DOCSLIB.ORG

US5266490.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
US5266490.Pdf ||||||||||||I|| US005266490A United States Patent (19) 11 Patent Number: 5,266,490 Davis et al. 45 Date of Patent: Nov.30, 1993 (54) MAMMALIAN EXPRESSION VECTOR Maniatis et al. (1990), Molecular Cloning: A Laboratory Manual, vol. 2, pp. 16.3-16.81. 75 Inventors: Samuel Davis, New York; George D. Martson (1987), DNA Cloning: A Practical Approach, Yancopoulos, Briarcliff Manor, both vol. 3, Chap. 4, pp. 59-88. of N.Y. Mizushima et al. (1990), Nucl. Acids Res. 18 (17): 5322. 73) Assignee: Regeneron Pharmaceuticals, Inc., Sambrook et al. (1988), Focus 10(3): 41-48. Tarrytown, N.Y. Simmons et al. (1988), J. Immunol. 141 (8): 2797-2800. Spector (1985), Genet. Engineering 7: 199-234. (21) Appl. No.: 678,408 Stamenkovic et al. (1988), J. Exp. Med. 167: 1975-1980. (22 Filed: Mar. 28, 1991 Urlaub et al. (1980), Proc. Nat. Acad. Sci USA 77(7): 51) Int. Cl.5...................... C12N 15/79; C12N 15/12; 426-4220. C12N 15/18 Woeltje et al. (1990), J. Biol. Chem. 265 (18): 10720-10725. 52) U.S. C. ................................ 435/320.1; 536/23.4; Wysocki et al. (1978); Proc. Nat. Acad. Sci USA 75(6): 536/23.5; 536/24.1 2844-2848. 58) Field of Search ................. 435/320.1, 69.1, 172.3; Seed, B. (Oct. 1987), Nature, vol. 329, pp. 840-842. 536/27, 24.1, 23.4, 23.5 Yanisch-Perron et al. (1985), Gene, vol. 33, pp. (56) References Cited 103-119. PUBLICATIONS Seed et al. (May, 1987), Proc. Nat. Acad. Sci USA, vol. 84, pp. 3365-3369. Alt et al. (1978), J. Biol. Chem. 253(5):1357-1370. Andersson et al. (1989), J. Biol. Chem. 264(14): Primary Examiner-Richard A. Schwartz 8222-8229. Assistant Examiner-Philip W. Carter Aruffo et al. (1989), J. Immunol. 143(5): 1723-1730. Attorney, Agent, or Firm-Pennie & Edmonds Aruffo et al. (1987), Proc. Nat. Acad. Sci USA 84: 57 ABSTRACT 8573-8577. Bebbington et al. (1987), DNA Cloning: A Practical DNA plasmid expression vector, pCMX, enables Approach, vol. 3, Chapter 8, pp. 163-168, 188. cDNA expression cloning in mammalian cell culture. Boulay et al. (1990), Biochem. Biophys. Res. Comm. This novel expression vector exhibits a marked increase 168(3): 1103-1109. in gene expression when compared to its parental plas Cunningham et al. (1991), Science 254; 821-825. mid construction. Kenny et al. (1989), SV40 DNA Replication. In Vitro, NATO ASl Series, vol. 434, pp. 437-448. 7 Claims, 7 Drawing Sheets U.S. Patent Nov. 30, 1993 Sheet 1 of 7 5,266,490 ACGCTTGAC ATTGATTATTGACTATTAT TAATAGTAAT CAATTACGGG GTCATTATT 60 CATAGCCCAT ATATGATT CCGCTTACA TAACTTACGG AAATGGCCC CGCCTGGCTG 120 ACCGCCCAAC GACCCCCGCC CATTGACGTC AATAATGACG TATGTTCCCA TAGTAACGCC 18O AATAACTTTCCATTGAC GTCAATGGGT GACTATTTA CGGTAAACTG CCCACTTGGC 240 ATACATCAA GTGTATCATA TGCCAAGTAC GCCCCCTATTGACGTCAATG ACTAAATG 300 GCCCCCT CATTATGCCC ATACATAC CTTATGGGAC TTTCCTACTT GGCATACAT 