Disruption of Wnt Planar Cell Polarity Signaling by Aberrant Accumulation of the Metap-2 Substrate Rab37

Chemistry & Biology Article

Disruption of Wnt Planar Cell Polarity Signaling by Aberrant Accumulation of the MetAP-2 Substrate Rab37

Thomas B. Sundberg,1 Nicole Darricarrere,2 Pasquale Cirone,1 Xia Li,1 Lucy McDonald,3 Xue Mei,4 Christopher J. Westlake,5 Diane C. Slusarski,4 Robert J. Beynon,3 and Craig M. Crews1,6,7,* 1Department of Molecular, Cellular, and Developmental Biology 2Department of Cell Biology Yale University, New Haven, CT 06511, USA 3Protein Function Group, Institute of Integrative Biology, University of Liverpool, Liverpool L69 7ZB, UK 4Department of Biology, University of Iowa, Iowa City, IA 52242, USA 5Genentech, South San Francisco, CA 94080, USA 6Department of Pharmacology 7Department of Chemistry Yale University, New Haven, CT 06511, USA *Correspondence: [email protected] DOI 10.1016/j.chembiol.2011.07.020

SUMMARY tinylated fumagillin derivatives identified the metalloprotease methionine aminopeptidase-2 (MetAP-2), one of two proteins Identification of methionine aminopeptidase-2 responsible for N-terminal methionine excision (NME) in eukary- (MetAP-2) as the molecular target of the antiangio- otes, as the molecular target responsible for fumagillin/TNP- genic compound TNP-470 has sparked interest in 470’s antiangiogenic activity (Griffith et al., 1997; Sin et al., N-terminal Met excision’s (NME) role in endothelial 1997; Yeh et al., 2006). This discovery has stimulated interest cell biology. In this regard, we recently demonstrated in the exquisite sensitivity of endothelial cells to loss of MetAP-2 that MetAP-2 inhibition suppresses Wnt planar cell activity, relative to nonendothelial cell types, and inspired development of several novel structural classes of MetAP-2 inhibitors polarity (PCP) signaling and that endothelial cells (Arico-Muendel et al., 2009; Marino et al., 2007; Wang et al., depend on this pathway for normal function. Despite 2007, 2008). this advance, the substrate(s) whose activity is Recently, our lab demonstrated that MetAP-2 inhibition altered upon MetAP-2 inhibition, resulting in loss of suppresses Wnt planar cell polarity (PCP) signaling (Zhang Wnt PCP signaling, is not known. Here we identify et al., 2006), an intracellular signaling network activated by the small G protein Rab37 as a MetAP-2-specific binding of secreted Wnt proteins to Frizzled (Fz) seven-pass substrate that accumulates in the presence of TNP- transmembrane receptors (Angers and Moon, 2009). Wnt-Fz 470. A functional role for aberrant Rab37 accumula- complexes transduce signaling through the intracellular scaf- tion in TNP-470’s mode of action is demonstrated folding protein Dishevelled (Dvl), leading to activation of various using a Rab37 point mutant that is resistant to downstream effectors (Angers and Moon, 2009). MetAP-2 inhibi- NME, because expression of this mutant pheno- tion specifically suppresses activation of downstream effectors of Wnt PCP signaling such as c-Jun N-terminal kinase and the copies the effects of MetAP-2 inhibition on Wnt small G protein RhoA (Zhang et al., 2006). We, and others, PCP signaling-dependent processes. have also demonstrated that normal endothelial cell function depends on finely balanced Wnt PCP signaling; expressing a dominant-negative Dishevelled mutant, knockdown of wnt5,or INTRODUCTION expression of a constitutively active form of the Wnt PCP effector DAAM1 suppresses endothelial cell proliferation and impairs Angiogenesis is the process of forming new blood vessels from angiogenesis in vivo (Cheng et al., 2008; Cirone et al., 2008; Ju the existing vasculature and is essential for normal development et al., 2010; Masckaucha´ n et al., 2006). (Carmeliet, 2005). However, because inappropriate blood vessel Although several preferential MetAP-2 substrates (e.g., formation contributes to many disease processes including GAPDH, cyclophilin A, and thioredoxin-1) have been identified, rheumatoid arthritis, endometriosis, diabetic retinopathy, mac- N-terminal Met retention on these proteins does not contribute ular degeneration, and tumorigenesis, antiangiogenic therapy to the effects of MetAP-2 inhibition on Wnt PCP signaling and has broad clinical potential (Folkman, 2007). The microbial angiogenesis (Wang et al., 2008; Warder et al., 2008). Here, using metabolite fumagillin and its synthetic derivatives (e.g., TNP- an unbiased N-terminal positional proteomics screen, we iden- 470) are potent, first-in-class small-molecule angiogenesis tify Rab37 as a preferential MetAP-2 substrate that aberrantly inhibitors with established efficacy in vivo (Ingber et al., 1990; accumulates in the presence of TNP-470 and, when overex- Kruger and Figg, 2000). Affinity chromatography with bio- pressed, phenocopies the effects of MetAP-2 inhibition on Wnt

Figure 1. Identiﬁcation of MetAP-2 Substrates by N-Terminal Positional Proteomics 13 MPE cells cultured in media containing stable heavy isotope-labeled arginine ([ C6]Arg) were treated with TNP-470, whereas vehicle-treated cells were 12 maintained in the presence of [ C6]Arg. Following cell lysis, soluble fractions from the two treatment conditions were pooled and N-terminal peptides were isolated by the following reaction sequence: (1) proteomic chemical acetylation of primary amines on N termini and lysine-residue side chains; (2) tryptic proteolysis to generate blocked N-terminal peptides and internal peptides with newly exposed reactive a-amino groups; and (3) removal of these internal peptides by reaction with an immobilized amine capture reagent. Isolated N-terminal peptides can then be identiﬁed by LC-MS/MS and the role of MetAP-2in N-terminal Met excision determined by comparing abundance of the heavy (TNP-470-treated) versus light (vehicle-treated) peptides.

PCP signaling-dependent processes such as endothelial cell For this study, murine pulmonary endothelial (MPE) cells were proliferation/network formation and zebrafish embryogenesis. cultured in media containing stable heavy isotope-labeled argi- 13 nine ([ C6]Arg) for seven passages before exposure to TNP- RESULTS 470 (50 nM, 16 hr). A control set of MPE cells was maintained in unlabeled media and then treated with vehicle. Following Identification of Preferential MetAP-2 Substrates cell lysis, soluble fractions from the two treatment conditions by N-Terminal Proteomics were pooled and used to generate N-terminal peptide prepara- Given that methionine aminopeptidases are responsible for tions. Whereas stable isotope-labeled (‘‘heavy’’) N-terminal pep- NME, we reasoned that an N-terminal positional proteomics tides are derived from TNP-470-treated cells, the unlabeled screen would be well suited for identification of proteins that (‘‘light’’) counterparts from vehicle-treated cells should show retain their N-terminal Met residue following MetAP-2 inhibition. normal processing. In this experiment, essentially all of the iden- Our N-terminal positional proteomics approach (see Figure 1) tified N-terminal peptides produced LC-MS/MS signals of equiv- generates an enriched pool of N-terminal peptides that can alent intensity, suggesting that MetAP-2 is redundant for NME more easily be identified by liquid chromatography-tandem for most proteins. In contrast, abundance of the heavy (TNP- mass spectroscopy (LC-MS/MS) than global proteomic prepara- 470-treated) versus light (vehicle-treated) N-terminal peptide tions (McDonald et al., 2005). corresponding to glyceraldehyde 3-phosphate dehydrogenase

