Smooth Muscle Cell Characterization and Transcriptomic Analysis in Human Carotid Atherosclerotic Plaques Haize Goicuria 2018

Total Page:16

File Type:pdf, Size:1020Kb

Smooth Muscle Cell Characterization and Transcriptomic Analysis in Human Carotid Atherosclerotic Plaques Haize Goicuria 2018 SMOOTH MUSCLE CELL CHARACTERIZATION AND TRANSCRIPTOMIC ANALYSIS IN HUMAN CAROTID ATHEROSCLEROTIC PLAQUES HAIZE GOICURIA 2018 UNIVERSIDAD DEL PAÍS VASCO (UPV / EHU) Departamento de Neurociencias SMOOTH MUSCLE CELL CHARACTERIZATION AND TRANSCRIPTOMIC ANALYSIS IN HUMAN CAROTID ATHEROSCLEROTIC PLAQUES TESIS DOCTORAL Haize Goicuria Directores: Dra. Iraide Alloza y Dr. Koen Vandenbroeck Leioa, 2018 (c)2018 HAIZE GOICURIA IRIONDO AKNOWLEDGEMENTS I would like to thank all those people who have participated so much and who have made this thesis possible. First, thanks to the directors of this thesis Koen Vandenbreock and Iraide Alloza, for their direction, support and enthusiasm during these years of thesis in the laboratory of Neurogenomiks. Also thanks to the University of the Basque Country (UPV / EHU) as well as ACHUCARRO center which have facilitated the development of this thesis. I would also like to thank all the members of the laboratory for their support during all these years. In one way, to the colleagues of the past as Aitzkoa, Pepe and Ianire and, in another way, to those of the present as Nerea, Jorge, Cristina and Andoni, and especially to Paloma, my laboratory partner, for her unconditional help and because the fun moments with her helped me to get here. I am immensely grateful to my parents and relatives for their support and especially to my mother for her motivation, empathy and patience during these years, her understanding has been very important to me. I would like also give thanks to my friends Bea and Ana for their understanding during my PhD and to Alberto, for be my breath and bring me a piece of happiness to my life every day. And finally I wish to thank patients of this study for their sample donation without whom this study would be impossible. TABLE OF CONTENTS LIST OF PUBLICATIONS ABBREVIATIONS 1. INTRODUCTION ............................................................................................................... 1 1.1. ATHEROSCLEROSIS DISEASE ................................................................................ 1 1.1.1. Epidemiology ........................................................................................................ 1 1.1.2. Carotid atherosclerosis .......................................................................................... 2 1.1.3. Biology of atherosclerotic plaque .......................................................................... 3 1.1.4. Unstable vs Stable plaque – Symptomatic vs. Asymptomatic patients ................. 9 1.1.5. Risk factors .......................................................................................................... 11 1.1.6. Biomarkers of carotid atherosclerotic plaque rupture ......................................... 15 1.2. VASCULAR SMOOTH MUSCLE CELLS ............................................................... 23 1.2.1. SMC phenotypic switching ................................................................................. 24 1.2.2. SMCs in carotid atherosclerosis .......................................................................... 26 1.2.3. SMC-specific markers ......................................................................................... 28 2. OBJECTIVES ................................................................................................................... 31 3. SUBJECTS & METHODS ............................................................................................... 32 3.1. SMC CHARACTERIZATION ................................................................................... 32 3.1.1. Patient selection ................................................................................................... 32 3.1.2. Isolation of human vascular smooth muscle cells ............................................... 33 3.1.3. Flow cytometry ................................................................................................... 34 3.1.4. Gene expression analysis .................................................................................... 