Supporting Information

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Supporting Information Hübner et al. 10.1073/pnas.1321533111 SI Materials and Methods imposed, disallowing a direct transition between low and high Sampling and DNA Extractions. Single nucleotide polymorphism states (7). For each chromosome arm, parameters with highest was tested in Drosophila melanogaster isofemale lines established log-likelihood were used in the HMM. Assignment of SNPs to from females inseminated in nature and collected on the oppo- each of the detected “hidden” distributions was conducted by site slopes of Nahal Oren canyon (Carmel massif, Israel) in local decoding of each point to a posteriori most probable state. A October 2010. All flies were reared on standard instant Dro- local decoding approach was preferred over the Viterbi global sophila food medium (Carolina Biological Supply Co.) in half- decoding algorithm (10) because the later maximized the joint pint milk bottles at a temperature of 24 ± 1 °C and on a 12:12 distribution of the hidden states even at the cost of local false light/dark cycle. For the molecular experiments, we used flies assignments. from 32 isofemale lines [16 from north facing slope (NFS) and 16 To search for high-differentiation regions along chromosome from south facing slope (SFS)]. DNA was extracted from 100 arms, we used 10-kb nonoverlapping windows. For each window, males of each line using DNAzol Genomic DNA Isolation Re- the level of differentiation was represented by two parameters, agent (Molecular Research Center Inc.) according to the man- LI = nL/nT (“low island”)andHI= nH/nT (“high island”), where ufacturer’s protocol. Equal amounts of ∼1 μg of DNA from each nT is the total number of SNPs within each window whereas nH line were pooled to make slope representations. Illumina paired- and nL are the numbers of SNPs assigned in the HMM step to end libraries were constructed and sequenced with HiSeq, 100- either high- or low-differentiation states, respectively. Following cycle, at ∼40× coverage per population. this step, a permutation test was conducted to detect genomic regions with significant enrichment of HI scores. For each per- Mapping Reads and Data Processing. Paired-end reads were filtered mutation, Fst values were taken randomly from the whole set for minimum average base quality score of 20 and a minimum of SNPs within a chromosome arm together with their corre- length of 50 bp using PoPoolation (1). Trimmed reads were sponding assignment to high-differentiation hidden state. High- mapped to the D. melanogaster reference genome using the differentiation score HI was then calculated for each window. Burrows–Wheeler aligner (BWA) v0.6.2 (2) with the following This reshuffling process was repeated 10,000 times, allowing only parameters: -n 0.01 -l 100 -o 1-d 12 -e 12. Paired-end data were significantly differentiated regions to be compared with random merged to single files in sam format with the “sampe” option of expectations. BWA, converted to binary alignment/map format and filtered for Significantly differentiated genomic regions between slopes a minimum mapping quality of 20 using SAMtools v1.18 (3). were then inspected for the type and strength of selection using Files of both NFS and SFS populations were further converted the Tajima’s D scores for each window as obtained with Po- to a pileup file and synchronized for downstream analysis of poolation (1). Trimmed files of each population were converted allele frequency differences between the slopes of the canyon. to a pileup format separately and used to calculate population For each detected SNP, differentiation between populations was measures over a nonoverlapping window of size 10 kb in Po- < − calculated using both Fst and Fisher exact test as implemented in Poolation. A score of D 2 is indicative of a recent selective Popoolation2 (4). For each of the two populations, footprints of sweep (fixation of novel mutation) followed by a slow recovery of natural selection were detected using Tajima’s D calculated over variation, thus an excess of rare alleles. On the other hand, D > 2 nonoverlapping 10-kb windows along chromosome arms. Trim- is indicative of small allele frequency differences due to bal- med files of each population were converted to a pileup format ancing selection. Thus, combining both differentiation and se- separately and used to calculate population measures over lection scores can be used for detection of genomic regions a nonoverlapping window of size 10 kb in PoPoolation using corresponding to interslope differentiation caused by alternative a minimum allele frequency of 2, minimum quality of 20, mini- selection (small D and significant HI). mum coverage of 6, and maximum coverage of 400. Gene Ontology Term Analysis. To study the biological significance Detection of Interslope Selective Differentiated Genomic Regions. To of genes under diversifying selection, an enrichment analysis of reveal genomic regions with significant interslope differentiation, gene ontology (GO) terms was conducted with the Bioconductor we used Hidden Markov Model (HMM) analysis (5–7). HMM package gosEq (11), which accounts for the gene-length bias. was used to discriminate between the distributions of three hidden Genes located in genomic regions found to be under differen- states corresponding to high, moderate, and low interslope dif- tiation between slopes (HI) were further tested for their asso- ferentiation and to assign each SNP to a corresponding state. We ciation with the detected differentiation. For each SNP within thus applied an HMM as implemented in the R package “Hid- each gene, a Fisher exact test was performed, and the proportion fi < denMarkov” (8) using interslope Fst values as were obtained for of signi cantly differentiated SNPs (P 0.01) was recorded for each SNP from PoPoolation2 software. Additional parameters each gene. Genes with significantly high proportion of differen- for the HMM are the transition probability matrix between tiated SNPs (P adjusted < 0.0001) were selected for downstream states, emission probabilities, and states distribution parameters. GO enrichment analysis. A list of all genes (significant and Evaluation of these parameters was made within the HMM nonsignificant) and their corresponding sequence length was framework using the expectation maximization Baum–Weltch used to generate the probability weighting function, which en- algorithm (9) for each chromosome arm separately, by enabling ables one to correct for the gene-length bias. For time efficiency, a maximum of 1,000 iterations to reach convergence. Initial pa- the Wallenius distribution method (11) was used as an approx- rameters were defined from the data using a maximum likelihood imation for the H0 distribution. Gene length was calculated for approach by launching the Baum–Weltch algorithm 100 times each gene using FlyBase resources (batch download tool), based with randomly sampled values from a predefined parameter on sequence minimum and maximum locations (available for space. Single-SNP Fst values were found to follow a gamma dis- D. melanogaster reference genome v5.31). We generated a list of tribution, with rate and shape parameters extending between GO annotations for the whole genome using AmiGO v1.8 soft- 0–300 and 0–60, respectively. A constrained transition matrix was ware, the official web-based set of tools for searching and Hübner et al. www.pnas.org/cgi/content/short/1321533111 1of5 browsing the Gene Ontology database (12), which served to physical position of the gene loci in the chromosome sequence determine significant GO terms based on the chosen criteria. relative to the centromere (dist, Mb) known as strong suppressor Significantly overrepresented GO terms were further corrected of recombination (“centromeric effect”) (for a review, see ref. for multiple comparisons using the Benjamini–Hochberg method 17). The two variables, r and dist, allow taking into account (13). The Functional Annotation Clustering tool in DAVID (v. the centromeric effect and local variation of recombination su- 6.7) (14, 15) was used for an in-depth GO enrichment analysis perimposed on the centromeric effect. The effect of recom- and clustering. We performed functional annotation clustering bination was tested for each of the large chromosomal arms for GO terms with high-classification stringency. using rank correlation of r and dist, with the following param- Effects of Recombination. In the current study, we tested, albeit eters calculated for the components of gene sequence [coding indirectly, the effect of recombination on population polymor- DNA sequences (CDSs), introns, 5′ UTR and 3′ UTR, and the phism in the canyon for SNP sites. The effect of recombination total gene sequence]: density of polymorphic SNPs per kb was tested based on the local recombination rates using data from (parameter all/kb) and density of SNPs significantly differen- Marais et al. (16), represented by the score r, cM/Mb, and tiated between the slopes (parameter sig/kb). 1. Kofler R, et al. (2011) PoPoolation: A toolbox for population genetic analysis of next 10. Viterbi AJ (1967) Error bounds for convolutional codes and an asymptotically generation sequencing data from pooled individuals. PLoS ONE 6(1):e15925. optimum decoding algorithm. IEEE Trans Inf Theory 13:260–269. 2. Li H, Durbin R (2009) Fast and accurate short read alignment with Burrows-Wheeler 11. Young MD, Wakefield MJ, Smyth GK, Oshlack A (2010) Gene ontology analysis for transform. Bioinformatics 25(14):1754–1760. RNA-seq: Accounting for selection bias. Genome Biol 11(2):R14. 3. Li H, et al.; 1000 Genome Project Data Processing Subgroup (2009) The Sequence 12. Carbon S, et al.; AmiGO Hub; Web Presence Working Group (2009) AmiGO: Online Alignment/Map format and SAMtools. Bioinformatics 25(16):2078–2079. access to ontology and annotation data. Bioinformatics 25(2):288–289. 4. Kofler R, Pandey RV, Schlötterer C (2011) PoPoolation2: Identifying differentiation 13. Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: A practical and between populations using sequencing of pooled DNA samples (Pool-Seq).
Recommended publications
  • Multi-Ancestry Genome-Wide Gene-Sleep Interactions Identify Novel