360 CTACGTATTA GTCATCGCTA TTACCATGGT GATGCGGTTTTGGCAGTACA TCAATGGGCG 420 TGGATAGCGGTTTGACTCACGGGGATTTCC AAGTCTCCAC CCCATTGACGTCAATGGGAG 480 TTTTTTT CACCAAAATC AACGGGACTT TCCAAAATGT CGTAACAACT CCGCCCCATT 540 GACCAAATGGGCGTAGGC GTGTACGTGGGAGTCTATATAAGCAGA CTCTCTGGCT 600 AACTAGAGAA CCCACTGCTT ACTGGCTTAT CGAAATTAAT ACACTCACT ATAGGGAGAC 660 CGGAAGCTTC TAGAGATCCC TCACCCA GATCCATTT GCTGGCGCGG ATTCTTTATC 720 ACTGATAAGT TGGTGGACAT ATTATGTTTA TCAGTGATAA AGTGTCAAGC ATGACAAAGT 780 TCAGCCGAA TACATGATC CTGCCGCCC TAGACCTGTTGAACGAGGTC GGCGTAGACG 840 TCTGACAC ACCAAACTG GCGGAACGGT TGGGGTTCA GCAGCCGC CTTTACTGGC 900 ACTTCAGGAA CAAGCGGGCGCTCTCGACCACTGGCCGA AGCCATGCTGGCGGAGAATC 960 ATACACTTC GTGCCGAGA GCCACAC ACTGGCGCTC ATTTCTACT GGGAATGCCC 020 GCAGCTTCAGGCAGGCGCTG CTCGCCTACC GCCAGCACAA TGGATCTCGA GGGATCTTCC 080 F.G. 1A U.S. Patent Nov. 30, 1993 Sheet 2 of 7 5,266,490 ATACCTACCA GTTCTCCC TGCAGTCGC GGCCGCGACT CAGAGATC TTTTGAAGG 1140 AACCTTACTT CTTGTGT ACATAATTGACAAACTACC TACAAGATT TAAAGCTCTA 1200 AGTAAATAT AAAATTTTTA ATTATAAT GTGITAAACT ACTGATTCTA ATTGTTTGTG 1260 TATTTTAGAT TCCAACCTAT GGAACTGATG AATGGGAGCA GTGGTGGAAT GCCTTTAATG 320 AGGAAAACCT GTTTTGCTCA GAAGAAATGC CATCTATA TGATAGCT ACTGCTGACT 1380 CTCAACATTC TACTCCTCCAAAAAAGAAA GAAAGTAGA AGACCCCAAG GACTTTCCTT 440 CAAATTGCT AAGTTTTTTG ATCATGCTG TGTTTAGAA TAGAACTCTT GCTTGCTTTG 1500 CTATTTACAC CACAAAGGAA AAAGCTGCAC TGCTATACAA GAAAATTATG GAAAAATATT 560 CTTAACCTT TATAAGTAG CATAACAGTT AAATCATAA CATACTGTTTTTTCTTACTC 1620 CACACAGGCA TAGAGTTCT GCTATTAATAACTATGCTCA AAAATTTGT ACCTTTAGCT 680 TTTTAATTT TAAAGGGTT AATAAGAAT ATTTGATTA TATGCCTT ACTAGAGATC 1740 ATAATCAGCC ATACCACATT TTAGAGGTT TACTGT TAAAAAACCT CCCACACCTC 1800 CCCCTGAACC TAAACATAA AATAATGCA ATTTTTTG TTAACTTTT TATTGCACT 1860 TATAATGGTT ACAAATAAAG CAATAGCATC ACAAATTTCA CAAATAAAGC ATTTTTTTCA 1920 CTGCATTCTA GTGTGGTTT GTCCAAACTC ATCAATGTAT CTTATCATGT CTGATCCTT 1980 ACTCCCCCA TCCCCCCCT AACTCCCCC ATTCCGCCC ATTCTCCGCC CCATGCTA 2040 F.G. 1B U.S. Patent Nov. 30, 1993 Sheet 3 of 7 5,266,490 CTAATTTTTTTTATTTATGC AAGGCCGAGGCCGCCTCGCCTCTGAGCT ATTCCAGAAG 2100 TAGTAGGAGGCTTTTTTGG AGGCCTAGGC TTTTGCAAAA AGGAGCTCCC AGCAAAAGGC 260 CAGGAACCGT AAAAAGGCCGCGTTGCTGGC GTTTTTCCAT AGGCTCCGCC CCCCTGACGA 2220 GCATCACAAA AATCGACGCT CAATCAGAG. GTGGCGAAAC CCGACAGGAC TATAAAGATA 2280 CCAGGCTTT CCCCCTGGAA GCTCCCTCT GCGCTCTCCT GTTCCGACCC TGCCGCTTAC 2340 CGATACCTG TCCCCTTTC TCCCTTCGGG AACTGGCG CTTTCTCAAT GCTCACGCTG 2400 TAGTATCTC ATTCGGTT AGGTCGTTCG CTCCAAGCTG GGCTTGTGC ACAACCCCC 2460 CTTCAGCCC GACCCTGCGCCTTATCCGG TAACTATCGT CTTGATCCA ACCCGGTAAG 2520 ACACGACTTA TCGCCACTGG CAGCAGCCAC TGGTAACAGG ATTACAAG CGAGGTATT 2580 AGGCGTGCT ACAGATTCT TGAAGTGGTG GCCTAACTAC GGCTACACTA GAAGGACAT 2640 ATTTGGTATC TGCGCTCTC TGAAGCCAT TACCTTCGGA AAAAAGTTG GTAGCTCTT 2700 ATCCGGCAAA CAAACCACCGCTGGTAGCGG, TGGTTTTTTT GTTTGCAAGC AGCAGATTAC 2760 GCCAGAAAA AAAGATCTC AAGAAGATCC TTTGATCTTT TCTACGGGT CTGACGCTCA 2820 GTGGAACAA AACTCACGTT