34 3.1.5. Western blot ........................................................................................................ 36 3.1.6. Confocal microscopy ........................................................................................... 37 3.2. RNA-seq TECHNOLOGY ......................................................................................... 37 3.2.1. Patient selection for SMCs isolation ................................................................... 37 3.2.2. RNA library assembly ......................................................................................... 38 3.2.3. RNA transcriptomics analysis ............................................................................. 38 3.2.4. Gene Set functional enrichment analysis and network analysis .......................... 39 3.2.5. Digital PCR on Fluidigm Biomark platform ....................................................... 39 4. RESULTS ........................................................................................................................... 42 4.1. SMC ANALYSIS ........................................................................................................ 42 4.1.1. Selection of SMC culture method ....................................................................... 42 4.1.2. Purity control ....................................................................................................... 43 4.1.3. SMC characterization .......................................................................................... 47 4.2. RNA-SEQ STUDY DESIGN ...................................................................................... 54 4.2.1. Primary analysis .................................................................................................. 59 4.2.2. Secondary analysis .............................................................................................. 70 4.2.3. Tertiary analysis .................................................................................................. 72 4.3. TRANSCRIPTOME SEQUENCING ANALYSIS .................................................... 75 4.3.1. DEG and DEI analysis ........................................................................................ 75 4.3.2. Functional enrichment and network analysis ...................................................... 82 4.3.3. Effect of cell culture and passaging on gene expression ..................................... 96 4.3.4. Confirmation of RNAseq identified biomarkers by digital PCR ........................ 97 4.3.5. Inflammatory pathways in carotid atheroma SMCs ............................................ 99 4.3.6. Cytokines and chemokines expression based on patient symptomatology ....... 102 5. DISCUSSION .................................................................................................................. 104 5.1. ATHEROMA PLAQUE SMC CHARACTERIZATION ......................................... 104 5.2. SMC TRANSCRIPTOMIC ANALYSIS .................................................................. 106 5.3. CYTOKINE PATHWAYS UNEARTHED BY RNASEQ IN CAROTID ATHEROMA SMCs ............................................................................................................. 109 6. CONCLUSION ................................................................................................................ 114 7. REFERENCES ................................................................................................................ 114 LIST OF PUBLICATIONS Goikuria H., Freijo Guerrero M. del M., Vega R., Sastre M., Elizagary E., Lorenzo A., Vandenbroeck K., Alloza I., Characterization of Carotid Smooth Muscle Cells during Phenotypic Transition, Cells, 7 (2018) 23. doi: 10.3390/cells7030023. Goikuria H., Vandenbroeck K., Alloza I., Inflammation in human carotid atheroma plaques, Cytokine Growth Factor Rev. 39 (2018) 62-70. doi: 10.1016/j.cytogfr.2018.01.006 Alloza Moral I., Goikuria H., Idro J.L., Triviño J.C., Férnandez Velasco J.M., Elizagaray E., García Barcina M., Montoya G., Sarasola E., Vega R., Freijo Guerrero M. del M., Vandenbroeck K., RNAseq based transcriptomics study of SMCs from carotid atherosclerotic plaque: BMP2 and IDs proteins are crucial