    Multi-Ancestry Genome-Wide Gene-Sleep Interactions Identify Novel

    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.29.123505; this version posted May 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Multi-ancestry genome-wide gene-sleep interactions identify novel loci for blood pressure Heming Wang1,2,*, Raymond Noordam3,* , Brian E Cade1,2,*, Karen Schwander4,*, Thomas W Winkler5,*, Jiwon Lee1,*, Yun Ju Sung4,*, Amy R. Bentley6,*, Alisa K Manning2,7, Hugues Aschard8,9, Tuomas O Kilpeläinen10,11, Marjan Ilkov12, Michael R Brown13, Andrea R Horimoto14, Melissa Richard15, Traci M Bartz16, Dina Vojinovic17,18, Elise Lim19, Jovia L Nierenberg20, Yongmei Liu21, Kumaraswamynaidu Chitrala22, Tuomo Rankinen23, Solomon K Musani24, Nora Franceschini25, Rainer Rauramaa26, Maris Alver27,28, Phyllis Zee29, Sarah E Harris30, Peter J van der Most31, Ilja M Nolte31, Patricia B Munroe32,33, Nicholette D Palmer34, Brigitte Kühnel35,36, Stefan Weiss37,38, Wanqing Wen39, Kelly A Hall40, Leo-Pekka Lyytikäinen41,42, Jeff O'Connell43,44, Gudny Eiriksdottir12, Lenore J Launer22, Paul S de Vries13, Dan E Arking45, Han Chen13,46, Eric Boerwinkle13,47, Jose E Krieger14, Pamela J Schreiner48, Stephen S Sidney49, James M Shikany50, Kenneth Rice51, Yii-Der Ida Chen52, Sina A Gharib53, Joshua C Bis54, Annemarie I Luik17, M Arfan Ikram17,55, André G Uitterlinden17, Najaf Amin17, Hanfei Xu19, Daniel Levy19,56, Jiang He20, Kurt
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
  • Structural and Functional Analysis of Muskelin and Other Kelch-Repeat Proteins

    Structural and Functional Analysis of Muskelin and Other Kelch-Repeat Proteins

    structural and Functional Analysis of Muskelin by Soren Prag Hansen A Thesis submitted to the University College London for the degree of PhD September 2003 Department of Biochemistry and Molecular Biology University College London Gower Street London UK ProQuest Number: U643396 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest. ProQuest U643396 Published by ProQuest LLC(2016). Copyright of the Dissertation is held by the Author. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC. ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 Abstract Muskelin is an intracellular, kelch-repeat protein that is functionally involved in cell spreading on thrombospondin-1. The aim of this thesis project was to investigate the role of muskelin domains in the subcellular distribution and the regulation of the protein using cellular, biochemical, and bioinformatic approaches. Using bioinformatics to compare muskelin orthologues from Mus musculus, Homo sapiens, Rattus norvegicus, Danio rerio, Drosophila meianogaster, and Anopheles gambiae, highly conserved regions within muskelin were identified, with the combination of a discoidin domain, a LisH motif, a C-terminal to LisH motif, and six kelch repeats. A further bioinformatic analysis of the kelch repeat proteins in whole genomes from Homo sapiens, Drosophila meianogaster, and Anopheles gambiae, demonstrated that muskelin has a unique molecular architecture amongst the large family of kelch repeat proteins.
  • Characterization of the Long Terminal Repeat of the Endogenous

