Phylogenetic Relationships of Romanian Cattle to Other Cattle Populations Determined by Using Mitochondrial DNA D-Loop Sequence Variation

Home , Zebu

Phylogenetic relationships of Romanian cattle to other cattle populations determined by using mitochondrial DNA D-Loop sequence variation

Received for publication, January 9, 2009 Accepted, June 15, 2010

THIEU PHAN XUAN1, S. E. GEORGESCU1, MARIA ADINA MANEA1, ANCA OANA HERMENEAN2, MARIETA COSTACHE1 1University of Bucharest, Molecular Biology Center, 91-95 Splaiul Independentei, 5 Bucharest, Romania, email: [email protected]; [email protected]; 2Vasile Goldis Western University of Arad, 94-96 Revolution Avenue, Arad, Romania

Abstract Phylogenetic relationships of Romanian cattle breeds to various other cattle breeds including Bos taurus, Bos indicus (Indian zebu), Bison bison and Bison bonasus were assessed using mtDNA D- loop sequences. Kimura's two-parameter distances were calculated and a cluster analysis using the Neighbour-joining method was performed to obtain phylogenetic trees among sequences determined and then published in GenBank. The NJ tree showed that Bison bison, Bison bonasus and Bos indicus, respectively, are clearly separate from other cattle breeds. In addition, there are two main distinct genetic lineages: taurine (Bos taurus) and zebu (Bos indicus), that was fully supported by 100% of 1000 bootstrap iterations. The result also indicates that the geographic cattle sequences of taurine lineage are mixed. The conclusion we have reached indicates that the sequences are closely related or have recently diverged.

Keywords: Cattle; Mitochondrial DNA; D-Loop; Phylogenetic analysis

Introduction

The cattle species, humpless taurine (Bos taurus) and zebu (Bos indicus) are believed to be originated from the aurochs, Bos primigenius through a domestication event that occurred 8,000–10,000 years before present (B.P.) (Epstein and Mason 1984; MacHugh et al. 1997). However, the investigation of the sequence data of mitochondrial DNA (mtDNA) control region revealed that taurine and zebu cattle diverged 200,000–1,000,000 years B.P. and domestications of taurine and zebu cattle were two independent events that occurred separately 8,000–10,000 years B.P. (Payne, 1991; Loftus et al. 1994a). Many current breeds in both Bos taurus and Bos indicus cattle should be variants of these subspecies. The genetic diversity, origin, conservation and sustainable utilization of these breeds received world-wide attention for a long time. Mammalian mitochondrial DNA shows several special features such as absence of introns, maternal inheritance, the existence of single copy orthologous genes, lack of recombination events, and high mutation rate (Irwin et al., 1991; Pesole et al., 1999). Since the complete sequence of bovine mitochondrial DNA was published (Anderson et al., 1982), sequence comparisons of mtDNA D-loop region have been widely used to evaluate genetic diversity and phylogenetic performance among individuals and populations of cattle (Loftus et al., 1994; Bradley et al., 1996; Mannen et al., 1998; Kikkawa et al., 2003; Lai et al., 2006; Lei et al., 2006). In this study, we examined the mtDNA D-loop region sequence of Romanian cattle breeds and we compared it with the published data to estimate genetic diversity and phylogenetic relationships.