regulators of plaque stability, Sci. Rep. 7 (2017) 3470. doi: 10.1038/s41598-017-03687-9. Alloza Moral I., Goikuria H., Freijo Guerrero M. del M., Vandenbroeck K., A role for autophagy in carotid atherosclerosis, European stroke journal 1 (2016) 255 - 263. doi: 10.1177/2396987316674085. Swaminathan B., Goikuria H., Rodríguez-Antigüedad A., López Medina A., Freijo Guerrero M. del M., Vandenbroeck K., Alloza I, Autophagic marker MAP1LC3B expression levels are associated with carotid atherosclerosis symptomatology, Plos One (2014) 12 - 9. doi: 10.1371/journal.pone.0115176. ABBREVIATIONS SMC smooth muscle cells EC endothelial cells CV cardiovascular disease ROS reactive oxygen species ECM extracellular matrix ICAM-1 intracellular adhesion molecule 1 VCAM-1 vascular cell adhesion molecule 1 MCP-1 monocyte chemoattractant protein 1 CCL2 C-C motif chemokine ligand 2 LDL low density lipoprotein oxLDL oxidized low density lipoprotein IFN-γ interferon-gamma TNF-α tumor necrosis factor-alpha HDL high density lipoprotein PDGF platelet-derived growth factor EGF endothelial growth factor NFκβ nuclear factor kappa beta IL interleukin G-CSF granulocyte colony-stimulating factor M-CSF macrophage colony-stimulating factor GM-CSF granulocyte-macrophage
Recommended publications
  • Multi-Ancestry Genome-Wide Gene-Sleep Interactions Identify Novel
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.29.123505; this version posted May 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Multi-ancestry genome-wide gene-sleep interactions identify novel loci for blood pressure Heming Wang1,2,*, Raymond Noordam3,* , Brian E Cade1,2,*, Karen Schwander4,*, Thomas W Winkler5,*, Jiwon Lee1,*, Yun Ju Sung4,*, Amy R. Bentley6,*, Alisa K Manning2,7, Hugues Aschard8,9, Tuomas O Kilpeläinen10,11, Marjan Ilkov12, Michael R Brown13, Andrea R Horimoto14, Melissa Richard15, Traci M Bartz16, Dina Vojinovic17,18, Elise Lim19, Jovia L Nierenberg20, Yongmei Liu21, Kumaraswamynaidu Chitrala22, Tuomo Rankinen23, Solomon K Musani24, Nora Franceschini25, Rainer Rauramaa26, Maris Alver27,28, Phyllis Zee29, Sarah E Harris30, Peter J van der Most31, Ilja M Nolte31, Patricia B Munroe32,33, Nicholette D Palmer34, Brigitte Kühnel35,36, Stefan Weiss37,38, Wanqing Wen39, Kelly A Hall40, Leo-Pekka Lyytikäinen41,42, Jeff O'Connell43,44, Gudny Eiriksdottir12, Lenore J Launer22, Paul S de Vries13, Dan E Arking45, Han Chen13,46, Eric Boerwinkle13,47, Jose E Krieger14, Pamela J Schreiner48, Stephen S Sidney49, James M Shikany50, Kenneth Rice51, Yii-Der Ida Chen52, Sina A Gharib53, Joshua C Bis54, Annemarie I Luik17, M Arfan Ikram17,55, André G Uitterlinden17, Najaf Amin17, Hanfei Xu19, Daniel Levy19,56, Jiang He20, Kurt
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Structural and Functional Analysis of Muskelin and Other Kelch-Repeat Proteins
    structural and Functional Analysis of Muskelin by Soren Prag Hansen A Thesis submitted to the University College London for the degree of PhD September 2003 Department of Biochemistry and Molecular Biology University College London Gower Street London UK ProQuest Number: U643396 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest. ProQuest U643396 Published by ProQuest LLC(2016). Copyright of the Dissertation is held by the Author. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC. ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 Abstract Muskelin is an intracellular, kelch-repeat protein that is functionally involved in cell spreading on thrombospondin-1. The aim of this thesis project was to investigate the role of muskelin domains in the subcellular distribution and the regulation of the protein using cellular, biochemical, and bioinformatic approaches. Using bioinformatics to compare muskelin orthologues from Mus musculus, Homo sapiens, Rattus norvegicus, Danio rerio, Drosophila meianogaster, and Anopheles gambiae, highly conserved regions within muskelin were identified, with the combination of a discoidin domain, a LisH motif, a C-terminal to LisH motif, and six kelch repeats. A further bioinformatic analysis of the kelch repeat proteins in whole genomes from Homo sapiens, Drosophila meianogaster, and Anopheles gambiae, demonstrated that muskelin has a unique molecular architecture amongst the large family of kelch repeat proteins.