    Characterization of the Long Terminal Repeat of the Endogenous

    www.nature.com/scientificreports OPEN Characterization of the Long Terminal Repeat of the Endogenous Retrovirus-derived microRNAs in Received: 31 May 2018 Accepted: 12 September 2019 the Olive Flounder Published: xx xx xxxx Hee-Eun Lee1,2, Ara Jo1,2, Jennifer Im1,2, Hee-Jae Cha 3, Woo-Jin Kim4, Hyun Hee Kim5,6, Dong-Soo Kim7, Won Kim8, Tae-Jin Yang 9 & Heui-Soo Kim2,10 Endogenous retroviruses (ERVs) have been identifed at diferent copy numbers in various organisms. The long terminal repeat (LTR) element of an ERV has the capacity to exert regulatory infuence as both a promoter and enhancer of cellular genes. Here, we describe olive founder (OF)-ERV9, derived from chromosome 9 of the olive founder. OF-ERV9-LTR provide binding sites for various transcription factors and showed enhancer activity. The OF-ERV9-LTR demonstrates high sequence similarity with the 3′ untranslated region (UTR) of various genes that also contain seed sequences (TGTTTTG) that bind the LTR-derived microRNA(miRNA), OF-miRNA-307. Additionally, OF-miRNA-307 collaborates with transcription factors located in OF-ERV9-LTR to regulate gene expression. Taken together, our data facilitates a greater understanding of the molecular function of OF-ERV families and suggests that OF- miRNA-307 may act as a super-enhancer miRNA regulating gene activity. Paralichthys olivaceus, known as olive founder (OF) is an economically important marine fatfsh which is exten- sively cultured in Korea, China and Japan. Due to their high economic value, there are several selective breed- ing programs in place, such as those involving sex manipulation, owing to diferences in growth speed and size between male and female olive founders1–3.
  • Supplementary Data Genbank Or OSE Vs RO NIA Accession Gene Name Symbol FC B-Value H3073C09 11.38 5.62 H3126B09 9.64 6.44 H3073B0

    Supplementary Data Genbank Or OSE Vs RO NIA Accession Gene Name Symbol FC B-Value H3073C09 11.38 5.62 H3126B09 9.64 6.44 H3073B0

    Supplementary Data GenBank or OSE vs RO NIA accession Gene name Symbol FC B-value H3073C09 11.38 5.62 H3126B09 9.64 6.44 H3073B08 9.62 5.59 AU022767 Exportin 4 Xpo4 9.62 6.64 H3073B09 9.59 6.48 BG063925 Metallothionein 2 Mt2 9.23 18.89 H3064B07 9.21 6.10 H3073D08 8.28 6.10 AU021923 Jagged 1 Jag1 7.89 5.93 H3070D08 7.54 4.58 BG085110 Cysteine-rich protein 1 (intestinal) Crip1 6.23 16.40 BG063004 Lectin, galactose binding, soluble 1 Lgals1 5.95 10.36 BG069712 5.92 2.34 BG076976 Transcribed locus, strongly similar to NP_032521.1 lectin, galactose binding, soluble 1 5.64 8.36 BG062930 DNA segment, Chr 11, Wayne State University 99, expressed D11Wsu99e 5.63 8.76 BG086474 Insulin-like growth factor binding protein 5 Igfbp5 5.50 15.95 H3002d11 5.13 20.77 BG064706 Keratin complex 1, acidic, gene 19 Krt1-19 5.06 9.07 H3007A09 5.05 2.46 H3065F02 4.84 5.43 BG081752 4.81 1.25 H3010E09 4.71 11.90 H3064c11 4.43 1.00 BG069711 Transmembrane 4 superfamily member 9 Tm4sf9 4.29 1.23 BG077072 Actin, beta, cytoplasmic Actb 4.29 3.01 BG079788 Hemoglobin alpha, adult chain 1 Hba-a1 4.26 6.63 BG076798 4.23 0.80 BG074344 Mesothelin Msln 4.22 6.97 C78835 Actin, beta, cytoplasmic Actb 4.16 3.02 BG067531 4.15 1.61 BG073468 Hemoglobin alpha, adult chain 1 Hba-a1 4.10 6.23 H3154H07 4.08 5.38 AW550167 3.95 5.66 H3121B01 3.94 5.94 H3124f12 3.94 5.64 BG073608 Hemoglobin alpha, adult chain 1 Hba-a1 3.84 5.32 BG073617 Hemoglobin alpha, adult chain 1 Hba-a1 3.84 5.75 BG072574 Hemoglobin alpha, adult chain 1 Hba-a1 3.82 5.93 BG072211 Tumor necrosis factor receptor superfamily,
  • Molecular Signatures Differentiate Immune States in Type 1 Diabetes Families