Figure 2. Rab37 Is a Novel MetAP-2 Substrate 13 (A and B) LC-MS analysis of N-terminal peptides from MPE cells differentially labeled with [ C6]Arg before treatment with vehicle or TNP-470 (50 nM, 16 hr). 13 Unprocessed N-terminal tryptic peptides are highlighted in the ovals. Note the peak height difference in the light, vehicle-treated, and heavy (i.e., [ C6]Arg- labeled) TNP-470-treated peptides for the known MetAP-2 substrate GAPDH. No light, vehicle-treated N-terminal tryptic peptide was detected for the novel MetAP-2 substrate Rab37, suggesting that this protein is destabilized by NME. (C) Diagram of Rab37 constructs used in this study. (D) Whole-cell lysates from HEK293T cells transiently transfected with WT- or T2E-Rab37 (50 ng) or empty vector followed by incubation with vehicle or TNP-470 (50 nM, 16 hr) were immunoblotted with speciﬁc antibodies as indicated.

(GAPDH) was elevated approximately 3-fold (Figure 2A). These related to N-terminal Met retention, we transiently expressed data are consistent with previous reports indicating that GAPDH equivalent amounts of WT-Rab37 (50 ng) or a mutant (T2E- is preferentially processed by MetAP-2 (Turk et al., 1999; Wang Rab37) that is completely resistant to MetAP-2 processing due et al., 2008), and suggest N-terminal positional proteomics is to substitution of the penultimate N-terminal Thr to Glu (Xiao a viable approach to identify novel MetAP-2 substrates. et al., 2010). Basal levels of this MetAP-2-resistant mutant are >10-fold higher than WT-Rab37, and did not further increase Rab37 Is a Novel MetAP-2 Substrate in the presence of TNP-470 (Figure 2D). Importantly, abundance In addition to GAPDH, another protein that displayed an isotope- of T2E-Rab37 was essentially equivalent to that of WT-Rab37 in labeling pattern consistent with MetAP-2 processing was the TNP-470-treated cells (Figure 2D), suggesting that T2E-Rab37 is low-molecular weight G protein Rab37 (Figure 2B). In fact, unla- stabilized relative to the wild-type protein due to inhibition of beled N-terminal peptide was not detected in this case, suggest- NME. These data, along with the results of our N-terminal pro- ing that Rab37 is destabilized by NME and, thus, accumulates in teomic study, indicate that Rab37 is a novel MetAP-2 substrate the presence of TNP-470. As a first step, we sought to indepen- that is destabilized by NME and, thus, accumulates in the pres- dently confirm this result by determining whether Rab37 accu- ence of TNP-470. mulates upon MetAP-2 inhibition. Because available antibodies were unable to detect either endogenous or ectopically ex- Subcellular Localization of Rab37 in Endothelial Cells pressed Rab37, we transiently transfected human embryonic Rab GTPases are members of the Ras superfamily of low- kidney (HEK) 293T cells with a Rab37 construct containing molecular weight G proteins that function as key regulators of a FLAG epitope tag beginning at N+3 position (WT-Rab37), intracellular trafficking in eukaryotic cells (for reviews, see Pfeffer thereby preserving the endogenous N terminus of Rab37 (Fig- and Aivazian, 2004; Stenmark, 2009). The >60 Rab proteins in ure 2C). In vehicle-treated cells, WT-Rab37 was present at low metazoan cells are localized to specific organelles, where they levels, whereas inhibition of MetAP-2 with TNP-470 led to a large regulate vesicular transport by recruiting effectors such as (>10-fold) increase in Rab37 abundance (Figure 2D). To deter- lipid kinases/phosphatases, motor proteins, and membrane- mine whether TNP-470-induced Rab37 accumulation is directly tethering factors (Grosshans et al., 2006). Rab37 has been

Figure 3. Localization of Rab37 GTPase Cycle Mutants Suggests a Role in Plasma Membrane-to-Golgi Trafﬁcking (A) HUVE cells electroporated with WT- or T2E- Rab37 were cultured on gelatin-coated slides followed by staining with antibodies for FLAG and the Golgi marker Giantin. (B) HEK293T cells transiently transfected with WT-Rab37, Rab37-Q89L, or Rab37-T43N were cultured on poly-L-lysine-coated slides followed by staining with antibodies speciﬁc for FLAG and the Golgi marker Giantin. The scale bars represent 10 mm. See also Figures S1–S3.

was detected more readily than wild- type protein (i.e., photodetector sensitivity was increased for WT-Rab37 relative to T2E-Rab37 to obtain similar intensity staining), and was also localized to a perinuclear compartment closely associated with the Golgi resident protein Giantin (Figure 3A). Thus, unlike abundance, localization of Rab37 to the Golgi is not affected by N-terminal Met retention. To determine whether transient expression of any Rab protein in endothelial cells is sufficient to induce accumulation in the Golgi, HUVE cells were cotransfected with WT-Rab37 and RFP-Rab5, a Rab protein associated with early endosomes (Bucci et al., 1992). Whereas RFP-Rab5 displayed cytosolic, vesicular staining consistent with localization to early endosomes, Rab37 was again detected in perinuclear clusters (see Figure S1 available online). In addition, wild-type Rab37 bearing an N-terminal GFP colocalized with the Golgi resident protein GM130 when expressed in MPE cells (Figure S2), which indicates that Rab37 is localized to the Golgi in endothelial cells derived from different species and anatomical origins. Trafficking of Rab proteins from loading to docking membranes is associated with a transition from GDP to GTP binding reported to associate with secretory granules in mast cells and (Stenmark, 2009). Because the catalytic site of Rab proteins is pancreatic b-cells (Brunner et al., 2007; Masuda et al., 2000), highly conserved, well-characterized mutants can be prepared leading to the assumption that it plays a role in exocytosis in which the GTP (Q89L for Rab37)- or GDP (T43N for Rab37)- (Stenmark, 2009). However, Rab37 was recently identified in a bound state is stabilized (Masuda et al., 2000). Determining the proteomic analysis of the endoplasmic reticulum-Golgi interme- subcellular localization of these GTPase cycle mutants can diate compartment of hepatocarcinoma cells (Breuza et al., provide clues about the intracellular trafficking processes regu- 2004). Given these conflicting results, we sought to define the lated by a particular Rab protein (Stenmark, 2009). Expression subcellular localization of Rab37 in endothelial cells by transiently of Rab37-T43N could not be detected in transiently transfected expressing WT-Rab37 in human umbilical vein endothelial HUVE or MPE cells, preventing analysis of the subcellular distri- (HUVE) cells. In these cells, WT-Rab37 displayed a perinuclear, bution of Rab37 GTPase cycle mutants in endothelial cells. In crescent-shaped distribution suggestive of localization to the HEK293T cells, WT-Rab37 and the GTP-stabilized mutant are Golgi, which is further supported by colocalization with the Golgi primarily detected in a perinuclear compartment that colocalizes marker Giantin (Figure 3A). Transiently expressed T2E-Rab37 with Giantin (Figure 3B), and display little overlap with other

