The Human FSGS-Causing ANLN R431C Mutation Induces Dysregulated PI3K/AKT/Mtor/Rac1 Signaling in Podocytes

BASIC RESEARCH www.jasn.org

The Human FSGS-Causing ANLN R431C Mutation Induces Dysregulated PI3K/AKT/mTOR/Rac1 Signaling in Podocytes

Gentzon Hall,1,2,3 Brandon M. Lane,1,2 Kamal Khan ,4 Igor Pediaditakis,4 Jianqiu Xiao,4 Guanghong Wu,1,3 Liming Wang,3 Maria E. Kovalik,1,2,3 Megan Chryst-Stangl,1,2 Erica E. Davis,1,4 Robert F. Spurney,3 and Rasheed A. Gbadegesin 1,2,3

Departments of 1Pediatrics and 3Medicine, Duke University School of Medicine, Durham, North Carolina; 2Duke Molecular Physiology Institute, Durham, North Carolina; and 4Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina

ABSTRACT Background We previously reported that mutations in the anillin (ANLN) gene cause familial forms of FSGS. ANLN is an F-actin binding protein that modulates podocyte cell motility and interacts with the phosphoinositide 3-kinase (PI3K) pathway through the slit diaphragm adaptor protein CD2-associated protein (CD2AP). However, it is unclear how the ANLN mutations cause the FSGS phenotype. We hypoth- esized that the R431C mutation exerts its pathogenic effects by uncoupling ANLN from CD2AP. Methods We conducted in vivo complementation assays in zebrafish to determine the effect of the previously identified missense ANLN variants, ANLNR431C and ANLNG618C during development. We also performed in vitro functional assays using human podocyte cell lines stably expressing wild-type ANLN (ANLNWT)orANLNR431C. Results Experiments in anln-deficient zebrafish embryos showed a loss-of-function effect for each ANLN variant. In human podocyte lines, expression of ANLNR431C increased cell migration, proliferation, and apoptosis. Biochemical characterization of ANLNR431C-expressing podocytes revealed hyperactivation of the PI3K/AKT/mTOR/p70S6K/Rac1 signaling axis and activation of mTOR-driven endoplasmic reticulum stress in ANLNR431C-expressing podocytes. Inhibition of mTOR, GSK-3b, Rac1, or calcineurin ameliorated the effects of ANLNR431C. Additionally, inhibition of the calcineurin/NFAT pathway reduced the expression of endogenous ANLN and mTOR.

Conclusions The ANLNR431C mutation causes multiple derangements in podocyte function through hyperactivation of PI3K/AKT/mTOR/p70S6K/Rac1 signaling. Our findings suggest that the benefits of calcineurin inhibition in FSGS may be due, in part, to the suppression of ANLN and mTOR. Moreover, these studies illustrate that rational therapeutic targets for familial FSGS can be identified through biochemical characterization of dysregulated podocyte phenotypes.

J Am Soc Nephrol 29: 2110–2122, 2018. doi: https://doi.org/10.1681/ASN.2017121338

Received December 29, 2017. Accepted May 31, 2018.

FSGS is the most common primary glomerular G.H. and B.M.L. contributed equally to this work. 1 disorder causing ESKD in the United States. De- Published online ahead of print. Publication date available at spite current therapies, approximately 50% of pa- www.jasn.org. tients with nephrotic FSGS develop ESKD within Correspondence: Dr. Rasheed A. Gbadegesin, Department of 2 10 years of initial diagnosis. It is, therefore, critical Pediatrics, Duke University Medical Center, Duke University, T- to improve our understanding of the pathobiology Level RM0909 CHC, BOX 3959, Durham, NC 27710. Email: of the disease to devise more effective treatment [email protected] strategies. Copyright © 2018 by the American Society of Nephrology

2110 ISSN : 1046-6673/2908-2110 JAmSocNephrol29: 2110–2122, 2018 www.jasn.org BASIC RESEARCH

Studies of familial forms of FSGS suggest that disease results Significance Statement from injury or loss of glomerular epithelial cells (i.e.,podocytes).3 Podocytes are terminally differentiated cells that The authors previously reported that mutations in ANLN can cause maintain the structural integrity of the glomerular filtration familial FSGS. Anillin is an F-actin binding protein that modulates barrier. This function is highly dependent on the dynamic cell motility and signaling through the phosphoinositide 3-kinase (PI3K) pathway. This study examines its signaling through the PI3K regulation of the podocyte actin cytoskeleton. The phosphoi- pathway in podocytes to understand its role in the pathobiology nositide 3-kinase (PI3K)/AKTsignaling pathway is an essen- of FSGS. Mutant anillin induced hypermotility and apoptosis, tial regulator of podocyte actin cytoskeletal dynamics that has enhanced cellular proliferation, and activated PI3K/AKT/mTOR/ been shown to participate in slit diaphragm signaling through Rac1 signaling. Aberrant podocyte phenotypes induced by the interactions with proteins, such as CD2-associated protein mutation were ameliorated by inhibition of downstream effectors of PI3K and calcineurin phosphatase, and calcineurin inhibition 4 (CD2AP),nephrin,andpodocin. Pathogenic mutations in ameliorates ANLNR431C-induced podocyte apoptosis and down- CD2AP cause FSGS through mechanisms that involve the dis- regulates endogenous mTOR and ANLN expression. Drugs tar- ruption of PI3K/AKT signaling, highlighting the importance geting these pathways may be useful in the treatment of some of this pathway in the pathobiology of podocyte dysfunction forms of FSGS. in FSGS.5 fi We previously identi ed disease-causing muta- suppression experiment as described in Supplemental Mate- . . tions (c.1852G T: p.Gly618Cys[G618C] and c.1291C T: rial. We validated the transient suppression experiment using p.Arg431Cys[R431C]) in familial FSGS, the latter of which is CRISPR/Cas9 genome editing of the anln locus in zebrafish in the F-actin binding domain of anillin (ANLN). ANLNR431C (Supplemental Material). induced hypermotility in podocytes and disrupted the critical interaction between ANLN and CD2AP. To gain a better Conditionally Immortalized Human Podocyte Culture understanding of the role of ANLNR431C and ANLNG618C in Conditionally immortalized human podocytes were cultured the development of FSGS, we examined the effects of this and harvested as described.6 mutation in vivo through mRNA rescue experiments in anln- fi fi de cient zebra sh embryos and established that both Lentiviral Constructs and Infection mutations cause a loss of function during development. In Standard molecular cloning methods were used for stable complimentary in vitro studies, we showed that ANLNR431C transfection of all cell lines (Supplemental Material).7 overexpression hyperactivates AKT, mTOR, p70S6 Kinase, and Rac1 signaling in podocytes and that pharmacologic in- Immunofluorescence hibition of mTOR and Rac1 attenuates ANLNR431C-induced Conditionally immortalized human podocytes were differen- hypermotility and hyperproliferation. Additionally, we tiated and stained using standard protocols (Supplemental showed that ANLNR431C-induced hyperactivation of mTOR Material). induces endoplasmic reticulum (ER) stress and podocyte apoptosis and that this effect was attenuated by pharmaco- Rac1 and RhoA Activity Assay logic inhibition of mTOR, glycogen synthase kinase 3b GTP-bound Rac1 and RhoA were analyzed using PAK and (GSK-3b), and calcineurin phosphatase (Cn). Finally, we Rhotekin-Rho binding domain bead assays (Supplemental determined that endogenous ANLN and mTOR protein Material). expressions are downregulated by the Cn/NFAT pathway. Together, these findings suggest that ANLNR431C disrupts Targeted Inhibition podocyte cytoskeletal dynamics and promotes podocyte ap- For inhibition experiments, stock inhibitors were made in optosis through dysregulation of the PI3K/AKT/mTOR/ DMSO, and dilution was carried out as described in Supple- p70S6/Rac1 pathway. Furthermore, we identify the Cn/ mental Material. NFAT signaling pathway as a regulator of endogenous mTOR and ANLN expression and provide novel mechanistic Migration Assay insights into the beneficial clinical effects of Cn inhibitors in Scratch wound assays were used as described in Supplemental some forms of FSGS. Material.

Proliferation Assay METHODS A cell counting colorimetric assay was used for the cell proliferation studies as described in Supplemental Material. Transient Suppression of anln and In Vivo Complementation Assays in Zebraﬁsh Apoptosis Assay We designed a splice blocking morpholino (MO) targeting Serum starvation method was used to induce apoptosis in the donor site of exon 5 of the anln ortholog in zebraﬁsh experimental podocyte lines as described in Supplemental (Supplemental Figure 1A) and performed a transient Material.