AAGGGATTTT GTCATGAGA TTATCAAAAA GGATCTTCAC 2880 CTAGATCCTT TTAAATAAA AATGAATTT TAAATCAATC TAAAGTATAT ATAGTAAAC 2940 TTGTCTGAC ATACCAAT GCTTAATCAG TAGGCACCT ATCTCACGA TCTTCTATT 3000 FIG. 1C U.S. Patent Nov. 30, 1993 Sheet 4 of 7 5,266,490 TCTTCATCC ATAGTTCCT. GACTCCCCGT CTGTAGATA ACTACGATAC GGGAGGGCTT 3060 ACCATCTGGC CCCATCTG CAATGATACC GCGAGACCCA CGCTCACCG CTCCAGATTT 320 ATCAGCAATA AACCAGCCAGCCGGAAGGGC CGAGCCAGA AGTGGTCCTG CAACTTTATC 3180 CGCCTCCATC CATCTATTA ATTTTGCCG GMCA: GTAAGTATT CGCCATTAA 3240 TAGTTTCGC AACTTTTG CCATTGCTAC AGGCATCTGGTTCACGCT CGTCGTTTG 3300 TATGGCTTCATTCACTCCGGTTCCCAACG ATCAAGGCGA GTTACATGAT CCCCCATGTT 3360 GTGCAAAAAA GCGGTTAGCT CCTTCGGTCC TCCGATCGTT GTCAGAAGTA AGTTGGCCGC 3420 AGTGTTATCA CTCATGGTTA TGGCAGCACT GCATAATTCT CTTACTGTCATGCCATCCGT 3480 AAGATGCTTT TCTTGACTG TAGTACTC AACCAAGTCA TCTGAGAAT AGTGTATGCG 3540 GCGACCGAGT TGCTCTTGCC CGGCTCAAT ACGGGATAAT ACCGCGCCAC ATAGCAGAAC 3600 TTTAAAAGTG CTCATCATTG GAAAACTTC TTCGGGCGA AAACTCTCAA GATCTTACC 3660 GCTTTGAGA TCCATTCGA TGTAACCCAC TCTGCACCC AACTGATCTT CAGCATCTTT 3720 TACTTTCACC AGCGTTTCTGGGTGAGCAAA AACAGGAAG CAAAATGCCG CAAAAAAGGG 3780 AATAAGGGC ACACGGAAA GTTGAATACT CATACTCTTC CTTTTTCAAT ATTATTGAAG 3840 CATTTATCA GTATTGTC TCATGAGCGG ATACATATTT GAATGTATTT AGAAAAATAA 3900 ACAAATAGGGGTTCCGCCA CATTTCCCC AAAAGTGCCA CCTG 3944 FIG.1D U.S. Patent Nov. 30, 1993 Sheet 5 of 7 5,266,490 A MUAVP CENE CST SW400R B: Sri pro - DBMHSORT ( pcEM42 PBR OR 1. PCR WITH BAM B C & D PRIVERS, 1. DIGEST WITH 1. PCR WITH SST1 A B PRER. 2. DIGEST PCR MLU, BAM, AND PRODUCT WITH SOLATE FRAGMENT. 2. DIGEST PCR BAW, SST1 PRODUCT WITH '''SV40 MLU, SST, MLU MLU SST BAM CNN (MP POLY LIGATE NKER PBR OR SSTN MLU / BAM 7AMP CN pCMX PBR OR POLYNKER FIG.2 U.S. Patent Nov. 30, 1993 Sheet 6 of 7 5,266,490 | / | U.S. Patent Nov. 30, 1993 Sheet 7 of 7 5,266,490 sO S. N. S. S. S. itC Z isO Z 59 is 9 5,266,490 1. 2 sible for intron splicing and polyadenylation of mRNA MAMMALIAN EXPRESSION VECTOR transcripts. This contiguous region of the promoter polylinker-polyadenylation site is commonly referred to 1. INTRODUCTION as the transcription unit. The vector will also contain (4) The present invention relates to the construction and a selectable marker gene(s) (e.g., the B-lactamase gene), utilization of a DNA plasmid vector, in particular, often conferring resistance to an antibiotic (such as pCMX. This vector promotes the expression of cloned ampicillin), allowing selection of initial positive trans genes when transfected into mammalian cell lines. The formants in E. Coli; and (5) sequences facilitating the functional portions of pCMX include the immediate replication of the vector in both bacterial and mamma early promoter of human cytomegalovirus (HCMV), a 10 lian hosts. "polylinker' sequence facilitating the insertional clon An example of such an expression vector is CDM8 ing of DNA sequences, an RNA splice and