    Molecular Signatures Differentiate Immune States in Type 1 Diabetes Families

    Page 1 of 65 Diabetes Molecular signatures differentiate immune states in Type 1 diabetes families Yi-Guang Chen1, Susanne M. Cabrera1, Shuang Jia1, Mary L. Kaldunski1, Joanna Kramer1, Sami Cheong2, Rhonda Geoffrey1, Mark F. Roethle1, Jeffrey E. Woodliff3, Carla J. Greenbaum4, Xujing Wang5, and Martin J. Hessner1 1The Max McGee National Research Center for Juvenile Diabetes, Children's Research Institute of Children's Hospital of Wisconsin, and Department of Pediatrics at the Medical College of Wisconsin Milwaukee, WI 53226, USA. 2The Department of Mathematical Sciences, University of Wisconsin-Milwaukee, Milwaukee, WI 53211, USA. 3Flow Cytometry & Cell Separation Facility, Bindley Bioscience Center, Purdue University, West Lafayette, IN 47907, USA. 4Diabetes Research Program, Benaroya Research Institute, Seattle, WA, 98101, USA. 5Systems Biology Center, the National Heart, Lung, and Blood Institute, the National Institutes of Health, Bethesda, MD 20824, USA. Corresponding author: Martin J. Hessner, Ph.D., The Department of Pediatrics, The Medical College of Wisconsin, Milwaukee, WI 53226, USA Tel: 011-1-414-955-4496; Fax: 011-1-414-955-6663; E-mail: [email protected]. Running title: Innate Inflammation in T1D Families Word count: 3999 Number of Tables: 1 Number of Figures: 7 1 For Peer Review Only Diabetes Publish Ahead of Print, published online April 23, 2014 Diabetes Page 2 of 65 ABSTRACT Mechanisms associated with Type 1 diabetes (T1D) development remain incompletely defined. Employing a sensitive array-based bioassay where patient plasma is used to induce transcriptional responses in healthy leukocytes, we previously reported disease-specific, partially IL-1 dependent, signatures associated with pre and recent onset (RO) T1D relative to unrelated healthy controls (uHC).
  • MKLN1 Splicing Defect in Dogs with Lethal Acrodermatitis

    MKLN1 Splicing Defect in Dogs with Lethal Acrodermatitis

    RESEARCH ARTICLE MKLN1 splicing defect in dogs with lethal acrodermatitis Anina Bauer1,2, Vidhya Jagannathan1,2, Sandra HoÈ gler3, Barbara Richter3, Neil A. McEwan4, Anne Thomas5, Edouard Cadieu6, Catherine AndreÂ6, Marjo K. HytoÈ nen7,8,9, Hannes Lohi7,8,9, Monika M. Welle2,10, Petra Roosje2,11, Cathryn Mellersh12, Margret L. Casal13, Tosso Leeb1,2* 1 Institute of Genetics, Vetsuisse Faculty, University of Bern, Bern, Switzerland, 2 DermFocus, University of Bern, Bern, Switzerland, 3 Department of Pathobiology, Institute of Pathology and Forensic Veterinary Medicine, University of Veterinary Medicine Vienna, Vienna, Austria, 4 Department of Small Animal Clinical a1111111111 Sciences, The University of Liverpool, Leahurst Campus, Neston, Cheshire, United Kingdom, 5 Antagene, a1111111111 Animal Genetics Laboratory, La Tour de Salvagny, France, 6 Institut de GeÂneÂtique et DeÂveloppement de a1111111111 Rennes (IGDR), CNRS-UMR6290, Universite Rennes1, Rennes, France, 7 Department of Veterinary a1111111111 Biosciences, University of Helsinki, Helsinki, Finland, 8 Research Programs Unit, Molecular Neurology, a1111111111 University of Helsinki, Helsinki, Finland, 9 FolkhaÈlsan Institute of Genetics, University of Helsinki, Helsinki, Finland, 10 Institute of Animal Pathology, Vetsuisse Faculty, University of Bern, Bern, Switzerland, 11 Division of Clinical Dermatology, Department of Clinical Veterinary Medicine, Vetsuisse Faculty, University of Bern,Bern, Switzerland, 12 Kennel Club Genetics Centre, Animal Health Trust, Kentford, Newmarket, Suffolk, United Kingdom, 13 Section of Medical Genetics, Department of Clinical Sciences & Advanced Medicine, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, OPEN ACCESS United States of America Citation: Bauer A, Jagannathan V, HoÈgler S, * [email protected] Richter B, McEwan NA, Thomas A, et al. (2018) MKLN1 splicing defect in dogs with lethal acrodermatitis.
  • Supplementary Tables S1-S3

