Frequently Recurring Genital Herpes CTL in Persons with + Virus

Long Term Persistence of Herpes Simplex Virus-Specific CD8 + CTL in Persons with Frequently Recurring Genital Herpes

This information is current as Christine M. Posavad, Meei Li Huang, Serge Barcy, David of September 25, 2021. M. Koelle and Lawrence Corey J Immunol 2000; 165:1146-1152; ; doi: 10.4049/jimmunol.165.2.1146 http://www.jimmunol.org/content/165/2/1146 Downloaded from

References This article cites 34 articles, 17 of which you can access for free at: http://www.jimmunol.org/content/165/2/1146.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

by guest on September 25, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2000 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Long Term Persistence of Herpes Simplex Virus-Speciﬁc CD8؉ CTL in Persons with Frequently Recurring Genital Herpes1

Christine M. Posavad,2*‡ Meei Li Huang,* Serge Barcy,* David M. Koelle,*†‡ and Lawrence Corey*†‡

Herpes simplex virus (HSV) establishes a lifelong infection in humans. Reactivation of latent virus occurs intermittently so that the immune system is frequently exposed to viral Ag, providing an opportunity to evaluate memory T cells to a persistent human pathogen. We studied the persistence of genital herpes lesion-derived HSV-specific CD8؉ CTL from three immunocompetent individuals with frequently recurring genital HSV-2 infection. All CTL clones were HSV-2 type specific and only one to three unique clonotypes were identified from any single biopsy specimen. The TCRBV genes utilized by these clonotypes were sequenced, and clonotype-specific probes were used to longitudinally track these clonotypes in PBMC and genital lesions. CTL clonotypes were consistently detected in PBMC and lesions for at least 2 and up to 7 years, and identical clonotypes infiltrated herpes lesions Downloaded from spaced as long as 7.5 years apart. Moreover, these clones were functionally lytic in vivo over these time periods. Additionally, CTL clones killed target cells infected with autologous viral isolates obtained 6.5 years after CTL clones were established, suggesting that selective pressure by these CTL did not result in the mutation of CTL epitopes. Thus, HSV recurs in the face of persistent CD8؉ CTL with no evidence of clonal exhaustion or mutation of CTL epitopes as mechanisms of viral persistence. The Journal of Immunology, 2000, 165: 1146–1152. http://www.jimmunol.org/ erpes simplex virus type 2 is the major cause of genital ease (7). Clearance of HSV from lesions has been associated with herpes and one of the most prevalent sexually transmit- the development of local HSV-specific cytotoxic activity; much of H ted diseases worldwide. The epidemic of genital herpes the cytolytic activity appears to be due to HSV-specific CD8ϩ continues to increase in the U.S.; ϳ22% of adults are infected with CTL (6). HSV-2, representing a 31% increase over the last decade (1). After The high frequency of HSV reactivation despite robust CTL primary infection at mucosal sites, HSV-2 remains latent in neu- activity raises the question as to whether alterations in T cell spec- ronal cells with intermittent HSV reactivations, resulting in the ificity occur during the course of infection. Are there deletions of production of infectious virus with or without the onset of discern- HSV-specific clonotypes and generation of new clonotypes over ible disease. In immunocompetent persons infected with HSV-2, the course of infection? We sequenced the TCRBV genes utilized by guest on September 25, 2021 viral reactivation is high and occurs on an average of 20% of days by HSV-specific CD8ϩ CTL clones that were isolated from lym- (2). The high rate of HSV-2 shedding at mucosal sites suggests that phocytes infiltrating herpetic genital lesions (LIL).3 Clonotype- the immune system is frequently or even chronically exposed to specific oligonucleotide probes were used to longitudinally track HSV Ag and likely results in the intermittent restimulation of these clonotypes in PBMC and in LIL to determine their longevity HSV-specific T cells. and localization. Cellular immune defects are more closely associated with severe HSV disease than humoral immune defects, pointing to a critical Materials and Methods role of HSV-specific T cells in the control and resolution of HSV Subjects disease. High frequencies of HSV-specific CD4ϩ and CD8ϩ T cell Immunocompetent individuals with recurrent genital HSV infections were precursors are present in PBMC from immunocompetent HSV- enrolled in an Institutional Review Board-approved protocol at the Uni- seropositive individuals (3, 4), and both cell types infiltrate her- versity of Washington Viral Disease Research Clinic. Subjects were part of petic lesions (5, 6). In cross-sectional studies, immunosuppressed our prospective cohort studies of the natural history of HSV-2 infection. individuals with severe genital herpes infections (frequent and We studied three HIV-seronegative individuals (two female, one male) long-lasting lesions) had significantly lower frequencies of HSV- with culture and serologically proven recurrent HSV-2. All three subjects ϩ had clinically symptomatic genital herpes for a mean of 19 years before the specific CD8 CTL precursors than did individuals with mild dis- study and experienced symptomatic recurrences at a mean of 5 per year, a pattern typical of persons with frequent HSV-2 infection (8). Subjects were selected because their recurrences occurred on the buttocks (two individ- Departments of *Laboratory Medicine and †Medicine, University of Washington, uals) and the thigh (one individual), sites where subjects would allow mul- Seattle, WA 98195; and ‡Program in Infectious Diseases, Fred Hutchinson Cancer tiple biopsies. Research Center, Seattle, WA 98109 Received for publication February 23, 2000. Accepted for publication May 8, 2000. Viruses The costs of publication of this article were defrayed in part by the payment of page HSV-1 strain E115 and HSV-2 strain 333 were used throughout unless charges. This article must therefore be hereby marked advertisement in accordance otherwise noted. HSV-1 ϫ HSV-2 intertypic recombinant viruses (IRV) with 18 U.S.C. Section 1734 solely to indicate this fact. RH1G7, RS1G25, RS1G31, and R7015 (9, 10) containing 0.30–0.46, 1 This work was supported by National Institutes of Health Grants AI-27757 0.59–0.73, 0.67–0.73, and 0.82–1.0 HSV-2 map units, respectively, were (C.M.P.), AI-42528 (L.C., C.M.P.), CA-70017 (D.M.K.), and the Medical Research the kind gift of Bernard Roizman. HSV-1 ϫ HSV-2 IRV Dx1(32), Council of Canada (postdoctoral fellowship to C.M.P.). 2 Address correspondence and reprint requests to Dr. Christine Posavad, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue North, P.O. Box 19024, 3 Abbreviations used in this paper: LIL, lesion-infiltrating lymphocytes; LCL, lym- Room D3-100, Seattle, WA 98109. E-mail address: [email protected] phoblastoid cell line; IRV, HSV-1 ϫ HSV-2 intertypic recombinant virus; Pt., patient.

