496 Br J Ophthalmol 2001;85:496–503

the left eye, a left pars plana lensectomy and patients with VKH and one with sympathetic vitrectomy were performed to assess the visual ophthalmia reacted against the MART 1 LETTERS TO potential of this eye. The retina was found to melanoma antigen (an antigen carried by skin Br J Ophthalmol: first published as 10.1136/bjo.85.4.496f on 1 April 2001. Downloaded from be flat, and the macula healthy; therefore, and eye melanocytes), when presented in THE EDITOR enucleation was not performed. By 3 months association with HLA-A2. Interestingly, two she had regained a visual acuity of 6/6 in the of their three VKH patients carried HLA-A2, sympathising eye, and 6/12 in the exciting eye HLA-B51, HLA-DR4, and a further VKH (with a contact lens incorporating a pupil and patient carried the HLA-A2, and HLA-DR4 Sympathetic ophthalmia associated with an aphakic correction). antigens. Their sympathetic ophthalmia pa- high frequency deafness However, at 4 months post-injury, reduc- tient was also A2 positive, but was not positive tion of the prednisolone dose to 12.5 mg, and for either HLA-B51 or HLA-DR4. Our EDITOR,—Sympathetic ophthalmia with deaf- reduction of cyclosporin A to give a trough patient was HLA typed and found to carry ness has been reported rarely.12 We describe level of 70 µg/l, was followed by a flare of ante- HLA-A2, HLA-B51, HLA-DR4. one such case and explore a hypothesis rior uveitis in both the exciting and sympathis- HLA-A2 and HLA-DR4 are common and whereby genetic susceptibility may be associ- ing eyes. This responded to increased pred- linked antigens, occurring together in approxi- ated with cross reactivity of antigens derived nisolone (15 mg) and an increase in the dose mately 33% of the population, but HLA-B51 from common neural crest tissue. of cyclosporin A to achieve a trough level of is less common. From 537 random transplant 140 µg/l. At this time the exciting eye began to organ donors HLA typed over 3 years, we cal- display white choroidal lesions consistent with CASE REPORT culated the frequency of HLA-A2, HLA-B51, the appearance of Dalen Fuchs nodules (Fig A 72 year old woman who had previously HLA-DR4 in the regional population. These 1). Prednisolone was gradually reduced to undergone a left trabeculectomy had a fall in specificities were present together in only which she sustained a Colles fracture and a 12.5 mg without further complications and seven donors, giving a frequency of 1.3%. We left total hyphaema. By 14 days the blood had she ultimately achieved a visual acuity of 6/9 propose that patients carrying HLA-A2, cleared suYciently to reveal that she had in both eyes. Despite treatment, her hearing HLA-B51, and HLA-DR4 are at increased expelled the entire left iris into the trabeculec- loss gradually progressed to 90 dB; this has risk of damage arising in melanocytes of tomy bleb, with extensive dispersion of uveal not recovered. diverse tissues when one tissue is injured, pigment into the subconjunctival space. She whether in VKH or sympathetic ophthalmia. COMMENT was also found to have dislocated the lens, MARIE COMER and had sustained a choroidal detachment Sympathetic ophthalmia with features of CRAIG TAYLOR (confirmed by ultrasonography). A non- Vogt-Koyanagi-Harada disease (VKH), was SIMON CHEN granulomatous anterior uveitis was noted in initially reported in the 19th century.1 More KEITH MARTIN the left eye at this time. The initial visual acu- recently, Nirankari et al have reported one KERRY JORDAN ity was light perception in the left eye and 6/12 case of sympathetic ophthalmia with profound PAUL MEYER in the right eye. high frequency deafness which did not re- Department of Ophthalmology, Clinic 3, On the 25th day after the original injury, she cover.2 Rao and Marak3 have performed a Addenbrooke’s Hospital, Cambridge, UK experienced pain and blurring of vision in her clinicopathological survey of 100 pathological Correspondence to: M Comer right eye, with the simultaneous onset of bilat- specimens of eyes enucleated because of sym- Accepted for publication 19 September 2000 eral deafness (with an initial high frequency pathetic ophthalmia. Four of these had VKH hearing loss of 60 dB). She was found to have overlap features, of which two had hearing 1 Duke Elder S. In: Diseases of the uveal tract system a brisk anterior uveitis, with a dense vitritis in loss. The association of sympathetic ophthal- of ophthalmology. Vol IX. London: Henry this eye, through which rugose choroidal mia and deafness is clearly rare, which raises Kimpton, p574. thickening could just be discerned. At this the question of what such overlap cases can 2 Nirankari M, Khanna K, Chawla G, et al. stage, the right visual acuity had declined to teach us about the pathogenesis of VKH. Sympathetic ophthalmitis with total deafness. J 4 All Ind Ophthalmol Soc 1970;18:29–32. 6/24, and the left eye achieved hand move- Woods attempted to explain why deafness 3 Rao N, Marak G. Sympathetic ophthalmia simu- ments. could occur in VKH, hypothesising that lating Vogt-Koyanagi-Harada disease: a clinico- http://bjo.bmj.com/ A diagnosis of sympathetic ophthalmia was pigment present in the auditory labyrinth and pathological study of four cases. Jpn J Ophthal- made. She received two infusions of intra- the eye could be common targets of autoim- mol 1983;27:506–11. 4 Woods AC. Uveitis of proven, prbable, or venous methylprednisolone (1 g each) and munity. The auditory labyrinth and the uvea suspected viral aetiology (Chapter 7). Endo- oral prednisolone (20 mg daily) was started. are known to have a common embryological genous inflammations of the uveal tract. Baltimore: Cyclosporin A was commenced, and the dose origin in the neural crest. Could a genetic pre- Williams and Wilkins, 1961:269. adjusted to achieve a trough level of 200 µg/l disposition facilitate the recognition of such 5 Sugita S, Sagawa K, Mochizuki M, et al. Melano- 5 cyte lysis by cytotoxic T lymphocytes recognis- (despite a history of breast cancer in remis- shared antigens? Sugita et al have recently ing the MART-1 melanoma antigen in HLA A2 sion). In view of the severity of the injury to reported that cytotoxic T cells from three patients with Vogt-Koyanagi-Harada disease.

Int Immunol 1996;8:799–803. on October 1, 2021 by guest. Protected copyright.

