with the characteristic chromosomal translocation t(3;9)(q11–12;q22), which results in the formation of a chimeric protein in which the N-terminal domain of the TRK-fused gene (TFG) is fused to the translocated in extraskeletal chondrosarcoma (TEC; also called CHN, CSMF, MINOR, NOR1, and NR4A3) gene. The oncogenic effect of this translocation may be due to the higher transactivation ability of the TFG-TEC chimeric protein; however, downstream target genes of TFG-TEC have not yet been identified. The results presented here, demonstrate that TFG-TEC activates the human b-enolase promoter. EMSAs, ChIP assays, and luciferase reporter assays revealed that TFG-TEC upregulates b-enolase transcription by binding to two NGFI-B response element motifs located upstream of the putative transcription start site. In addition, northern blot, quantitative real-time PCR, and Western blot analyses showed that overexpression of TFG-TEC up-regulated b-enolase mRNA and protein expression in cultured cell lines. Finally, ChIP analyses revealed that TFG-TEC controls the activity of the endogenous b-enolase promoter by promoting histone H3 acetylation. Overall, the results presented here indicate that TFG-TEC triggers a regulatory gene hierarchy implicated in cancer cell metabolism.
    [Show full text]
  • The TRK-Fused Gene Is Mutated in Hereditary Motor and Sensory Neuropathy with Proximal Dominant Involvement
    REPORT The TRK-Fused Gene Is Mutated in Hereditary Motor and Sensory Neuropathy with Proximal Dominant Involvement Hiroyuki Ishiura,1 Wataru Sako,3 Mari Yoshida,4 Toshitaka Kawarai,3 Osamu Tanabe,3,5 Jun Goto,1 Yuji Takahashi,1 Hidetoshi Date,1 Jun Mitsui,1 Budrul Ahsan,1 Yaeko Ichikawa,1 Atsushi Iwata,1 Hiide Yoshino,6 Yuishin Izumi,3 Koji Fujita,3 Kouji Maeda,3 Satoshi Goto,3 Hidetaka Koizumi,3 Ryoma Morigaki,3 Masako Ikemura,7 Naoko Yamauchi,7 Shigeo Murayama,8 Garth A. Nicholson,9 Hidefumi Ito,10 Gen Sobue,11 Masanori Nakagawa,12 Ryuji Kaji,3,* and Shoji Tsuji1,2,13,* Hereditary motor and sensory neuropathy with proximal dominant involvement (HMSN-P) is an autosomal-dominant neurodegener- ative disorder characterized by widespread fasciculations, proximal-predominant muscle weakness, and atrophy followed by distal sensory involvement. To date, large families affected by HMSN-P have been reported from two different regions in Japan. Linkage and haplotype analyses of two previously reported families and two new families with the use of high-density SNP arrays further defined the minimum candidate region of 3.3 Mb in chromosomal region 3q12. Exome sequencing showed an identical c.854C>T (p.Pro285- Leu) mutation in the TRK-fused gene (TFG) in the four families. Detailed haplotype analysis suggested two independent origins of the mutation. Pathological studies of an autopsied patient revealed TFG- and ubiquitin-immunopositive cytoplasmic inclusions in the spinal and cortical motor neurons. Fragmentation of the Golgi apparatus, a frequent finding in amyotrophic lateral sclerosis, was also observed in the motor neurons with inclusion bodies.
    [Show full text]
  • Role of Ets-2 Phosphorylation in Inflammation, Development and Cancer
    ROLE OF ETS-2 PHOSPHORYLATION IN INFLAMMATION, DEVELOPMENT AND CANCER DISSERTATION Presented in Partial Fulfillment of the Requirement for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Guo Wei, M.S. * * * * * The Ohio State University 2003 Dissertation Committee: Approved by: Dr. Michael C. Ostrowski, Adviser Dr. Lee F. Johnson ___________________________________ Adviser Dr. Gustavo Leone Department of Molecular Genetics Dr. Michael Weinstein ABSTRACT Ets family transcription factors are regulated by signal transduction pathways. Phosphorylation of the Ets-1 and Ets-2 at a single conserved threonine residue (T38 and T72, respectively) by ras-MAPK pathways leads to their activation and persistent target genes expression. The phosphorylation of Ets-2 affected its activity, as well as its protein partnership. Ets-2 interacted with Brg-1 or BS69 co-repressors in a phosphorylation dependent manner, and repressed target gene expression. Ets-2 knockout mice are embryonic lethal due to an extra-embryonic defect, whereas ets-2T72A/T72A mice are viable and fertile, with no obvious abnormality. Ets-2 is constitutively phosphorylated in macrophages derived from motheaten-viable (mev) mice, while its phosphorylation is tightly regulated in wt cells. The aberrant Ets-2 phosphorylation correlated with increased target gene expression and cell survival. To directly test the role of Ets-2 phosphorylation in inflammation, the ets-2T72A allele was introduced into mev mice. In contrast to ets2+/+, mev/mev mice, ets-2T72A/T72A, mev/mev mice were fertile, had increased life span and body weight, elevated macrophage apoptosis in the absence of CSF-1, but reduced inflammation and expression of inflammatory genes, including cytokines (TNFα), chemokines (MIP1α, β), extracellular matrix proteases (MMP9), cell adhesion molecule (integrin αM) in lungs and macrophages.