Table I. Characterization of lesion-inﬁltrating CD8ϩ CTL clonesa

% Speciﬁc Lysis Biopsy HLA Subject Date Clone Mock HSV-1 HSV-2 Allo Restrictionb HSV-2 Map Unitc

1 2/95d 1B.4 7 2 24 1 A24 0.0–0.18 1B.5 6 9 27 1 A24 0.0–0.18 1B.13 1 0 33 2 A24 0.0–0.18 1B.14 4 3 32 2 A24 0.0–0.18 1B.18 5 3 21 3 A24 0.0–0.18

2 10/94 2B.1 Ϫ3 Ϫ1 46 2 A2 0.67–0.73 2B.11 0 Ϫ1 36 0 A2 0.67–0.73

3 6/91 3B.4 0 Ϫ147 Ϫ2 B45 0.0–0.18 3B.8 3 Ϫ136 Ϫ3 B45 0.0–0.18 3B.11 Ϫ3 1 47 0 A2orB8 ND 3B.22 Ϫ3 0 48 2 A2 0.68–0.70

a CD8ϩ cells were positively selected from PHA-stimulated lesion-derived cells and cloned with PHA, IL-2, and irradiated allogeneic PBMC. Cells were screened for HSV-speciﬁc CTL activity, and positive clones were expanded with PHA. CTL clones were tested in a 51Cr release assay with autologous or allogeneic (HLA class I mismatched) (allo) LCL that were mock infected or infected overnight with HSV-1 or HSV-2 using an EϺT ratio of 10Ϻ1. b CTL clones were tested for lytic activity against HSV-2 infected autologous LCL or HSV-2-infected allogeneic LCL that were HLA mismatched at one or more HLA class Downloaded from I alleles. c HSV-1 ϫ HSV-2 IRV were used to determine the approximate region on the HSV-2 genome recognized by CD8ϩ CTL clones. d Only 5 of the 14 clones from Pt. 1 are displayed; the additional 9 clones not displayed had killing patterns identical with those of the 5 shown in the table.

Bx1(13), Bx1(24), and RE6 containing 0.68–0.72, 0.0–0.57 and 0.7–1.0, TCRBC region, dNTPs, and Amplitaq (Perkin-Elmer, Norwalk, CT). Prim- 0.0–0.57, and 0.78–1.0, and 0.0–0.18 and 0.72–0.84 HSV-2 map units, ers (Fred Hutchinson Cancer Research Center, Biotechnology Center, Se- http://www.jimmunol.org/ respectively, were the kind gift of Howard Marsden (11). Clinical isolates attle, WA) were designed using primer sequence data from Ref. 15. Prod- 9349 and 9434 from patient (Pt.) 3 were isolated from a swab of an HSV-2 ucts were separated on 2% agarose gels, soaked in ethidium bromide, and buttock lesion on December 15, 1997, and December 18, 1997, respec- visualized by UV illumination. TCRAC 5Ј- and 3Ј-primers were used as a tively. All viruses were grown and titered on Vero cells as previously positive control. Negative controls included no cDNA and cDNA synthesis described (12). mixture with no RNA. PCR conditions consisted of 30 s denaturation at 95°C, 30 s annealing at 55°C, and 1 min extension at 72°C for 35 cycles. Cells Direct sequencing of PCR products was performed using the Taq DyeDeoxy Terminator Cycle Sequencing Kit (Applied Biosystems, Foster PBMC were isolated by Ficoll-Hypaque (Amersham Pharmacia, Piscat- City, CA) according to the manufacturer’s instructions. The TCRBV, away, NJ) density centrifugation. EBV-transformed B cell lines (LCL)

TCRBD, and TCRBJ sequence of each clone was aligned relative to other by guest on September 25, 2021 were established and maintained as previously described (13). TCRB sequences published in GenBank; and based on this alignment, spe- Lesion-derived HSV-specific CD8ϩ CTL clones cific oligonucleotides (15-mers) were designed to span the unique complementarity-determining region 3 of each clone. Lesion-infiltrating T cells were expanded in bulk from vesicle fluid or punch biopsy of HSV-2 culture-positive lesions with 0.8 ␮g/ml PHA-P Liquid hybridization (Murex Diagnostics, Dartford, U.K.), 32 U/ml IL-2 (Schiaperelli Biosys- PCR product (7 ␮l) was mixed with 10 mM Tris (pH 8.0), 280 mM NaCl, tems, Columbia, MD), allogeneic irradiated PBMC, and 50 ␮M acyclovir 6 32 ϩ 100 ␮M dNTPs, formamide, and 10 cpm P-labeled oligonucleotide in a (5). CD8 T cells were positively selected using CD8 microbeads and total volume of 25 ␮l as previously described (16, 17). The amount of MiniMACS columns (Miltenyi Biotec, Auburn, CA) from bulk lesion cul- formamide used for each probe was adjusted to T 34°C. Mixtures were tures containing CD8ϩ T cells (as determined by flow cytometry) and with m 51 ϩ heated to 97°C for 5 min and cooled to room temperature during 15 min; cytotoxic activity (as determined by a standard Cr release assay). CD8 and 10 ␮l were electrophoresed in 6% acrylamide gels, dried, and exposed T cells were cloned at 1 cell/well with PHA, IL-2, and irradiated autolo- to x-ray film. gous PBMC; screened for HSV-specific CTL activity; and expanded (4). Southern blotting Cytotoxicity assays