Similarities in the packaging of cyanoacrylate nail glue and ophthalmic preparations: an ongoing problem

EDITOR,—We would like to raise concern over an ongoing problem—namely, the similarity between the packaging used for fingernail extension glue (cyanoacrylate “superglue”) and topical ophthalmic preparations. These concerns were raised as long as 16 years ago1 and yet no action or progress has since been instituted by the manufacturers of these containers. Both nail glue and ophthalmic preparations are almost identically packaged in 5–10 ml clear, round bodied, soft plastic dropper type bottles with a white non-locking twist cap which are often manufactured in the same factory.1 The caps are even interchangeable. Discrimination between these products is therefore made unnecessarily diYcult, par- ticularly for patients who need to use regular topical medication—for example, glaucoma Figure 1 (A) Sympathising eye: acute uveitis (pigment ring after pupillary dilatation). (B) Exciting and contact lens wearers2 and patients who are eye: aniridia and hyphaema. (C) Exciting eye: iris pigment in trabeculectomy bleb. (D) Exciting eye: multifocal pale subretinal lesions, representing early Dalen Fuchs nodules. partially sighted or blind.

www.bjophthalmol.com Letters 497

Furthermore, once superglue has been installed into the eye, it undergoes instantane- ous polymerisation,1 so that no therapeutic Br J Ophthalmol: first published as 10.1136/bjo.85.4.496f on 1 April 2001. Downloaded from window of opportunity exists to irrigate the glue from the eye. Ocular injuries reported following super- glue administration have included corneal abrasions, punctate epithelial keratopathy, eyelash loss, skin excoriation, and conjunctivi- tis.3 There is also the initial fear of blindness generated by an instant tarsorrhaphy.4

CASE REPORT There have been multiple reports of the mistaken ocular use of nail adhesive in adults.1–4 We have recently treated two paediatric patients for accidental ocular administration of nail adhesive glue, in one case a direct result of confusion about the packaging. The young- Figure 1 (A) and (B) show disconjugate vertical and torsional eye movement when the patient is est was a baby aged 3 months, who had been asked to look to one side (direction of arrow). Horizontal gaze and upward movement above the midline are limited. (C) Axial T2 weighted magnetic resonance imaging shows a high signal intensity prescribed chloramphenicol 0.5% eye drops in pons (arrows) due to infarction. for conjunctivitis. The mother confused the antibiotic eye drops with the nail adhesive drops which were mistakenly installed into the the patient to communicate by way of ocular Brain MRI revealed an extensive infarct in the left eye, causing a partial tarsorrhaphy, eyelash movement, either conjugate upward or down- ventral pons (Fig 1C). clumping, and a corneal abrasion. ward. The second case was ofa3yearoldchild Here, we report an unusual case of COMMENT locked-in syndrome presenting disconjugate whose brother was receiving antibiotic eye- We report an unusual non-concomitant verti- vertical and torsional ocular movement, mim- drops for conjunctivitis. The child imitated cal and torsional eye movements with a large icking seesaw nystagmus (SSN). her mother’s actions by installing drops in her brainstem infarction that rendered him own eye but used nail adhesive instead. This “locked-in”. The main finding was intermit- led to misdirection of her eyelashes and a cor- CASE REPORT tent disconjugate vertical eye movement with neal abrasion. A 30 year old man was brought to the rising and intorting on one side while falling Both children responded well to the me- emergency room. He was unable to move his and extorting on the opposite side. It appeared chanical removal of the glued lashes and chlo- extremities at all. Verbal communication was to be SSN but it has not been previously ramphenicol 1% ointment. not possible because he could not speak. reported in locked-in syndrome. Unlike the Increased deep tendon reflex with bilateral previously reported SSN cases, the half cycle extensor toe signs were noted. He could open COMMENT of SSN was also induced when the patient Sixteen years have now passed since this issue his eyes. Visual acuity was uncheckable. Visual field appeared to be normal by a threatening attempted to look to the side. was first raised, and we feel that the manufac- Studies on SSN have suggested that inter- turers of nail glue products should be forced test. Pupil size was equal and light reflex was stitial nucleus of Cajal (INC) mediate this to address some remedial action, to ensure prompt. Funduscopic examination did not phenomenon. The INC, a centre of integra- that these preparations are packaged diVer- show any remarkable findings. tion of vertical and torsional eye movements, http://bjo.bmj.com/ ently from therapeutic preparations in the On command, he showed conjugate vertical eye movements but he could not make has extensive rostral and caudal connec- future. 12 At the very least, nail glue products should horizontal gaze. Instead, full conjugate hori- tions. It receives ipsilateral input from the be fitted with child safety caps to prevent any zontal leftward deviation was obtained with frontal cortex through the zona incerta, and further unnecessary anxiety and ocular cold water irrigation in the left ear, but nystag- contralateral input from the deep cerebellar trauma. mus to the opposite direction was absent. nuclei and pretectum. The INC itself sends Caloric stimulation on the right ear was not outputs to the ocular motor nuclei, the ipsilat- ANDREW D NEEDHAM performed because eardrum perforation was eral medial vestibular nucleus, and the con- SALIM NATHA

suspected. Doll’s eye manoeuvre showed full on October 1, 2021 by guest. Protected copyright. STEPHEN KAYE tralateral INC. In animal experiments, stimu- range of horizontal eye movements except for 3 Department of Ophthalmology, St Paul’s Eye Unit, lation near the INC or stimulation of 45 Royal Liverpool University Hospital, Link 8Z, the adduction of the left eye, presumably due semicircular canals produced one half cycle Prescot Street, Liverpool L7 8XP,UK to left internuclear ophthalmoplegia. Conver- of SSN. The underlying mechanism for a half gence for near target was not possible. When Correspondence to: Mr Andrew Needham cycle of SSN in our patient is not known. Accepted for publication 31 October 2000 the patient was asked to look to the right side, Horizontal conjugate deviation by cold caloric the right eye moved upward with intorsion, stimulation or oculocephalic reflex did not and at the same time, left eye moved produce SSN, suggesting a vestibular mech- 1 Morgan SJ, Astbury NJ. Inadvertent self admin- downward and extorsion. It appeared to be a anism may not explain SSN in this patient. istration of superglue: a consumer hazard. BMJ half cycle of SSN. When the patient was asked 1984; :226–7. Instead, we suggest that supranuclear control 289 to look to the left side, the reverse half cycle of 2 DeRespinis PA. Cyanoacrylate nail glue mis- for horizontal gaze inappropriately sends taken for eye drops. JAMA 1990;263:2301. SSN was observed—the left eye moved 3 Lyons C, Stevens J, Bloom J. Superglue inadvert- upward with intorsion whereas right eye signals to the INC, but a disturbance of neural ently used as eyedrops. BMJ 1990;300:328. moved downward with extorsion. Horizontal integration in the INC may be responsible for 67 4 Good AMT, McCabe SE. Superglue accidents gaze was limited, although there seemed to be the development of SSN. and the eye—cause and prevention. Br J Ophthalmol 1994;78:802. minimal movement. The eyes that moved upward didn’t cross above the midline (Fig 1A, B). This article is supported by grant no 01-1999-085-0 Disconjugate vertical ocular movement from the Seoul National University Hospital Re- In addition to the above findings, intermit- search Fund. in a patient with locked-in syndrome tent irregular jerky eye movements were detected. These also consisted of elevation SEONG-HO PARK Department of Neurology, Boramae City Hospital, EDITOR,—Locked-in syndrome is a rare para- with intorsion of one eye and synchronous lytic state in which voluntary movements are depression and extorsion of the other eye. Korea aVected. This uncommon de-eVerent state They appeared in a clustered pattern contain- DUKLNA results in quadriplegia, loss of gestural or vocal ing four to five cycles of SSN, beating at Samsung Medical Center, Korea communication with a defect in horizontal eye between 0.5 and 1 Hz. Whether this phenom- MANHO KIM movements. However, consciousness and ver- enon was purely voluntary or involuntary was Seoul National University Hospital, Clinical Research tical eye movements are spared, which enable not confirmed. It had persisted for 1 month. Institute, Seoul, Korea