polyadeny (Seed, 1987, Nature 329: 840-842; Seed and Aruffo, lation signal, origins of replication from SV40 (for repli 1987, Proc. Natl. Acad. Sci. USA 84:3365-3369; Aruffo cation in COS cells) and pBR322 (for replication in E. and Seed, Proc. Natl. Acad. Sci., USA 84: 8573-8577), coli), and the gene encoding 3-lactamase, a selectable 15 the parental plasmid to the pCMX plasmid of the pres marker conferring resistance to ampicillin in bacterial ent invention. The transcription unit of CDM8 is com cells. The invention can be used to transiently or stably posed of a chimeric promoter (the human cytomegalo express eukaryotic genes within mammalian cells, that virus AD169 constitutive promoter fused to the T7 can provide an environment conducive to appropriate RNA polymerase promoter), a polylinker region and protein folding or other eukaryotic protein modifica 20 the SV40 small tumor (t) antigen splice and early region tions such as glycosylation and oligomerization. polyadenylation signals derived from
Load more

Recommended publications
  • Expression Cloning of a Human Dual-Specificity Phosphatase TOSHIO ISHIBASHI, DONALD P
    Proc. Nati. Acad. Sci. USA Vol. 89, pp. 12170-12174, December 1992 Biochemistry Expression cloning of a human dual-specificity phosphatase TOSHIO ISHIBASHI, DONALD P. BOTTARO, ANDREW CHAN, TORU MIKI, AND STUART A. AARONSON* Laboratory of Cellular and Molecular Biology, National Cancer Institute, Bethesda, MD 20892 Communicated by Leon A. Heppel, September 24, 1992 ABSTRACT Using an expression cloning strategy, we iso- substrate specificity for both phosphotyrosine and phospho- lated a cDNA encoding a human protein-tyrosine-phosphatase. serine. Bacteria expressing the kinase domain of the keratinocyte growth factor receptor (bek/fibroblast growth factor receptor 2) were infected with a fibroblast cDNA library in a phanid MATERIALS AND METHODS prokaryotic expression vector and screened with a monoclonal Plamid Construction of bek Kiame. The EcoRI-Sal I anti-phosphotyrosine antibody. Among several clones showing fragment of the mouse keratinocyte growth factor (KGF) decreased anti-phosphotyrosine recognition, one displayed receptor cDNA (15), which includes the kinase and carboxyl- phosphatase activity toward the kinase in vitro. The 4.1- terminal domains (residues 361-707), was ligated to the kilobase cDNA encoded a deduced protein of 185 amino ds EcoRP-Sal I fragment ofthe expression vector pCEV-lacZ to with limited sequence similar to the vaccinia virus phospha- generate the plasmid pCEV-bek (Fig. 1A). pCEV-lacZ is a tase VH1. The puriffied recombinant protein dephosphorlated pUC-based plasmid expression vector that produces a 3-gal several activated growth factor receptors, as well as serine- fusion protein under the control of the lac promoter (see phosphorylated casein, in vitro. Both serine and tyrosine phos- below).