organelles involved in intracellular vesicular trafficking such as arrest in HUVE cells (Figure 4C). Together, the ability of T2E- the endoplasmic reticulum (Figure S3). In contrast, a significant Rab37 to selectively suppress endothelial cell proliferation and portion of Rab37-T43N staining was detected at the plasma to sensitize HUVE cells to TNP-470 supports a model in which membrane in this cell type (Figure 3B). These data indicate that N-terminal Met retention on Rab37 contributes to growth arrest wild-type Rab37 is localized to the Golgi in both endothelial following MetAP-2 inhibition. and nonendothelial cell types, where it is likely to play a role in In vivo, angiogenesis involves migration and intercellular retrograde transport from the plasma membrane. communication between endothelial cells in addition to proliferation (Carmeliet, 2005). Hence, the antiangiogenic effects of Aberrant Rab37 Accumulation Selectively Disrupts MetAP-2 inhibition suggest that aberrant Rab37 accumulation Endothelial Cell Function might also perturb these processes. Organization of endothelial Given that Rab37 levels increase in the presence of TNP-470, it is cells into coordinated tubular networks when cultured on Matri- intriguing that a number of Rab proteins or their effectors have gel basement membrane is a quantitative in vitro proxy of angio- been shown to regulate Wnt PCP signaling (Lee et al., 2007; genesis (Staton et al., 2004). As shown in Figure 4D, HUVE cells Mottola et al., 2010; Pataki et al., 2010; Purvanov et al., 2010). stably expressing GFP formed similar numbers of cell extensions Thus, we hypothesized that aberrant accumulation of Rab37 as a mock-infected control (108 ± 10 versus 89 ± 8 extensions/ following inhibition of MetAP-2 may act via a ‘‘gain-of-function’’ field-of-view, respectively), which indicates that retroviral mechanism to disrupt Wnt PCP signaling and, as a result, endo- infection/puromycin selection does not impair this process. By thelial cell homeostasis. We evaluated this model by comparing contrast, HUVE cells stably expressing WT- or T2E-Rab37 the effects of stably expressing WT- or T2E-Rab37 in HEK293T formed 36 ± 6 or 15 ± 4 extensions/field-of-view, respectively, versus HUVE cells to determine whether accumulation of which corresponds to a 60% or 85% decrease relative to GFP Rab37 ‘‘phenocopies’’ the endothelial cell-selective antiprolifer- control (Figure 4D). Because endothelial cell network formation ative activity of MetAP-2 inhibition. HEK293T and HUVE lines correlates with angiogenic potential (Staton et al., 2004), these stably expressing WT- or T2E-Rab37 or a GFP control were gen- data suggest that aberrant accumulation of Rab37 plays a role erated by infection with retroviral expression constructs fol- in the antiangiogenic effects of MetAP-2 inhibition. lowed by puromycin selection. T2E-Rab37 was observed at z3-fold higher levels than wild-type protein in both HUVE and Activation of Wnt PCP Signaling Suppresses HEK293T cells (Figure 4A). These data are consistent with tran- Rab37-Induced Growth Arrest sient expression in HEK293T cells (Figure 2D), and suggest that Given that expression of T2E-Rab37 phenocopies the inhibitory N-terminal Met retention also promotes aberrant Rab37 accu- effects of fumagillin/TNP-470 on Wnt PCP signaling-dependent mulation in endothelial cells. processes in endothelial cells, we next explored whether Stable expression of WT- or T2E-Rab37 did not significantly Rab37-induced growth arrest could be rescued by constitutive alter the proliferative capacity of HEK293T cells (Figure 4B). activation of this signaling cascade. To address this question, Although HUVE cells stably expressing WT-Rab37 displayed HUVE cells stably expressing a Dvl2 deletion mutant (DDIX- a modest (z15%) decrease in [3H]thymidine incorporation, this Dvl2) or the corresponding empty vector were generated by effect did not achieve statistical significance. In contrast, stable retroviral infection followed by zeocin selection (Figure 4E). Dele- expression of T2E-Rab37 results in an approximately 50% re- tion of the Dishevelled amino-terminal DIX domain results in duction in proliferative capacity (Figure 4B), a change that selective activation of Wnt PCP signaling in an Fz-independent was not associated with increased cell death as measured by manner (Heisenberg et al., 2000; Tada and Smith, 2000; Walling- vital dye exclusion (data not shown). To examine whether the ford and Habas, 2005), and expression of DDIX-Dvl2 rescues growth-inhibitory effect of T2E-Rab37 expression in HUVE cells endothelial cells from TNP-470-induced growth arrest (Zhang results from locating the FLAG epitope tag near the N terminus, et al., 2006). Next, HUVE cells expressing DDIX-Dvl2 or the we prepared untagged wild-type Rab37 and the T2E mutant as corresponding empty vector were infected with retroviruses well as constructs containing a FLAG epitope tag 16 residues encoding GFP or T2E-Rab37 and stable integrants selected proximal to the C terminus, which is not predicted to disrupt with puromycin (Figure 4E). Similar to Figure 4B, expression of the C-terminal prenylation motif (Figure S4A). These constructs T2E-Rab37 reduced [3H]thymidine incorporation by z40% were stably expressed in HUVE cells via retroviral infection/ compared to GFP in HUVE cells first infected with empty vector puromycin selection (Figure S4B). Consistent with N-terminal (Figure 4F). Whereas expression of DDIX-Dvl2 decreased [3H] FLAG epitope-tagged Rab37, expression of wild-type untagged thymidine incorporation by z50% relative to empty vector, or C-terminal tagged Rab37 did not alter the proliferative T2E-Rab37 did not further reduce proliferative capacity of capacity of HUVE cells (Figure S4C). In contrast, [3H]thymidine HUVE cells expressing this construct (Figure 4F). The ability of incorporation was reduced by nearly 50% and 30% in HUVE DDIX-Dvl2 to render HUVE cells resistant to T2E-Rab37-induced cells expressing the untagged or C-terminal tagged T2E- growth arrest suggests that disruption of Wnt PCP signaling Rab37, respectively, relative to GFP control cells (Figure S4C). contributes to the deleterious effects of aberrant Rab37 accumu- Along with reduced basal proliferative capacity, HUVE cells lation on normal endothelial cell function. stably expressing T2E-Rab37 were approximately 3-fold more sensitive to TNP-470-induced growth arrest than control cells Rab37 Knockdown Selectively Suppresses Endothelial expressing GFP, with EC50 values of 60 ± 10 versus 180 ± 20 Cell Proliferation pM, respectively (Figure 4C). In contrast, expression of WT- Normal development requires finely balanced Wnt PCP sig-

Rab37 did not affect the EC50 for TNP-470-induced growth naling; both knockdown and overexpression of Wnt PCP

Figure 4. Aberrant Rab37 Accumulation Disrupts Endothelial Cell Function (A) Whole-cell lysates from HUVE or HEK293T cells stably expressing GFP or WT- or T2E-Rab37 were immunoblotted with speciﬁc antibodies as indicated. (B) Effect of stably expressing GFP or WT- or T2E-Rab37 on [3H]thymidine incorporation in HEK293T cells (black bars) or HUVE cells (white bars). (C) HUVE cells stably expressing GFP (C, solid line), WT-Rab37 (-, dashed line), or T2E-Rab37 (:, dotted line) were treated with the indicated concentrations of TNP-470 for 20 hr followed by labeling with [3H]thymidine (20 mCi/ml; 4 hr) before harvesting of nuclei. (D) Stable retroviral infection with WT- or T2E-Rab37 suppresses network formation in HUVE cells plated on Matrigel relative to cells stably infected with GFP or mock-infected cells. The scale bar represents 100 mm. (E) Whole-cell lysates from HUVE cells stably expressing HA-DDIX-Dvl2 along with GFP or T2E-Rab37 were immunoblotted with speciﬁc antibodies as indicated. (F) Effect of stably expressing GFP (black bars) or T2E-Rab37 (white bars) on [3H]thymidine incorporation in HUVE cells previously infected with HA-DDIX-Dvl2 or the corresponding vector control. All values are mean ± SD of n R 3 independent experiments. See also Figure S4. proteins (e.g., Dishevelled) disrupt this pathway, leading to suppresses Wnt PCP-dependent processes, we next asked abnormal phenotypes (Seifert and Mlodzik, 2007; Wallingford what effect depleting Rab37 has on endothelial cell proliferation. et al., 2000). Given that aberrant accumulation of Rab37 For this experiment, Rab37 expression was stably reduced in