www.bjophthalmol.com 498 Letters

Correspondence to: Manho Kim, MD, Department a low flare without cells in the anterior cham- blood chemistry tests and anterior chamber of Neurology, Seoul National University Hospital, ber, an indication of persisting vascular tap) it has to be diagnosed as idiopathic non- 28 Chongnoku, Yeongeon-dong, Seoul, Korea 110- damage, moreover posterior synechiae. Lens specific uveitis. Br J Ophthalmol: first published as 10.1136/bjo.85.4.496f on 1 April 2001. Downloaded from 744 opacification and age related macular degen- Orbital magnetic resonance imaging (MRI) [email protected] eration were similar to the right eye. Because showed a supraequatorial lesion that sur- Accepted for publication 7 November 2000 of the age related macular degeneration and rounded the right eyeball (Fig 1A and B). the cataract visual acuity was “only” 20/100 Computed tomography (CT) scans demon- 1 Fukushima K. The interstitial nucleus of Cajal and its role in the control of movements of head for the right eye, for the phthisic left eye strated an intact bone structure of the orbit and eyes. Prog Neurobiol 1987;29:107–92. counting fingers/1 metre. The intraocular and no abnormalities were seen in the remain- 2 Fukushima K, Kaneko CRS, Fuchs AF. The pressure was normal for the right eye (17 mm ing skull, body or abdomen. As extensive as neuronal substrate of integration in the oculo- motor system. Prog Neurobiol 1992;39:609–39. Hg), but hypotonic for the left eye (7 mm Hg). possible the anterior, visible part of the 3 Westheimer G, Blair SM. Synkinesis of head and Because the uveitis was not due to any epibulbar lesion was surgically resected (Fig eye movements evoked by brainstem stimula- systemic or ocular disorder (characterised by 1C and D), formalin fixed and paraYn tion in the alert monkey. Exp Brain Res 1975;24: 89–95. 4 Cohen B, Suzuki J, Bender MB. Eye movements from semicircular canal nerve stimulation in the cat. Ann Otol Rhinol Laryingol (St Louis) 1973;73:153–69. 5 Suzuki J, Cohen B, Bendoer MB. Compensatory eye movements induced by vertical semicircular canal stimulation. Exp Neurol 1964;9:137–60. 6 DaroV RB. Seesaw nystagmus. Neurol 1965;16: 874–7. 7 Williams IM, Dickinson P, Ramsay RJ, et al. See- saw nystagmus. Aust J Ophthalmol 1982;10:19– 25.

Conjunctival CD5+ MALT lymphoma

EDITOR,—Primary ocular non-Hodgkin’s lymphoma (NHL) may be found in the conjunctiva, eyelids, and lacrimal glands, but the majority occur in the orbit.1 Most primary ocular NHL are of B cell origin, either of the follicular, diVuse small, or mixed cell type.1 According to the Revised European Ameri- can classification of lymphoid neoplasms (REAL classification)2 the most common ocu- lar NHL, arising from mucosa associated lym- phoid tissue (MALT) and the marginal zone of lymph follicles, is included in the group of extranodal peripheral B cell lymphomas.1 His- topathological features of marginal zone lymphoma (MZL) of the MALT type consists ofadiVuse and parafollicular growth pattern and the presence of lymphoepithelial lesions.2 The tumour cells express monotypic surface Ig (sIg) and sometimes cytoplasmic Ig (cIg) http://bjo.bmj.com/ (usually IgM), moreover the pan B cell antigens CD19, CD20, CD22, and CD79a.2 Typically, they are negative for CD5, CD10, and CD23.2 Characteristically, MZL of the MALT type aVects older patients and may remain local- ised for years,2 while disseminated disease involving bone marrow and peripheral blood is rare.2 Localised tumours may be cured with on October 1, 2021 by guest. Protected copyright. local irradiation, whereas disseminated stages of the disease are not curable and transforma- tion into a large cell NHL may occur.2 We report a case of conjunctival MZL of the MALT type with an unusual clinical appear- ance, an CD5+ immunophenotype, and a his- tory of idiopathic non-specific anterior uveitis.

CASE REPORT A 79 year old man was referred to our hospital with a 3 month history of right eye discomfort and an epibulbar mass below the upper eyelid. Ophthalmological examination of the right eye revealed a reddish palpable tumour, 1.5 Figures 1 and 2 Clinical and diagnostic presentation of a rare conjunctival MALT lymphoma. (1A) Orbital magnetic resonance imaging (MRI) shows a supraequatorial and epibulbar tumour cm in diameter, located in the upper conjunc- mass (arrow) with extension to the deep orbit of the right eyeball (arrowheads). (1B) On equatorial tiva (Fig 1C). The extraocular movements sectional plane, MRI revealed tumour masses surrounding the optical nerve (arrowheads). The optical were normal. Cornea and anterior chamber nerve appears not to be infiltrated. (1C and 1D) Excisional biopsy showed a well defined tumour. appeared clear; however, cortical and nuclear Histological presentation of conjunctival MALT lymphoma. (2A) DiVuse and homogeneous opacities were noted in the crystalline lens. infiltration of the conjunctival connective tissue by small sized lymphoid cells. Haematoxylin and eosin Posterior segment examinations showed areas staining, magnification ×40. (2B) Monoclonal antibody MIB1 recognises a relatively low tumour growth fraction of about 10%. Proliferating cells are indicated by a red nuclear or cytoplasmic signal. of confluent drusen and retinal pigment × epithelium atrophy, with a normal optic disc. APAAP technique, counterstaining by haematoxylin, magnification 240. (2C) Almost all cells of the tumour mass are immunoreactive for the B cell marker CD79a (left), whereas only few intermingled The patient’s left eye had suVered from a normal T cells express CD3 (right). Immunoreactive cells are indicated by a red membranous signal. severe anterior uveitis 30 years earlier and APAAP technique, counterstaining by haematoxylin, magnification ×240. (2D) About 50% of the some recurrences, resulting in subsequent tumour cells express the T cell antigen CD5. Immunoreactive cells are indicated by a red membranous phthisis bulbi. Slit lamp examination revealed signal. APAAP technique, counterstaining by haematoxylin, magnification ×240.