5287 THIEU PHAN XUAN, S. E. GEORGESCU, MARIA ADINA MANEA, ANCA OANA HERMENEAN, MARIETA COSTACHE

Materials and methods

Sampling and DNA extraction Fresh blood samples were collected from three Romanian cattle breeds: Romanian Black Spotted (RBS), Romanian Brown (RB), Romanian Grey Steppe (RGS) and one French breed: Montbeliarde (M). The individuals were chosen at random and we avoided closely related animals. The isolation of genomic DNA from fresh blood was performed with Wizard Genomic DNA Extraction Kit (Promega). D-loop sequences of European, African, American, Asian, Indian cattle and bison species have been previously reported in GenBank. Amplification and Sequencing The mtDNA D-Loop region was amplified by using forward primer 5’ CAGAATTTGCACCCTAACCAA 3’ and reverse primer 5’ TGTCCTGTG- AACATTGACTGT 3’. PCR was performed in a 25 μl reaction mixture containing 50 ng of genomic DNA, 5X Reaction Buffer, 1.5 mM MgCl2, 0.8 pM of each dNTPs, 10 pmol of each primer and 0.2 Units of Taq DNA Polymerase. Thermal cycling was performed on GeneAmp 9700 System (AppliedBiosystems). The standard PCR conditions were as follows: 5 min. at 950C; 35 cycles of denaturation/annealing/extension with 30s at 950C for denaturation, 30s at 620C for annealing, 60s at 720C for extension and a final 10 min extension at 720C, before cooling to 40C for 10min. PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega). PCR sequencing was performed with 40 ng PCR product and the same primers were used for amplification and BigDye Terminator v3.1 Cycle Sequencing kit and then purified with BigDye XTerminator Purification Kit Protocol. Sequencing was performed on ABI Prism 3130 Genetic Analyzer with DNA Sequencing Analysis 5.2 Software (AppliedBiosytems). Statistical analysis Variations in the mtDNA D-loop region were defined by comparison with the reference bovine mtDNA sequence (Accession No. V00654) published by Anderson et al., (1982). Sequences of the mtDNA D-loop region from different breeds were aligned in Clustal X with parameters set to default (Thompson et al., 1997). Sites representing a gap in any of the aligned sequences were excluded from the analysis. Nucleotide variable sites, number of transitions and transversions, and nucleotide composition in D-loop regions were explored by MEGA Version v4 (Tamura et al., 2007), in which the average genetic distance between breeds/groups were computed using Kimura's two-parameter method (Kimura, 1980) with the standard error computed by 1000 bootstrap replications. The NJ tree based on the mtDNA D-loop region sequence was constructed with the MEGA package. The reliability of the tree topology was assessed by 1000 bootstrap replications (Felsenstein, 1985).

Results and Discussions

Sequence variation in the mtDNA D-Loop region Analysis of the mtDNA D-loop region sequences of Romanian Black Spotted (RBS), Romanian Brown (RB), Romanian Grey Steppe (RGS) and Montbeliarde (M) cattle showed 13 polymorphic sites, representing 1.96% of the total DNA sequence analyzed (661 bp). No insertion/deletion of single base pairs. The remaining 13 variable positions were single nucleotide substitutions, only one of which was a transversion.

5288 Romanian Biotechnological Letters, Vol. 15, No. 3, 2010 Phylogenetic relationships of Romanian cattle to other cattle populations determined using mitochondrial DNA D-Loop sequence variation

The average nucleotide frequencies of T, C, A, and G were 28.50, 23.55, 30.95 and 17.00%, respectively (Table 1). The nucleotide composition does not differ much between A+T and G+C (52.05 and 47.95%, respectively). Table 1. Nucleotide composition of mtDNA D-loop region sequences of four cattle breeds. Breeds T C A G RBS 28.4 23.4 30.9 17.1 RB 28.6 23.3 30.9 17.2 RGS 28.6 23.9 31.0 16.9 M 28.4 23.6 31.0 16.8 Average 28.50 23.55 30.95 17.00