HUVE cells by infection with two separate lentiviral shRNA constructs targeting Rab37 or a nontargeting scramble shRNA construct followed by puromycin selection. Because endogenous Rab37 could not be detected in HUVE cells, we simulta- neously infected a HEK293 clone stably expressing WT-Rab37, which resulted in a >90% decrease in Rab37 protein levels relative to the nontargeting scramble shRNA (Figure 5A). Although near-complete knockdown of Rab37 modestly inhibited proliferation of HEK293 cells measured in terms of [3H]thymidine incorporation (Figure 5B), this trend failed to achieve statistical signiﬁcance. In contrast, stable knockdown of Rab37 in HUVE cells decreased [3H]thymidine incorporation >75% relative to the scramble shRNA control (Figure 5B). Levels of [3H]thymidine incorporation in HUVE cells expressing the shRNA scramble sequence are reproducibly z2-fold higher than those stably infected with GFP (Figure 5C versus Figures 4C and 4E), a decrease likely attributable to differential effects of lenti- versus retroviral infection, respectively. Although growth arrest induced by Rab37 depletion in HUVE cells substantially obscures the antiproliferative effects of MetAP-2 inhibition, [TNP-470] R1nM reduced [3H]thymidine incorporation z2-fold in Rab37 knockdown HUVE cells (Figure 5C). Although these data suggest that N-terminal Met retention on additional MetAP-2 substrates may contribute to growth arrest induced by fumagillin/ TNP-470, the endothelial cell-selective antiproliferative effect of Rab37 knockdown is consistent with this protein playing a previously unappreciated role in Wnt PCP signaling in this cell type.

Effect of Rab37 Expression on Zebrafish Embryogenesis Wnt PCP signaling plays a regulatory role in convergence- extension (CE) movements during vertebrate gastrulation (Seifert and Mlodzik, 2007). For instance, loss-of-function mutations in the wnt5 locus lead to a characteristic truncated, kinked pipetail (ppt) morphology and accompanying vascular defects during zebrafish embryogenesis (Cirone et al., 2008; Rauch et al., 1997). An analogous phenotype is observed in zebrafish embryos, where MetAP-2 function is reduced by TNP-470 or downregulation of metap2 with antisense morpho- lino oligonucleotides (Cirone et al., 2008; Zhang et al., 2006). To determine whether Rab37 expression phenocopies the effects of MetAP-2 inhibition on CE, zebrafish embryos were injected with equivalent amounts of RNA encoding untagged wild-type Rab37 or the MetAP-2-resistant T2E mutant. For T2E-Rab37, the injected embryos displayed a moderately penetrant (z25% of embryos) phenotype characterized by a shortened, kinked Figure 5. Rab37 Is Essential for Endothelial Cell Proliferation tail reminiscent of the morphology resulting from downregula- (A) Infecting HEK293 cells stably expressing WT-Rab37 with lentiviral shRNA tion of wnt5 or metap2 (Figure 6A; Table 1). Careful examination constructs targeting Rab37 reduced levels of this protein relative to a non- of the T2E-Rab37-injected embryos revealed formation of targeting scramble shRNA as detected by immunoblotting with specific anti- C-shaped somites and undulations in the notochord, which bodies as indicated. contrasts with the straight notochord and chevron-shaped (B) Effect of stably expressing lentiviral shRNA constructs targeting Rab37 on 3 somites in control embryos (Figure 6A). Although similar phe- [ H]thymidine incorporation in HEK293 cells (black bars) or HUVE cells (white bars) versus a nontargeting scramble shRNA. notypes were observed in WT-Rab37-injected embryos, (C) HUVE cells stably expressing Rab37-targeting shRNA #1 (6, dotted line) or these effects were both milder and less penetrant (Figure 6A; #2 (,, dashed line) or a nontargeting scramble shRNA (B, solid line) were Table 1). treated with the indicated concentrations of TNP-470 for 20 hr followed by To determine whether molecular evidence of Wnt PCP labeling with [3H]thymidine (20 mCi/ml; 4 hr) and harvesting of nuclei. signaling loss accompanied these morphological changes, we All values are mean ± SD of n R 3 independent experiments. coinjected embryos with RNA encoding membrane-localized mCherry and Centrin-GFP in the presence or absence of

Figure 6. Rab37 Expression Phenocopies Loss of Wnt PCP Signaling during Zebrafish Development (A) Uninjected (control) zebrafish embryos 24 hr postfertilization display a straight notochord characterized by the presence of ‘‘chevron-shaped’’ somites. Injection with wild-type Rab37 RNA results in slight shortening of the anterior-posterior axis, whereas embryos injected with T2E-Rab37 RNA results in notochord undulations and formation of ‘‘C-shaped’’ somites (black arrows) leading to severe shortening and kinking of the anterior- posterior axis. Additionally, embryos injected with T2E-Rab37 RNA display an accumulation of blood posterior to the yolk extension (black chevron), which suggests impaired vasculogenesis. (B) Confocal images of the neural floorplate of zebrafish embryos injected with membrane-localized mCherry and Centrin-GFP in the presence/ absence of T2E-Rab37. Centrin-GFP is localized to the posterior membrane of control-injected embryos (white arrows), whereas overall morpho- genesis and Centrin localization is disrupted in embryos injected with T2E-Rab37 RNA. The scale bar represents 10 mm.