    [Show full text]
  • Characterization of the Long Terminal Repeat of the Endogenous
    www.nature.com/scientificreports OPEN Characterization of the Long Terminal Repeat of the Endogenous Retrovirus-derived microRNAs in Received: 31 May 2018 Accepted: 12 September 2019 the Olive Flounder Published: xx xx xxxx Hee-Eun Lee1,2, Ara Jo1,2, Jennifer Im1,2, Hee-Jae Cha 3, Woo-Jin Kim4, Hyun Hee Kim5,6, Dong-Soo Kim7, Won Kim8, Tae-Jin Yang 9 & Heui-Soo Kim2,10 Endogenous retroviruses (ERVs) have been identifed at diferent copy numbers in various organisms. The long terminal repeat (LTR) element of an ERV has the capacity to exert regulatory infuence as both a promoter and enhancer of cellular genes. Here, we describe olive founder (OF)-ERV9, derived from chromosome 9 of the olive founder. OF-ERV9-LTR provide binding sites for various transcription factors and showed enhancer activity. The OF-ERV9-LTR demonstrates high sequence similarity with the 3′ untranslated region (UTR) of various genes that also contain seed sequences (TGTTTTG) that bind the LTR-derived microRNA(miRNA), OF-miRNA-307. Additionally, OF-miRNA-307 collaborates with transcription factors located in OF-ERV9-LTR to regulate gene expression. Taken together, our data facilitates a greater understanding of the molecular function of OF-ERV families and suggests that OF- miRNA-307 may act as a super-enhancer miRNA regulating gene activity. Paralichthys olivaceus, known as olive founder (OF) is an economically important marine fatfsh which is exten- sively cultured in Korea, China and Japan. Due to their high economic value, there are several selective breed- ing programs in place, such as those involving sex manipulation, owing to diferences in growth speed and size between male and female olive founders1–3.
    [Show full text]
  • Supplementary Data Genbank Or OSE Vs RO NIA Accession Gene Name Symbol FC B-Value H3073C09 11.38 5.62 H3126B09 9.64 6.44 H3073B0
    Supplementary Data GenBank or OSE vs RO NIA accession Gene name Symbol FC B-value H3073C09 11.38 5.62 H3126B09 9.64 6.44 H3073B08 9.62 5.59 AU022767 Exportin 4 Xpo4 9.62 6.64 H3073B09 9.59 6.48 BG063925 Metallothionein 2 Mt2 9.23 18.89 H3064B07 9.21 6.10 H3073D08 8.28 6.10 AU021923 Jagged 1 Jag1 7.89 5.93 H3070D08 7.54 4.58 BG085110 Cysteine-rich protein 1 (intestinal) Crip1 6.23 16.40 BG063004 Lectin, galactose binding, soluble 1 Lgals1 5.95 10.36 BG069712 5.92 2.34 BG076976 Transcribed locus, strongly similar to NP_032521.1 lectin, galactose binding, soluble 1 5.64 8.36 BG062930 DNA segment, Chr 11, Wayne State University 99, expressed D11Wsu99e 5.63 8.76 BG086474 Insulin-like growth factor binding protein 5 Igfbp5 5.50 15.95 H3002d11 5.13 20.77 BG064706 Keratin complex 1, acidic, gene 19 Krt1-19 5.06 9.07 H3007A09 5.05 2.46 H3065F02 4.84 5.43 BG081752 4.81 1.25 H3010E09 4.71 11.90 H3064c11 4.43 1.00 BG069711 Transmembrane 4 superfamily member 9 Tm4sf9 4.29 1.23 BG077072 Actin, beta, cytoplasmic Actb 4.29 3.01 BG079788 Hemoglobin alpha, adult chain 1 Hba-a1 4.26 6.63 BG076798 4.23 0.80 BG074344 Mesothelin Msln 4.22 6.97 C78835 Actin, beta, cytoplasmic Actb 4.16 3.02 BG067531 4.15 1.61 BG073468 Hemoglobin alpha, adult chain 1 Hba-a1 4.10 6.23 H3154H07 4.08 5.38 AW550167 3.95 5.66 H3121B01 3.94 5.94 H3124f12 3.94 5.64 BG073608 Hemoglobin alpha, adult chain 1 Hba-a1 3.84 5.32 BG073617 Hemoglobin alpha, adult chain 1 Hba-a1 3.84 5.75 BG072574 Hemoglobin alpha, adult chain 1 Hba-a1 3.82 5.93 BG072211 Tumor necrosis factor receptor superfamily,
    [Show full text]
  • Molecular Signatures Differentiate Immune States in Type 1 Diabetes Families