J Am Soc Nephrol 29: 2110–2122, 2018 ANLN R431C, mTOR, and Rac1 in FSGS 2111 BASIC RESEARCH www.jasn.org

In Silico Modeling embryos (3, 6, and 9 ng); we observed disruption of mRNA The ANLNR431C variant wasassessedforitseffectsonthe splicing in anln e5i5 morphants (Supplemental Figure 1, B and secondary structure of the protein. The in silico prediction C). Furthermore, we observed a dose-dependent response of program I-TASSER (http://zhanglab.ccmb.med.umich.edu/ e5i5 MO; larval batches scored live at 4 days postfertilization I-TASSER/) was used to generate the ANLNWTand ANLNR431C displayed ocular and pericardial edema (P,0.001 versus con- images.8 trols; n=63–81 per batch, repeated) (Supplemental Figure 1D). Next, we coinjected 3 ng MO with 150 pg of human Actin Bundling/Polymerization Assay ANLNWT mRNA and scored larval batches for edema pheno- HEK 293T cellsweregrown in DMEM + 5% FBSin T75flasksat types in three phenotypic classes. Whereas 92% of e5i5 mor- 37°C until 85% confluency and transfected using Lipofecta- phant larvae displayed edema phenotypes, an equivalent dose mine 2000 with plasmids containing CMV-turbo GFP (tGFP), of MO with ANLNWT mRNA improved phenotypes signifi- CMV-ANLNWT-tGFP, or CMV-hANLNR431C-tGFP; 65 ml cantly (P,0.001 versus MO; n=42–56 per injection batch, of Lipofectamine 2000 (Thermo-Fisher) was combined with repeated) (Figure 1, A and B). 1.7 ml of Opti-MEM (Gibco) and allowed to incubate at room To complement our transient suppression reagents,7 we temperature for 5 minutes before combining with 1.7 ml of introduced small insertions and deletions into the Danio rerio Opti-MEM containing 26 mg of plasmid DNA. After 20 min- anln locus using CRISPR/Cas9 genome editing. We designed a utes of incubation, the mixture was added to 15 ml of DMEM single-guide RNA (sgRNA) targeting exon 8 (Supplemental with 5% FBS. Cells were analyzed using fluorescence micros- Figure 1A) and injected 100 pg sgRNA with 200 pg Cas9 pro- copy between 40 and 48 hours to ensure adequate transfection tein into WT zebrafish embryos. Heteroduplex analysis levels, and then, they were harvested at 48 hours and lysed showed high mosaicism in F0 mutants (100% of clones had using a syringe in 400 ml of 20 mM HEPES and 20 mM NaCl insertions and deletions; n=5 embryos) (Supplemental Figure buffer. Supernatant was collected after spinning for 3 minutes 1, E and F). Importantly, anln F0 mutants recapitulated mor- at 14,0003g at 4°C and analyzed using immunoblotting to phant phenotypes at 4 days postfertilization, and 59% of lar- ensure equivalent levels of exogenous ANLN expression be- vae displayed edema (P,0.001; n=41–75 per batch, repeated) tween samples. Bundling reactions including appropriate pos- (Figure 1, B and C); larvae injected with sgRNA alone were itive and negative controls were performed using the Actin indistinguishable from controls (Figure 1C). Binding Protein Biochem Kit (Cytoskeleton Inc.) per the Next, we used in vivo complementation studies to test the ’ m 8 manufacturer s instruction. Next, 30 l of experimental lysate direction of allele effect of ANLNR431C and ANLNG618C. We was combined with 50 mlofpurified human nonmuscle have used renal function readouts previously to both inform F-actin stock or an F-actin buffer and incubated for 30 min- variant pathogenicity and indicate whether deleterious effects utes at room temperature. After spinning at 14,0003g for are likely to be loss of function, dominant negative, or gain of 6,9 1 hour, the supernatant was collected, and the F-actin pellet function. We compared the ANLNWT rescue efficiency with was mixed with 30 ml of water and 30 mlof23 Laemmli re- that of either FSGS-associated variant or a likely benign vari- ducing sample buffer and analyzed using immunoblotting ant, ANLNR185K. We observed that ANLNR185K improved the with an F-actin mouse mAb (1:500; Novus Biologicals). anln e5i5 MO-induced pathology (P,0.001 versus MO; n=42–56, repeated); both mutant mRNAs rescued at efficien- Statistical Analyses cies significantly worse than ANLNWT (P,0.001), ANLNR431C fi Zebra sh larval batches were compared using chi-squared was not significantly different from MO, and ANLNR618C was tests. All in vitro data are represented as the mean6SEM. modestly improved in comparison with MO alone (Figure 1, Group differences were assessed by the t test with unequal A and B). Heterologous expression of human ANLN mRNAs variances. One-way ANOVA with a Tukey HSD post hoc test in embryo batches produced no phenotypes that differed from was used to determine the differences between means where uninjected controls (n=53–75, repeated) (Supplemental Fig- there are three or more groups. Statistical significance was ure 2), arguing against any dominant negative or toxic effects. established at P,0.05. Together, our in vivo data reinforce the involvement of anln in podocyte integrity and indicate that ANLNR431C and ANLN618C confer a loss-of-function effect. RESULTS Overexpression of ANLNR431C Alters Podocyte F-Actin In Vivo Complementation Studies in Zebrafish Indicate Organization In Vitro That Missense ANLN Variants Result in a Loss of ANLN is known to bind directly to F-actin filaments and in- Function duce formation of F-actin bundles at epithelial cell junctions.10 We have shown that transient suppression of anln in zebrafish CD2AP is a multifunctional adaptor protein that assembles larvae recapitulates aspects of FSGS pathology.7 We designed a intermediates of the PI3K/AKT pathway for signaling at the slit splice blocking MO targeting the exon 5 splice donor (e5i5) diaphragm.4,11 We previously showed that the R431C mutation (Supplemental Figure 1A) and injected it into WT zebrafish disrupts the interaction between ANLN and CD2AP. In silico

2112 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2110–2122, 2018 www.jasn.org BASIC RESEARCH

Figure 1. Transient suppression and CRISPR/Cas9 genome editing of anillin (anln) demonstrates loss-of-function phenotypes for two human FSGS mutations. (A) Zebrafish larvae injected with 3 ng morpholino (MO) alone or with 150 pg ANLN mRNA were scored live at 4 days postfertilization (dpf) for edema as a proxy for glomerular filtration defects: class 1 (mild), mild ocular and pericardial edema; class 2 (severe), pronounced ocular, pericardial, and yolk sac edema (B). Statistical calculations were performed using a chi-squared test (n=42–56 per batch, repeated). p.G618C, p.Gly618Cys; p.R185K, p.Arg185Lys (likely benign variant because of common incidence in healthy control populations, allele frequency 0.6480; dbSNP ID: rs572020591); p.R431C, p.Arg431Cys; WT, wild type. (B) Representative live lateral images of zebrafish larvae at 4 dpf show different phenotypic classes. (C) CRISPR/Cas9 F0 mutants mimic anln morphant phenotypes. Qualitative scoring of zebrafish larvae at 4 dpf on the basis of objective phenotypic criteria (B). Statistical differences were compared using a chi-squared test (n=41–75 per batch, repeated). sgRNA, single-guide RNA. modeling of the effect of the mutation on ANLN secondary struc- polymerization in the presence of purified a-actin under ture suggests that introduction of a cysteine residue at amino acid cellfree conditions. In the presence of HEK 293T cell lysates, 431 distorts the architecture of the F-actin binding domain and we detected a doublet of F-actin. There was no significant the CD2AP binding region (Figure 2A). On the basis of these difference in ANLNWT and ANLNR431C in the bundling/ findings, we postulated that ANLNR431C overexpression would polymerization of F-actin in the lower molecular weight disrupt F-actin bundling and organization in podocytes. We band (Figure 2, D and F); however, there was a significant used a lentiviral delivery system to generate immortalized human difference in F-actin bundling/polymerization at the higher podocyte lines stably expressing tGFP control, tGFP-ANLNWT molecular weight (Figure 2, D and E), suggesting that the (ANLNWT), and tGFP-ANLNR431C (ANLNR431C). By immuno- difference in F-actin bundling/polymerization observed in fluorescence imaging, we observed well organized bundles of ANLNR431C-overexpressing HEK 293T cells may be dependent filamentous actin in regular array throughout the cytoplasm in on the interaction of ANLN with other F-actin–associated tGFP-ANLNWT–expressing podocytes and tGFP controls proteins. (Figure 2B). Conversely, therewasprominentdisruptionof F-actin organization in ANLNR431C-overexpressing podo- Overexpression of ANLNR431C Induces cytes with mislocalization of disorganized aggregates to the Hyperproliferation in Podocytes and Activation of the periphery of the cytoplasmic compartment. Equivalent PI3K/AKT/mTOR/Rac1 Signaling Axis ANLN overexpression was confirmed by immunoblot in ANLN is recognized as a driver of cellular proliferation in 12–15 ANLNWT-andANLNR431C-expressing lines relative to the en- various forms of cancer, and it is upregulated in HIV- dogenous ANLN expression in the control line (Figure 2C). associated nephropathy (HIVAN), a phenotype characterized 7,16–18 These findings suggest that ANLNR431C may induce podocyte by podocyte hyperproliferation and apoptosis. On the injury through disruption of actin bundling and organization basis of these findings, we postulated that ANLNR431C may in podocytes. To test this hypothesis, we performed F-actin cause podocyte dysfunction through hyperproliferation. Cell bundling/polymerization assays in HEK 293T cells transiently proliferation assays revealed a significant increase in transfected with plasmids expressing tGFP control, tGFP- ANLNR431C podocyte proliferation relative to ANLNWT and ANLNWT,andtGFP-ANLNR431C (Figure 2, D–F, Supplemen- tGFP controls at 24 and 48 hours (P=0.02 and P=0.001, re- tal Figure 3). In Figure 2D, we confirm F-actin bundling/ spectively) (Figure 3A). To understand the biochemical basis