opmental abnormalities in T2E- versus WT-Rab37-injected embryos is consistent with our endothelial cell culture data and suggests that N-terminal Met reten- T2E-Rab37. Centrin-GFP is a viable marker for basal bodies at tion promotes Rab37 accumulation and disruption of Wnt PCP the base of cilia projecting from neural floorplate glia (Piel signaling-dependent processes in a variety of contexts. et al., 2000), and Wnt PCP signaling is implicated in polarized cil- iogenesis in this organ during zebrafish embryogenesis DISCUSSION (Borovina et al., 2010). In control-injected embryos, the cells of the neural floorplate show an ordered, interlaced pattern with Owing to the subtlety of the structural change resulting from many basal bodies docked at the posterior membrane (Fig- N-terminal Met retention, identification of preferential MetAP-2 ure 6B). In contrast, the morphological abnormalities in T2E- substrates has proven challenging using global proteomics tech- Rab37-injected embryos were accompanied by loss of neural niques. Here we employ a positional proteomics strategy to floorplate organization and random localization of Centrin-GFP enrich N-terminal peptides, enabling specific analysis of how (Figure 6B), both effects that are consistent with aberrant MetAP-2 inhibition affects both protein abundance and Rab37 levels acting to compromise Wnt PCP signaling. N-terminal amino acid composition in endothelial cells. Despite We previously demonstrated that perturbation of Wnt PCP this highly sensitive and focused approach, levels of nearly all signaling due to wnt5 loss-of-function alleles or overexpression the detected N-terminal peptides were not altered by TNP-470 of the Wnt PCP effector DAAM1 leads to vascular defects during treatment, which suggests that MetAP-2 specifically processes zebrafish embryogenesis (Cirone et al., 2008; Ju et al., 2010). a very small subset of proteins. A more prominent role for Similarly, embryos injected with T2E-Rab37, but not wild- MetAP-1 in bulk NME is consistent with the dramatic growth- type protein, were characterized by an accumulation of blood inhibitory effect of deleting map1 in yeast, relative to the mild posterior to the yolk extension, which is indicative of defective phenotype observed in Dmap2 strains (Li and Chang, 1995). vasculogenesis (Figure 6A). The increased severity of the devel- However, in this study, TNP-470 treatment led to N-terminal Met retention on Rab37 (N terminus: Met-Thr-Gly N terminus) as well as on the previously identified substrate GAPDH (N Table 1. Quantification of Developmental Defects Caused by terminus: Met-Val-Lys), which is consistent with recent bio- Aberrant Rab37 Expression during Zebrafish Embryogenesis chemical analysis of NME indicating that proteins beginning C-Shaped Undulated with Met-Thr or Met-Val are preferentially processed by RNA Wild-Type-like Somites Notochord Morphant (%) MetAP-2 (Xiao et al., 2010). In accordance with previous studies, Control 77 — 1 1 TNP-470 treatment did not significantly elevate GAPDH levels (Turk et al., 1999; Wang et al., 2008). In contrast, Rab37 abun- WT-Rab37 100 8 5 11 dance is dramatically increased by MetAP-2 inhibition, which T2E-Rab37 95 20 14 26 appears to be a direct consequence of N-terminal Met retention

because the MetAP-2-resistant T2E-Rab37 mutant is detected signaling components (e.g., Fz and Dvl) depends on their locali- at equivalent levels as wild-type protein in the presence of zation to the plasma membrane (Seifert and Mlodzik, 2007). As TNP-470. The differential accumulation of GAPDH versus such, it is tempting to speculate that aberrant accumulation of Rab37 in response to TNP-470 is likely related to the turnover Rab37 might, opposite of the mechanism induced by Rab11- rate of each protein. Whereas the subtle effects of MetAP-2 inhi- QL mutants, sequester Wnt PCP components in the Golgi, bition on GAPDH abundance are consistent with the low rate of thereby disrupting normal signaling. Regardless of the mecha-

GAPDH turnover (t1/2 z38 hr) (Franch et al., 2001), the pro- nism involved, the discovery and functional validation of Rab37 nounced increase in levels of Rab37 bearing an N-terminal Met as a novel MetAP-2-specific substrate provides new insight residue in TNP-470-treated endothelial cells suggests this pro- into fumagillin/TNP-470’s mode of action and identifies a previ- tein is degraded/resynthesized at a significantly faster rate. ously unrecognized regulatory role for this protein in Wnt PCP A recent extension of Varshavsky’s N-End-Rule indicates signaling. that acetylated N-terminal Met, Ala, Ser, Thr, Cys, and Val residues are specifically recognized by the E3 ubiquitin ligase SIGNIFICANCE Doa10 (Teb4 in metazoans), leading to degradation by the ubiquitin-proteasome system (Hwang et al., 2010). Acetylation The microbial metabolite fumagillin and its synthetic deriva- of N-terminal Met residues by the NatB complex requires the tives (e.g., TNP-470) possess promising antiangiogenic and presence of charged or bulky, hydrophobic penultimate resi- antitumor activities derived from exquisite cell type-selec- dues, which also prevent NME (Arnesen et al., 2009). In contrast, tive arrest of endothelial cell proliferation. The metallopro- N-terminal Ala, Ser, Thr, Cys, and Val residues revealed by NME tease methionine aminopeptidase-2 (MetAP-2), one of two are acetylated by the NatA complex (Arnesen et al., 2009). proteins that mediate N-terminal Met excision, is the molec- Perhaps retention of the N-terminal Met residue on Rab37 ular target responsible for fumagillin/TNP-470’s antiangio- following MetAP-2 inhibition prevents acetylation by NatA and, genic activity. Recently, we demonstrated that MetAP-2 in- as a result, Doa10/Teb4-mediated proteasomal degradation. hibition suppresses Wnt planar cell polarity (PCP) signaling Consistent with this model, endothelial cell-specific knockout and that disruption of this pathway impairs endothelial of the NatA component NAA15, which should suppress Rab37 cell function, leading to vascular defects during zebrafish N-terminal acetylation, results in vascular defects in mice (Wall embryogenesis. Despite this advance, the identity of the et al., 2004). MetAP-2 substrate(s) whose function is altered in the pres- Genetic studies in model organisms such as Drosophila have ence of fumagillin/TNP-470 resulting in loss of Wnt PCP identified ‘‘core’’ PCP proteins whose asymmetric cellular local- signaling has remained enigmatic. Here we employed an ization is required for normal formation of polarized tissues N-terminal positional proteomics strategy to screen for across phyla (Seifert and Mlodzik, 2007). Perhaps not surpris- MetAP-2-specific substrates. This unbiased approach iden- ingly given their central role in intracellular trafficking, an tified Rab37 as a protein whose N-terminal Met-retained emerging body of evidence implicates Rab proteins in Wnt form is highly enriched in endothelial cells following MetAP-2 PCP signaling. For example, Rab23 loss-of-function alleles inhibition. Significantly, expression of a Rab37 point mu- induce trichome misorientation in Drosophila wings, and knock- tant that is resistant to MetAP-2 processing phenocopies down of XRab40 in Xenopus embryos disrupts CE movements the inhibitory effects of fumagillin/TNP-470 on Wnt PCP during embryogenesis (Lee et al., 2007; Pataki et al., 2010). signaling-dependent processes such as endothelial cell Moreover, normally functioning Wnt PCP signaling requires proliferation/network formation as well as vascularization precisely coordinated intracellular trafficking, as evidenced by during zebrafish embryogenesis. These findings position the multiple-wing hair phenotype observed in Drosophila ex- aberrant Rab37 accumulation as a critical component of pressing a gain-of-function, GTP-stabilized Rab11-QL mutant, the mechanism underlying the antiangiogenic effects of which disrupts Wnt PCP signaling due to unchecked recycling MetAP-2 inhibition. Perhaps more generally, identification of Fz receptors to the plasma membrane (Purvanov et al., of Rab37 as a regulator of Wnt PCP signaling corresponds 2010). These findings support a model whereby aberrant accu- to an emerging body of evidence implicating Rab proteins mulation of Rab37 following MetAP-2 inhibition disrupts Wnt in the normal organization/function of the Wnt PCP signaling PCP signaling and, as a result, compromises endothelial cell machinery. Therefore, further study of how aberrant Rab37 function. Although expression of T2E-Rab37 selectively sup- accumulation disrupts Wnt PCP signaling should provide presses endothelial cell proliferation, this reduction is less fresh insight into how this signaling network regulates endo- pronounced than the effects on endothelial cell network forma- thelial cell function. tion and zebrafish embryogenesis. This difference may imply that N-terminal Met retention on additional MetAP-2 substrates EXPERIMENTAL PROCEDURES contributes to the antiproliferative activity of fumagillin/TNP- 470. Alternatively, the inhibitory effects of T2E-Rab37 expression Cell Culture on Wnt PCP signaling may be more profound in assays that Tissue-culture reagents, including fetal bovine serum (FBS), were obtained better recapitulate the complex, multicellular processes under- from Invitrogen. Primary HUVE cells were obtained from the Yale University Vascular Biology and Therapeutics Program and maintained in EGM-2-MV lying angiogenesis in vivo. media (Lonza). HEK293T cells obtained from the American Type Culture The subcellular distribution of the Rab37 GTPase cycle Collection and gp293 retroviral packing cells (BD Biosciences) were cultured mutants suggests a role for this protein in plasma membrane- in Dulbecco’s modified Eagle’s medium supplemented with 10% FBS (vol/vol) to-Golgi trafficking. Normal function of many core Wnt PCP and penicillin (100 mg/ml)/streptomycin (100 U/ml). Cells were transfected using

Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Addgene) using Lipofectamine 2000 (Invitrogen). HUVE cells were electropo- For stable expression of WT-Rab37, pCDNA5/FRT/WT-Rab37 was cotrans- rated with the same constructs using the BTX electroporation kit and an fected in a 1:9 ratio with pOG4 (FRT plasmid) into 293 FlpIn cells (Invitrogen) fol- ECM 830 electroporator machine (settings: 160 V, 20 ms pulse) and then lowed by selection of stable clones with hygromycin B (100 mg/ml). For retroviral seeded on 0.8% gelatin-coated coverslips. Immunofluorescence staining infections, pBABE.puro/WT- or T2E-Rab37 or pBABE.ble/HA-DDIX-Dvl2 were and confocal microscopy were conducted as described previously (Cirone cotransfected in a 1:1 ratio with pMD2.G (12259; Addgene) into gp293 retroviral et al., 2008). The antibody detecting Giantin (ab24586) was obtained from packaging cells. For stable knockdown of Rab37, HEK293T cells were cotrans- Abcam, the antibody against protein disulfide isomerase (2446) was from fected in a 1:3:3 ratio with pMD2.G and psPAX2 (12260; Addgene) along with Cell Signaling, and the antibody targeting GM130 (610822) was obtained pLKO shRNA vectors targeting Rab37 (RHS4552-NM_001006638; Open Bio- from BD Biosciences. systems) or a nontargeting scramble shRNA (1864; Addgene). After 48 hr, viral supernatants were harvested, passed through a 0.45 mm filter, and added [3H]Thymidine Incorporation directly to the growth media of target cells that had been supplemented with HEK293T or HUVE cells were seeded onto 96-well plates in growth media at polybrene (8 mg/ml). After an additional 48 hr, stable integrants were selected a density of 3 3 103 cells/well followed by TNP-470 treatments and assess- with puromycin (0.5 mg/ml) or zeocin (100 mg/ml). Organic compounds were ment of [3H]thymidine incorporation as described previously (Hines et al., dissolved in cell-culture growth media containing %0.5% DMSO. 2010).

PCR and Plasmid Construction Endothelial Cell Network Formation pCMV-Sport6/hRab37 (BC016615) was purchased from Open Biosystems. Network formation assays were performed on Matrigel (BD Biosciences) Wild-type and T2E-Rab37 bearing a FLAG epitope tag at the N+3 position basement membranes as described previously (Cirone et al., 2008). were generated by PCR amplification using the primer sets (FP: 50-ATATGCG GATCCGCCACCATGACGGGCGATACAAGGATGACGACGATAAGACGCCA Zebrafish Manipulation 0 0 GGCGCCGTTGCC-3 and RP: 5 -ATGCTATCTAGATCACATGAAGGAGCAG Danio rerio 0 0 Zebrafish ( ) embryos were collected from natural spawning. cDNA CAGCT-3 ) or (FP: 5 -ATATGCGGATCCGCCACCATGGAAGGCGATTACAAG encoding WT-Rab37, T2E-Rab37, membrane-localized mCherry, or Centrin- GATGACGACGATAAGACGCCAGGCGCCGTTGCC-30 and RP: 50-ATGCTAT 0 GFP cloned into the pCS2+ expression vector was linearized, and synthetic CTAGATCACATGAAGGAGCAGCAGCT-3 ), respectively, and cloned into the RNAs were produced with the mMessage mMachine Capped RNA transcrip- BamHI/XbaI sites of the pCS2+ vector. Alternatively, WT- and T2E-Rab37 0 tion kit (Ambion) using SP6 RNA polymerase. Zebrafish embryos were injected were amplified by PCR using the primer sets (FP: 5 -ATATGCTACGTAGCC at the one-cell stage into the yolk with 4–6 nl of 200 ng/ml of each RNA as ACCATGACGGGCGATTACAAGGATGACGACGATAAGACGCCAGGCGCCG described previously (Cirone et al., 2008). Live embryos were photographed TTGCC-30 and RP: 50-ATGCTAGTCGACTCACATGAAGGAGCAGCAGCT-30) 0 after orienting on 3% methylcellulose. A Zeiss Stereo Discovery.V12 micro- or (FP: 5 -ATATGCTACGTAGCCACCATGGAAGGCGATTACAAGGATGACGA scope equipped with an AxioVision camera and software was used to acquire CGATAAGACGCCAGGCGCCGTTGCC-30 and RP: 50-ATGCTAGTCGACTCA 0 images. For neural tube morphology, live embryos at 28–30 hr postfertilization CATGAAGGAGCAGCAGCT-3 ), respectively, and cloned into the SnaBI/SalI were oriented in low-melt agarose and analyzed using a Leica SP2 laser sites of the pBABE.puro retroviral vector. pCDNA5/FRT/WT-Rab37 was gen- 3 3 0 confocal microscope system with 63 magnification and 2 zoom. Images erated by PCR amplifying wild-type Rab37 using the primer set (FP: 5 -ATA are representative of maximum projections of six focal planes (Z series). TGCGGATCCGCCACCATGACGGGCGATTACAAGGATGACGACGATAAGA CGCCAGGCGCCGTTGCC-30 and RP: 50-ATGCTAGGGCCCTCACATGAAGG Statistical Analysis AGCAGCAGCT-30) and cloned between the BamH1/Aga1 sites of pCDNA5/ Data analysis was conducted using Prism v4.0b software (GraphPad Soft- FRT (Invitrogen). The Rab37-Q89L and -T43N mutants were generated using ware). Student’s t test and one- or two-way ANOVA analysis were conducted the Stratagene QuikChange Site-Directed Mutagenesis Kit (Agilent Technolo- as appropriate. gies) from pCS2+/WT-Rab37 using the primer sets (FP: 50-ACACCGC TGGGCTGGAACGGTTCCG-30 and RP: 50-CGGAACCGTTCCAGCCCAGCG GTGT-30) or (FP: 50-GAGACACAGGCGTCGGCAAAAATTGTTTCCTGATCCA SUPPLEMENTAL INFORMATION ATT-30 and RP: 50-AATTGGATCAGGAAACAATTTTTGCCGACGCCTGTGT CTC-30), respectively. The pBABE.ble/HA-DDIX-Dvl2 vector was constructed Supplemental Information includes four figures and can be found with this as described previously (Zhang et al., 2006). Membrane-localized mCherry article online at doi:10.1016/j.chembiol.2011.07.020. and Centrin-GFP cloned into pCS2+ were obtained from S. Holley (Yale University). ACKNOWLEDGMENTS