    Supplementary Tables S1-S3

    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
  • Castration Delays Epigenetic Aging and Feminizes DNA

    Castration Delays Epigenetic Aging and Feminizes DNA

    RESEARCH ARTICLE Castration delays epigenetic aging and feminizes DNA methylation at androgen- regulated loci Victoria J Sugrue1, Joseph Alan Zoller2, Pritika Narayan3, Ake T Lu4, Oscar J Ortega-Recalde1, Matthew J Grant3, C Simon Bawden5, Skye R Rudiger5, Amin Haghani4, Donna M Bond1, Reuben R Hore6, Michael Garratt1, Karen E Sears7, Nan Wang8, Xiangdong William Yang8,9, Russell G Snell3, Timothy A Hore1†*, Steve Horvath4†* 1Department of Anatomy, University of Otago, Dunedin, New Zealand; 2Department of Biostatistics, Fielding School of Public Health, University of California, Los Angeles, Los Angeles, United States; 3Applied Translational Genetics Group, School of Biological Sciences, Centre for Brain Research, The University of Auckland, Auckland, New Zealand; 4Department of Human Genetics, David Geffen School of Medicine, University of California, Los Angeles, Los Angeles, United States; 5Livestock and Farming Systems, South Australian Research and Development Institute, Roseworthy, Australia; 6Blackstone Hill Station, Becks, RD2, Omakau, New Zealand; 7Department of Ecology and Evolutionary Biology, UCLA, Los Angeles, United States; 8Center for Neurobehavioral Genetics, Semel Institute for Neuroscience and Human Behavior, University of California, Los Angeles (UCLA), Los Angeles, United States; 9Department of Psychiatry and Biobehavioral Sciences, David Geffen School of Medicine at UCLA, Los Angeles, United States *For correspondence: Abstract In mammals, females generally live longer than males. Nevertheless, the mechanisms [email protected] (TAH); underpinning sex-dependent longevity are currently unclear. Epigenetic clocks are powerful [email protected] (SH) biological biomarkers capable of precisely estimating chronological age and identifying novel †These authors contributed factors influencing the aging rate using only DNA methylation data. In this study, we developed the equally to this work first epigenetic clock for domesticated sheep (Ovis aries), which can predict chronological age with a median absolute error of 5.1 months.
  • Short- and Long-Term Impact of Hyperoxia on the Blood and Retinal Cells’ Transcriptome in a Mouse Model of Oxygen- Induced Retinopathy

    Short- and Long-Term Impact of Hyperoxia on the Blood and Retinal Cells’ Transcriptome in a Mouse Model of Oxygen- Induced Retinopathy