J Am Soc Nephrol 29: 2110–2122, 2018 ANLN R431C, mTOR, and Rac1 in FSGS 2113 BASIC RESEARCH www.jasn.org

for the observed phenotype, we evaluated the activation state of signaling intermediates of the PI3K/AKT/mTOR pathway. In ANLNR431C-overexpressing podocytes, levels of activated AKT (phospho-AKT S473) were significantly elevated relative to ANLNWT-overexpressing and tGFP control podocytes (P=0.03 and P=0.004, respectively) (Figure 3, B and C). Ad- ditionally, phosphorylation of mTOR at serine residues 2448 and 2481 (considered indicators of rapamycin-sensitive, mTORC1-specific and total mTOR activity, respectively19,20) was increased in ANLNR431C-overexpressing podocytes relative to ANLNWT-overexpressing and tGFP control podocytes (P=0.05 and P=0.05, respectively) (Figure 3, B, D, and E). Hyperactivation of mTOR was also reflected in the increased activation of p70 S6 Kinase, a downstream effector kinase of mTOR, in ANLNR431C podocytes (Figure 3, C and F). The p70S6 kinase is a downstream effector kinase of mTOR that modulates actin cytoskeletal dynamics through direct activation of Rac1 and F-actin binding.21 Becausewepreviously established that ANLNR431C induces podocyte hypermotility,7 we evaluated the activation state of the Rho GTPases Rac1 and RhoA as the potential mediators of both hyperproliferation and hypermotility in ANLNR431C-overexpressing podocytes given their known roles in both cellular process- 22,23 es. In ANLNR431C podocytes, Rac1 was significantly upregulated relative to ANLNWT and tGFP control podocytes (P=0.004) (Figure 3, C and G). There was no significant difference observed in RhoA activation between ANLNWT and ANLNR431C cell lines (P=0.10) (Supplemental Figure 4). Next, we evaluated the activation state of the transcription factor Signal Transducer and Activator of Transcription 3 (STAT3). STAT3 is indirectly activated by Rac1 and has been identified as the principal driver of podocyte proliferation in

position 431 distorts the architecture of the F-actin binding domain (FABD) andtheCD2-associatedproteinbindingregion (CBR).AHD, Anillin Homology Domain; MBD, Myosin Binding Domain; NLR, Nuclear Localization Region; PHD, Pleckstrin Homology Domain;

RBD, Rho A Binding Domain. (B) ANLNWT and ANLNR431C cells were stained with a Phalloidin antibody to visualize F-actin. GFP-tagged ANLN expression can be seen in the nucleus of the three lines. Phalloidin staining showed F-actin ﬁbers extending from end to end

in regular array throughout the cell in the ANLNWT cell line compared with ANLNR431C-overexpressing podocytes that showed a paucity of F-actin staining, with small aggregates present mostly in the periphery. (C) Western blot analysis of lentiviral-infected GFP control,

turbo GFP (tGFP)–tagged ANLNWT, and tGFP-tagged ANLNR431C immortalized podocyte cell lines for ANLN and b-actin protein levels. Both experimental lines displayed similar levels of tGFP-ANLN, whereas endogenous ANLN is visible in a lower band. (D and E) Actin bundling/polymerization assays were performed with or without the addition of assay-speciﬁc nonmuscle F-actin. Transfected HEK 293

cell lines overexpressing ANLNR431C displayed increased bundling/ Figure 2. The R431C mutation distorts the secondary structure polymerization of lysate-associated F-actin (upper band) compared and F-actin bundling activity of ANLN.(A)In silico modeling of with the wild-type ANLN (P=0.03). (D and F) There was no difference the effect of R431C mutation on the secondary structure of ANLN in relative bundling/polymerization of assay-speciﬁc puriﬁed F-actin reveals that the introduction of a cysteine residue at amino acid (lower band) between the two ANLN cell lines (P=0.08). *P=0.03.

2114 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2110–2122, 2018 www.jasn.org BASIC RESEARCH

Figure 3. AnillinR431C (ANLNR431C)-expressing podocytes display an increase in proliferation and activation of the phosphoinositide 3- kinase (PI3K)/AKT/mTOR/Rac1 signaling axis. (A) Proliferation assays were performed on control, ANLNWT,andANLNR431C podocyte cell lines using a CCK colorimetric assay with data collected at 0, 3, 24, and 48 hours. ANLNR431C podocytes display significantly increased proliferation at the 24- and 48-hour time points (n=13; P=0.02 and P=0.001, respectively). (B) Western blot quantification revealed a significant difference between GFP and experimental cell lines as well as a significant increase in the ANLNR431C-expressing podocytes compared with ANLNWT podocytes when exposed to phosphorylated AKT S473 (n=6; P=0.03). (C) Representative Western blots are depicted for phospho-AKT S473, total AKT, phospho-mTOR S2481, phospho-mTOR S2448, total mTOR, phospho–p70-S6K

T424/S421, total p70-S6K, b-actin, GTP-bound Rac1, and total Rac1. (D–F) This same pattern of increased activation in ANLNR431C compared with ANLNWT was revealed when examining mTOR phosphorylation at serine 2481 and serine 2448 as well as the downstream effector kinase p70-S6K at Thr424/Ser421 (n=6, P=0.05; n=5, P=0.05; n=5, P=0.02, respectively). (G) Rac1 activity assays using a

PAK bead pulldown assay to analyze GTP-bound active Rac1 showed an increase in Rac1 activity in ANLNR431C-expressing podocytes compared with ANLNWT (n=3; P,0.01). tGFP, turbo GFP. *P,0.05.

24–26 HIVAN. In ANLNR431C-overexpressing podocytes, we inhibitor rapamycin and the Rac1 inhibitor NSC23766 both showed that activation of STAT3 was signiﬁcantly upregulated eliminated the increased podocyte proliferation in ANLNR431C- relative to ANLNWT-overexpressing podocytes (P,0.01) overexpressing podocytes at 24 and 48 hours relative to (Figure 4, A and B), suggesting that ANLNR431C-induced podo- ANLNWT-overexpressing podocytes (P=0.99, P=0.78, P=0.53, cyte hyperproliferation may be driven by the mTOR-dependent and P=0.98, respectively) (Figure 4C). Together, these data activation of STAT3 through Rac1. To test this possibility, we show that the ANLNR431C mutation induces podocyte hyper- evaluated podocyte proliferation in the presence of selective proliferation through inappropriate upregulation of PI3K/ pharmacologic inhibitors of mTOR and Rac1. The mTOR AKT/mTOR/Rac1/STAT3 signaling.

J Am Soc Nephrol 29: 2110–2122, 2018 ANLN R431C, mTOR, and Rac1 in FSGS 2115 BASIC RESEARCH www.jasn.org

Figure 4. AnillinR431C (ANLNR431C)-induced podocyte hyperproliferation is driven by mTOR-dependent activation of Signal Transducer and Activator of Transcription 3 (STAT3) through Rac1. (A) Representative Western blots are depicted for phospho-Stat3 S727, total

Stat3, and b-actin in the turbo GFP (tGFP) control, ANLNWT,andANLNR431C podocyte cell lines. (B) Western blot quantification revealed a significant increase in Stat3 activation in ANLNR431C podocyte cell lines compared with ANLNWT (P,0.01). (C) Quantification of proliferation using a CCK colorimetric assay showed that the increased proliferation in the ANLNR431C podocyte line at the 24- and 48-hour time points was rescued with 100 nM rapamycin (P=0.99 and P=0.78, respectively) or 80 mMNSC-23766(P=0.53 and P=0.98, respectively). Twelve wells per time point per sample (n=4). *P,0.05.

Overexpression of ANLNR431C Induces Hypermotility in while leaving control cells relatively unaffected (P=0.15 and Podocytes P=0.10, respectively) (Figure 5, E and F). These findings sug- We previously reported that ANLNR431C induces hypermotility gest that the hypermotility phenotype in ANLNR431C-overex- in podocytes.7 This finding supports a similar role for pressing podocytes is driven by inappropriate activation of the ANLN in the migration and invasiveness of various malignan- PI3K/AKT/mTOR/Rac1 signaling and that targeting compo- cies.27 In this study, we examined the biochemical basis for the nentsofthispathwaymaybeaviablestrategyincasesofANLN increased migratory activity in ANLNR431C-overexpressing overexpression or mutation. podocytes. As described above, PI3K/AKT/mTOR/Rac1 signaling and podocyte motility were significantly upregulated Overexpression of ANLNR431C Induces ER Stress and in mutant podocytes compared with the wild type (Figure 5, Apoptosis in Podocytes A–D). Hypermotility in ANLNR431C-overexpressing podo- We previously showed that ANLN expression was upregulated cytes was significantly attenuated in the presence of inhibitors in human collapsing glomerulopathy and the murine model of of this pathway, including rapamycin and Rac1 inhibitor HIVAN.7 Because podocyte apoptosis is a characteristic fea- 28 NSC-23766 (P=0.32 and P=0.98, respectively) (Figure 5, ture of HIVAN, we determined if ANLNR431C overexpression A–D, Supplemental Figure 5). Both rapamycin and NSC- induced apoptosis in podocytes. We subjected tGFP control–, 23766 treatment resulted in a significant reduction of motility ANLNWT-, and ANLNR431C-overexpressing podocytes to se- in ANLNWT (P,0.001 and P=0.003, respectively) and rum deprivation to induce apoptosis. Overexpression of fi ANLNR431C podocytes (P,0.001 and P,0.001, respectively) ANLNR431C induced a signi cant increase in apoptosis and

2116 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2110–2122, 2018 www.jasn.org BASIC RESEARCH