www.bjophthalmol.com Letters 499 embedded sent to the pathology department The last were excluded because of diVerent syndrome: a clinicopathologic study of 13 of Justus-Liebig-University Giessen, Ger- morphological and phenotypic features.2 Fur- patients. Hum Pathol 1991;22:422–30. 13 Hyjek E, Isaacson PG. Primary B-cell lymphoma Br J Ophthalmol: first published as 10.1136/bjo.85.4.496f on 1 April 2001. Downloaded from many, for immunohistological studies (Fig 2). thermore, B-CLL and MCL are usually wide- of the thyroid and its relationship to Hashimo- Immunohistochemistry was done on the spread at diagnosis showing diVuse lymphad- to’s thyroiditis. Hum Pathol 1988;19:1315–26. routinely formalin-fixed, paraYn embedded enopathy, substantial lymphocytosis, and 14 Aozasa K. Malignant lymphoma of the mucosa biopsy specimen after microwave pretreat- bone marrow involvement. Both diseases are associated lymphoid tissue (MALT). Am J Surg Pathol 1992;16:90–2. ment of the prepared 3–4 µm tissue sections. more aggressive than MALT lymphoma and In the absence of analysable epithelium or usually not curable.2 Although there was an mucosal glands, lymphoepithelial lesions were extended growth from the epibulbar conjunc- Autosomal dominant microcephaly— not assessed. However, general expression of tiva towards the deep orbit, our patient lymphoedema-chorioretinal dysplasia CD20 and CD79a revealed the B cell nature showed a localised stage of the disease, an syndrome of the tumour infiltrate, but it was interesting indolent clinical course, and a favourable that CD5 expression in about 50% of tumour response to radiotherapy. Thus, we demon- EDITOR,—We describe a family with chorio- cells was positive (Fig 2D), while only few strated an exceptional case of a conjunctival retinal dysplasia, microcephaly, mental retar- intermingled reactive T lymphocytes were MZL of the MALT type with unusual CD5+ dation, and lymphoedema. observed (Fig 2C). Hints for a plasma cellular phenotype. The proband presented with a severe multi- diVerentiation were not detected by VS38c ple malformation syndrome, with anomalies and reactivity for CD10, CD23, and CD30 We thank Drs Irina Fenic, Joachim Woenckhaus, of the brain, heart, and eyes. Ocular anomalies was negative. Karsten Münstedt, and Christian Vorwerk for included microphthalmia and chorioretinopa- critical reading the manuscript. Furthermore, we General physical examination of the patient thank all colleagues from the Medical School Bad thy. Pedal lymphoedema was obvious at birth. showed no abnormality. There were no Hersfeld and the Institute of Pathology, University These features overlap with three previously lymphadenopathy or hepatosplenomegaly. Pe- Giessen, who were involved in the diagnosis and distinguished conditions (microcephaly with ripheral blood smears as well as bone marrow treatment of our patient. chorioretinopathy (MIM 156590), micro- aspiration biopsy showed no signs for a ALEXANDER H HEURING cephaly with microphthalmia and retinal folds disseminating lymphoma. All haematological Department of Ophthalmology, Otto-von-Guericke (MIM180060), and microcephaly and lym- and biochemical parameters were within the University Magdeburg, Magdeburg, Germany and phoedema (MIM152950), and this suggests Department of Ophthalmology, Kreiskrankenhaus Bad normal range with the exception of slightly Hersfeld, Bad Hersfeld, Germany that they can be the variable expression of a elevated thymidine kinase (8 U/l) and â2- single entity. In all children with micro- microglobulin levels (2.9 µg/l) suggestive for FOLKER E FRANKE cephaly, a history of pedal oedema and intensified cell growth. In conclusion, the final Department of Pathology, Justus Liebig University detailed eye examination are essential. Gieâen, Gieâen, Germany diagnosis of a low malignant conjunctival WERNER W HÜTZ MLZ of the MALT type was established and CASE REPORTS confirmed by the German reference centre Department of Ophthalmology, Kreiskrankenhaus Bad Hersfeld, Bad Hersfeld, Germany The index patient, a male, was born as the (Prof M-L Hansmann, University of Frank- second child, to unrelated parents. He was Correspondence to: Dr med Alexander H. Heuring, furt). The patient underwent radiotherapy (40 born at a gestational age of 37 weeks by elec- × Augenklinik der Otto-von-Guericke-Universität, Gy) of the right orbit (fractionated to 5 2 tive caesarean section for unexplained intrau- Gy/week). After radiotherapy, the lesion de- Leipzigerstrasse 44, D-39120 Magdeburg, Germany [email protected] terine growth retardation. He was severely creased markedly. No recurrence of the orbital Accepted for publication 1 November 2000 microcephalic and had marked lymphoedema lesion or any systemic involvement was noted of the dorsum of both feet. Facial features during the follow up period of 18 months. 1 Knowles DM, Jakobiec FA, McNally L, et al. were peculiar with, in addition to the micro- Lymphoid hyperplasia and malignant lymphoma occurring in the ocular adnexa cephaly, low set ears and retrognathia. There COMMENT (orbit, conjunctiva, and eyelids): a prospective was a transverse palmar groove on the left The immunophenotypic profiles of low grade multiparametric analysis of 108 cases during side, a right sided hydrocele and cardiac B cell NHL are complex and still under inves- 1977 to 1987. Hum Pathol 1990;21:959–73. examination revealed the presence of an atrial 2 Harris LN, JaVe ES, Stein H, et al. A revised tigation. Especially the T cell antigen CD5 is septal defect, a small ventricle septal defect,