[ 1111111 2222222222 2222222223 3333333444 5556666] [ 3485777888 0011112344 4555566791 2235588337 7783335] [ 7910058356 2712341814 7058919123 3876938064 1252596] V00654 CGCGTGCTGC TAACTGGCTT TTCTTTTATG AGCACTCGTG CTCAAAC L27712 ...... G. L27713 ...... C.T...... G... L27716 ...... A...... G.. L27717 ...... G.. L27718 ...... G.. L27724 ...A...... C...... G.. L27726 ....CA.C...... C...... T..A .....G. L27727 ...... G...... L27730 ...... T...... C. .C..C...... C...... G.. L27731 ...... T.A...... C...... C...... G.. L27734 ...... G. L27735 ...... G.. GQ129208 ...... GQ129207 ...... C...... C...... G... M ...... C.C...... T.... FJ815661 ...... C...... FJ815659 ...... C...... AB117038 ....C...... G...A...... A...... G.T AB117077 ....C...... A...... A...... G.T AF409046 ....C...... A...... A...... G.. AB117076 ....C...... A...... A...... G.. U87901 ....C...... A...... AC. .-..G.. U87902 ....C...... A..C ...... A.. T-..G.. AB117075 ....C...... A...... C...... A.A ....G.. AB117037 ....C...... A...... C...... G...A...... G.. AF409051 ...... A...... G.. AF409052 ...... A...... G.. RBS ...... C...... T...... G.. .A...... G.. RB G...... G.. EU177831 ...... G.. AF409047 ...... G.. AF409048 ...... C...... G.. U87903 ...... T...... C...... -...G.. EU177843 ...... T...... C...... C...... AF409050 ...... T...... C.... .C..G.. AB117039 ...... C...... A ..T.TC...... G.. RGS ...... C...... A .....C.... .C..G.. EU177867 ..G...... T .G...... C...... FJ971080 .AG...... C...... G..

Figure 1. Sequence variation observed among 40 cattle D-loop region sequences (Bos taurus) defined according to Anderson et al. (1982); (.) indicates the same base pair; (-) indicates insertion/deletion. Comparison with 36 mtDNA D-loop region sequences of cattle breeds (Bos taurus) in GenBank (fig. 1) show that, there are 47 variable sites (7.11% of all sites), of which 20 sites Romanian Biotechnological Letters, Vol. 15, No. 3, 2010 5289 THIEU PHAN XUAN, S. E. GEORGESCU, MARIA ADINA MANEA, ANCA OANA HERMENEAN, MARIETA COSTACHE were parsimony informative polymorphic sites. Of the 47 variable sites, the transition and transversion sites comprised 42 and 2, respectively. The transition/transversion ratio (R) was 21, indicating a strong transitional bias. This is a characteristic of mammalian mitochondrial evolution and has been demonstrated in a variety of other species (especially between closely related sequences) (Loftus et al., 1994; Mannen et al., 1998). Genetic distances The average genetic distance calculated on the basis of Kimura's two-parameter (Table 2) was longer than 0.08 between Bison bonasus and other cattle populations (Asia, European, Romanian, Indian, American and African cattle) and longer than 0.04 between Indian (Bos indicus) and the others (Asia, European, Romanian, American and African cattle cattle). However, the genetic distances among Asia, European, Romanian, American and African cattle were 0.003–0.010 (not much different from the intrapopulation distance, 0.003–0.009), indicating that these geographic cattle populations are closely related in their mitochondria. All cattle populations showed almost equal distances from Indian (Bos indicus) (0.041 – 0.045) or from European bison (0.087–0.093) and American bison (0.093 – 0,103), suggesting internal rate consistency. Table 2. Kimura's two-parameter pairwise distances within and between cattle populations, including bison species Population [1] [2] [3] [4] [5] [6] [7] [8] [1] Bison bonasus 0.005 0.012 0.012 0.012 0.012 0.012 0.012 0.012 [2] Asia 0.087 0.007 0.002 0.007 0.002 0.002 0.003 0.013 [3] European 0.088 0.007 0.005 0.006 0.002 0.001 0.003 0.013 [4] Indian zebu 0.093 0.045 0.041 0.027 0.006 0.006 0.007 0.012 [5] Romanian 0.088 0.009 0.007 0.044 0.009 0.002 0.003 0.013 [6] American 0.088 0.006 0.003 0.040 0.005 0.003 0.003 0.013 [7] African 0.087 0.010 0.009 0.043 0.010 0.008 0.004 0.013 [8] Bison bison 0.093 0.103 0.100 0.104 0.102 0.099 0.098 0.008 Note. On diagonal: intrapopulation distance. Below diagonal: interpopulation distance. Above diagonal: standard error of interpopulation distance.