    [Show full text]
  • Unifying the Genomics-Based Classes of Cancer Fusion Gene Partners: Large Cancer Fusion Genes Are Evolutionarily Conserved
    CANCER GENOMICS & PROTEOMICS 9: 389-396 (2012) Unifying the Genomics-based Classes of Cancer Fusion Gene Partners: Large Cancer Fusion Genes Are Evolutionarily Conserved LIBIA M. PAVA, DANIEL T. MORTON, REN CHEN and GEORGE BLANCK Department of Molecular Medicine, Morsani College of Medicine, University of South Florida, Tampa, FL, U.S.A. Abstract. Background: Genes that fuse to cause cancer have fusion of NPM and ALK in anaplastic large-cell lymphoma been studied to determine molecular bases for proliferation, to (3); ABL and BCR in chronic myelogenous leukemia (CML) develop diagnostic tools, and as targets for drugs. To facilitate (4, 5); and C-MYC and IgH in Burkitt’s lymphoma in (6), identification of additional, cancer fusion genes, following among many others. The detection and understanding of the observation of a chromosomal translocation, we have ABL-BCR fusion protein, which stimulates unregulated cell characterized the genomic features of the fusion gene partners. division and leads to leukemia, led to the development of Previous work indicated that cancer fusion gene partners, are Gleevec, a drug able to block the ATP-binding site of the either large or evolutionarily conserved in comparison to the tyrosine kinase domain of ABL-BCR, halting CML (7). This neighboring genes in the region of a chromosomal extraordinary success has led to the hope of designing drugs translocation. These results raised the question of whether targeted against other cancer fusion proteins. large cancer fusion gene partners were also evolutionarily There are about 50,000 unstudied translocations, raising conserved. Methods and Results: We developed two methods the question of whether that information can continue to be for quantifying evolutionary conservation values, allowing the used to facilitate the identification of fusion genes.
    [Show full text]
  • The Neurodegenerative Diseases ALS and SMA Are Linked at The
    Nucleic Acids Research, 2019 1 doi: 10.1093/nar/gky1093 The neurodegenerative diseases ALS and SMA are linked at the molecular level via the ASC-1 complex Downloaded from https://academic.oup.com/nar/advance-article-abstract/doi/10.1093/nar/gky1093/5162471 by [email protected] on 06 November 2018 Binkai Chi, Jeremy D. O’Connell, Alexander D. Iocolano, Jordan A. Coady, Yong Yu, Jaya Gangopadhyay, Steven P. Gygi and Robin Reed* Department of Cell Biology, Harvard Medical School, 240 Longwood Ave. Boston MA 02115, USA Received July 17, 2018; Revised October 16, 2018; Editorial Decision October 18, 2018; Accepted October 19, 2018 ABSTRACT Fused in Sarcoma (FUS) and TAR DNA Binding Protein (TARDBP) (9–13). FUS is one of the three members of Understanding the molecular pathways disrupted in the structurally related FET (FUS, EWSR1 and TAF15) motor neuron diseases is urgently needed. Here, we family of RNA/DNA binding proteins (14). In addition to employed CRISPR knockout (KO) to investigate the the RNA/DNA binding domains, the FET proteins also functions of four ALS-causative RNA/DNA binding contain low-complexity domains, and these domains are proteins (FUS, EWSR1, TAF15 and MATR3) within the thought to be involved in ALS pathogenesis (5,15). In light RNAP II/U1 snRNP machinery. We found that each of of the discovery that mutations in FUS are ALS-causative, these structurally related proteins has distinct roles several groups carried out studies to determine whether the with FUS KO resulting in loss of U1 snRNP and the other two members of the FET family, TATA-Box Bind- SMN complex, EWSR1 KO causing dissociation of ing Protein Associated Factor 15 (TAF15) and EWS RNA the tRNA ligase complex, and TAF15 KO resulting in Binding Protein 1 (EWSR1), have a role in ALS.