European-American classification of lymphoid http://bjo.bmj.com/ used to subclassify this group of B cell neoplasms: a proposal from the international and a right aortic arch. Neurological examina- lymphomas. Since CD5+ B cells were found lymphoma study group. Blood 1994;84:1361– tion revealed axial hypertonia and severe 92. in normal liver, spleen, and lymph node, 3 Antin JH, Emerson SG, Martin P, et al. Leu-1+ developmental delay. Axial T1 weighted MR CD5+ B cell NHL are considered to be a (CD5+) B-cells. A major lymphoid subpopula- image at 4 months showed microcephaly and malignant clonal proliferation of a specific tion in human fetal spleen: phenotypic and microlissencephaly. Asymmetry of the eyes stage of B cell diVerentiation.3 The T cell anti- functional studies. J Immunol 1986;36:505–11. was noted and the right eye had an abnormal 4 Medeiros LJ, Harris NL. Lymphoid infiltrates of gen CD5 has been reported in B cell NHL the orbit and conjunctiva. A morphologic and leucocoric appearance. Corneal diameters between 3% and 40%.145In extranodal MZL immunophenotypic study of 99 cases. Am J Surg were 11.5 mm on the right and 9 mm on the Pathol 1989;13:459–71. the presence of CD5 is described in one of 35 left. There was an iris bombans on the on October 1, 2021 by guest. Protected copyright. 5 Jakobiec FA, Iwamoto T, Patell M, et al. Ocular cases, in two of 63 cases, respectively in one of adnexal monoclonal lymphoid tumors with a cataractous right eye with pressure of 30 mm 6–8 nine cases. Only three cases were disclosed favorable prognosis. Ophthalmology 1986;93: Hg. Ultrasound showed the characteristics of which aVected the eye.910 1547–57. a persistent hyperplastic primary vitreous Since increased numbers of CD5+ B cells 6 Coupland SE, Krause L, Delecluse HJ, et al. (PHPV). After a surgical procedure with irid- Lymphoproliferative lesions of the ocular adn- are found in blood of patients with autoim- exa. Analysis of 112 cases. Ophthalmology 1998; ectomy the pressure normalised. On fundus- mune diseases,11 CD5+ B cells are thought to 105:1430–41. copy of the left eye a dystrophic retina with exert an immunoregulatory function. Whether 7 Nakata M, Matsuno Y, Katsumata N, et al. His- punched out lesions was seen (Fig 1). The tology according to the revised European- CD5 expression is relevant to the prognosis of American lymphoma classification significantly second patient is the 3 year old brother of the patients with MALT lymphoma is controver- predicts the prognosis of ocular adnexal index patient. He was microcephalic and sial.6910 lymphoma. Leuk Lymphoma 1999;32:533–43. showed marked lymphoedema of both feet at The association of MALT lymphomas with 8 White WL, Ferry JA, Harris NL, et al. Ocular birth. Development was moderately retarded. adnexal lymphoma. A clinicopathologic study diverse autoimmune disorders, especially Sjö- with identification of lymphomas of mucosa- Ophthalmological examination revealed bilat- gren’s syndrome and Hashimoto’s thyroiditis associated lymphoid tissue type. Ophthalmology eral chorioretinal dysplasia with the punched is well known.12 13 Until now, the pathogenetic 1995;102:1994–2006. out lesions being localised in the periphery 9 Ballesteros E, Osborne BM, Matsushima AY. link of this relation is not clear, but an CD5+ low-grade marginal zone B-cell lympho- and midperiphery. Optic discs had a waxy pale influence of a long standing inflammation and mas with localized presentation. Am J Surg aspect, macular reflex was dull (Fig 2). A a lack of a regulatory lymphocytic subset are Pathol 1998;22:201–7. fERG performed under sedation using con- discussed to promote the development of 10 Ferry JA, Yang WI, Zukerberg LR, et al. CD5+ tact lens electrodes showed a severely attenu- 14 extranodal marginal zone B-cell (MALT) MALT lymphoma. Perhaps there is also a lymphoma. A low grade neoplasm with a ated cone and rod response. The third patient (autoimmune) correlation of anterior uveitis propensity for bone marrow involvement and is the 27 year old father of both patients. He (of the contralateral eye) and MALT relapse. Am J Clin Pathol 1996;105:31–7. was mildly mentally retarded. Physical exam- 11 Hsi ED, Singleton TP, Svoboda SM, et al. Char- lymphoma as demonstrated here, but it acterization of the lymphoid infiltrate in Hashi- ination revealed microcephaly and dilated cannot be proved and is perhaps incidental. moto thyroiditis by immunohistochemistry and veins on the dorsal side of his feet. On fundus- The diVerential diagnoses of our patient are polymerase chain reaction for immunoglobulin copy subtle atrophic pigment epithelial MZL, bearing the unusual CD5+ phenotype, heavy chain gene rearrangement. Am J Clin changes could be noted temporally from the Pathol 1998;110:327–33. chronic lymphocytic B cell leukaemia 12 Shin S, Sheibani K, Fishleder A, et al. Monocy- optic disc on the right eye; on the left eye (B-CLL), and mantle cell lymphoma (MCL). toid B-cell lymphoma in patients with Sjogren’s atrophic changes were prominent. A fERG