51 PCR products were separated on a 6% acrylamide gel and transferred to a Standard Cr release assays were performed (4). Briefly, target LCL (au- nitrocellulose membrane. Specific DNA sequences were identified by hy- tologous or partially/completely mismatched at HLA class I) were mock 32 ϫ bridization with P-labeled clone-specific oligonucleotide in a mixture infected or infected for 18 h with HSV-1, HSV-2, an HSV-1 HSV-2 containing 5ϫ SSC, 5ϫ Denhardt’s solution, 1% SDS, and 100 ␮g/ml IRV, or a clinical HSV-2 isolate at a multiplicity of infection of 10 in the salmon sperm DNA. After hybridization at 68°C overnight, membranes ␮ 51 ϩ presence of 100 Ci Cr; washed; and counted. CD8 T cell clones and were washed using high stringency conditions and exposed to x-ray film. 51Cr-labeled target LCL were cultured together using various E:T ratios. ␮ After4hat37°C, 30 l supernatant were removed and counted in Lu- Results maplates with a Topcount scintillation counter (Packard, Meriden, CT). ϩ Percent of specific 51Cr release was calculated as [(mean experimental Characterization of lesion-infiltrating HSV-specific CD8 CTL cpm Ϫ mean minimum cpm)/(mean maximum cpm Ϫ mean minimum clones ϫ cpm)] 100%. Spontaneous release (target cells in media alone) was ϩ always Ͻ30% of maximum release (target cells in Nonidet P-40). HSV-specific CD8 CTL clones were isolated from LIL expanded from three immunocompetent HSV-2 infected individuals. Of the RNA extraction, PCR, and sequencing 960 cloning wells, 10, 17, and 20% were positive for growth from Total RNA was extracted from CTL clones (1–2 ϫ 106), PBMC (5–10 ϫ Pts. 1, 2, and 3, respectively; of these, 21, 5, and 10%, respectively, 106), or bulk lesion cultures (3–5 ϫ 106) by the single-step guanidinium demonstrated cytotoxic activity to HSV-2. All of the clones that method (14), and cDNA was synthesized using random hexamer primers, reacted to HSV-2 were subsequently restimulated and tested for Moloney murine leukemia virus reverse transcriptase (Life Technologies, HLA-restricted CTL activity. Table I displays all the lesion-de- Gaithersburg, MD), and dNTPs (Boehringer Mannheim, Indianapolis, IN). ϩ To determine the TCRBV usage of individual clones, cDNA was amplified rived CD8 CTL clones from each of the three subjects that grew with 1 of 26 TCRBV family-specific 5Ј-primers, a 3Ј-primer from the and maintained HSV-specific lytic activity after restimulation. All 1148 LONG TERM PERSISTENCE OF HUMAN HSV-SPECIFIC CD8ϩ CTL

Table II. TCR V␤-D␤-J␤-C␤ usage and sequences of lesion-derived HSV-speciﬁc CD8ϩ CTL clonesa

BV Gene BJ Gene Clone TCRB Gene Usage 3Ј-End N-BD-N 5Ј-End

1B.4b TCRBV12J1S1C2 ATCAGT GAGCCGGATAGGGGC ACTGAA 1B.5 TCRBV12J1S1C2 –––––– ––––––––––––––– –––––– 1B.13 TCRBV12J1S1C2 –––––– ––––––––––––––– –––––– 1B.14 TCRBV12J1S1C2 –––––– ––––––––––––––– –––––– 1B.18 TCRBV12J1S1C2 –––––– ––––––––––––––– ––––––

2B.1 TCRBV10J2S4C2 GCCAGC AGCAGGGGACCACCGGGACAGGGGGCC AAAAAC 2B.11 TCRBV10J2S4C2 –––––– ––––––––––––––––––––––––––– ––––––

3B.4 TCRBV17J1S5C1 CCAGTA GCCCCTACGGGGGGGGCC AGCCCC 3B.8 TCRBV17J1S5C1 –––––– –––––––––––––––––– ––––––

3B.11 TCRBV5S2J2S2C2 CAGCTT TGGAGGTGGAGGGCT AACCGG

3B.22 TCRBV21J2S3C2 AGCAGC CGACGGGGTAGCGCG ACAGAT

a Bold and italicized nucleotides depict the sequence of complementarity-determining region 3 clonotype-speciﬁc oligonucleotide probes; dashes represent identical nucleotide

sequences. These sequence data are available from GenBank under accession numbers AF200426, AF200427, AF200428, AF300429, and AF200430. Downloaded from b Only 5 of the 14 clones from Pt. 1 are displayed; all 14 clones had identical nucleotide sequences.

of the CD8ϩ CTL clones speciﬁcally lysed autologous HSV-2- progeny of a single progenitor clone, although whether this clone infected LCL and not autologous mock infected LCL or HSV-2- was expanded within the lesion in vivo or by in vitro stimulation