    Page 1 of 65 Diabetes Molecular signatures differentiate immune states in Type 1 diabetes families Yi-Guang Chen1, Susanne M. Cabrera1, Shuang Jia1, Mary L. Kaldunski1, Joanna Kramer1, Sami Cheong2, Rhonda Geoffrey1, Mark F. Roethle1, Jeffrey E. Woodliff3, Carla J. Greenbaum4, Xujing Wang5, and Martin J. Hessner1 1The Max McGee National Research Center for Juvenile Diabetes, Children's Research Institute of Children's Hospital of Wisconsin, and Department of Pediatrics at the Medical College of Wisconsin Milwaukee, WI 53226, USA. 2The Department of Mathematical Sciences, University of Wisconsin-Milwaukee, Milwaukee, WI 53211, USA. 3Flow Cytometry & Cell Separation Facility, Bindley Bioscience Center, Purdue University, West Lafayette, IN 47907, USA. 4Diabetes Research Program, Benaroya Research Institute, Seattle, WA, 98101, USA. 5Systems Biology Center, the National Heart, Lung, and Blood Institute, the National Institutes of Health, Bethesda, MD 20824, USA. Corresponding author: Martin J. Hessner, Ph.D., The Department of Pediatrics, The Medical College of Wisconsin, Milwaukee, WI 53226, USA Tel: 011-1-414-955-4496; Fax: 011-1-414-955-6663; E-mail: [email protected]. Running title: Innate Inflammation in T1D Families Word count: 3999 Number of Tables: 1 Number of Figures: 7 1 For Peer Review Only Diabetes Publish Ahead of Print, published online April 23, 2014 Diabetes Page 2 of 65 ABSTRACT Mechanisms associated with Type 1 diabetes (T1D) development remain incompletely defined. Employing a sensitive array-based bioassay where patient plasma is used to induce transcriptional responses in healthy leukocytes, we previously reported disease-specific, partially IL-1 dependent, signatures associated with pre and recent onset (RO) T1D relative to unrelated healthy controls (uHC).
    [Show full text]
  • MKLN1 Splicing Defect in Dogs with Lethal Acrodermatitis
    RESEARCH ARTICLE MKLN1 splicing defect in dogs with lethal acrodermatitis Anina Bauer1,2, Vidhya Jagannathan1,2, Sandra HoÈ gler3, Barbara Richter3, Neil A. McEwan4, Anne Thomas5, Edouard Cadieu6, Catherine AndreÂ6, Marjo K. HytoÈ nen7,8,9, Hannes Lohi7,8,9, Monika M. Welle2,10, Petra Roosje2,11, Cathryn Mellersh12, Margret L. Casal13, Tosso Leeb1,2* 1 Institute of Genetics, Vetsuisse Faculty, University of Bern, Bern, Switzerland, 2 DermFocus, University of Bern, Bern, Switzerland, 3 Department of Pathobiology, Institute of Pathology and Forensic Veterinary Medicine, University of Veterinary Medicine Vienna, Vienna, Austria, 4 Department of Small Animal Clinical a1111111111 Sciences, The University of Liverpool, Leahurst Campus, Neston, Cheshire, United Kingdom, 5 Antagene, a1111111111 Animal Genetics Laboratory, La Tour de Salvagny, France, 6 Institut de GeÂneÂtique et DeÂveloppement de a1111111111 Rennes (IGDR), CNRS-UMR6290, Universite Rennes1, Rennes, France, 7 Department of Veterinary a1111111111 Biosciences, University of Helsinki, Helsinki, Finland, 8 Research Programs Unit, Molecular Neurology, a1111111111 University of Helsinki, Helsinki, Finland, 9 FolkhaÈlsan Institute of Genetics, University of Helsinki, Helsinki, Finland, 10 Institute of Animal Pathology, Vetsuisse Faculty, University of Bern, Bern, Switzerland, 11 Division of Clinical Dermatology, Department of Clinical Veterinary Medicine, Vetsuisse Faculty, University of Bern,Bern, Switzerland, 12 Kennel Club Genetics Centre, Animal Health Trust, Kentford, Newmarket, Suffolk, United Kingdom, 13 Section of Medical Genetics, Department of Clinical Sciences & Advanced Medicine, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, OPEN ACCESS United States of America Citation: Bauer A, Jagannathan V, HoÈgler S, * [email protected] Richter B, McEwan NA, Thomas A, et al. (2018) MKLN1 splicing defect in dogs with lethal acrodermatitis.