Figure 5. AnillinR431C (ANLNR431C) dysregulated motility can be rescued with inhibitors of mTOR and Rac1 activity. (A–C) Represen- tative images at 0 and 24 hours for GFP control–, ANLNWT-, and ANLNR431C-expressing podocytes when exposed to (A) vehicle control (DMSO), (B) 100 nM rapamycin, and (C) 80 mM NSC-23766 in a scratch wound healing assay. (D) Quantiﬁcation of podocyte migration in GFP control–, ANLNWT-, and ANLNR431C-expressing podocytes when exposed to vehicle control (DMSO), mTOR inhibitor (rapamycin), or Rac1 inhibitor (NSC-23766). There is signiﬁcant increase in motility of ANLNR431C cells at baseline compared with ANLNWT cells; this increased motility was rescued by inhibition of mTOR (P=0.32) or Rac1 (P=0.98; n=20 for each condition). (E and F)

Quantification of migration revealed a significant decrease in motility in ANLNWT and ANLNR431C cells after treatment with either (E) rapamycin (P,0.001 and P,0.001, respectively) or (D) NSC-23766 (P=0.003 and P,0.001, respectively). tGFP, turbo GFP. *P value ,0.05. total cell death (P=0.03 and P=0.04, respectively) relative to of mTOR may cause ER stress and podocyte apoptosis.29 To the ANLNWT-overexpressing cell line (Figure 6, A and B). test this, we evaluated the activation state of GSK-3b, a down- Caspase 3 cleavage was also significantly increased (P=0.01) stream target of AKTand regulator of the death-inducing tran- in the mutant cell line (Figure 6, C and D). Because PI3K/AKT scription factor C/EBP homologous protein (CHOP).30 We is widely recognized as a prosurvival pathway, we sought to observed a decrease in inhibitory phosphorylation of GSK-3b characterize the biochemical basis for the increased suscepti- and an increase in CHOP in ANLNR431C-overexpressing podo- bility of ANLNR431C-overexpressing podocytes to apoptosis. cytes relative to ANLNWT-overexpressing podocytes (Figure 6, We postulated that the ANLNR431C-induced hyperactivation D and E). The dephosphorylation/activation of GSK-3b is

J Am Soc Nephrol 29: 2110–2122, 2018 ANLN R431C, mTOR, and Rac1 in FSGS 2117 BASIC RESEARCH www.jasn.org

Figure 6. Overexpression of anillinR431C (ANLNR431C) induces endoplasmic reticulum (ER) stress and apoptosis in podocytes. (A and B) Apoptosis was examined in the control and experimental podocyte cell lines after 48 hours of serum starvation using Annexin V and

7-AAD staining. FACS analysis revealed increased apoptosis and total cell death in the ANLNR431C-expressing podocytes compared with the wild type. (C and D) Cell lysates from control, ANLNWT,andANLNR431C podocyte cell lines exposed to 48 hours of serum starvation were examined for activation of caspase 3 apoptotic signaling. Cleaved caspase expression was signiﬁcantly increased in the

ANLNR431C cell line compared with the ANLNWT. (D) Representative Western blots are shown for cleaved caspase 3, total caspase 3, and b-actin expression. (C) Quantiﬁcation of Western blot analysis shows a decrease in caspase 3 apoptotic signaling in ANLNWT cells

2118 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2110–2122, 2018 www.jasn.org BASIC RESEARCH

Figure 7. Calcineurin inhibitors may ameliorate anillin (ANLN)-mediated disease by targeting ANLN and mTOR expression. (A) Representative Western blot images of ANLN and mTOR protein amounts in GFP control– and VIVIT-expressing podocytes. (B and C) Quantification of Western blots revealed a significant decrease in (B) ANLN and (C) mTOR protein in VIVIT-expressing podocytes compared with GFP control podocytes (P,0.01 and P=0.03, respectively). tGFP, turbo GFP. regulated by Protein Phosphatase 2A (PP2A) and Cn. Because inhibition of the Cn/NFATsignaling pathway could effectively both have been shown to modulate ER stress–induced apopto- attenuate ANLN-induced podocyte injury through downre- tic signaling, we postulated that inhibition of Cn or PP2A gulation of endogenous mTOR and ANLN. To examine this, would suppress GSK-3b dephosphorylation/activation and we established a conditionally immortalized human podocyte promote cell survival. We showed that caspase 3 cleavage was cell line overexpressing GFP-tagged VIVIT, a peptide inhibitor 36 significantly attenuated in ANLNR431C-overexpressing podo- of the interaction between Cn and NFAT. We determined cytes in the presence of the Cn inhibitor FK-506 and the that VIVIT-overexpressing podocytes exhibited significantly GSK-3b inhibitor NP-12 (Figure 6, F and G). The PP2A in- reduced expression of both ANLN (P,0.01) (Figure 7, A hibitor Calyculin A did not inhibit ER stress–induced apoptosis and B) and mTOR (P=0.03) (Figure 7, A and C), suggesting (data not shown). Rapamycin also significantly reduced apo- that endogenous expression of both genes is regulated by ptosis in ANLNR431C-overexpressing podocytes (Supplemental Cn/NFAT. Coupled with the finding that FK-506 attenuated Figure 6), consistent with previous reports of the protective caspase 3 cleavage in ANLNR431C-expressing podocytes, this roles of mTOR and GSK-3b inhibition against ER stress and suggests that Cn inhibitors may be a viable alternative to ra- apoptosis (Supplemental Figure 6).31 Taken together, these pamycin for treatment of mTOR-mediated injury and apo- data suggest that ANLNR431C induces ER stress and apoptosis ptosis in ANLNR431C-expressing podocytes. Additionally, in podocytes through hyperactivation of mTOR. these results support the hypothesis that therapies targeting the reduction of mTOR expression (i.e., tacrolimus or cyclo- Calcineurin Inhibitors May Ameliorate ANLN-Mediated sporin A) may be as effective as therapies that reduce mTOR Disease by Targeting ANLN and mTOR Expression activity (i.e., rapamycin) in the management of ANLNR431C- Recent studies suggest that mTOR inhibitors may be useful for induced podocyte injury and FSGS. All uncropped original the treatment of FSGS.32 However, the use of rapamycin has Western blot images are shown in Supplemental Figure 7. been associated with significant nephrotoxicity, especially in patients with renal disease.33–35 To identify additional candidate therapeutic targets, we interrogated putative MTOR and DISCUSSION ANLN promoter sequences to identify regulatory elements that might operate downstream of pharmacologically modifi- We previously identified missense mutations in ANLN as a able pathways. We identified multiple candidate NFAT bind- cause of familial FSGS and found that the ANLNR431C muta- ing sequences in both putative promoters and posited that tion induced podocyte dysmotility as well as disruption of a

compared with GFP controls (P=0.03) but an increase in ANLNR431C compared with ANLNWT cells (n=4; P=0.01). (D) Representative Western blots images showing expression of cleaved caspase 3, total caspase 3, phosphoglycogen synthase kinase 3b (phospho–GSK-3b)

S9, total GSK-3b, and C/EBP homologous protein (CHOP) in serum-starved turbo GFP (tGFP) control–, ANLNWT-, and ANLNR431C-expressing podocytes. (E) Quantification of CHOP expression revealed a significant increase in CHOP expression in ANLNR431C compared with ANLNWT cells (n=3; P=0.04). (F) Twenty-four–hour treatment of the serum-starved cells with 100 nM mTOR inhibitor rapamycin, 1 mM calcineurin phosphatase (Cn) inhibitor FK-506, or 2.5 mMGSK-3b inhibitor NP-12 was able to significantly reduce cleaved caspase 3 in

ANLNR431C podocytes (P=0.02, P,0.01, and P=0.05, respectively) (n=3). Representative blots for each treatments as well as control ANLNWT-andANLNR431C-expressing podocytes are depicted in G. *P value ,0.05.

J Am Soc Nephrol 29: 2110–2122, 2018 ANLN R431C, mTOR, and Rac1 in FSGS 2119 BASIC RESEARCH www.jasn.org

7 critical interaction with CD2AP, which induces downstream previously reported ANLNR431C and ANLNG618C mutations PI3K/Akt signaling.8 On the basis of these observations, we in zebrafish and found that both variants cause a loss of func- postulated that ANLNR431C may cause podocyte injury and tion during development. loss through disruption of actin cytoskeletal dynamics, pro- Second, we showed that podocytes expressing ANLNR431C survival signaling, and proliferation; we, therefore, examined exhibit hyperactivation of the PI3K/AKT/mTOR/Rac1 signal- the biochemical basis of the pathologic phenotypes induced by ing pathway, which drives the dysmotility phenotype that we 7 ANLNR431C mutation in cultured podocytes. previously reported. Notably, RhoA activity was also upregu- First,wevalidatedour previousfindings that anln deficiency lated in cell lines overexpressing mutant ANLN compared in zebrafish larvae disrupts the glomerular filtration barrier,7 with controls. Although RhoA is known to inhibit Rac1-mediated with (1) an additional transient knockdown reagent targeting cell migration through retraction of actomyosin-mediated la- an independent site of the locus and (2) CRISPR/Cas9 genome mellipodial extensions, its upregulation in ANLNR431C- editing of the anln locus. Furthermore, we used in vivo com- induced hypermotility may reflect a bistable system of mutually plementation studies to show the pathogenicity of the antagonistic cytoskeletal regulation that underlies podocyte