    www.nature.com/pr BASIC SCIENCE ARTICLE OPEN Short- and long-term impact of hyperoxia on the blood and retinal cells’ transcriptome in a mouse model of oxygen- induced retinopathy Magdalena Zasada1, Anna Madetko-Talowska2, Cecilie Revhaug3,4, Anne Gro W. Rognlien3,4, Lars O. Baumbusch3,Teofila Książek2, Katarzyna Szewczyk2, Agnieszka Grabowska2, Miroslaw Bik-Multanowski2, Jacek Józef Pietrzyk1, Przemko Kwinta1 and Ola Didrik Saugstad3,4 BACKGROUND: We aimed to identify global blood and retinal gene expression patterns in murine oxygen-induced retinopathy (OIR), a common model of retinopathy of prematurity, which may allow better understanding of the pathogenesis of this severe ocular prematurity complication and identification of potential blood biomarkers. METHODS: A total of 120 C57BL/6J mice were randomly divided into an OIR group, in which 7-day-old pups were maintained in 75% oxygen for 5 days, or a control group. RNA was extracted from the whole-blood mononuclear cells and retinal cells on days 12, 17, and 28. Gene expression in the RNA samples was evaluated with mouse gene expression microarrays. RESULTS: There were 38, 1370 and 111 genes, the expression of which differed between the OIR and control retinas on days 12, 17, and 28, respectively. Gene expression in the blood mononuclear cells was significantly altered only on day 17. Deptor and Nol4 genes showed reduced expression both in the blood and retinal cells on day 17. 1234567890();,: CONCLUSION: There are sustained marked changes in the global pattern of gene expression in the OIR mice retinas. An altered expression of Deptor and Nol4 genes in the blood mononuclear cells requires further investigation as they may indicate retinal neovascularization.
  • Integrative Prediction of Functionally Relevant Sumoylated Proteins

    Integrative Prediction of Functionally Relevant Sumoylated Proteins

    bioRxiv preprint doi: https://doi.org/10.1101/056564; this version posted December 21, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. iSUMO - integrative prediction of functionally relevant SUMOylated proteins Xiaotong Yao1,2, Shashank Gandhi1, 3, Rebecca Bish1, Christine Vogel1* 1 Center for Genomics and Systems Biology, New York University, New York, USA 2 Tri-Institutional Program in Computational Biology and Medicine, New York, USA 3 Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, California, USA * Corresponding author: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/056564; this version posted December 21, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Post-translational modifications by the Small Ubiquitin-like Modifier (SUMO) are essential for many eukaryotic cellular functions. Several large-scale experimental datasets and sequence-based predictions exist that identify SUMOylated proteins. However, the overlap between these datasets is small, suggesting many false positives with low functional relevance. Therefore, we applied machine learning techniques to a diverse set of large-scale SUMOylation studies combined with protein characteristics such as cellular function and protein-protein interactions, to provide integrated SUMO predictions for human and yeast cells (iSUMO).
  • Reduced Ranbpm Expression Is Associated with Distant Metastasis in Gastric Cancer and Chemoresistance

    Reduced Ranbpm Expression Is Associated with Distant Metastasis in Gastric Cancer and Chemoresistance

    ANTICANCER RESEARCH 36: 1295-1304 (2016) Reduced RanBPM Expression Is Associated with Distant Metastasis in Gastric Cancer and Chemoresistance SHUAI SHAO1*, PING-HUI SUN1, LUCY K. SATHERLEY1, XIANGYU GAO1,2, KE JI1, YI FENG1, YONGNING JIA2, JIAFU JI2, WEN G. JIANG1 and LIN YE1 1Metastasis & Angiogenesis Research Group, Cardiff-China Medical Research Collaborative (CCMRC), Division of Cancer & Genetics, Cardiff University School of Medicine, Heath Park, Cardiff, U.K.; 2Key Laboratory of Carcinogenesis and Translational Research, Gastrointestinal Tumor Center, Peking University Cancer Hospital and Institute, Beijing, P.R. China Abstract. Aim: Ran binding protein M (RanBPM) is a patients over the past three decades in the USA, Spain and ubiquitous, nucleocytoplasmic protein that serves as a several European countries (2, 3). Associated genes and scaffolding molecule. This study aimed to investigate the role proteins such as human epidermal growth factor receptor 2, of RanBPM in gastric cancer. Materials and Methods: vascular endothelial growth factor A, fibroblast growth factor RanBPM expression in human gastric cancer tissue samples receptor and hepatocyte growth factor receptor have become was analyzed using real-time polymerase chain reaction. The targets for biological therapeutic agents (4, 5). Unfortunately, effect of RanBPM on cellular functions was examined in little progress has been made in the treatment of advanced RanBPM-knockdown gastric cells and with in vitro cell or metastatic gastric cancer and median overall survival (OS) functional assays. Results: Gastric tumors with distant remains less than 1 year (6). Therefore, there has been much metastases expressed lower levels of RanBPM transcripts interest in the identification of potential new biomarkers or compared to tumours without detectable metastases molecular targets to aid early diagnosis and facilitate the (p=0.036).