www.bjophthalmol.com 500 Letters

not in his father and brother, suggesting that A LEYS both conditions might belong to the same H VAN CLEYNENBREUGEL spectrum of a single genetic disorder. Micro- Department of Ophthalmology, St Rafael University Br J Ophthalmol: first published as 10.1136/bjo.85.4.496f on 1 April 2001. Downloaded from cephaly and lymphoedema (MIM152950) Hospitals, Capucijnenvoer 33, B-3000, Leuven, was first described by Leung in 1985 in five Belgium individuals in a four generation family.4 There P DEMAEREL was no mental retardation. Congenital lym- Department of Radiology, Gasthuisberg University phoedema has also been described in three Hospitals Leuven, Herestraat 49, B-3000 Leuven other isolated cases of microcephaly- F DE TAVERNIER chorioretinopathy.5–7 In the present family, the Department of Paediatrics, AZ St-Lucas-St-Jozef microcephaly and lymphoedema of the feet in Hospital, St-Lucaslaan 29, 8310 Assebroek Brugge patients 1 and 2 was associated with mental J P FRYNS retardation as well as chorioretinopathy. This Department of Clinical Genetics, Gasthuisberg suggests that the three disorders previously University Hospitals Leuven, Herestraat 49, B-3000 distinguished could be the variable expression Leuven of a single genetic condition. Correspondence to: I Casteels, Department of Oph- Ophthalmological findings reported in the thalmology, Capucijnenvoer 33, B-3000 Leuven autosomal dominant syndrome of [email protected] microcephaly-chorioretinal dysplasia syn- Accepted for publication 7 November 2000 drome (MIM156590) include chorioretinal dysplasia, myopic astigmatism, and retinal 1 Alzial C, Dufier JL, Brasnu C, et al. Micro- dystrophy. Chorioretinal dysplasia represents céphalie ‘vraie’ avec dysplasie chorio-rétinienne the most common ocular abnormality seen in à hérédité dominante. Ann Genet 1980;23:91–4. all patients of this report. Microphthalmia as 2 Sadler LS, Robinson LK. Chorioretinal dysplasia-microcephaly-mental retardation syn- seen in the proband has been reported drome. Report of an American family. Figure 1 Patient 1. On funduscopy of the left 58 Am J eye a dystrophic retina with punched out lesions before. Closed angle glaucoma secondary to Med Genet 1993;47:65–8. became obvious. a persistent primary hyperplastic vitreous 3 Limwongse C, Wyszynski RE, Dickerman LH, (PHPV) has not been described. The spec- et al. Microcephaly-lymphedema-chorioretinal dysplasia: a unique genetic syndrome with vari- was performed and showed a normal rod and trum of eye anomalies seen in the three able expression and possible characteristic facial cone response. patients of a single family clearly indicate the appearance. Am J Med Genet 1999;86:215–18. In all three patients high resolution chromo- wide variety of eye anomalies that can be asso- 4 Leung AKC. Dominantly inherited syndrome of ciated with a single genetic entity. microcephaly and congenital lymphedema. Clin somal analysis on a peripheral blood lym- Genet 1985;27:611–12. phocyte culture revealed a 46,XY normal Feingold and Bartoshesky and Limwongse 5 Fryns JP, Smeets E and Van den Berghe H. On male karyotype after G-banding. et al suggested before that the three entities the nosology of the ‘primary true microcephaly’, might represent the variable expression of a chorioretinal dysplasia, lymphoedema associ- single entity.37 The clinical variability in the ation. Clin Genet 1995;48:131–3. 6 Angle B, Holgado S, Burton BK, . Micro- COMMENT expression of this syndrome is remarkable. et al In literature, three distinct conditions have cephaly, lymphedema, and chorioretinal The proband of the present family had a dysplasia: report of two additional cases. Am J been delineated—microcephaly with chori- severe multiple malformation syndrome, with Med Genet 1994;53:99–101. oretinopathy (MIM 156590)) microcephaly anomalies of the brain, heart, and eyes. The 7 Feingold M, Bartoshesky L. Microcephaly, with microphthalmia and retinal folds lymphedema, and chorioretinal dysplasia: a dis- presence of marked lymphoedema of the feet tinct syndrome? Am J Med Genet 1992;43: (MIM180060), and microcephaly and lymph- suggested the diagnosis which was confirmed 1030–1. oedema (MIM152950). The features in the upon examination of his brother and father, 8 Hordijk R, van de Logt F, Houtman WA, et al. present family overlap with these three disor- who had milder manifestations with micro- Chorioretinal dysplasia-microcephaly-mental ders. This suggests that, in at least some retardation syndrome: another family with auto- cephaly and developmental delay. Interest- somal dominant inheritance. instances, they can be the variable expression Genetic Counselling ingly, the eye anomalies had not been 1996;7:113–22. http://bjo.bmj.com/ of a single genetic condition. diagnosed in either of them, and in addition 9 Talmie JL, Mc Noy M, Stephenson JB, et al. In the syndrome with microcephaly with the pedal oedema had disappeared. This Microcephaly: genetic counselling and antenatal chorioretinopathy variable expressivity and diagnosis after the birth of the aVected child. suggests that in all children with micro- Am J Med Genet 1987;27:583–94. the presence of mental retardation as an asso- cephaly, a careful eye examination is war- 10 McKusick VA, StauVer M, Knox DL, et al. Cho- 1 ciated feature have repeatedly been reported. ranted. rioretinopathy with heriditary microcephaly. Male to male transmission of microcephaly, Counselling in microcephaly is diYcult, and Arch Ophthalmol 1966;75:597–600. chorioretinal dysplasia, and mental retarda- in the absence of a specific aetiological tion has also been described.23 Microcephaly diagnosis, an empirical recurrence risk of Uveitis associated with OKT3 therapy for with microphthalmia and retinal folds 910 on October 1, 2021 by guest. Protected copyright. 15–20% is often cited. Chorioretinal renal transplant rejection (MIM180060) has been reported as an appar- dysplasia-microcephaly-mental retardation ently separate condition. However, micro- syndrome (CDMMS) with autosomal reces- EDITOR,—OKT3 (Ortho Biotech, Inc, Rari- cephaly and microphthalmia were also present sive inheritance was described by McKusick et tan, NJ, USA) is a murine monoclonal in the youngest child in the present family, but 10 al. antibody to the CD3 receptor of human T In a sporadic patient with microcephaly, lymphocytes, used in treatment of acute cellu- chorioretinal dysplasia, and mental retarda- lar graft rejection.1 Adverse eVects of OKT3 tion the clinical distinction between and auto- include flu-like symptoms, hypotension, pul- somal dominant and recessive inheritance is monary oedema, cardiac dysfunction, aseptic 8 not possible. However, the association with meningitis, and visual complications.2 We pedal lymphoedema could indicate probable describe uveitis following administration of autosomal dominant inheritance, since this OKT3. has not been described in the autosomal recessive families. CASE REPORT A 51 year old man with polycystic renal Koen Devriendt is a senior clinical investigator of the disease underwent renal transplant from an Fund for Scientific Research-Flanders (Belgium) unrelated donor. He was treated with antithy- (FWO). This paper was presented at the EPOG meeting mocyte globulin and steroid in the immediate Cambridge in September 2000 by I Casteels postoperative period, and was discharged 7 I CASTEELS days after surgery, with a nadir creatinine of Department of Ophthalmology, St Rafael University 1.1, on cyclosporine 100 mg twice daily, pred- Hospitals, Capucijnenvoer 33, B-3000, Leuven, nisone 200 mg/day, amiodipine, nystatin, and Belgium famotidine. Figure 2 Patient 2, right eye. On funduscopy, K DEVRIENDT Creatinine rose to 1.9 on postoperative day chorioretinal dysplasia was evident in both eyes Department of Clinical Genetics, Gasthuisberg 30, and renal biopsy demonstrated lym- with the punched out lesions being localised in the University Hospitals Leuven, Herestraat 49, B-3000 phocytic interstitial infiltration, tubulitis, and periphery and midperiphery. Leuven endothelialitis. The patient was diagnosed