Figure 8. The R431C mutation induces hyperproliferation, hypermotility and ER stress-induced apoptosis in podocytes. (A) In healthy podocytes, ANLN modulates actin cytoskeletal dynamics at the slit diaphragm and facilitates prosurvival signaling through the phosphoinositide 3-kinase (PI3K)/AKT signaling pathway. The ANLN interaction with CD2-associated protein (CD2AP) is essential to these functions. The R431C mutation disrupts the ANLN-CD2AP interaction, producing (1) dysregulated F-actin polymerization and bundling, (2) hyperactivation of the PI3K/AKT/mTOR/p70S6K/Rac1 signaling axis, and (3) activation of endoplasmic reticulum (ER) stress–induced apoptosis. Speciﬁcally, the R431C mutation distorts the secondary structure of ANLN at the F-actin binding domain (Figure 2), which impairs F-actin polymerization and bundling in podocytes. These changes alter podocyte foot process architecture at the slit diaphragm, contributing to the development of proteinuria.7 The R431C mutation also disrupts the ANLN-CD2AP interaction through distortion of the CD2-associated protein binding region (Figure 2). This uncoupling further impairs F-actin cytoskeletal dynamics and alters podocyte prosurvival signaling through the PI3K/AKT signaling pathway. Hyperactivation of the PI3K/AKT/mTOR/ p70S6K/Rac1 axis enhances Rac1-mediated cytoskeletal remodeling, contributing to distortion of foot process architecture. Addi- tionally, increased Rac1 activity induces activation of the transcriptional regulator Signal Transducer and Activator of Transcription 3 (Figure 4), which promotes podocyte proliferation. In a parallel process, the hyperactivation of mTOR induces ER stress. ER stress promotes the upregulation of calcineurin phosphatase (Cn) activity. Cn dephosphorylates/activates glycogen synthase kinase 3b (GSK- 3b), which activates C/EBP homologous protein (CHOP) expression in the context of ER stress. Activation of CHOP induces caspase 3– mediated apoptotic signaling. The loss-of-function effect of the R431C mutation in vivo likely reﬂects the effect of R431C-induced podocyte apoptosis. R431C-induced apoptosis is attenuated by inhibition of PI3K, AKT, mTOR, GSK-3b,andCnin vitro.(B)TheR431C mutation causes podocyte dysfunction through hyperactivation of PI3K/AKT/mTOR signaling and induces podocyte apoptosis through activation of mTOR-driven ER stress. PP2A, Protein Phosphatase 2A.

2120 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2110–2122, 2018 www.jasn.org BASIC RESEARCH motility in epithelial cells.37,38 Furthermore, we found that In addition to broadening our understanding of the thera- pharmacologic inhibition of mTOR and Rac1 ameliorates dys- peutic benefits of Cn inhibitors, these studies are consistent motility in ANLNR431C-overexpressing podocytes, suggesting with previous reports that mTOR inhibitors have beneficial that mTOR and Rac1 may be viable therapeutic targets for effects in FSGS.32 Although the use of mTOR inhibitors in phenotype correction in ANLNR431C-mediated podocyte in- FSGS remains controversial, our studies suggest that mTOR jury. These findings are in agreement with previous reports is a central contributor to the pathogenesis of podocyte dys- of increased Rac1 and mTOR activation in biopsies from pa- function in some forms of FSGS. As we progress toward an era tients with FSGS, and the ability of these inhibitors to correct of personalized medicine, individual assessment of mTOR ac- the Rac1 and mTOR overexpression induced glomerular dis- tivity in patients with FSGS may inform the targeted use of ease in mice.32,39,40 mTOR activity inhibitors (i.e., rapamycin) or mTOR expres- In addition to its role in the dysregulation of podocyte sion inhibitors (i.e., FK-506 or cyclosporin A) for certain types motility, we showed that the ANLNR431C-induced hyperacti- of FSGS. vation of PI3K/AKT/mTOR/Rac1 signaling also induced In summary, we report that the loss-of-function ANLNR431C an upregulation of podocyte proliferation, which was amelio- mutation may exert its deleterious effects on podocyte func- rated by pharmacologic inhibitors of mTOR and Rac1. tion and viability through multiple derangements of PI3K/ Because Rac1 indirectly activates the proproliferative tran- AKT/mTOR/Rac1 signaling (Figure 8). Through the iden- scription factor STAT3, we examined the role of STAT3 in tification and biochemical characterization of ANLNR431C- ANLNR431C-induced podocyte hyperproliferation. Our find- induced podocyte injury phenotypes, we have identified ings suggest that ANLNR431C induces proliferation through the discrete molecular targets (i.e., ANLN, mTOR, and GSK- amplification of STAT3-mediated proproliferative gene 3b) that may be pharmacologically manipulated to amelio- expression. These findings are similar to those of previous rate podocyte dysfunction in a form of hereditary FSGS. studies, which showed that decreased STAT3 activation was Although further characterization of the effects of these protective against inappropriate cell cycle re-entry and the therapies in a representative in vivo model of disease will development of HIVAN in mice.25 be required to assess their potential clinical utility, this Interestingly, we also observed an increase in apoptosis in study highlights the value of rigorous biochemical charac- ANLNR431C-overexpressing podocytes. This increase in cell terization of the molecular mechanisms of familial death was unexpected given the hyperactivation of PI3K/ nephrotic syndromes for the identification of potential AKT signaling, which is widely recognized as a prosurvival therapeutic targets. pathway. However, this finding can be explained by the inappropriate activation of mTOR signaling in ANLNR431C-overexpressing podocytes. It is well recognized that upregulation of mTOR can lead to ER stress and apoptosis through induc- ACKNOWLEDGMENTS tion of the unfolded protein response.29 ER stress–induced death signaling can proceed through a number of pathways, This work was supported by National Institutes of Health (NIH) culminating in the expression of transcriptional activators of National Institute of Diabetes and Digestive and Kidney Diseases apoptotic signaling, such as CHOP.41 GSK-3b is a regulator of (NIDDK) grants 1K08DK111940-01 (to G.H.) and 5R01DK098135 CHOP expression that is negatively regulated by phosphory- (to R.A.G.) and the American Society of Nephrology/Amos Medical lation at serine 9 (Ser 9) by AKT.30 Although we did not an- Faculty Development Program/Robert Wood Johnson Foundation. ticipate the decrease in inhibitory GSK-3b phosphorylation at We acknowledge support from the Animal Models Core (Core A) and Renal Genomics Core (Core B) of the Duke O’Brien Center for Ser 9 that we observed in our ANLNR431C-overexpressing podocytes, this might be explained by the concomitant activation Kidney Research supported by NIH NIDDK grant P30DK096493. of protein phosphatases such as Cn, which activate GSK-3b R.F.S. is supported by grant R01 DK087707 and Veterans Affairs Merit through dephosphorylation of Ser 9. In these studies, we Review BX002984. found that GSK-3b activation and CHOP expression were induced in ANLNR431C-overexpressing podocytes. Moreover, caspase 3 cleavage was significantly attenuated in DISCLOSURES None. ANLNR431C-overexpressing podocytes treated with inhibitors of mTOR (rapamycin) and GSK-3b (NP-12). The calcineurin inhibitor (Cn) FK-506 was also effective in attenuating caspase 3 cleavage, which may be due to inhibition of GSK-3b de- REFERENCES phosphorylation or the downregulation of endogenous fi mTOR expression. The identification of Cn inhibitors as neg- 1. Hall G, Gbadegesin RA: Translating genetic ndings in hereditary nephrotic syndrome: The missing loops. Am J Physiol Renal Physiol 309: ative modulators of mTOR and ANLN expression is novel and F24–F28, 2015 may have broader implications for our understanding of the 2. Korbet SM: Treatment of primary FSGS in adults. JAmSocNephrol23: use of Cn inhibitors in proteinuric kidney disease. 1769–1776, 2012

J Am Soc Nephrol 29: 2110–2122, 2018 ANLN R431C, mTOR, and Rac1 in FSGS 2121 BASIC RESEARCH www.jasn.org