Phylogenetic analysis In this article, phylogenetic analysis was based on three mtDNA D-loop region sequences of Romanian cattle breeds and 58 homologous fragments of mtDNA D-loop region sequences cited in GenBank: European (accession nos. L27712-L27737, GQ129208, GQ129207, EU177867, FJ971080, EU177843, EU177831, FJ815682, FJ815681, FJ815661, FJ815659), Asian (accession nos. AB117037, AB117038, AB117039, AF409046, AF409047, AF409048, AF409050, AF409051, AF409052, AB117075, AB117076, AB117077, U87901, U87902, U87903), American (accession nos. FJ815919, FJ815794, FJ815727, FJ815725, FJ815706, FJ815705), African (accession nos. L27730, L27731, L27728, L27729), American bison (accession nos. BBU12936, BBU12946, BBU12948, BBU12955, BBU12959) and European bison (accession nos. AF083356). The NJ phylogenetic tree of the Bovinae was constructed with Bubalus bubalis (Accession no. AF197196) as outgroup. The reliability of the tree topology was assessed by 1000 bootstrap replications. The tree illustrates that the sequences fell into two main distinct genetic lineages: taurine (Bos taurus) and zebu (Bos indicus) (Fig. 2), which was fully supported by 100% of 1000 bootstrap iterations. In addition, the taurine lineage has as one of its major features the intermingling of European, Asian, African, Romanian and American sequences, indicating that the sequences are closely related or have diverged only recently; at the same time, these sequences seem to be separate from the Indian zebus, American bison and European bison.

5290 Romanian Biotechnological Letters, Vol. 15, No. 3, 2010 Phylogenetic relationships of Romanian cattle to other cattle populations determined using mitochondrial DNA D-Loop sequence variation

The phylogenetic tree also shows that the three Romanian cattle breeds were divided in two distinct clusters. The first group consists of Romanian Black Spotted and Romanian Brown, the second cluster is formed by Romanian Grey Steppe. All the breeds are closely related to their original breeds among the Friesian, Simmental and Grey cattle.

Conclusions

In this study, we have obtained mtDNA D-loop partial sequences of Romanian Black Spotted (RBS), Romanian Brown (RB), Romanian Grey Steppe (RGS) and Montbeliarde (M) cattle and have analyzed these in conjunction with previously published data from Europe, Asia, India, America and Africa. The phylogenetic analysis obtained shows that the geographic cattle sequences of taurine lineage are mixed; while still separate from the Indian zebus (Bos indicus), American bison and European bison.

L27727 Jersy FJ815725 Caracu FJ815727 Caracu FJ815919 Gyr FJ815794 Criollo Nayarit V00654 Friesian L27725 Hereford 15 FJ815705 Criollo Argentino FJ815682 Canaria FJ815681 Canaria L27719 Friesian GQ129208 Grey 12 FJ815706 Criollo Argentino FJ815661 Mostrenca FJ815659 Mostrenca 61 M Montbeliarde 18 L27726 Jersy L27712 Aberdeen Angus 48 L27734 Simmental L27713 Aberdeen Angus

49 GQ129207 Grey 24 RGS Romanian Grey Steppe AB117038 Korean native U87901 Japanese Black 59 AB117076 Mogolian Bos taurus AB117077 Mogolian 78 AF409046 Cheju Black 9 52 U87902 Japanese Black AB117037 Korean native L27716 Charolais 52 L27724 Hereford AF409048 Cheju Black 18 10 AF409047 Cheju Black L27717 Charolais RBS Romanian Black Spotted L27735 Simmental 9 EU177831 Modicana L27718 Friesian RB Romanian Brown 19 AF409051 Cheju Yellow

65 AF409052 Cheju Yellow 94 AB117039 Korean native U87903 Japanese Black AF409050 Cheju Yellow 10025 EU177843 Podolica 43 L27730 N Dama 40 30 L27731 N Dama 100 FJ971080 Romagnola EU177867 Cabannina L27723 Hariana 40 L27722 Hariana 77 100 L27732 Sahiwal Bos indicus 36 L27733 Sahiwal L27736 Tharparkar 31 53 L27737 Tharparkar Bison bonasus Bison bonasus 100 AF083356 BBU12936 92 BBU12946 100 BBU12948 Bison bison

59 BBU12955 58 BBU12959 AF197196 Outgroup

0.02 Figure 2. Neighbor-Joining tree of mtDNA D-Loop region sequences of the bovine species (The bootstrap values of the branches).