www.bjophthalmol.com Letters 501 with BANFF 2B rejection, and given intra- In conclusion, severe anterior uveitis oc- venous methylprednisolone 500 mg on the curred during treatment with OKT3, and first day, tapered over 5 days to prednisone 30 resolved with OKT3 withdrawal and topical Br J Ophthalmol: first published as 10.1136/bjo.85.4.496f on 1 April 2001. Downloaded from mg/day. Creatinine level rose to 2.4 on day 35, therapy. and OKT3 (5 mg/day, intravenous) was RAY F GARIANO begun. MARC L WEITZMAN On the fifth day of OKT3 therapy, the Department of Ophthalmology and Visual Science, Yale patient complained of right eye discomfort University School of Medicine, New Haven, CT,USA and redness. Over 2 days, the discomfort Correspondence to: Ray Gariano, MD, PhD, Yale worsened and visual acuity fell, to 6/24− on University Eye Center, 330 Cedar Street, New the right and 6/9 on the left. Marked conjunc- Haven, CT 06520-8061, USA tival injection, keratic precipitates, iris vessel [email protected] congestion, white cells in the anterior Accepted for publication 31 October 2000 Figure 1 Mass on the temporal area of superior chamber, hypopyon, and trace anterior right lid. vitreous cells were present in the right eye. 1 Parlevliet KJ, Schellekens PT. Monoclonal anti- Inflammation obscured fundus details, but bodies in renal transplantation: a review. Trans- revealed a serous retinal detachment and an abnormalities were not detected by B-mode plant Int 1992;52:34–46. intraocular mass. ultrasonography. The left eye exhibited con- 2 Sgro C. Side-eVects of a monoclonal antibody, muromonab CD3/orthoclone OKT3: biblio- Since a lymphoma was highly suspected junctival injection without intraocular inflam- graphic review. Toxicology 1995;105:23–9. specific treatment was started, and 5 days after mation. 3 Saran BR, Maguire AM, Nichols C, et al. the first chemotherapy, a significant reduction Anterior chamber paracentesis from the Hypopyon uveitis in patients with acquired in the size of the mass was noted. Examination right eye revealed white blood cells and no immunodeficiency syndrome treated for sys- temic Mycobacterium avium complex infection of the right fundus disclosed a large temporal organisms. Cultures of aqueous humour and with rifabutin. Arch Ophthalmol 1994;112:1159– scar and surprisingly, the left choroidal lesion conjunctival swab were negative. Topical 65. had completely disappeared. prednisolone 1% every 2 hours and hyoscine 4 Strominger MB, Liu GT, Schatz NJ. Optic disk One month after the last chemotherapy, a (scopolamine) 0.25% twice daily were begun swelling and abducens palsies associated with OKT3. Am J Ophthalmol 1995;119:664–5. drastic recurrence of the right mass occurred, in the right eye, and OKT3 was discontinued. 5 Dukar O, Barr CC. Visual loss complicating causing total ophthalmoplegia, paralytic my- Three days later, acuity improved to 6/18, OKT3 monoclonal antibody therapy. Am J driasis, and amaurosis. An elevated lesion was conjunctival injection decreased, and the Ophthalmol 1993;115:781–5. found on the bulbar conjunctiva from which a hypopyon resolved. Prednisolone drops were 6 McCarthy JM, Sullivan K, Keown PA, et al. Dif- fuse anterior scleritis during OKT3 monoclonal tissue specimen was easily obtained. Left tapered and, within 5 days, vision improved to antibody therapy for renal transplant rejection. visual acuity had also decreased to 6/60. At 6/7.5 in both eyes, and ocular inflammation Can J Ophthalmol 1992;27:22–4. this moment, an extensive yellowish temporal cleared. Over the next week, topical medica- 7 Sakaguchi M, Sugita S, Sagawa K, et al. Cytokine choroidal lesion was found in the right fundus. tions were tapered, then discontinued, with- production by T cells infiltrating in the eye of uveitis patients. Jpn J Ophthalmol 1998;42:262– Left fundus examination disclosed a serous out return of inflammation. 8. retinal detachment involving the superior 8 Zegans ME, Walton RC, Holland GN, et al. Transient vitreous inflammatory reactions asso- retina along the supratemporal arcade. CT COMMENT ciated with combination antiretroviral therapy scan showed that the right orbital mass OKT3 is implicated as a cause of anterior in patients with AIDS and cytomegalovirus expanded towards the apex, with cavernous uveitis in our patient because of onset of retinitis. Am J Ophthalmol 1998;125:292–300. sinus involvement. It also detected a left retro- inflammation soon after initiating OKT3 ocular mass associated with a posterior scleral therapy, accelerated resolution of inflamma- Maxillary sinus non-Hodgkin’s thickening, as well as multiple cerebral lesions. tion following discontinuation of OKT3, and lymphoma with orbital and intraocular The patient’s condition rapidly deteriorated lack of identifiable infectious aetiologies. We and he died a few days later. Postmortem did not further pursue a cause and eVect rela- involvement in the acquired examination was not performed. tion through OKT3 rechallenge because renal immunodeficiency syndrome The specimen removed from the right http://bjo.bmj.com/ status had improved. It is unclear whether bulbar conjunctiva revealed a large cell, poorly EDITOR,—In spite of its rare occurrence there OKT3 acted alone or in combination to diVerentiated neoplasm. Neoplastic cells with is a well established association between the induce uveitis. This type of synergistic drug plasmocytoid diVerentiation were found in a acquired immune deficiency syndrome interaction is reported for rifabutin induced scattered distribution. Immunohistochemical (AIDS) and lymphoma, which most of the uveitis, which may be potentiated by concur- studies were done using the indirect imu- 3 time is a highly malignant B cell type aVecting rent administration of fluconazole. noperoxidase method with diaminobenzidine the central nervous system (CNS).1 Ocular side eVects of OKT3 include optic (DAB), and the antigen retrieval method Rare cases of lymphomas involving parana- neuritis, abducens nerve palsies, conjunctivi- using heat or protease. The following markers sal sinus, orbit, and intraocular structures tis, scleritis, and blindness presumed due to were used: CD3, CD20, CD30, Kappa, on October 1, 2021 by guest. Protected copyright. 4–6 have been described. This report describes a photoreceptor toxicity. Non-infectious uvei- Lambda, Vimentin, Citoceratina pan, case of primary lymphoma of the maxillary tis in patients taking OKT3 is not reported or HMB45, Protrína S-100. The tumour cells sinus with orbital and intraocular secondary known to the manufacturer. showed nucleolar immunopositivity for anti- involvement. While eYcacy of OKT3 against allograft CD20 antibody. rejection is based on suppression of CD3 T lymphocytes, OKT3 side eVects may result CASE REPORT from stimulation of separate immune path- A 28 year old man with AIDS presented with ways. For instance, aseptic meningitis and right proptosis and recurrent sinusitis. His encephalitis may result from activation by CD4+ count was 3 cells ×109/l and viral load OKT3 of non-CD3 T cells that then attack 1 343 145 copies. Skull and orbital computed neural antigens.2 OKT3 induces a cytokine tomograph (CT) scans demonstrated right release syndrome in which interleukin-6, maxillary sinus opacification, mild right prop- tumour necrosis factor, and other mediators tosis, and an anterior superotemporal mass in are released by lymphocytes2; these agents are the right orbit. Cerebral image was unremark- also implicated in uveitis.7 Production of anti- able. The ocular examination disclosed right OKT3 and other antibodies, and complement eye proptosis, ptosis, and a visible mass on the activation, also occur with OKT3 therapy, and temporal area of superior right lid, restricting may contribute to inflammation by immune spontaneous lid opening (Fig 1). There was complex formation with ocular or other bilateral lid oedema but no mass could be antigens.2 Although vitritis may develop dur- found on the left side. Right eye movements ing immune recovery in patients with AIDS were restricted. Pupillary reflexes were normal and retinitis,8 it is unlikely that enhanced in both eyes, and visual acuity reached 6/12 immune activity associated with acute rejec- right eye and 6/6 left eye. Fundus examination tion is relevant in our patient, since uveitis revealed a left choroidal lesion measuring began only after additional immunosuppres- approximately one disc diameter superior to Figure 2 Left fundus showing choroidal lesion sive therapy was given. A direct toxic eVect of the disc (Fig 2). Lid infiltration prevented measuring approximately 1 disc diameter OKT3 in ocular tissues has not been reported. right fundus examination, but a B-scan superior to the disc.