infected allogeneic LCL completely mismatched at the HLA class is unknown. Lesion-derived clones from Pt.3 (3B.4 and 3B.8) were http://www.jimmunol.org/ I locus (Table I). Interestingly, all the clones were HSV-2 type also identical at the nucleotide level, and each utilized specific in that they lysed autologous HSV-2-infected LCL and not TCRBV17J1S5 genes. Clone 2B.1 and 2B.11 from Pt. 2 were sister HSV-1-infected LCL (Table I). None of the clones killed the NK- clones and utilized TCRBV10J2S4 genes, whereas clones 3B.11 sensitive K562 cells (data not shown), confirming the specificity of and 3B.22 utilized TCRBV5S2J2S2 and TCRBV21J2S3, respec- these clones. tively (Table II). Thus, only Pt. 3 demonstrated evidence of more The HLA class I-restricting element of each clone was deter- than one unique lesion-derived CD8ϩ T cell clonotype from their mined using a panel of LCL that were completely mismatched or original biopsy specimen. partially matched at one or more class I alleles. Each clone was ϩ tested for lytic activity against HSV-2-infected autologous or mis- Detection of HSV-specific CD8 CTL clones by RT-PCR by guest on September 25, 2021 matched LCL (data not shown). The HLA-restricting element of Liquid hybridization was used to detect the presence of CTL clones 1B.4 and 1B.5 was HLA A24, clone 2B.1, 2B.11 and 3B.22 clones in PBMC and LIL. 32P-labeled clonotype-specific oligonu- was HLA A2 and clone 3B.4 and 3B.8 was HLA B45 (Table I). cleotide probes (15-mers) spanning the CRD3 region were used Clone 3B.11 lysed LCL matched at A2 and B8 but not LCL (Table II). The concentration of formamide used in each hybrid- matched at A1 or B45. Clone 3B.11 lost killing activity after two ization reaction reduced the probe Tm to 34°C. Therefore, the strin- rounds of restimulation; thus, the HLA-restricting allele could not gency and specificity of each hybridization reaction were very be confirmed to either A2 or B8. high. Any single-base pair mismatch in the probe region would ϳ Because all lesion-derived clones were HSV-2 type specific, reduce the Tm to 67°C. To test the specificity of this technique, HSV-1 ϫ HSV-2 IRV were utilized to define the antigenic spec- PCR products from four lesion-derived HSV-specific TCRBV12- ificity more closely. Clones 1B.4, 1B.5, 3B.4, and 3B.8 recognized expressing T cells clones from Pt. 7 (an unrelated HSV-2-seropos- an HSV-2 epitope contained within 0.0–0.18 map unit (Table I). itive individual) were mixed with the 1B.5-specific oligonucleo- Clones 2B.1 and 2B.11 recognized an epitope contained within tide. Clones from Pt. 7 were lesion-derived CD4ϩ HSV-specific T 0.67–0.73 map unit, and clone 3B.22 recognized an epitope con- cell clones that differed by 7 or 8 nucleotides at complementarity- tained within 0.68–0.70 map unit. The region on the HSV-2 ge- determining region 3 (Fig. 1A). The 1B.5 oligonucleotide bound nome recognized by 3B.11 could not be determined because the specifically to the PCR product from clone 1B.5 and did not hy- clone lost killing activity after two rounds of restimulation. These bridize to the PCR products from the TCRBV12-expressing clones ϩ data indicate that the lesion-derived CD8 T cell response among from Pt. 7 (Fig. 1B). PCR product from all clones could be visu- these subjects with frequently recurring HSV-2 appears, at least by alized by ethidium bromide staining (data not shown), demonstrat- these methods, to be narrowly focused. ing that a negative signal in the liquid hybridization reaction was Ͼ ϩ not due to lack of PCR product. Thus, even with 50% homology TCRBV usage of lesion-derived HSV-specific CD8 CTL clones over a 15-nucleotide region, no cross-hybridization occurred. RT-PCR using 26 TCRBV family-specific primers was performed To determine the sensitivity of the liquid hybridization protocol on the lesion-derived CD8ϩ CTL clones followed by DNA se- for detecting HSV-specific CD8ϩ CTL clones, RNA was isolated quencing of the TCRBV, TCRBD, and TCRBJ regions. For each from 1000 1B.5 cells, and serial 10-fold dilutions were mixed with of the clones, a single dominant band was visualized on ethidium RNA from 3 ϫ 105 CD8ϩ cells from an unrelated HSV-seropos- bromide-stained agarose gels with only 1 of the 26 TCRBV fam- itive individual. cDNA was amplified with the TCRBV12 primer, ily-specific primers, a pattern confirming their clonality. All 14 of and liquid hybridization was performed with the 1B.5-specific oli- the clones isolated from Pt.1 utilized TCRBV12J1S1 genes, and the gonucleotide. The clonotype-specific oligonucleotide specifically TCRBV, TCRBD, and TCRBJ regions were identical at the nu- bound to the PCR product from clone 1B.5 but not to the PCR cleotide level (Table II). This suggests that these clones were the product from the control CD8ϩ cells amplified with the TCRBV12 The Journal of Immunology 1149

ϩ FIGURE 1. Lesion-derived HSV-specific CD8 clonotypes are present in blood and persist for 2 years. A, CDR3 sequence alignment of 1B.5 with 4 Downloaded from TCRBV12 HSV-specific lesion-derived CD4ϩ T cell clones from Pt.7. O, nucleotide matches. B, Liquid hybridization using 1B.5-specific oligonucleotide with PCR products from 1B.5 and the four TCRBV12 clones from Pt. 7. C, Serial 10-fold dilutions of RNA isolated from 1000 1B.5 cells were added to RNA from 3 ϫ 105 CD8ϩ PBMC from an unrelated HSV-seropositive individual, cDNA was synthesized, TCRBV transcripts were amplified, and liquid hybridization was performed. O, no cDNA in PCR reaction; ctrl CD8ϩ, CD8ϩ PBMC from the unrelated HSV-seropositive donor. D, TCRBV12 transcripts were amplified by PCR using cDNA from 1B.4, 1B.5, CD8ϩ PBMC from Pt. 1 at the time of the lesion from which these clones were originally isolated (February 1995), 1 mo (March 1995), 6 mo (August 1995), and 2 years (February 1997) post-lesion onset and from CD8ϩ PBMC from an unrelated HSV-seropositive individual (ctrl CD8ϩ). Liquid hybridization of PCR products with the 1B.5-specific oligonucleotide probe was used to detect the http://www.jimmunol.org/ presence of this clone. E, A longer exposure of gel from D to confirm the presence of 1B.5 at the 6-mo time point (August 1995).