N-Terminal Positional Proteomics Screen The authors acknowledge Dr. Taavi Neklesa and Dr. John Hines for helpful MPE cells were cultured in D-MEM-Flex media (Invitrogen) supplemented with discussions and critical review of the manuscript. This work was supported 13 12 (heavy) [ C6]Arg or (light) [ C6]Arg (100 mg/ml) for seven passages and then by National Institutes of Health grants CA083048 (to C.M.C.) and CA112369 treated with TNP-470 (50 nM, 16 hr) or DMSO, respectively. Cells were resus- (to D.C.S.) and a Biotechnology and Biological Sciences Research Council pended in isotonic lysis buffer (25 mM Tris [pH 7.4]) and lysed by passage grant (BB/F004699/1) (to R.J.B.). P.C. is a recipient of a Leukemia and through a Dounce homogenizer. Cell debris was removed by low-speed Lymphoma Society Fellowship, and T.B.S. is supported by an American centrifugation (2,000 rpm, 5 min, 4C) followed by isolation of soluble fractions Cancer Society Postdoctoral Fellowship. The authors declare no conflict of (S100) by high-speed centrifugation (42,000 rpm, 45 min, 4C). N-terminal interest. peptides were enriched from S100 fractions and analyzed by LC-MS/MS as described previously (McDonald et al., 2005). Received: February 28, 2011 Revised: July 18, 2011 Immunoblotting Accepted: July 28, 2011 Preparation of whole-cell lysates and immunoblotting was conducted as Published: October 27, 2011 described previously (Hines et al., 2010). Antibodies detecting the FLAG epitope tag (F1804) and b-actin (A2228) were obtained from Sigma-Aldrich, whereas REFERENCES the antibody for the HA epitope tag (3724) was purchased from Cell Signaling. Angers, S., and Moon, R.T. (2009). Proximal events in Wnt signal transduction. Immunofluorescence Nat. Rev. Mol. Cell Biol. 10, 468–477. Briefly, HEK293T cells cultured on poly-L-lysine (100 mg/ml)-coated glass Arico-Muendel, C.C., Benjamin, D.R., Caiazzo, T.M., Centrella, P.A., Contonio, coverslips were transfected with Rab37 constructs or RFP-Rab5 (14437; B.D., Cook, C.M., Doyle, E.G., Hannig, G., Labenski, M.T., Searle, L.L., et al.