Romanian Biotechnological Letters, Vol. 15, No. 3, 2010 5291 THIEU PHAN XUAN, S. E. GEORGESCU, MARIA ADINA MANEA, ANCA OANA HERMENEAN, MARIETA COSTACHE

References

1. ANDERSON, S., DE BRUIJN, M.H., COULSON, A.R., EPERON, I.C., SANGER, F., YOUNG, I.G., 1982. Complete sequence of bovine mitochondrial DNA. Conserved features of the mammalian mitochondrial genome. J. Mol. Biol. 156, 683–717. 2. BRADLEY, D.G., MACHUGH, D.E., CUNNINGHAM, P., LOFTUS, R.T., 1996. Mitochondrial diversity and origin of African and European cattle. Proc. Natl. Acad. Sci. U.S.A. 93, 5131–5135. 3. IRWIN, D.M., T.D. KOCHER AND A.C. WILSON, 1991. Evolution of the cytochrome b gene of mammals. J. Mol. Evol., 32: 128-144. 4. FELSENSTEIN, J., 1985. Confidence limits on phylogenies:An approach using the bootstrap. Evol., 39: 783-791. 5. KIKKAWA, Y., TAKADA, T., SUTOPO, NOMURA, K., NAMIKAWA, T., YONEKAWA, H., AMANO, T., 2003. Phylogenies using mtDNA and SRY provide evidence for male-mediated introgression in Asian domestic cattle. Anim. Genet. 34, 96–101. 6. LAI, S.J., LIU, Y.P., LIU, Y.X., LI, X.W., YAO, Y.G., 2006. Genetic diversity and origin of Chinese cattle revealed by mtDNA D-loop sequence variation. Mol. Phylogenet. Evol. 38, 146–154 7. LEI, C.Z., CHEN, H., ZHANG, H.C., CAI, X., LIU, R.Y., LUO, L.Y.,WANG, C.F., ZHANG,W., GE, Q.L., ZHANG, R.F., LAN, X.Y., SUN, W.B., 2006. Origin and phylogeographical structure of Chinese cattle. Anim. Genet. 37, 579–582. 8. LOFTUS, R.T., MACHUGH, D.E., BRADLEY, D.G., SHARP, P.M., CUNNINGHAM, P., 1994. Evidence for two independent domestications of cattle. Proc. Natl. Acad. Sci. U.S.A. 91, 2757–2761. 9. MACHUGH, D.E., SHRIVER, M.D., LOFTUS, R.T., CUNNINGHAM, P., BRADLEY, D.G., 1997. Microsatellite DNA variation and the evolution, domestication and phylogeography of taurine and zebu cattle (Bos taurus and Bos indicus). Genetics 146, 1071–1086. 10. MANNEN, H., TSUJI, S., LOFTUS, R.T., BRADLEY, D.G., 1998. Mitochondrial DNA variation and evolution of Japanese black cattle (Bos taurus). Genetics 150, 1169–1175. 11. PESOLE, G., GISSI, C., DE CHIRICO, A., SACCONE, C., 1999. Nucleotide substitution rate of mammalian mitochondria genomes. J. Mol. Evol. 48, 427–434. 12. TAMURA, K. AND M. NEI, 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol., 10: 512-526. 13. TAMURA K, DUDLEY J, NEI M & KUMAR S., 2007. Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol., 24:1596-1599. 14. THOMPSON JD, GIBSON TJ, PLEWNIAK F, JEANMOUGIN F, HIGGENS DG., 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tool. Nucleic Acids Res 25(24):4876–4882

5292 Romanian Biotechnological Letters, Vol. 15, No. 3, 2010