primer (Fig. 1C). A positive signal could be detected with 1 cell related HSV-seropositive individual (Fig. 1B). Thus, both tech- RNA equivalent in a background of RNA from cells not express- niques generated identical results. ing the particular clonotype. Thus, this technique detected the Each of the three unique clonotypes isolated from Pt. 3 were RNA from 1 cell expressing a particular TCRBV clonotype. also found in PBMC. No PBMC were available from the time the by guest on September 25, 2021 ϩ clone was isolated from a lesion in June 1991. Clones 3B.4 and HSV-specific CD8 CTL clones in PBMC 3B.8 were detected in PBMC 2 years after they were originally To determine whether lesion-derived HSV-specific CD8ϩ CTL isolated but not detected in PBMC 7 years later (Fig. 3A). In con- clones were present and persisted in PBMC from the same indi- trast, clones 3B.11 and 3B.22 were detected in PBMC obtained 7 vidual, we purified RNA from CD8ϩ T cells from PBMC obtained years after the clone was initially isolated (May 1998) (Fig. 3, B at the time of initial biopsy (if available) and prospectively over and C). time. For these studies, we utilized RNA from 5–10 ϫ 106 un- stimulated PBMC or CD8-selected PBMC. Liquid hybridization ϩ was performed with the clonotype-specific probe. A representative HSV-specific CD8 CTL clones infiltrate subsequent lesions experiment on Pt. 1 is shown in Fig. 1. A positive signal was Once we developed the techniques to detect unique clonotypes in detected in PBMC-derived CD8ϩ T cells isolated at the time of the lesions, we sought to determine whether the same clone infiltrated lesion from which clone 1B.4/5 was isolated (February 1995), 1 subsequent herpetic lesions. For these studies, RT-PCR was per- mo later (March 1995), 6 mo later (Fig. 1E, longer exposure), and formed on RNA from LIL isolated from different episodes of 2 years later (February 1997), but not in PBMC-derived CD8ϩ T HSV-2 reactivation. Pt. 2 agreed to undergo two additional genital cells from an unrelated HSV-seropositive donor (Fig. 1, D and E). lesion biopsies from recurrences 1 and 4.75 years after initial en- Thus, this clonotype was present simultaneously in a genital HSV rollment. Clone 2B.1 was detected in the lesion from which it was lesion and in PBMC. Moreover, we could detect the persistence of isolated (October 5, 1994, and October 7, 1994), from a lesion 1 this clone in PBMC for at least 2 years. Similar results were ob- year later on October 20, 1995 (Fig. 2C) and from a lesion 4.75 tained with Pt. 2; clones 2B.1 and 2B.11 were detected in PBMC years later (data not shown). Pt. 3 agreed to have biopsies of HSV at the time the clone was isolated from the lesion (October 1994) recurrences 6.5 and 7.5 years postenrollment. Clone 3B.4, isolated and from all subsequent time points (n ϭ 3) (up to 4.75 years later) from a genital lesion in June 1991, was detected in two subsequent but not in PBMC from an unrelated HSV-2-seropositive individual lesions 6.5 (December 1997) and 7.5 (November 1998) years after (Fig. 2A). the clone was initially isolated but not during a recurrence on We compared the results with liquid hybridization protocol to 10/98 (Fig. 3A). Clone 3B.11, also isolated from a lesion in June that of Southern blotting, an alternate technique used to longitu- 1991, was detected in biopsies from October 1998 and November dinally track CTL clonotypes (18). cDNA was amplified with the 1998 (Fig. 2B), and 3B.22 was detected in the November 1998 TCRBV10 family-specific primer as in Fig. 2A, and products were biopsy (Fig. 3C). Fig. 3D summarizes the detection of clones from eluted on an acrylamide gel, transferred to nitrocellulose, and Pt. 3 in PBMC and lesions. Therefore, lesion-derived HSV-specific probed with the 32P-labeled 2B.1 clonotype-specific oligonucleo- CD8ϩ CTL clones could infiltrate HSV recurrences spaced Ͼ7 tide. As in Fig. 2A, 2B.1 was detected in PBMC from Pt. 2 from years apart. Pt. 1 did not agree to undergo further biopsies, pre- all time points tested over 28 mo but not in PBMC from an un- cluding study of local long term memory. 1150 LONG TERM PERSISTENCE OF HUMAN HSV-SPECIFIC CD8ϩ CTL

epitopes, we evaluated the lytic activity of CTL clones to the viral isolate obtained from a buttock recurrence of Pt. 3, 6.5 years after the CTL clones were initially obtained. Two separate clinical isolates of HSV-2 obtained from lesion swabs on December 15, 1997 (strain 9349), and December 18, 1997 (strain 9434), were har- vested and used to infect autologous LCL. CTL clones 3B.8 and 3B.22, isolated in June 1991, were tested for lytic activity against autologous LCL infected with these 1997 viruses. Both clones lysed autologous LCL and LCL matched at the appropriate HLA- restricting allele (B45 for 3B.8 and A2 for 3B.22) infected with either clinical isolate (Fig. 4). This demonstrates that in an individual with frequently recurring HSV disease, no detectable mu- tations in viral genes to which CD8ϩ T cells were directed could be identiﬁed.