(2009). Carbamate analogues of fumagillin as potent, targeted inhibitors of Li, X., and Chang, Y.H. (1995). Amino-terminal protein processing in methionine aminopeptidase-2. J. Med. Chem. 52, 8047–8056. Saccharomyces cerevisiae is an essential function that requires two distinct 92 Arnesen, T., Van Damme, P., Polevoda, B., Helsens, K., Evjenth, R., Colaert, methionine aminopeptidases. Proc. Natl. Acad. Sci. USA , 12357–12361. N., Varhaug, J.E., Vandekerckhove, J., Lillehaug, J.R., Sherman, F., and Marino, J.P., Jr., Fisher, P.W., Hofmann, G.A., Kirkpatrick, R.B., Janson, C.A., Gevaert, K. (2009). Proteomics analyses reveal the evolutionary conservation Johnson, R.K., Ma, C., Mattern, M., Meek, T.D., Ryan, M.D., et al. (2007). and divergence of N-terminal acetyltransferases from yeast and humans. Highly potent inhibitors of methionine aminopeptidase-2 based on a 1,2,4- Proc. Natl. Acad. Sci. USA 106, 8157–8162. triazole pharmacophore. J. Med. Chem. 50, 3777–3785. Borovina, A., Superina, S., Voskas, D., and Ciruna, B. (2010). Vangl2 directs Masckaucha´ n, T.N., Agalliu, D., Vorontchikhina, M., Ahn, A., Parmalee, N.L., the posterior tilting and asymmetric localization of motile primary cilia. Nat. Li, C.M., Khoo, A., Tycko, B., Brown, A.M., and Kitajewski, J. (2006). Wnt5a Cell Biol. 12, 407–412. signaling induces proliferation and survival of endothelial cells in vitro and 17 Breuza, L., Halbeisen, R., Jeno¨ , P., Otte, S., Barlowe, C., Hong, W., and Hauri, expression of MMP-1 and Tie-2. Mol. Biol. Cell , 5163–5172. H.P. (2004). Proteomics of endoplasmic reticulum-Golgi intermediate Masuda, E.S., Luo, Y., Young, C., Shen, M., Rossi, A.B., Huang, B.C., Yu, S., compartment (ERGIC) membranes from brefeldin A-treated HepG2 cells iden- Bennett, M.K., Payan, D.G., and Scheller, R.H. (2000). Rab37 is a novel mast tifies ERGIC-32, a new cycling protein that interacts with human Erv46. J. Biol. cell specific GTPase localized to secretory granules. FEBS Lett. 470, 61–64. 279 Chem. , 47242–47253. McDonald, L., Robertson, D.H., Hurst, J.L., and Beynon, R.J. (2005). Positional Brunner, Y., Coute´ , Y., Iezzi, M., Foti, M., Fukuda, M., Hochstrasser, D.F., proteomics: selective recovery and analysis of N-terminal proteolytic Wollheim, C.B., and Sanchez, J.C. (2007). Proteomics analysis of insulin peptides. Nat. Methods 2, 955–957. 6 secretory granules. Mol. Cell. Proteomics , 1007–1017. Mottola, G., Classen, A.K., Gonza´ lez-Gaita´ n, M., Eaton, S., and Zerial, M. Bucci, C., Parton, R.G., Mather, I.H., Stunnenberg, H., Simons, K., Hoflack, B., (2010). A novel function for the Rab5 effector Rabenosyn-5 in planar cell and Zerial, M. (1992). The small GTPase rab5 functions as a regulatory factor in polarity. Development 137, 2353–2364. 70 the early endocytic pathway. Cell , 715–728. Pataki, C., Matusek, T., Kurucz, E., Ando´ , I., Jenny, A., and Miha´ ly, J. (2010). Carmeliet, P. (2005). Angiogenesis in life, disease and medicine. Nature 438, Drosophila Rab23 is involved in the regulation of the number and planar polar- 932–936. ization of the adult cuticular hairs. Genetics 184, 1051–1065. Cheng, C.W., Yeh, J.C., Fan, T.P., Smith, S.K., and Charnock-Jones, D.S. Pfeffer, S., and Aivazian, D. (2004). Targeting Rab GTPases to distinct (2008). Wnt5a-mediated non-canonical Wnt signalling regulates human endo- membrane compartments. Nat. Rev. Mol. Cell Biol. 5, 886–896. 365 thelial cell proliferation and migration. Biochem. Biophys. Res. Commun. , Piel, M., Meyer, P., Khodjakov, A., Rieder, C.L., and Bornens, M. (2000). The 285–290. respective contributions of the mother and daughter centrioles to centrosome Cirone, P., Lin, S., Griesbach, H.L., Zhang, Y., Slusarski, D.C., and Crews, activity and behavior in vertebrate cells. J. Cell Biol. 149, 317–330. C.M. (2008). A role for planar cell polarity signaling in angiogenesis. Purvanov, V., Koval, A., and Katanaev, V.L. (2010). A direct and functional 11 Angiogenesis , 347–360. interaction between Go and Rab5 during G protein-coupled receptor Folkman, J. (2007). Angiogenesis: an organizing principle for drug discovery? signaling. Sci. Signal. 3, ra65. 6 Nat. Rev. Drug Discov. , 273–286. Rauch, G.J., Hammerschmidt, M., Blader, P., Schauerte, H.E., Stra¨ hle, U., Franch, H.A., Sooparb, S., Du, J., and Brown, N.S. (2001). A mechanism regu- Ingham, P.W., McMahon, A.P., and Haffter, P. (1997). Wnt5 is required for lating proteolysis of specific proteins during renal tubular cell growth. J. Biol. tail formation in the zebrafish embryo. Cold Spring Harb. Symp. Quant. Biol. Chem. 276, 19126–19131. 62, 227–234. Griffith, E.C., Su, Z., Turk, B.E., Chen, S., Chang, Y.H., Wu, Z., Biemann, K., Seifert, J.R., and Mlodzik, M. (2007). Frizzled/PCP signalling: a conserved and Liu, J.O. (1997). Methionine aminopeptidase (type 2) is the common target mechanism regulating cell polarity and directed motility. Nat. Rev. Genet. 8, for angiogenesis inhibitors AGM-1470 and ovalicin. Chem. Biol. 4, 461–471. 126–138. Grosshans, B.L., Ortiz, D., and Novick, P. (2006). Rabs and their effectors: Sin, N., Meng, L., Wang, M.Q., Wen, J.J., Bornmann, W.G., and Crews, C.M. achieving specificity in membrane traffic. Proc. Natl. Acad. Sci. USA 103, (1997). The anti-angiogenic agent fumagillin covalently binds and inhibits the 11821–11827. methionine aminopeptidase, MetAP-2. Proc. Natl. Acad. Sci. USA 94, 6099– Heisenberg, C.P., Tada, M., Rauch, G.J., Sau´ de, L., Concha, M.L., Geisler, R., 6103. Stemple, D.L., Smith, J.C., and Wilson, S.W. (2000). Silberblick/Wnt11 medi- Staton, C.A., Stribbling, S.M., Tazzyman, S., Hughes, R., Brown, N.J., and ates convergent extension movements during zebrafish gastrulation. Nature Lewis, C.E. (2004). Current methods for assaying angiogenesis in vitro and 405, 76–81. in vivo. Int. J. Exp. Pathol. 85, 233–248. Hines, J., Ju, R., Dutschman, G.E., Cheng, Y.C., and Crews, C.M. (2010). Stenmark, H. (2009). Rab GTPases as coordinators of vesicle traffic. Nat. Rev. Reversal of TNP-470-induced endothelial cell growth arrest by guanine and Mol. Cell Biol. 10, 513–525. 334 guanine nucleosides. J. Pharmacol. Exp. Ther. , 729–738. Tada, M., and Smith, J.C. (2000). Xwnt11 is a target of Xenopus Brachyury: Hwang, C.S., Shemorry, A., and Varshavsky, A. (2010). N-terminal acetylation regulation of gastrulation movements via Dishevelled, but not through the of cellular proteins creates specific degradation signals. Science 327, canonical Wnt pathway. Development 127, 2227–2238. 973–977. Turk, B.E., Griffith, E.C., Wolf, S., Biemann, K., Chang, Y.H., and Liu, J.O. Ingber, D., Fujita, T., Kishimoto, S., Sudo, K., Kanamaru, T., Brem, H., and (1999). Selective inhibition of amino-terminal methionine processing by Folkman, J. (1990). Synthetic analogues of fumagillin that inhibit angiogenesis TNP-470 and ovalicin in endothelial cells. Chem. Biol. 6, 823–833. 348 and suppress tumour growth. Nature , 555–557. Wall, D.S., Gendron, R.L., Good, W.V., Miskiewicz, E., Woodland, M., Leblanc, Ju, R., Cirone, P., Lin, S., Griesbach, H., Slusarski, D.C., and Crews, C.M. K., and Paradis, H. (2004). Conditional knockdown of tubedown-1 in endothe- (2010). Activation of the planar cell polarity formin DAAM1 leads to inhibition lial cells leads to neovascular retinopathy. Invest. Ophthalmol. Vis. Sci. 45, of endothelial cell proliferation, migration, and angiogenesis. Proc. Natl. 3704–3712. 107 Acad. Sci. USA , 6906–6911. Wallingford, J.B., and Habas, R. (2005). The developmental biology of Kruger, E.A., and Figg, W.D. (2000). TNP-470: an angiogenesis inhibitor in clin- Dishevelled: an enigmatic protein governing cell fate and cell polarity. ical development for cancer. Expert Opin. Investig. Drugs 9, 1383–1396. Development 132, 4421–4436. Lee, R.H., Iioka, H., Ohashi, M., Iemura, S., Natsume, T., and Kinoshita, N. Wallingford, J.B., Rowning, B.A., Vogeli, K.M., Rothba¨ cher, U., Fraser, S.E., (2007). XRab40 and XCullin5 form a ubiquitin ligase complex essential for and Harland, R.M. (2000). Dishevelled controls cell polarity during Xenopus the noncanonical Wnt pathway. EMBO J. 26, 3592–3606. gastrulation. Nature 405, 81–85.

Wang, G.T., Mantei, R.A., Kawai, M., Tedrow, J.S., Barnes, D.M., Wang, J., pharmacodynamic markers of methionine aminopeptidase-2 inhibition. Zhang, Q., Lou, P., Garcia, L.A., Bouska, J., et al. (2007). Lead optimization J. Proteome Res. 7, 4807–4820. of methionine aminopeptidase-2 (MetAP2) inhibitors containing sulfonamides Xiao, Q., Zhang, F., Nacev, B.A., Liu, J.O., and Pei, D. (2010). Protein of 5,6-disubstituted anthranilic acids. Bioorg. Med. Chem. Lett. 17, 2817– N-terminal processing: substrate speciﬁcity of Escherichia coli and human 2822. methionine aminopeptidases. Biochemistry 49, 5588–5599. Wang, J., Tucker, L.A., Stavropoulos, J., Zhang, Q., Wang, Y.C., Bukofzer, G., Yeh, J.R., Ju, R., Brdlik, C.M., Zhang, W., Zhang, Y., Matyskiela, M.E., Niquette, A., Meulbroek, J.A., Barnes, D.M., Shen, J., et al. (2008). Correlation Shotwell, J.D., and Crews, C.M. (2006). Targeted gene disruption of methio- of tumor growth suppression and methionine aminopetidase-2 activity nine aminopeptidase 2 results in an embryonic gastrulation defect and endo- 105 blockade using an orally active inhibitor. Proc. Natl. Acad. Sci. USA , thelial cell growth arrest. Proc. Natl. Acad. Sci. USA 103, 10379–10384. 1838–1843. Zhang, Y., Yeh, J.R., Mara, A., Ju, R., Hines, J.F., Cirone, P., Griesbach, H.L., Warder, S.E., Tucker, L.A., McLoughlin, S.M., Strelitzer, T.J., Meuth, J.L., Schneider, I., Slusarski, D.C., Holley, S.A., and Crews, C.M. (2006). A chemical Zhang, Q., Sheppard, G.S., Richardson, P.L., Lesniewski, R., Davidsen, and genetic approach to the mode of action of fumagillin. Chem. Biol. 13, S.K., et al. (2008). Discovery, identiﬁcation, and characterization of candidate 1001–1009.