3. Tryggvason K, Patrakka J, Wartiovaara J: Hereditary proteinuria syn- 23. Filic V, Marinovic M, Faix J, Weber I: A dual role for Rac1 GTPases in the dromes and mechanisms of proteinuria. NEnglJMed354: 1387–1401, regulation of cell motility. JCellSci125: 387–398, 2012 2006 24. Simon AR, Vikis HG, Stewart S, Fanburg BL, Cochran BH, Guan KL: 4. Huber TB, Hartleben B, Kim J, Schmidts M, Schermer B, Keil A, et al.: Regulation of STAT3 by direct binding to the Rac1 GTPase. Science NephrinandCD2APassociatewithphosphoinositide3-OHkinaseand 290: 144–147, 2000 stimulate AKT-dependent signaling. MolCellBiol23: 4917–4928, 25. Feng X, Lu T-C, Chuang PY, Fang W, Ratnam K, Xiong H, et al.: Re- 2003 duction of Stat3 activity attenuates HIV-induced kidney injury. JAmSoc 5. Gigante M, Pontrelli P, Montemurno E, Roca L, Aucella F, Penza R, et al.: Nephrol 20: 2138–2146, 2009 CD2AP mutations are associated with sporadic nephrotic syndrome 26. Gu L, Dai Y, Xu J, Mallipattu S, Kaufman L, Klotman PE, et al.: Deletion and focal segmental glomerulosclerosis (FSGS). Nephrol Dial Trans- of podocyte STAT3 mitigates the entire spectrum of HIV-1-associated plant 24: 1858–1864, 2009 nephropathy. AIDS 27: 1091–1098, 2013 6. Hall G, Gbadegesin RA, Lavin P, Wu G, Liu Y, Oh EC, et al.: A novel 27. ZhouW,WangZ,ShenN,PiW,JiangW,HuangJ,etal.:Knockdownof missense mutation of Wilms’ Tumor 1 causes autosomal dominant ANLN by lentivirus inhibits cell growth and migration in human breast FSGS. JAmSocNephrol26: 831–843, 2015 cancer. Mol Cell Biochem 398: 11–19, 2015 7. Gbadegesin RA, Hall G, Adeyemo A, Hanke N, Tossidou I, Burchette J, 28. Ross MJ, Martinka S, D’Agati VD, Bruggeman LA: NF-kappaB regulates et al.: Mutations in the gene that encodes the F-actin binding protein Fas-mediated apoptosis in HIV-associated nephropathy. JAmSoc anillin cause FSGS. JAmSocNephrol25: 1991–2002, 2014 Nephrol 16: 2403–2411, 2005 8. Yang J, Zhang Y: Protein structure and function prediction using I- 29. Reiling JH, Sabatini DM: Increased mTORC1 signaling UPRegulates TASSER. Curr Protoc Bioinforma 52: 5.8.1–5.8.15, 2015 stress. Mol Cell 29: 533–535, 2008 9. Niederriter AR, Davis EE, Golzio C, Oh EC, Tsai IC, Katsanis N: In vivo modeling 30. Meares GP, Mines MA, Beurel E, Eom T-Y, Song L, Zmijewska AA, et al.: of the morbid human genome using Danio rerio. JVisExp78: 50338, 2013 Glycogen synthase kinase-3 regulates endoplasmic reticulum (ER) 10. Wang D, Chadha GK, Feygin A, Ivanov AI: F-actin binding protein, stress-induced CHOP expression in neuronal cells. Exp Cell Res 317: anillin, regulates integrity of intercellular junctions in human epithelial 1621–1628, 2011 cells. Cell Mol Life Sci 72: 3185–3200, 2015 31. Marchand B, Arsenault D, Raymond-Fleury A, Boisvert F-M, Boucher M- 11. Tang VW, Brieher WM: FSGS3/CD2AP is a barbed-end capping protein J: Glycogen synthase kinase-3 (GSK3) inhibition induces prosurvival that stabilizes actin and strengthens adherens junctions. J Cell Biol 203: autophagic signals in human pancreatic cancer cells. J Biol Chem 290: 815–833, 2013 5592–5605, 2015 12. Hall PA, Todd CB, Hyland PL, McDade SS, Grabsch H, Dattani M, et al.: 32. Zschiedrich S, Bork T, Liang W, Wanner N, Eulenbruch K, Munder S, The septin-binding protein anillin is overexpressed in diverse human et al.: Targeting mTOR signaling can prevent the progression of FSGS. tumors. Clin Cancer Res 11: 6780–6786, 2005 JAmSocNephrol28: 2144–2157, 2017 13. Olakowski M, Tyszkiewicz T, Jarzab M, Król R, Oczko-Wojciechowska 33. Boratynska M, Banasik M, Watorek E, Falkiewicz K, Patrzałek D, Szyber P, M, Kowalska M, et al.: NBL1 and anillin (ANLN) genes over-expression et al.: Conversion to sirolimus from cyclosporine may induce nephrotic in pancreatic carcinoma. Folia Histochem Cytobiol 47: 249–255, 2009 proteinuria and progressive deterioration of renal function in chronic al- 14. Suzuki C, Daigo Y, Ishikawa N, Kato T, Hayama S, Ito T, et al.: ANLN lograft nephropathy patients. Transplant Proc 38: 101–104, 2006 plays a critical role in human lung carcinogenesis through the activation 34. Letavernier E, Bruneval P, Mandet C, Duong Van Huyen J-P, Péraldi M- of RHOA and by involvement in the phosphoinositide 3-kinase/AKT N, Helal I, et al.: High sirolimus levels may induce focal segmental pathway. Cancer Res 65: 11314–11325, 2005 glomerulosclerosis de novo. Clin J Am Soc Nephrol 2: 326–333, 2007 15. Shimizu S, Seki N, Sugimoto T, Horiguchi S, Tanzawa H, Hanazawa T, 35. Marti HP, Frey FJ: Nephrotoxicity of rapamycin: An emerging problem et al.: Identification of molecular targets in head and neck squamous in clinical medicine. Nephrol Dial Transplant 20: 13–15, 2005 cell carcinomas based on genome-wide gene expression profiling. 36. Yu H, van Berkel TJC, Biessen EAL: Therapeutic potential of VIVIT, a Oncol Rep 18: 1489–1497, 2007 selective peptide inhibitor of nuclear factor of activated T cells, in 16. Bódi I, Abraham AA, Kimmel PL: Apoptosis in human immunodeficiency cardiovascular disorders. Cardiovasc Drug Rev 25: 175–187, 2007 virus-associated nephropathy. Am J Kidney Dis 26: 286–291, 1995 37. Ridley AJ: Rho GTPase signalling in cell migration. Curr Opin Cell Biol 17. Barisoni L, Kriz W, Mundel P, D ’Agati V: The dysregulated podocyte 36: 103–112, 2015 phenotype: A novel concept in the pathogenesis of collapsing idio- 38. Byrne KM, Monsefi N, Dawson JC, Degasperi A, Bukowski-Wills J-C, pathic focal segmental glomerulosclerosis and HIV-associated ne- Volinsky N, et al.: Bistability in the Rac1, PAK, and RhoA signaling phropathy. J Am Soc Nephrol 10: 51–61, 1999 network drives actin cytoskeleton dynamics and cell motility switches. 18. Barisoni L, Bruggeman LA, Mundel P, D’Agati VD, Klotman PE: HIV-1 Cell Syst 2: 38–48, 2016 induces renal epithelial dedifferentiation in a transgenic model of HIV- 39. Robins R, Baldwin C, Aoudjit L, Côté J-F, Gupta IR, Takano T: Rac1 associated nephropathy. Kidney Int 58: 173–181, 2000 activation in podocytes induces the spectrum of nephrotic syndrome. 19. Rosner M, Siegel N, Valli A, Fuchs C, Hengstschläger M: mTOR phosphor- Kidney Int 92: 349–364, 2017 ylated at S2448 binds to raptor and rictor. Amino Acids 38: 223–228, 2010 40. Shibata S, Nagase M, Yoshida S, Kawarazaki W, Kurihara H, Tanaka H, et al.: 20. Soliman GA, Acosta-Jaquez HA, Dunlop EA, Ekim B, Maj NE, Tee AR, Modification of mineralocorticoid receptor function by Rac1 GTPase: Im- et al.: mTOR Ser-2481 autophosphorylation monitors mTORC-specific plication in proteinuric kidney disease. Nat Med 14: 1370–1376, 2008 catalytic activity and clarifies rapamycin mechanism of action. JBiol 41. Li Y, Guo Y, Tang J, Jiang J, Chen Z: New insights into the roles of Chem 285: 7866–7879, 2010 CHOP-induced apoptosis in ER stress. Acta Biochim Biophys Sin 21. Ip CKM, Cheung ANY, Ngan HYS, Wong AST: p70 S6 kinase in the (Shanghai) 46: 629–640, 2014 control of actin cytoskeleton dynamics and directed migration of ovarian cancer cells. Oncogene 30: 2420–2432, 2011 22. Moore KA, Sethi R, Doanes AM, Johnson TM, Pracyk JB, Kirby M, et al.: Rac1 is required for cell proliferation and G2/M progression. Biochem J This article contains supplemental material online at http://jasn.asnjournals. 326: 17–20, 1997 org/lookup/suppl/doi:10.1681/ASN.2017121338/-/DCSupplemental.

2122 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2110–2122, 2018 SUPPLEMENTARY MATERIALS

The Human FSGS-causing ANLN R431C mutation induces dysregulated PI3K/AKT/mTOR/Rac1 signaling in podocytes

#Gentzon Hall MD PhD1,2,3, #Brandon M Lane PhD1,2, Kamal Khan MS4, Igor Pediaditakis BS4, Jianqiu Xiao PhD4, Guanghong Wu BS1,3, Liming Wang MD, PhD3, Maria E Kovalik1,2,3 Megan Chryst-Stangl MS1,2, Erica E Davis PhD1,4, Robert F. Spurney MD3, *Rasheed A Gbadegesin MBBS, MD1,2,3

1. Department of Pediatrics, Duke University School of Medicine 2. Duke Molecular Physiology Institute 3. Department of Medicine, Duke University School of Medicine 4. Center for Human Disease Modeling, Duke University Medical Center

Running Title: ANLN R431C causes FSGS through mTOR and Rac1 activation

SUPPLEMENTARY METHODS (SM)

Transient suppression of anln and in vivo complementation assays in zebrafish:

All studies performed in zebrafish were approved by the Duke University Institutional

Animal Care and Use Committee (IACUC). We designed a splice blocking MO targeting the donor site of exon 5 of the anln ortholog in zebrafish (Ensembl ID:

ENSDART00000113574.3, GRCz10; 48% amino acid identity and 62% similarity vs. human; 5´- AGATGACAAGCTCCACTAACCAGGC - 3´; Gene Tools; Supplementary

Figure 1a). To determine MO efficiency, we injected 3 ng of MO into WT zebrafish embryos (ZDR) at the 1-4 cell stage (1 nl / embryo) and harvested them at 2 days post fertilization (dpf) for RNA extraction. We used Trizol (Invitrogen) to extract total RNA from morphants and uninjected controls following the manufacturer’s protocol. We used the QuantiTect Reverse Transcription kit (QIAGEN), to perform RT-PCR on resulting

RNA, and amplified the anln targeted region. After migrating the amplified product on a

1 % agarose gel, PCR fragments were purified using the QIAquick gel extraction kit

(QIAGEN) and cloned using the TOPO-TA cloning kit for sequencing (ThermoFisher).