Discussion HSV as a recurrent mucocutaneous infection offers an opportunity

to study in vivo survival and persistence of memory T cell re- Downloaded from sponses to Ags that appear not to undergo antigenic variation. We developed several sensitive techniques to define and follow HSV- specific CD8ϩ CTL clonotypes. We demonstrated that individual clonotypes were consistently detected in PBMC for as long as 7 years. Most fascinating was the finding that identical clonotypes FIGURE 2. Long term persistence of 2B.1 in PBMC and presence of infiltrated herpetic lesions spaced as long as 7.5 years apart and http://www.jimmunol.org/ this clonotype in temporally spaced lesions. A, TCRBV10 transcripts were that these clonotypes retained cytotoxic function and recognized amplified by PCR using cDNA from 2B.1, Pt. 2 PBMC isolated at the time ϩ and killed autologous clinical HSV-2 isolates. HSV-specific CD8 of the lesion from which these clones were originally isolated (October 1994), 16 mo (February 1996), 28 mo (February 1997), and 4.75 years CTL clonotypes were not compartmentalized to the skin but were (July 1999) post-lesion onset and from PBMC from an HSV-seropositive found simultaneously in the skin and in peripheral blood. unrelated individual (ctrl PBMC). Liquid hybridization of PCR products One of the intriguing aspects of our study was the limited num- ϩ with the 2B.1-specific oligonucleotide probe was used to detect the pres- ber of unique CD8 memory T cell clonotypes we were able to ence of this clone. O, no cDNA control. B, Southern blot analysis. PCR derive from LIL and the fact that all the clones were specific for products amplified with TCRBV10 primers were eluted on a 6% acryl- the infecting strain of virus, HSV-2, and were not cross-reactive amide gel, transferred to a nitrocellulose membrane, and probed with the with HSV-1. We may have skewed our results by the timing of by guest on September 25, 2021 2B.1-specific oligonucleotide. Lanes as in A. C, TCRBV10 transcripts were biopsies in that HSV-specific CD8ϩ T cells infiltrating at times amplified from 2B.1, from LIL isolated and expanded from HSV buttock postbiopsy would not be expanded. Although this is a possibility, lesions from Pt. 2 from October 5, 1994, and October 7, 1994, on clinical we did perform multiple biopsies at different stages and time points lesion days 2 and 4 and from a buttock lesion occurring 1 year later (Oc- tober 20, 1995). 2B.1 was originally isolated from the October 7, 1994, during lesion evolution. In each of these cases, consistency in the biopsy. Liquid hybridization of PCR products with the 2B.1-specific probe TCRBV usage in LIL was noted. Unfortunately, the total number was used to detect the presence of this clonotype. O, no cDNA control. of T cells that can be isolated from a single biopsy is extremely low, precluding direct analysis of T cells from lesions without expansion. Thus, it is possible that the clones we identified possess HSV-specific clonotypes retain cytotoxic function a unique stability compared with other clones. Highly restricted To determine whether the clones isolated over time retained cyto- TCRBV usage has been observed in lymph nodes draining HSV ϩ lytic function, CD8 T cell clones isolated from LIL from Pt. 3 in infection in the murine model, providing further support of a re- December 1997 were expanded and tested for CTL function. One stricted CD8ϩ T cell response to HSV; the vast majority of T cells ϩ of the CD8 CTL clones that was isolated was HSV-2 type spe- recognize a single epitope of glycoprotein B (19, 20). Our data cific and restricted to HLA-B45 (Fig. 3E). With the use of the suggest that HSV-specific CD8ϩ T cell responses appear highly HSV-1 ϫ HSV-2 IRV, this clone, termed 3B.51, was specific for restricted in nature in terms of both TCRBV usage and immuno- an HSV-2 epitope contained within the region 0.0–0.18, the same genic viral epitopes. We studied only persons with frequently re- region as recognized by the earlier clones 3B.4 and 3B.8. RNA curring HSV, and it is possible that persons with infrequent disease from clone 3B.51 was isolated, and RT-PCR and liquid hybrid- have a more diverse response. ization performed with the 3B.4 clonotype-specific oligonucleo- Immune evasion strategies used by HSV are myriad and include tide. The 3B.4 oligonucleotide hybridized with the PCR product latency in immunologically privileged neurons, down-regulation from clone 3B.51 amplified with the TCRBV17 primer (Fig. 3A). of HLA class I (21–23), infection and inactivation of immune ef- Sequencing of this PCR product confirmed that 3B.4 and 3B.51 fector cells (13, 24–26), and inhibition of complement- and Ab- were identical at the nucleotide level (data not shown), proving mediated viral neutralization (reviewed in Ref. 27). Selection of definitively that this clonotype persisted for 7.5 years and retained viral mutants that can escape immune surveillance has not been cytotoxic activity. thought to be a mechanism of viral immune evasion utilized by

ϩ herpesviruses due to the high fidelity of DNA polymerase. How- Lesion-derived HSV-specific CD8 CTL clones lyse autologous ever, an example of viral mutation of a CTL epitope in a herpes- HSV isolates obtained 6.5 years later virus, namely EBV, has been described (28) although this mech- To determine whether HSV-specific CD8ϩ CTL clones exerted anism does not appear to be universal (29). Few studies have selective pressure on HSV-2 resulting in the mutation of CTL performed detailed sequence analyses of sequential HSV isolates The Journal of Immunology 1151 Downloaded from http://www.jimmunol.org/

FIGURE 3. Long term persistence of CD8ϩ CTL clones from Pt. 3 in PBMC and in temporally spaced lesions. A, TCRBV17 transcripts were amplified by PCR using cDNA from the following sources: clone 3B.4 (isolated in June 1991); PBMC from Pt. 3 isolated in August 1993 and May 1998 (2 and 7 years after the clone was initially isolated); and from LIL isolated in June 1991 (lesion from which 3B.4 was isolated), December 1997, October 1998, and November 1998. Liquid hybridization of PCR products with the 3B.4/8-specific oligonucleotide probe was used to detect the presence of this clone. O, by guest on September 25, 2021 no cDNA control. B, TCRBV5S2 transcripts were amplified by PCR using cDNA from clone 3B.11; PBMC from Pt. 3 isolated in August 1993, March 1998, and May 1998; and from LIL from June 1991, October 1998, and November 1998. Bottom panel, longer exposure to show the detection of weaker bands. Liquid hybridization was performed with the 3B.11-specific probe. C, TCRBV21 transcripts were amplified by PCR using cDNA from 3B.22, PBMC from Pt. 3 isolated on August 1993, July 1998, and May 1998 and from LIL from June 1991, December 1997, October 1998, and November 1998. Liquid hybridization was performed with the 3B.22-specific probe. D, Summary of clones detected in PBMC and lesions. E, Clonotype 3B.4/8 retains cytolytic function after 6.5 years. Clone 3B.4 isolated from a lesion in June 1991 and clone 3B.51 isolated from a lesion in December 1997 were tested for killing against autologous LCL that were mock infected or infected with HSV-1, HSV-2, or RE6 or with HSV-2-infected LCL that were completely mismatched at the HLA class I locus (allo) or matched at HLA-B45. Data represent the mean of triplicate wells at E:T 10:1. from individuals over time; however, “hot spots” for genetic virus. Our novel albeit limited look at this issue suggests no evi- change in the thymidine kinase gene have been described under dence of viral escape variants. The clinical isolates used to infect drug selection (30). Our study is the first to use in vivo selection autologous target cells were recognized and killed by the CD8ϩ of T cell sequences as a mechanism to probe genetic changes in the CTL clones, which is consistent with no mutation(s) of HSV-2 in