    [Show full text]
  • Temporal Proteomic Analysis of HIV Infection Reveals Remodelling of The
    1 1 Temporal proteomic analysis of HIV infection reveals 2 remodelling of the host phosphoproteome 3 by lentiviral Vif variants 4 5 Edward JD Greenwood 1,2,*, Nicholas J Matheson1,2,*, Kim Wals1, Dick JH van den Boomen1, 6 Robin Antrobus1, James C Williamson1, Paul J Lehner1,* 7 1. Cambridge Institute for Medical Research, Department of Medicine, University of 8 Cambridge, Cambridge, CB2 0XY, UK. 9 2. These authors contributed equally to this work. 10 *Correspondence: [email protected]; [email protected]; [email protected] 11 12 Abstract 13 Viruses manipulate host factors to enhance their replication and evade cellular restriction. 14 We used multiplex tandem mass tag (TMT)-based whole cell proteomics to perform a 15 comprehensive time course analysis of >6,500 viral and cellular proteins during HIV 16 infection. To enable specific functional predictions, we categorized cellular proteins regulated 17 by HIV according to their patterns of temporal expression. We focussed on proteins depleted 18 with similar kinetics to APOBEC3C, and found the viral accessory protein Vif to be 19 necessary and sufficient for CUL5-dependent proteasomal degradation of all members of the 20 B56 family of regulatory subunits of the key cellular phosphatase PP2A (PPP2R5A-E). 21 Quantitative phosphoproteomic analysis of HIV-infected cells confirmed Vif-dependent 22 hyperphosphorylation of >200 cellular proteins, particularly substrates of the aurora kinases. 23 The ability of Vif to target PPP2R5 subunits is found in primate and non-primate lentiviral 2 24 lineages, and remodeling of the cellular phosphoproteome is therefore a second ancient and 25 conserved Vif function.
    [Show full text]
  • Human Intestinal Nutrient Transporters
    Gastrointestinal Functions, edited by Edgard E. Delvin and Michael J. Lentze. Nestle Nutrition Workshop Series. Pediatric Program. Vol. 46. Nestec Ltd.. Vevey/Lippincott Williams & Wilkins, Philadelphia © 2001. Human Intestinal Nutrient Transporters Ernest M. Wright Department of Physiology, UCLA School of Medicine, Los Angeles, California, USA Over the past decade, advances in molecular biology have revolutionized studies on intestinal nutrient absorption in humans. Before the advent of molecular biology, the study of nutrient absorption was largely limited to in vivo and in vitro animal model systems. This did result in the classification of the different transport systems involved, and in the development of models for nutrient transport across enterocytes (1). Nutrients are either absorbed passively or actively. Passive transport across the epithelium occurs down the nutrient's concentration gradient by simple or facilitated diffusion. The efficiency of simple diffusion depends on the lipid solubility of the nutrient in the plasma membranes—the higher the molecule's partition coefficient, the higher the rate of diffusion. Facilitated diffusion depends on the presence of simple carriers (uniporters) in the plasma membranes, and the kinetic properties of these uniporters. The rate of facilitated diffusion depends on the density, turnover number, and affinity of the uniporters in the brush border and basolateral membranes. The ' 'active'' transport of nutrients simply means that energy is provided to transport molecules across the gut against their concentration gradient. It is now well recog- nized that active nutrient transport is brought about by Na+ or H+ cotransporters (symporters) that harness the energy stored in ion gradients to drive the uphill trans- port of a solute.
    [Show full text]
  • Genomic/Plasmid Dna and Rna)
    NPTEL – Bio Technology – Genetic Engineering & Applications MODULE 4- LECTURE 1 ISOLATION AND PURIFICATION OF NUCLEIC ACIDS (GENOMIC/PLASMID DNA AND RNA) 4-1.1. Introduction Every gene manipulation procedure requires genetic material like DNA and RNA. Nucleic acids occur naturally in association with proteins and lipoprotein organelles. The dissociation of a nucleoprotein into nucleic acid and protein moieties and their subsequent separation, are the essential steps in the isolation of all species of nucleic acids. Isolation of nucleic acids is followed by quantitation of nucleic acids generally done by either spectrophotometric or by using fluorescent dyes to determine the average concentrations and purity of DNA or RNA present in a mixture. Isolating the genetic material (DNA) from cells (bacterial, viral, plant or animal) involves three basic steps- • Rupturing of cell membrane to release the cellular components and DNA • Separation of the nucleic acids from other cellular components • Purification of nucleic acids 4-1.2. Isolation and Purification of Genomic DNA Genomic DNA is found in the nucleus of all living cells with the structure of double- stranded DNA remaining unchanged (helical ribbon). The isolation of genomic DNA differs in animals and plant cells. DNA isolation from plant cells is difficult due to the presence of cell wall, as compared to animal cells. The amount and purity of extracted DNA depends on the nature of the cell. The method of isolation of genomic DNA from a bacterium comprises following steps (Figure 4-1.2.)- 1. Bacterial culture growth and harvest. 2. Cell wall rupture and cell extract preparation. Joint initiative of IITs and IISc – Funded by MHRD Page 1 of 57 NPTEL – Bio Technology – Genetic Engineering & Applications 3.