To characterize aberrant splicing, we Sanger sequenced individual colonies on an

ABI3730 sequencer using BigDye Terminator chemistry (Applied Biosystems) and analyzed data using Lasergene software (DNASTAR). We assessed the effect of progressive doses of MO (3 ng, 6 ng and 9 ng) and subsequently used 3ng MO for the in vivo complementation assays. We cloned the human ANLNWT open reading frame into the pCS2+ vector, and performed site directed mutagenesis as described1 to introduce the R431C, G618C and R185K variants; all constructs were sequence confirmed. To perform in vitro transcription, we linearized plasmids with NotI, and generated capped mRNA using the SP6 mMessage mMachine transcription kit

(ThermoFisher). We injected 150 pg mRNA for all embryo injections. Live bright field images were acquired on 4 dpf larvae anesthetized with tricaine using a Nikon AZ100 microscope with a Digital Sight color camera and NIS elements software.

CRISPR/Cas9 genome editing of the anln locus in zebrafish:

We used CHOPCHOP v22 to identify an sgRNA targeting the coding region of exon 8

(Ensembl ID: ENSDART00000113574.3, GRCz10; 5´-

GAAGGCTTATTATCATGCAGTGG -3´; Supplementary Figure 1a). We synthesized sgRNAs using the Gene Art precision gRNA synthesis Kit (Invitrogen) as described.3

We then injected 100 pg sgRNA in combination with 200 pg Cas9 protein (PNA Bio) in

WT zebrafish embryos (ZDR) at the 1-cell stage and harvested them at 2 dpf for genomic DNA extraction using proteinase K (Life Technologies). We PCR-amplified the targeted region and assessed for indels by heteroduplex analysis as described.3 Briefly, the amplified products from control embryos (n=2) and mutant embryos (n=8) were migrated by polyacrylamide gel electrophoresis (PAGE) using precast gels (Invitrogen) following heat denaturation and slow reannealing (95º C for 5 min, ramp down to 85º C at -1º C/s, and then to -0.1º C/s). The PCR fragments were then visualized using ethidium bromide and a UV lamp. For estimation of mosaicism in individual embryos we then cloned PCR product from F0 mutant embryos (n= 5) and a control embryo (n=1) using the TOPO-TA cloning kit for sequencing (ThermoFisher) per manufacturer’s protocol. We sequenced 16-24 colonies from each embryo on an ABI 3730 sequencer using BigDye Terminator chemistry (Applied Biosystems) and we analyzed the data using Lasergene software (DNASTAR).

Conditionally Immortalized Human Podocyte Culture: Conditionally immortalized human podocyte cell lines were generously provided by Dr. Jeffrey Kopp (Chief, Kidney

Diseases Branch, NIDDK) and were cultured and harvested as described4. For immunoblotting experiments examining apoptosis, cells were exposed to serum starvation for 48 hours at growth restrictive temperatures before the media and cells were collected by cell scraping.

Lentiviral Constructs and Infection: Standard molecular cloning methods were used to replace the ubiquitin-EGFP of FUGW 19 with CMV-turboGFP, CMV-hANLNWT-tGFP and CMV-hANLNR431C-tGFP. For calcineurin inhibition, the ubiquitin-EGFP of FUGW 19 was replaced with CMV-hVIVIT-tGFP. Lentivirus was made and conditionally immortalized human podocytes were transduced as described5.

Immunofluorescence: Conditionally immortalized human podocytes were differentiated per established protocols on collagen I–coated coverslips (BD Biosciences) and processed as described6. Cells were then exposed to phalloidin alexa-568 (Invitrogen) for one hour at RT followed by two PBS washes and then 4′,6-diamidino-2-phenylindole stain at a concentration of 1:20,000 diluted in PBS. Immunofluorescence imaging was performed using a Carl Zeiss AxioImager and the ZenBlue Bioimaging Software.

F-actin bundling/polymerization assay: HEK293T cells were grown in DMEM +5% FBS in T75 flasks at 37 degrees Celcius until 85% confluency and transfected using

Lipofectamine 2000 with plasmids containing CMV-turboGFP, CMV-hANLNWT-tGFP, or

CMV-hANLNR431C-tGFP. 65 ul of Lipofectamine 2000 (Thermo-Fisher) was combined with 1.7 mls of Opti-MEM (Gibco) and allowed to incubate at room temperature for 5 mins before combining with 1.7mls of Opti-MEM containing 26ug of plasmid DNA.

After 20 mins of incubation, the mixture was added to the cells in 15 mls of DMEM with

5% FBS. Cells were analyzed using flouresense microscopy between 40- 48hrs to ensure adequate transfection levels and then harvested at 48 hrs and lysed using a syringe in 400 ul of 20mM HEPES, 20mM NaCl buffer. Supernatant was collected after spinning for 3 mins at 14,000 x G at 4 degrees Celsius and analyzed using immunoblotting to ensure equivalent levels of hANLN between samples. Bundling reactions including appropriate positive and negative controls were performed using the

Actin Binding Protein Biochem Kit (Cytoskeleton Inc) according to the provided bundling method protocol. 30 ul of experimental lysate was combined with 50 ul of human nonmuscle F-actin stock or an F-actin buffer and incubated for 30 mins at room temperature. After spinning at 14,000 x G for one hour, the supernatant was collected and the F-actin pellet was mixed with 30 ul of water and 30 ul of 2X Laemmli reducing- sample buffer and analyzed using immunoblotting with an F-actin mouse monoclonal antibody (1:500; Novus Biologicals).

Immunoblotting: Conditionally immortalized podocytes were harvested, and treated with lysis buffer (Pierce Biotechnology, Rockford, IL) supplemented with phosphatase/protease inhibitor cocktail, 1:100 dilution (Cell Signaling Technology) and

1:100 PMSF (Sigma-Aldrich) for 15 min on ice. Cells were then spun at 14,000 RPM for

10 mins at 4°C (Eppendorf). Protein Immunoblotting was performed as described 6 using a rabbit monoclonal phospho AKT S473 antibody (1:1000; Cell Signaling Technology), rabbit monoclonal total AKT antibody (1:1000; Cell Signaling Technologies), rabbit polyclonal phospho-mTOR S2481 antibody (1:750; Cell Signaling Technologies), rabbit monoclonal phospho-mTOR S2448 (1:1000; Cell Signaling Technologies), rabbit monoclonal p70-S6K (1:1000; Cell Signaling Technologies), rabbit polyclonal phospho p70-S6K T424/S421 (1:1000; Cell Signaling Technologies), rabbit monoclonal mTOR antibody (1:1000; Cell Signaling Technologies), mouse monoclonal Rac1 antibody

(1:500; Cytoskeleton Inc), rabbit polyclonal Anillin antibody (1:1000; Bethyl

Laboratories), mouse monoclonal F-actin antibody (Novus Biologicals), rabbit polyclonal

Cleaved Caspase 3 antibody (1:1000; Cell Signaling Technologies), rabbit polyclonal

Caspase 3 antibody (1:1000; Cell Signaling Technologies), rabbit monoclonal GSK3β

(1:1000 Cell Signaling Technologies), rabbit monoclonal phospho-S9 GSK3β (1:1000

Cell Signaling Technologies), mouse monoclonal Stat3 antibody (1:1000 Cell Signaling

Technologies), rabbit phospho-S727 antibody (1:1000 Cell Signaling Technologies), mouse monoclonal CHOP antibody (1:500 Cell Signaling Technologies), and mouse monoclonal β-actin antibody (1:3000; Sigma-Aldrich).

Rac1 and RhoA Activity Assays: GTP-bound Rac1 and RhoA were analyzed using PAK and RBD bead assays (Cytoskeleton Inc). Conditionally immortalized podocytes were grown to 80% confluence, washed twice in ice cold PBS and lysed on ice for 15 minutes with 600 ul of ice cold lysis buffer supplemented with phosphatase inhibitor. Lysate was collected using a cell scraper and spun at 10,000 x G at 4 degrees Celsius for 3 mins and 30 ul of lysate was set apart to analyze for total Rac1 or RhoA expression. The remaining lysate was applied to 15mg of PAK or RBD bound beads for 1 hour in rotation at 4 degrees Celsius before 2 washes with 500ul Wash Buffer with centrifugation at

5000 X G at 4 degrees. 25ul of 2X SDS buffer was applied to the washed beads before boiling for 2 mins and running them on a gel for immunoblotting with Rac1 or RhoA monoclonal antibodies (1:500; Cytoskeleton Inc).

Targeted Inhibition: For inhibition experiments, stock inhibitors were made in DMSO and diluted 1:1000 in media to reach final working concentrations of 100nM Wortmannin

(Calbiotech), 1.5uM MK-2206 (Selleckchem), 5uM KU-0063794 (Selleckchem), 100nM

Rapamycin (Selleckchem), 80uM NSC-23766 (Tocris), 1µM FK-506 (Tacrolimus).