    [Show full text]
  • Autocrine IFN Signaling Inducing Profibrotic Fibroblast Responses By
    Downloaded from http://www.jimmunol.org/ by guest on September 23, 2021 Inducing is online at: average * The Journal of Immunology , 11 of which you can access for free at: 2013; 191:2956-2966; Prepublished online 16 from submission to initial decision 4 weeks from acceptance to publication August 2013; doi: 10.4049/jimmunol.1300376 http://www.jimmunol.org/content/191/6/2956 A Synthetic TLR3 Ligand Mitigates Profibrotic Fibroblast Responses by Autocrine IFN Signaling Feng Fang, Kohtaro Ooka, Xiaoyong Sun, Ruchi Shah, Swati Bhattacharyya, Jun Wei and John Varga J Immunol cites 49 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130037 6.DC1 This article http://www.jimmunol.org/content/191/6/2956.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 23, 2021. The Journal of Immunology A Synthetic TLR3 Ligand Mitigates Profibrotic Fibroblast Responses by Inducing Autocrine IFN Signaling Feng Fang,* Kohtaro Ooka,* Xiaoyong Sun,† Ruchi Shah,* Swati Bhattacharyya,* Jun Wei,* and John Varga* Activation of TLR3 by exogenous microbial ligands or endogenous injury-associated ligands leads to production of type I IFN.
    [Show full text]
  • Clinicopathologic and Genomic Characterization of Inflammatory
    ORIGINAL ARTICLE Clinicopathologic and Genomic 05/24/2021 on B1Ie3HEQKAtYlViOB6v9JkXYwHPCf2wpOZ6Gj4zLHHows5c8Cwy9/GE8tenobMw6o+askVh8Okj8o5aNeJrpPG5G953b+vs1dmmVmYK5o60oNhSlAcCbJMhr/+1KYGRtyjCfO+GDnjJqT4eFHq0Rgg== by http://journals.lww.com/ajsp from Downloaded Characterization of Inflammatory Myofibroblastic Downloaded Tumors of the Head and Neck from Highlighting a Novel Fusion and Potential Diagnostic Pitfall http://journals.lww.com/ajsp Darcy A. Kerr, MD,*† Lester D.R. Thompson, MD,‡ Laura J. Tafe, MD,*† Vickie Y. Jo, MD,§ Azfar Neyaz, MD,∥ Prashanthi Divakar, MD,¶ Joseph A. Paydarfar, MD,†¶ David A. Pastel, MD,†# Keisuke Shirai, MD, MSc,†** Ivy John, MD,†† Raja R. Seethala, MD,†† by B1Ie3HEQKAtYlViOB6v9JkXYwHPCf2wpOZ6Gj4zLHHows5c8Cwy9/GE8tenobMw6o+askVh8Okj8o5aNeJrpPG5G953b+vs1dmmVmYK5o60oNhSlAcCbJMhr/+1KYGRtyjCfO+GDnjJqT4eFHq0Rgg== Claudia M. Salgado, MD, PhD,‡‡ Vikram Deshpande, MD,∥ Julia A. Bridge, MD,§§∥∥ Karl Kashofer, PhD,¶¶ Iva Brčić, MD,¶¶ and Konstantinos Linos, MD*† event was identified in 92% (n = 11/12) of cases and an additional fl fi Abstract: In ammatory myo broblastic tumor (IMT) is a distinc- case was ALK-positive by IHC but could not be evaluated mo- fi fi tive broblastic and myo broblastic spindle cell neoplasm with an lecularly. ALK represented the driver in all but 1 case. Re- fl fi accompanying in ammatory cell in ltrate and frequent receptor arrangement of ALK, fused with the TIMP3 gene (n = 6) was most tyrosine kinase activation at the molecular level. The tumor may commonly detected, followed by 1 case each of the following fusion recur and rarely metastasizes. IMT is rare in the head and neck gene partnerships: TPM3-ALK, KIF5B-ALK, CARS-ALK, region, and limited information is available about its clin- THBS1-ALK, and a novel alteration, SLC12A2-ROS1.Theex- icopathologic and molecular characteristics in these subsites.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]