    [Show full text]
  • Eukaryotic Expression Cloning with an Antimetastatic
    [CANCER RESEARCH 59, 3812–3820, August 1, 1999] Eukaryotic Expression Cloning with an Antimetastatic Monoclonal Antibody Identifies a Tetraspanin (PETA-3/CD151) as an Effector of Human Tumor Cell Migration and Metastasis1 Jacqueline E. Testa,2,3 Peter C. Brooks,4 Jian-Min Lin,5 and James P. Quigley3 Department of Pathology, State University of New York at Stony Brook, Stony Brook, New York 11794 ABSTRACT interactions with different matrix proteins. Our efforts to identify novel metastasis-associated antigens have, therefore, focused on the tumor cell A monoclonal antibody (mAb), 50-6, generated by subtractive immuniza- surface. As our model system, we have used a highly metastatic human tion, was found to specifically inhibit in vivo metastasis of a human epider- epidermoid carcinoma cell line, HEp-3, which disseminates to host lung moid carcinoma cell line, HEp-3. The cDNA of the cognate antigen of mAb 50-6 was isolated by a modified eukaryotic expression cloning protocol from tissue. The distinct characteristics and behavior patterns of this tumor cell a HEp-3 library. Sequence analysis identified the antigen as PETA-3/CD151, line have been described by Ossowski in a series of papers published a recently described member of the tetraspanin family of proteins. The cloned between 1980 and 1998 (7–9). These cells are very aggressive and readily antigen was also recognized by a previously described antimetastatic anti- give rise to metastasizing tumors in both the chicken embryo (10–12) and body, mAb 1A5. Inhibition of HEp-3 metastasis by the mAbs could not be in the nude mouse model (13, 14).
    [Show full text]
  • A Genome-Scale Protein Interaction Profile of Drosophila P53 Uncovers Additional Nodes of the Human P53 Network
    A genome-scale protein interaction profile of Drosophila p53 uncovers additional nodes of the human p53 network Andrea Lunardia,b,1, Giulio Di Minina,b,1, Paolo Proveroc, Marco Dal Ferroa,b, Marcello Carottia,b, Giannino Del Sala,b, and Licio Collavina,b,2 aLaboratorio Nazionale Consorzio Interuniversitario per le Biotecnologie (LNCIB), Area Science Park, 34012 Trieste, Italy; bDipartimento di Scienze della Vita, Università degli Studi di Trieste, 34129 Trieste, Italy; and cMolecular Biotechnology Center and Dipartimento di Genetica, Biologia e Biochimica, Università degli Studi di Torino, 10126 Torino, Italy Communicated by Marc W. Kirschner, Harvard Medical School, Boston, MA, March 2, 2010 (received for review June 9, 2009) Thegenomeofthefruitfly Drosophila melanogaster contains a single to better understand the functions of all members of the p53 family p53-like protein, phylogenetically related to the ancestor of the mam- in mammals. malian p53 family of tumor suppressors. We reasoned that a compre- hensive map of the protein interaction profile of Drosophila p53 Results (Dmp53) might help identify conserved interactions of the entire Small Pool in Vitro Expression Cloning (IVEC) Screen for Drosophila p53 family in man. Using a genome-scale in vitro expression cloning p53 Interactors. The Drosophila Gene Collection (DGC) comprises approach, we identified 91 previously unreported Dmp53 interactors, full-length annotated cDNAs of the majority of known genes in considerably expanding the current Drosophila p53 interactome. D. melanogaster (16). Clones from DGC1.0 and DGC2.0 were pu- Looking for evolutionary conservation of these interactions, we rified and pooled in groups of 24. Recombinant maltose binding tested 41 mammalian orthologs and found that 37 bound to one or protein (MBP)-Dmp53 fusion protein was prepared from Bacu- more p53-family members when overexpressed in human cells.
    [Show full text]
  • Expression Cloning of the Cdna for a Polypeptide Associated With
    Proc. Natl. Acad. Sci. USA Vol. 92, pp. 1495-1499, February 1995 Physiology Expression cloning of the cDNA for a polypeptide associated with rat hepatic sinusoidal reduced glutathione transport: Characteristics and comparison with the canalicular transporter JLAN-Ri YI*, SHILUN LU*, JOSE FERNAINDEZ-CHECAt, AND NEIL KAPLOWITZ*1 *Division of Gastrointestinal and Liver Diseases, Department of Medicine, University of Southern California School of Medicine, Los Angeles, CA 90033; and tLiver Unit, Hospital Clinic i Provincial, Universidad de Barcelona, Barcelona 08036, Spain Communicated by Leonard A. Herzenberg, Stanford University, Stanford, CA, November 23, 1994 (received for review July 27, 1994) ABSTRACT Using the Xenopus oocyte expression system, canalicular systems are facilitative, bidirectional, and exhibit we previously identified an -4-kb fraction of mRNA from rat low affinity and high capacity (5-7). However, differences in liver that expresses sulfobromophthalein reduced glutathione certain physiological characteristics of the two low-affinity S-conjugate (BSP-GSH)-insensitive and an -2.5-kb fraction transport systems permit their functional distinction. Sinusoi- expressing BSP-GSH-sensitive reduced glutathione (GSH) dal GSH transport is cis-inhibited by sulfobromophthalein transport. From the former, a 4.05-kb cDNA was cloned and GSH S-conjugate (BSP-GSH) (7, 8), trans-inhibited by me- characterized as the putative rat canalicular GSH trans- thionine (9-11) or cystathionine (12), and unchanged after porter. Starting with a cDNA library constructed from the phenobarbital treatment (6, 13). The low-affinity canalicular -2.5-kb fraction, we have now isolated a single clone that GSH transport is not affected by these inhibitors (12, 14) but leads to expression of a BSP-GSH- and cystathionine- is induced by phenobarbital (6, 13).