    [Show full text]
  • 1 Mucosal Effects of Tenofovir 1% Gel 1 Florian Hladik1,2,5*, Adam
    1 Mucosal effects of tenofovir 1% gel 2 Florian Hladik1,2,5*, Adam Burgener8,9, Lamar Ballweber5, Raphael Gottardo4,5,6, Lucia Vojtech1, 3 Slim Fourati7, James Y. Dai4,6, Mark J. Cameron7, Johanna Strobl5, Sean M. Hughes1, Craig 4 Hoesley10, Philip Andrew12, Sherri Johnson12, Jeanna Piper13, David R. Friend14, T. Blake Ball8,9, 5 Ross D. Cranston11,16, Kenneth H. Mayer15, M. Juliana McElrath2,3,5 & Ian McGowan11,16 6 Departments of 1Obstetrics and Gynecology, 2Medicine, 3Global Health, 4Biostatistics, University 7 of Washington, Seattle, USA; 5Vaccine and Infectious Disease Division, 6Public Health Sciences 8 Division, Fred Hutchinson Cancer Research Center, Seattle, USA; 7Vaccine and Gene Therapy 9 Institute-Florida, Port St. Lucie, USA; 8Department of Medical Microbiology, University of 10 Manitoba, Winnipeg, Canada; 9National HIV and Retrovirology Laboratories, Public Health 11 Agency of Canada; 10University of Alabama, Birmingham, USA; 11University of Pittsburgh 12 School of Medicine, Pittsburgh, USA; 12FHI 360, Durham, USA; 13Division of AIDS, NIAID, NIH, 13 Bethesda, USA; 14CONRAD, Eastern Virginia Medical School, Arlington, USA; 15Fenway Health, 14 Beth Israel Deaconess Hospital and Harvard Medical School, Boston, USA; 16Microbicide Trials 15 Network, Magee-Women’s Research Institute, Pittsburgh, USA. 16 Adam Burgener and Lamar Ballweber contributed equally to this work. 17 *Corresponding author E-mail: [email protected] 18 Address reprint requests to Florian Hladik at [email protected] or Ian McGowan at 19 [email protected]. 20 Abstract: 150 words. Main text (without Methods): 2,603 words. Methods: 3,953 words 1 21 ABSTRACT 22 Tenofovir gel is being evaluated for vaginal and rectal pre-exposure prophylaxis against HIV 23 transmission.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • Castration Delays Epigenetic Aging and Feminizes DNA
    RESEARCH ARTICLE Castration delays epigenetic aging and feminizes DNA methylation at androgen- regulated loci Victoria J Sugrue1, Joseph Alan Zoller2, Pritika Narayan3, Ake T Lu4, Oscar J Ortega-Recalde1, Matthew J Grant3, C Simon Bawden5, Skye R Rudiger5, Amin Haghani4, Donna M Bond1, Reuben R Hore6, Michael Garratt1, Karen E Sears7, Nan Wang8, Xiangdong William Yang8,9, Russell G Snell3, Timothy A Hore1†*, Steve Horvath4†* 1Department of Anatomy, University of Otago, Dunedin, New Zealand; 2Department of Biostatistics, Fielding School of Public Health, University of California, Los Angeles, Los Angeles, United States; 3Applied Translational Genetics Group, School of Biological Sciences, Centre for Brain Research, The University of Auckland, Auckland, New Zealand; 4Department of Human Genetics, David Geffen School of Medicine, University of California, Los Angeles, Los Angeles, United States; 5Livestock and Farming Systems, South Australian Research and Development Institute, Roseworthy, Australia; 6Blackstone Hill Station, Becks, RD2, Omakau, New Zealand; 7Department of Ecology and Evolutionary Biology, UCLA, Los Angeles, United States; 8Center for Neurobehavioral Genetics, Semel Institute for Neuroscience and Human Behavior, University of California, Los Angeles (UCLA), Los Angeles, United States; 9Department of Psychiatry and Biobehavioral Sciences, David Geffen School of Medicine at UCLA, Los Angeles, United States *For correspondence: Abstract In mammals, females generally live longer than males. Nevertheless, the mechanisms [email protected] (TAH); underpinning sex-dependent longevity are currently unclear. Epigenetic clocks are powerful [email protected] (SH) biological biomarkers capable of precisely estimating chronological age and identifying novel †These authors contributed factors influencing the aging rate using only DNA methylation data. In this study, we developed the equally to this work first epigenetic clock for domesticated sheep (Ovis aries), which can predict chronological age with a median absolute error of 5.1 months.