FIGURE 4. HSV-specific CD8ϩ CTL clones lyse targets infected with autologous clinical HSV-2 isolates: no evidence of CTL escape variants. Clones 3B.8 (HLA B45-restricted) and 3B.22 (HLA A2-restricted), isolated from a lesion in June 1991, were tested for lytic activity against autologous LCL (auto), LCL matched at HLA-A2 or B45, or LCL mismatched at all HLA class I loci (allo). LCL were mock infected or infected with HSV-1, HSV-2, or HSV-2 strains 9349 and 9434. HSV-2 strains 9349 and 9434 were isolated from Pt. 3 on December 15, 1997, and December 18, 1997, respectively. E:T ratio was 10:1. 1152 LONG TERM PERSISTENCE OF HUMAN HSV-SPECIFIC CD8ϩ CTL the genes providing the CTL epitopes. Confirmation of this awaits 9. Para, M. F., K. M. Zezulak, A. J. Conley, M. Weinberger, K. Snitzer, and the identification of the epitope and sequencing of HSV-2 corre- P. G. Spear. 1983. Use of monoclonal antibodies against two 75,000-molecular weight glycoproteins specified by herpes simplex virus type 2 in glycoprotein sponding to this region. However, this does not exclude the pos- identification and gene mapping. J. Virol. 45:1223. sibility that other epitopes had succumbed to immune pressure but 10. Purves, F. C., D. Spector, and B. Roizman. 1991. The herpes simplex virus type 1 protein kinase encoded by the US3 gene mediates posttranslational modification that changes were not detected based on our experimental design. of the phosphoprotein encoded by the UL34 gene. J. Virol. 65:5757. Clonal exhaustion also does not appear to promote viral persistence 11. Preston, V. G., A. J. Davison, H. S. Marsden, M. C. Timbury, J. H. Subak-Sharpe, to this human pathogen in immunocompetent adults. Even in the pres- and N. M. Wilkei. 1978. Recombinants between herpes simplex virus types 1 and 2: analyses of genome structures and expression of immediate early polypeptides. ence of frequent Ag exposure, shown in certain infections to cause J. Virol. 28:499. clonal exhaustion or deletion of Ag-specific T cells (reviewed in Ref. 12. Koelle, D. M., M. A. Tigges, R. L. Burke, F. W. Symington, S. R. Riddell, 31), all the HSV-specific CD8ϩ CTL clones that we isolated from our H. Abbo, and L. Corey. 1993. Herpes simplex virus infection of human fibroblasts and keratinocytes inhibits recognition by cloned CD8ϩ cytotoxic T lym- three patients with frequently recurring HSV disease persisted for phocytes. J. Clin. Invest. 91:961. long periods of time and retained cytolytic function. 13. Posavad, C. M., and K. L. Rosenthal. 1992. Herpes simplex virus-infected fibro- Our findings raise several questions related to the complex in- blasts are resistant to and inhibit cytotoxic T-lymphoyte activity. J. Virol. 66: 6264. teraction between the virus and host. Is it the person with fre- 14. Chomczynski, P., and N. Sacchi. 1987. Single-step of RNA isolation by acid quently recurring disease who has a restricted response whereas guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156. those with less frequent disease display a broader response? T cell 15. Monteiro, J., R. Hingorani, I. H. Choi, J. Silver, R. Pergolizzi, and P. K. Gregersen. 1995. Oligoclonality in the human CD8ϩ T cell repertoire in diversity is likely to be an important component in the establish- normal subjects and monozygotic twins: implications for studies of infectious and ment and maintenance of a balanced host-virus coexistence. In autoimmune diseases. Mol. Med. 1:614.

HIV infection, another persistent human infection, polyclonal 16. Cone, R. C., A. C. Hobson, J. Palmer, M. Remington, and L. Corey. 1991. Downloaded from ϩ Extended duration of herpes simplex virus DNA in genital lesions detected by the HIV-specific CD8 T cell responses have been associated with polymerase chain reaction. J. Infect. Dis. 164:757. better clinical status (32, 33). Do quantitative differences in mem- 17. Cone, R. W., A. C. Hobson, and M. L. Huang. 1992. Coamplified positive control ory T cell responses make a difference in disease severity in im- detects inhibition of polymerase chain reactions. J. Clin. Microbiol. 30:3185. 18. Kalams, S. A., R. P. Johnson, A. K. Trocha, M. J. Dynan, H. S. Ngo, R. T. munocompetent persons? In immunosuppressed persons, severe D’Aquila, J. T. Kurnick, and B. D. Walker. 1994. Longitudinal analysis of T cell HSV disease was more closely correlated with low to undetectable receptor (TCR) gene usage by human immunodeficiency virus 1 envelope-spe- ϩ cific cytotoxic T lymphocyte clones reveals a limited TCR repertoire. J. Exp. numbers of HSV-specific CD8 memory CTL (7). In the present http://www.jimmunol.org/ Med. 179:1261. report, we studied only people with longstanding infection; do the 19. Cose, S. C., J. M. Kelly, and F. R. Carbone. 1995. Characterization of a diverse clones isolated at later stages of disease represent clones with more primary herpes simplex virus type 1 gB-specific cytotoxic T-cell response show- ␤ or less avidity/efficacy in vivo than clones isolated earlier in the ing a preferential V bias. J. Virol. 69:5849. 20. Wallace, M. E., R. Keating, W. R. Heath, and F. R. Carbone. 1999. The cytotoxic disease process? Perhaps the major implication of our work is the T-cell responses to herpes simplex virus type 1 infection of C57BL/6 mice is almost development of a reproducible tracking assay to define the persis- entirely directed against a single immunodominant determinant. J. Virol. 74:7619. tence and localization of a clonotype over time. With the elucida- 21. York, I. A., C. Roop, D. W. Andrews, S. R. Riddell, F. L. Graham, and D. C. ϩ Johnson. 1994. A cytosolic herpes simplex virus protein inhibits antigen presen- tion of specific epitopes recognized by HSV-specific CD8 CTL, tation to CD8ϩ T lymphocytes. Cell 77:525. use of the tetramer binding technology (34) will likely be helpful 22. Hill, A., P. Jugovic, I. York, G. Russ, J. Bennink, J. Yewdell, H. Ploegh, and D.