    [Show full text]
  • Development of a Highly Efficient Expression Cdnacloning System
    Proc. Nati. Acad. Sci. USA Vol. 88, pp. 5167-5171, June 1991 Cell Biology Development of a highly efficient expression cDNA cloning system: Application to oncogene isolation (mouse hepatoma/stable expression/plasmid rescue/B-raf gene/in vivo activation) TORU MIKI*, TIMOTHY P. FLEMING*, MARCO CRESCENZI*t, CHRISTOPHER J. MOLLOY*t, SHELLEY B. BLAM*§, STEVEN H. REYNOLDS¶, AND STUART A. AARONSON*JI *Laboratory of Cellular and Molecular Biology, National Cancer Institute, Building 37, Room 1E24, Bethesda, MD 20892; and sNational Institute of Environmental Health Sciences, Biological Risk Assessment Program, Research Triangle Park, NC 27709 Communicated by G. D. Aurbach, March 19, 1991 (receivedfor review October 16, 1990) ABSTRACT We developed an expression cDNA cloning Cells were maintained in Dulbecco's modified Eagle's me- system capable of generating high-complexity libraries with dium (DMEM)/5% calf serum. unidirectionally inserted cDNA fragments and allowing effi- Plasmid Rescue. Genomic DNA (1.22g) was cleaved byXho cient plasmid rescue. As an application of this system, a cDNA I and ligated at the concentration of3 ng/,ul. Four aliquots (100 library was constructed from an NIH 3T3 transformant in- Al each) of PLK-F' competent cells (Stratagene) were trans- duced by mouse hepatocellular carcinoma DNA. Transfection formed by the ligated DNA, as directed by the manufacturer. of NIH 3T3 cells by the library DNA led to the detection of After heat shock, the cells were diluted 10-fold with S.O.C. several transformed foci from which identical plasmids with medium (BRL) containing 1 mM isopropyl /8-D-thiogalacto- transforming ability could be rescued.
    [Show full text]
  • F. Katzen Et Al. the Past, Present and Future of Cell-Free Protein Synthesis
    Review TRENDS in Biotechnology Vol.23 No.3 March 2005 The past, present and future of cell-free protein synthesis Federico Katzen1, Geoffrey Chang2 and Wieslaw Kudlicki1 1Invitrogen Corporation, 1600 Faraday Avenue, Carlsbad, CA 92008, USA 2Department of Molecular Biology, The Scripps Research Institute, 10550 North Torrey Pines Road, CB-105, La Jolla, CA 92037, USA Recent technical advances have revitalized cell-free Configurations and history expression systems to meet the increasing demands In vitro translation systems are based on the early for protein synthesis. Cell-free systems offer several demonstration that cell integrity is not required for advantages over traditional cell-based expression protein synthesis to occur. In its simplest form, translation methods, including the easy modification of reaction can be accomplished using a crude lysate from any given conditions to favor protein folding, decreased sensitivity organism (that provides the translational machinery, to product toxicity and suitability for high-throughput accessory enzymes, tRNA and factors) in combination strategies because of reduced reaction volumes and with exogenously added RNA template, amino acids and process time. Moreover, improvements in translation an energy supply. This classical in vitro translation efficiency have resulted in yields that exceed a milligram scheme is called ‘uncoupled’ as opposed to the ‘coupled’ of protein per milliliter of reaction mix. We review the or ‘combined’ transcription and translation configuration advances on this expanding
    [Show full text]
  • Working with Molecular Genetics Chpt. 3: Isolating and Analyzing Genes
    Working with Molecular Genetics Chpt. 3: Isolating and Analyzing Genes CHAPTER 3 ISOLATING AND ANALYZING GENES Recombinant DNA, Polymerase Chain Reaction and Applications to Eukaryotic Gene Structure and Function The first two chapters covered many important aspects of genes, such as how they function in inheritance, how they code for protein (in general terms) and their chemical nature. All this was learned without having a single gene purified. A full understanding of a gene, or the entire set of genes in a genome, requires that they be isolated and then studied intensively. Once a gene is “in hand”, in principal one can determine both its biochemical structures and its function(s) in an organism. One of the goals of biochemistry and molecular genetics is to assign particular functions to individual or composite structures. This chapter covers some of the techniques commonly used to isolate genes and illustrates some of the analyses that can be done on isolated genes. Methods to purify some abundant proteins were developed early in the 20th century, and some of the experiments on the fine structure of the gene (colinearity of gene and protein for trpA and tryptophan synthase) used microbial genetics and proteins sequencing. However, methods to isolate genes were not developed until the 1960’s, and the were applicable to only a few genes. All this changed in the late 1970’s with the development of recombinant DNA technology, or molecular cloning. This technique enabled researchers to isolate any gene from any organism from which one could isolate intact DNA (or RNA). The full potential to provide access to all genes of organisms is now being realized as full genomes are sequenced.