Migration Assay: Stably transfected immortalized podocytes expressing tGFP, ANLNWT or ANLNR431C were grown to confluence on collagen coated 6 well plates. Cell monolayers were washed and scratch wounds were applied using a 1000-µl pipet tip before removing media and applying new media. Podocytes were imaged using an

EVOS microscope at time 0 immediately after wound creation. Cells were then returned to growth restrictive conditions for 24 hours before final imaging of wound healing. 2 mls of media containing inhibitors or DMSO controls were added to each well (6 wells per inhibitor for each cell line repeated in triplicate) 1 hr prior to scratch wound and then fresh inhibitor media was applied post scratch wound.

Proliferation Assay: Stably transfected immortalized podocytes expressing tGFP,

4 ANLNWT or ANLNR431C were grown to 80% confluence as described and then transferred to collagen coated 96 well plates at 5,000 cells per well in 100ul of media and grown at growth permissive temperatures. 12 replicate wells were used for each sample per time-point. 10 ul of a cell counting colorimetric assay (Dojindo Molecular

Technologies, Inc. Cell Counting Kit-8, Rockville, MD, USA) colorimetric assay) was added to each sample according to manufacturer protocol at time-points of 0 hrs, 3hrs,

24hrs, and 48hrs before reading on a Tecan Infinite 200 PRO microplate reader

(Switzerland). For the 48-time point reading, fresh inhibitor or control media as re- applied to the cells after 24hrs. All experiments were repeated in triplicate.

Apoptosis Assay: Stably transfected immortalized podocytes expressing tGFP, ANLNWT

4 or ANLNR431C were grown at growth permissive temperatures as described previously to 80% confluency. 200,000 cells were plated on 6-well plates in triplicate for each sample and allowed to grow to 80% confluency. The cells were then given serum free media and moved to growth restrictive temperatures for 48hrs before harvesting.

Annexin V and 7-AAD staining (BD Annexin V Apoptosis Detection Kit) was applied to the cells according to established protocols before flow cytometry analysis (BD

FACSCalibur). The apoptosis assay was individually repeated 4 times for each cell line.

Statistical Analyses: Zebrafish larval batches were compared using 2 tests (GraphPad software). All in vitro data are represented as the mean±SEM. Group differences were assessed by the t test with unequal variances. One-way analysis of variance (ANOVA) followed by a Tukey HSD post hoc test was used to determine the differences between means where there are three or more groups. Statistical significance was established at P<0.05.

Supplementary Figure 1: Validation of transient suppression and CRISPR/Cas9 genome editing reagents targeting anln in zebrafish.

(a) Schematic of zebrafish anln locus (Ensembl ID: ENSDART00000113574.3, GRCz10). Red boxes, coding exons; white boxes, untranslated regions. Vertical green arrow indicates position of MO, horizontal green arrows correspond to primers flanking MO targeted region for RT-PCR shown in (b). Vertical blue arrow indicates position of sgRNA, horizontal blue arrows correspond to primers flanking sgRNA targeting region for heteroduplex analysis shown in (e). (b) Agarose gel image shows RT-PCR products amplified around the anln target region in uninjected control embryos and anln morphants. Red arrow indicates wild type anln product; upper band, middle band and lower band in MO indicate 84 bp insertion, wild-type and 67 bp deletion, respectively. (c) Chromatograms indicate aberrant splicing events in anln morphants. Top, wild type; center, partial excision of exon 5 (67 bp); bottom, inclusion of intron 5-6 (84 bp). (d) anln e5i5 MO dose curve. Zebrafish embryos at the 1-4 cell stage were injected with progressively increasing doses of MO (3 ng, 6 ng and 9 ng); larvae were scored qualitatively based on edema phenotype and mortality at 4 dpf; see Figure 1b for representative images. Statistical calculations were performed using a 2 test; ns, not significant (n=63-81 per batch, repeated). (e) Heteroduplex analysis of uninjected controls and anln F0 mosaic mutants. DNA was extracted at 2 dpf and the targeted region was PCR-amplified, denatured and reannealed slowly, then migrated on a 20% polyacrylamide gel. Red arrow indicates the WT anln product. (f) Representative chromatograms of PCR products from uninjected control embryos and anln F0 mutants indicating insertion deletion events in F0 mutants; sgRNA target, top; protospacer adjacent motif (PAM), red box.

Supplementary Figure 2: Overexpression of ANLN mRNA in zebrafish. Zebrafish larvae injected with 150 pg ANLN mRNA were scored live for edema phenotypes based on objective criteria (see Figure 1b). Statistical calculations were performed using a 2 test; ns, not significant; n=53-75 per batch, repeated.

Supplementary Figure 3: Transient transfection of HEK 293 cell lines showed similar expression of ANLN between tGFP-ANLNWT and tGFP-ANLNR431C cell lines.

Supplementary Figure 4: Overexpression of ANLNR431C does not alter podocyte RhoA Activity in vitro: Conditionally immortalized podocyte cell lines were examined for RhoA activity using an RBD bead pulldown assay. (A) Representative immunoblots for GTP bound RhoA and total RhoA in control, ANLNWT and ANLNR431C cells. (B) Quantification of 3 independent assay results revealed no significant difference between ANLNWT and ANLNR431C cells (p=0.107), but there was an increase in both cells lines when compared to control (p=0.025 and 0.022 respectively)

Supplementary Figure 5: Inhibition of components of the PI3K/AKT/mTOR eliminates the increased migration induced by ANLNR431C mutation. (a) Inhibition of PI3K signaling through treatment with 100nM Wortmannin (p=0.599). (b) Inhibition of AKT signaling through treatment with 1.5 uM MK-2206 (p=0.46). (c) Inhibition of both mTOR complexes through use of 5uM KU-0063794 (p=0.76). *p<0.05

Supplementary Figure 6: Rapamycin ameliorates serum starvation induced apoptosis in ANLNR431C podocytes. FACS analysis of Annexin V stained, serum starved tGFP, ANLNWT and ANLNR431C expressing podocytes treated with Rapamycin or vehicle control. Analysis revealed a significant decrease in apoptosis in Rapamycin treated ANLNR431C expressing podocytes when compared to tGFP controls and ANLNWT expressing podocytes.

Supplementary Figure 7: Uncropped original Western Blot images

Shown in order of appearance in publication. From left to right, Top Row: Anillin (~130 kDa), β-actin (~45 kDa), Anillin (~130 kDa), F-actin (~37 kDa + 50 kDa), β-actin (~45 kDa), Phospho AKT S473 (~60 kDa), Total AKT (~60 kDa), Phospho mTOR S2481

(~250 kDa), Phospho mTOR S2448 (~250 kDa), Total mTOR (~250 kDa), β-actin (~45 kDa), Active Rac1 (~20 kDa), Total Rac1 (~20 kDa). Bottom Row: Phospho Stat3

S727 (~85 kDa), Total Stat3 (~85 kDa), β-actin (~45 kDa), Cleaved Capase 3 (~19 kDA and 17 kDa), Total Caspase 3 (~35 kDa), Phospho GSK3β S9 (~50 kDa), Total GSK3β

S9 (~50 kDa), CHOP (~28 kDa), Anillin (~130 kDa), Total mTOR (~250 kDa), β-actin

(~45 kDa), Active RhoA (~20 kDa), Total RhoA (~20 kDa)

References 1. Niederriter AR, Davis EE, Golzio C, Oh EC, Tsai I-C, Katsanis N: In vivo modeling of the morbid human genome using Danio rerio. J. Vis. Exp. JoVE e50338, 2013

2. Labun K, Montague TG, Gagnon JA, Thyme SB, Valen E: CHOPCHOP v2: a web tool for the next generation of CRISPR genome engineering. Nucleic Acids Res. 44: W272-276, 2016

3. Küry S, Besnard T, Ebstein F, Khan TN, Gambin T, Douglas J, et al: De Novo Disruption of the Proteasome Regulatory Subunit PSMD12 Causes a Syndromic Neurodevelopmental Disorder. Am. J. Hum. Genet. 100: 689, 2017

4. Hall G, Gbadegesin RA, Lavin P, Wu G, Liu Y, Oh EC, et al: A novel missense mutation of Wilms’ Tumor 1 causes autosomal dominant FSGS. J. Am. Soc. Nephrol. JASN 26: 831–843, 2015

5. Gbadegesin RA, Hall G, Adeyemo A, Hanke N, Tossidou I, Burchette J, et al: Mutations in the gene that encodes the F-actin binding protein anillin cause FSGS. J. Am. Soc. Nephrol. JASN 25: 1991–2002, 2014

6. Hall G, Lane B, Chryst-Ladd M, Wu G, Lin J-J, Qin X, et al: Dysregulation of WT1 (- KTS) is Associated with the Kidney-Specific Effects of the LMX1B R246Q Mutation. Sci. Rep. 7: 39933, 2017

SIGNIFICANCE STATEMENT

The authors previously reported that mutations in ANLN can cause familial FSGS. Anillin is an F-actin binding protein that modulates cell motility and signaling through the phosphoinositide 3-kinase (PI3K) pathway. This study examines its signaling through the PI3K pathway in podocytes to understand its role in the pathobiology of FSGS. Mutant anillin induced hypermotility and apoptosis, enhanced cellular proliferation, and activated PI3K/AKT/mTOR/Rac1 signaling. Aberrant podocyte phenotypes induced by the mutation were ameliorated by inhibition of downstream effectors of PI3K and calcineurin phosphatase, and calcineurin inhibition ameliorates ANLNR431C-induced podocyte apoptosis and downregulates endogenous mTOR and ANLN expression. Drugs targeting these pathways may be useful in the treatment of some forms of FSGS.