Johnson. 1995. Herpes simplex virus turns off the TAP to evade host immunity. by guest on September 25, 2021 in defining more of the quantitative aspects of viral-host interac- Nature 375:411. tions for HSV. However, the novel techniques we outline here 23. Fruh, K., K. Ahn, H. Djaballah, P. Semp’e, P. M. v. Endert, R. Tamp’e, provide a useful model for studying the immunobiology of her- P. A. Peterson, and Y. Yang. 1995. A viral inhibitor of peptide transporters for antigen presentation. Nature 375:415. pesviruses, viruses that persist and in which antigenic variation is 24. Posavad, C. M., J. J. Newton, and K. L. Rosenthal. 1993. Inhibition of human not a recognized aspect of their life cycle. CTL-mediated lysis by fibroblasts infected with herpes simplex virus. J. Immu- nol. 151:4865. 25. York, I. A., and D. C. Johnson. 1993. Direct contact with herpes simplex virus- Acknowledgments infected cells results in inhibition of lymphokine-activated killer cells because of We thank Dawn Mueller, Scott Whitlow, Heather Parker, Matthew John- cell-to-cell spread of virus. J. Infect. Dis. 168:1127. 26. Hayward, A. R., G. S. Read, and M. Cosyns. 1993. Herpes simplex virus inter- son, Minjun Chung, and Tony Marquardt for technical assistance; Stephen feres with monocyte accessory cell function. J. Immunol. 150:190. Polyak for technical advice and many helpful discussions; and Mike Rem- 27. Lubinski, J., T. Nagashunmugam, and H. M. Friedman. 1998. Viral interference ington, Mary Shaughnessy, and Gail Barnum for specimen collection. with antibody and complement. Cell Dev. Biol. 9:329. 28. de Campos-Lima, P.-O., V. Levitsky, J. Brooks, S. P. Lee, L. F. Hu, A. B. Rickinson, and M. G. Masucci. 1994. T cell responses and virus evolution: References Epstein-Barr virus isolates from highly HLA A11-positive populations carry mu- 1. Fleming, D. T., G. M. McQuillan, R. E. Johnson, A. J. Nahmias, S. O. Aral, tations selectively involving anchor residues of A11-restricted CTL epitopes. F. K. Lee, and M. E. S. Louis. 1997. Herpes simplex virus type 2 in the United J. Exp. Med. 179:1297. States, 1976 to 1994. N. Engl. J. Med. 337:1105. 29. Lee, S. P., S. Morgan, J. Skinner, W. A. Thomas, S. R. Jones, J. Sutton, 2. Wald, A., L. Corey, R. Cone, A. Hobson, G. Davis, and J. Zeh. 1997. Frequent R. Khanna, H. C. Whittle, and A. B. Rickinson. 1995. Epstein-Barr virus isolates genital herpes simplex virus 2 shedding in immunocompetent women: effect of with the major cytotoxic T cell epitope are prevalent in a highly B35.01-positive acyclovir treatment. J. Clin. Invest. 99:1092. African population. Eur. J. Immunol. 25:102. 3. Schmid, D. S. 1988. The human MHC-restricted cellular response to herpes sim- 30. Sasadeusz, J. J., F. Tufaro, S. Safrin, K. Schubert, M. M. Hubinette, plex virus type 1 is mediated by CD4ϩ, CD8Ϫ T cells and is restricted to the DR P. K. Cheung, and S. L. Sacks. 1997. Homopolymer mutational hot spots mediate region of the MHC complex. J. Immunol. 140:3610. herpes simplex virus resistance to acyclovir. J. Virol. 71:3872. 4. Posavad, C. M., D. M. Koelle, and L. Corey. 1996. High frequency of CD8ϩ 31. Welsh, R. M., and J. M. McNally. 1999. Immune deficiency, immune silencing, cytotoxic T-lymphocyte precursors specific for herpes simplex viruses in persons and clonal exhaustion of T cell responses during viral infections. Curr. Opin. with genital herpes. J. Virol. 70:8165. Microbiol. 2:382. 5. Koelle, D. M., H. Abbo, A. Peck, K. Ziegweid, and L. Corey. 1994. Direct 32. Liu, S. L., T. Schacker, L. Musey, D. Shriner, M. J. McElrath, L. Corey, and recovery of herpes simplex virus (HSV)-specific T lymphocyte clones from re- J. I. Mullins. 1997. Divergent patterns of progression to AIDS after infection current genital HSV-2 lesions. J. Infect. Dis. 169:956. from the same source: human immunodeficiency virus type 1 evolution and an- 6. Koelle, D. M., C. M. Posavad, G. R. Barnum, M. L. Johnson, J. M. Frank, and tiviral responses. J. Virol. 71:4282. L. Corey. 1998. Clearance of HSV-2 from recurrent genital lesions correlates with 33. Dalod, M., M. Dupuis, J. C. Deschemin, D. Sicard, D. Salmon, J. F. Delfraissy, infiltration of HSV-specific cytotoxic T lymphocytes. J. Clin. Invest. 101:1500. A. Venet, M. Sinet, and J. G. Guillet. 1999. Broad, intense anti-human immu- ϩ 7. Posavad, C. M., D. M. Koelle, M. F. Shaughnessy, and L. Corey. 1997. Severe nodeficiency virus (HIV) ex vivo CD8 responses in HIV type 1-infected pa- genital herpes infections in HIV-infected individuals with impaired HSV-specific tients: comparison with anti-Epstein-Barr virus responses and changes during CD8ϩ cytotoxic T lymphocyte activity. Proc. Natl. Acad. Sci. USA 94:10289. antiretroviral therapy. J. Virol. 73:7108. 8. Benedetti, J. K., J. Zeh, and L. Corey. 1999. Clinical reactivation of genital 34. Altman, J. D., P. A. H. Moss, P. J. R. Goulder, D. H. Barouch, herpes simplex virus infection decreases in frequency over time. Ann. Intern. M. G. McHeyzer-Williams, J. I. Bell, A. J. McMichael, and M. M. Davis. 1996. Med. 131:14. Phenotypic analysis of antigen-specific T lymphocytes. Science 274:94.