    [Show full text]
  • Basics of Molecular Biology
    16 Basics of Molecular Biology Yinghui Li ([email protected]), Dingsheng Zhao State Key Laboratory of Space Medicine Fundamentals and Application, Astronaut Research and Training Center of China, Beijing 100094, China 16.1 Introduction Molecular biology is the study of biology on molecular level. The field overlaps with areas of biology and chemistry, particularly genetics and biochemistry. Molecular biology chiefly concerns itself with understanding the interactions between the various systems of a cell, including the interactions between DNA (deoxyribonucleic acid), RNA (Ribonucleic acid) and protein biosynthesis as well as learning how these interactions are regulated[1]. Researchers in molecular biology use specific techniques native to molecular biology (see the techniques section), but they combine these with techniques and ideas from genetics and biochemistry. There is not a definite line between these disciplines. Today the terms molecular biology and biochemistry are nearly interchangeable. Biochemistry is the study of chemical substances and vital processes occurring in living organisms. Biochemists focus heavily on the role, function, and structure of biomolecules. The study of chemistry behind biological processes and the synthesis of biologically active molecules are examples of biochemistry. Genetics is the study of the effects of genetic differences on organisms. Often this can be inferred by the absence of a normal component (e.g. one gene). Mutants lack one or more functional components with respect to the so-called “wild type” or normal phenotype. Genetic interactions (epistasis) can often confound simple interpretations of such “knock-out” studies. Molecular biology is the study of molecular underpinnings of the process of replication, transcription and translation of the genetic material.
    [Show full text]
  • Expression Cloning of a Human Cdna Encoding Folylpoly (Gamma
    Proc. Nati. Acad. Sci. USA Vol. 89, pp. 9151-9155, October 1992 Biochemistry Expression cloning of a human cDNA encoding folylpoly(y- glutamate) synthetase and determination of its primary structure TIMOTHY A. GARROW*, ARIE ADMONt, AND BARRY SHANE*t *Department of Nutritional Sciences and tHoward Hughes Medical Institute, Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720 Communicated by Jesse C. Rabinowitz, June 25, 1992 ABSTRACT A human cDNA for folylpoly(y-glutamate) have been reported and pig liver FPGS has been purified to synthetase [FPGS; tetrahydrofolate:L-glutamate r-ligase (ADP homogeneity (19) but, in each case, only small amounts of forming), EC 6.3.2.17] has been cloned by functional comple- protein have been obtained, which has limited characteriza- mentation of an Escherichia coli foiC mutant. The cDNA tion to kinetic analyses (15-22). The low abundance and encodes a 545-residue protein of Mr 60,128. The deduced instability of mammalian FPGS have complicated its purifi- sequence has regions that are highly homologous to peptide cation in sufficient quantity to carry out mechanistic studies. sequences obtained from purified pig liver FPGS and shows CHO-human (23) and CHO-mouse (24) hybrids have been limited homology to the E. coli and Lactobacilus casei FPGSs. used to localize the human and murine FPGS genes to Expression ofthe cDNA in E. coli results in elevated expression chromosomes 9 and 2, respectively. To aid in the further of an enzyme with characteristics of mammalian FPGS. Ex- characterization of the mammalian protein and to study its pression of the cDNA in AUXB1, a mammalian cell lacking regulation, we initially attempted to clone the human FPGS FPGS activity, overcomes the cell's requirement for thymidine gene by purifying human sequences capable of complement- and purines but does not overcome the cell's glycine auxotro- ing CHO AUXB1 cells to the wild-type phenotype using phy, consistent with expression of the protein in the cytosol but multiple rounds of DNA transfection (25).
    [Show full text]