    [Show full text]
  • An Integrative Analysis of Gene Expression Profiles
    Int J Clin Exp Pathol 2020;13(7):1698-1706 www.ijcep.com /ISSN:1936-2625/IJCEP0107763 Original Article Identification of transcriptomic markers for developing idiopathic pulmonary fibrosis: an integrative analysis of gene expression profiles Diandian Li1, Yi Liu2, Bo Wang1 1Department of Respiratory and Critical Care Medicine, West China Hospital of Sichuan University, Chengdu 610041, China; 2West China School of Medicine, Sichuan University, Chengdu 610041, China Received January 12, 2020; Accepted March 6, 2020; Epub July 1, 2020; Published July 15, 2020 Abstract: Idiopathic pulmonary fibrosis (IPF) remains a lethal disease with unknown etiology and unmet medical need. The aim of this study was to perform an integrative analysis of multiple public microarray datasets to inves- tigate gene expression patterns between IPF patients and healthy controls. Moreover, functional interpretation of differentially expressed genes (DEGs) was performed to assess the molecular mechanisms underlying IPF progres- sion. DEGs between IPF and normal lung tissues were picked out by GEO2R tool and Venn diagram software. Data- base for Annotation, Visualization and Integrated Discovery (DAVID) was applied to analyze gene ontology (GO) and Kyoto Encyclopedia of Gene and Genome (KEGG) pathway. Protein-protein interaction (PPI) of these DEGs was visu- alized by Cytoscape with Search Tool for the Retrieval of Interacting Genes (STRING). 5520 DEGs were identified in IPF based on six profile datasets, including 3714 up-regulated genes and 1806 down-regulated genes. Using Venn software, a total of 367 commonly altered DEGs were revealed, including 259 up-regulated genes mostly enriched in collagen catabolic process, heparin binding, and the extracellular region.
    [Show full text]
  • The Role of Sulfotransferases in Liver Diseases
    DMD Fast Forward. Published on June 25, 2020 as DOI: 10.1124/dmd.120.000074 This article has not been copyedited and formatted. The final version may differ from this version. TITLE PAGE The Role of Sulfotransferases in Liver Diseases Yang Xie1, Wen Xie1,2 1 Center for Pharmacogenetics and Department of Pharmaceutical Sciences, University of Downloaded from Pittsburgh School of Pharmacy, Pittsburgh, PA, USA; 2 Department of Pharmacology and Chemical Biology, University of Pittsburgh School of dmd.aspetjournals.org Medicine, Pittsburgh, PA, USA. at ASPET Journals on September 27, 2021 1 DMD Fast Forward. Published on June 25, 2020 as DOI: 10.1124/dmd.120.000074 This article has not been copyedited and formatted. The final version may differ from this version. RUNNING TITLE PAGE Running Title: SULTs in liver diseases Corresponding Author: Wen Xie Address: 306 Salk Pavilion, 335 Sutherland Drive, Pittsburgh PA 15261 Phone: 412-648-9941 Downloaded from Email: [email protected] dmd.aspetjournals.org Number of Text Pages: 42 Number of Tables: 2 Number of Figures: 2 at ASPET Journals on September 27, 2021 Number of References: 100 Number of Words in Abstract: 221 Number of Words in Introduction: 287 Number of Words in Discussion: 275 List of Nonstandard Abbreviations: SULTs – sulfotransferases PAPS - phosphoadenosine-5′-phosphosulfate NRs – nuclear receptors PPARs - peroxisome proliferator-activated receptors PXR - pregnane X receptor 2 DMD Fast Forward. Published on June 25, 2020 as DOI: 10.1124/dmd.120.000074 This article has not been copyedited
    [Show full text]