www.bjophthalmol.com 502 Letters

COMMENT 3 Matzkin DC, Slamovits TL, Rosenbaum PS. Classically, the AIDS associated lymphomas Simultaneous intraocular and orbital non- Hodgkin lymphoma in the acquired immuno- Br J Ophthalmol: first published as 10.1136/bjo.85.4.496f on 1 April 2001. Downloaded from are of the B cell type and involve the CNS and deficiency syndrome. Ophthalmology 1994;101: the abdominal cavity, as opposed to the 850–5. 4 Desai UR, Peyman GA, Blinder KJ. Orbital preferential ganglion involvement seen in extension of sinus lymphoma in AIDS patient. 1–3 immune competent patients. Such cases Jpn J Ophthalmol 1992;36:205–14. usually develop at advanced disease stage. Pri- 5 Rootman J, Robertson WD. In: Rootman J, ed. mary maxillary sinus lymphoma is rare, as is Tumors, diseases of the orbit—a multidisciplinary 4 approach. Philadelphia: JB Lippincott, 1988: secondary orbital involvement. Malignant 281–480. paranasal sinus tumour secondarily involves 6 Logani S, Logani SC, Ali BH, et al. Bilateral, the orbit in 45% of the cases, but lymphomas intraconal non-Hodgkin’s lymphoma in a pa- 5 tient with acquired immunodeficiency syn- are uncommon. Primary and secondary drome. Am J Ophthalmol 1994;118:401–2. orbital lymphomas are rare, and bilateral 7 Schanzer MC, Font RL, O’Malley RE. Primary occurrence is very unlikely.6 Rare cases of ocular malignant lymphoma associated with the acquired immune deficiency syndrome. Oph- intraocular primary lymphomas were also 1991; :88–91. 78 thalmology 98 previously described. Our patient had bilat- 8 Stanton CA, Sloan III DB, Slusher MM, et al. eral involvement of the sinuses, orbit, and Acquired immunodeficiency syndrome-related intraocular structures, which was confirmed primary intraocular lymphoma. Arch Ophthal- mol 1992;110:1614–17. by CT scan, and although we didn’t obtain a 9 Levine AM, Gill PS, Meyer PR, et al. Retrovirus specimen from the choroidal lesions for histo- and malignant lymphoma in homosexual men . logical confirmation, the disappearance of the JAMA 1985;254:1921–5. 10 Mittra RA, Pulido JS, Hanson GA, et al. Primary left lesion and the scarring on the right fundus ocular Epstein-Barr virus-associated non- just after treatment supports lymphoma as the Hodgkin’s lymphoma in a patient with AIDS—a diagnosis for the intraocular lesion. The clinicopathologic report. Retina 1999;19:45–50. Figure 2 Histopathology of the excised cornea immunohistochemistry was CD20 (L26) (×625). Top, silver stain. Bottom, PAS. The positive, and negative for all the other markers organisms have not stained with PAS; their Pythium insidiosum keratitis confirmed (CD3, CD30, Lambda, Kappa, S-100 pro- presence is indicated by the spaces in the section. tein, HMB45), confirming the B cell origin. by DNA sequence analysis Non-Hodgkin’s lymphoma in HIV infected EDITOR,—Pythium insidiosum is an unusual but taken. Gram and Giemsa stains were negative. patients tends to be of high grade malignancy, serious ocular pathogen. Although the organ- A biopsy was performed the following day and being very aggressive most of the times, with a hyphae were observed in sections. A filamen- 49 ism grows as a mycelium in tissue, it is not a mean survival of around 8 months. Our member of the fungal kingdom and its identi- tous organism appeared in cultures of the patient died after 3 months in spite of initial fication can be a challenge for a routine labo- original scrapings. There was no response to good response to chemotherapy. ratory. We report a case of Pythium keratitis in continued antifungal treatment and a pen- Lymphoma treatment is still controversial. which the organism was confirmed by nucleic etrating graft was performed 4 days after the Radiotherapy has demonstrated good results acid sequencing. biopsy. Postoperatively, the patient received for treatment of both systemic disease and in oral itraconazole and topical natamycin. Pred- cases of orbital and intraocular involvement. nisolone phosphate drops were introduced 10 On the other hand, chemotherapy has been CASE REPORT days later. Twice in the first 3 weeks after sur- good for systemic disease but has not been A 32 year old man was referred from Kuala gery the patient returned to theatre for an successfully used for intraocular disease.10 Lumpur having suVered with intractable kera- anterior chamber washout of proliferative Interestingly, our patient had a significant titis of the left eye for 4 weeks. He gave a his- material invading from the peripheral cornea tory of diabetes, disposable contact lens wear, improvement after chemotherapy, but that (Fig 1, bottom). Hyphae were seen in these and swimming in the Kelang River. Routine was shortly followed by an intense reactiva- specimens, but cultures were negative. The microbiological investigations had been nega- tion, which was probably due to the high patient returned to Malaysia and, 7 months tive. At presentation to Flinders Medical Cen- http://bjo.bmj.com/ grade of malignancy. postoperatively, had a clear graft, useful vision tre, he was on topical antibacterial, antifungal, Isolated or associated paranasal sinus, in the eye, and no recurrence of infection. and antiamoebic medication. He had a large orbital, and intraocular lymphomas are con- The histopathology revealed a florid kerati- epithelial defect, a deep stromal infiltrate sidered to be very rare tumours, and even tis with necrotic stroma and degenerate approaching the limbus, and hypopyon (Fig 1, though their incidence has decreased in the neutrophils and monocytes. Massive numbers top). His visual acuity was hand movements HAART era, clinicians should be aware of this of hyphae were seen in silver-stained sections, and there was considerable pain. The drops potential manifestation of non-Hodgkin’s particularly in the anterior stroma (Fig 2, top). were stopped and corneal scrapings were lymphoma. Hyphae were also observed penetrating De-

scemet’s membrane. The organisms were not on October 1, 2021 by guest. Protected copyright. ANDRÉLLCURI stained by the periodic acid-SchiV (PAS) Department of Ophthalmology, Fluminense Federal method, also commonly used in suspected University, Niterói, Brazil fungal infection, giving these sections the TEREZA C FERREIRA appearance of Swiss cheese (Fig 2, bottom). Department of Infectious Diseases, Santa Martha Colonies grew rapidly on the primary Hospital, Niterói, Brazil fungal medium (plain Sabouraud’s agar, JOSÉ C SADDY 28°C). They were white with a yellowish Department of Pathology, Fluminense Federal tinge, unusually flat, and diYcult to cut and University, Niterói, Brazil separate from the agar. Few septae and no RICARDO SALGADO spores were seen. The isolate was sent to a ref- Department of Oncology, Santa Martha Hospital, erence laboratory under suspicion of being a Niterói, Brazil zygomycete. However, no further taxonomic CARLOS PAVÉSIO clues were induced by standard measures so a Department of Medical Retina, Moorfields Eye molecular approach was employed. The meth- Hospital, London, UK ods have been described.1 Initially, a 510 base Correspondence to: Carlos Pavesio, Medical Retina segment of the 18S ribosomal RNA gene was Department, Moorfields Eye Hospital, City Road amplified (universal primers NS1 and NS2)2 EC1V 2PD, London, UK and sequenced (Model 373A DNA se- Accepted for publication 1 November 2000 quencer, Applied Biosystems Inc). A search of databases (GenBank, EMBL) revealed ho- mology to oomycetes. The isolate was then 1 Ziegler JL, Drew WL, Miner RC, et al. Outbreak of Burkitt’s-like lymphoma in homosexual men. incubated for 48 hours in water containing Lancet 1982;2:631–3. autoclaved grass. Motile zoospores were ob- 2 Font RL, Laucirica R, Patrinely JR. Immunoblas- Figure 1 Pythium insidiosum keratitis. Top, the served, indicative of P insidiosum. Other char- tic B-cell malignant lymphoma involving the acteristics consistent with this identification orbit and maxillary sinus in a patient with patient at presentation. Bottom, proliferative acquired immune deficiency syndrome. Oph- material in the anterior chamber after corneal were colony morphology, optimal temperature thalmology 1993;100:966–70. transplantation. of growth (35°C), hyphal diameter (4–6 mm),

www.bjophthalmol.com Letters 503 intercalary swellings in viable hyphae, vesicles fish. In mammals, P insidiosum causes a granu- MICHAEL A ROZENBILDS at the end of spore discharge tubes, and spores lomatous disease (“swamp cancer”) in several Department of Anatomical Pathology, Flinders Medical germinating by means of germ tubes.3 species including horses and dogs. A number of Centre, Bedford Park, Br J Ophthalmol: first published as 10.1136/bjo.85.4.496f on 1 April 2001. Downloaded from To confirm the identification, the internal cases of human pythiosis have been reported, South Australia transcribed spacer (ITS) region defined by mostly subcutaneous infections and arteritis in ANDRÉ DRENTH primers TW81 and AB28 (incorporating thalassaemic patients in farming communities GABRIELE WAGELS ITS1, the 5.8S gene and ITS2) was amplified. of South East Asia.6 With respect to the eye, P CRC for Tropical Plant Pathology, University of The 900 base pair product was sequenced by a insidiosum has been responsible for periorbital Queensland, St. Lucia, direct double stranded DNA cycle method infections in Australia7 and the USA8 and Queensland 1 6 9 using primers 1–6 as detailed except for the corneal ulcers in Thailand, Haiti, and New Correspondence to: Dr Paul Badenoch, Department 10 substitution of primer 3 with 3c (5’- Zealand. Some patients have had no other of Ophthalmology, Flinders Medical Centre, South GCGACTTCGGTTAGGACATT). The se- medical history. Contact lens wear, exposure to Australia 5042, Australia quences were checked between complemen- river water, and diabetes were possible predis- Accepted for publication 23 October 2000 tary strands and shown to be 99.0% posing factors in our patient. homologous with P insidiosum reference strain No cases of Pythium keratitis have been CBS777.84 using CLUSTAL V software4 (CA cured medically. A boy with facial pythiosis 1 Crawford AR, Bassam BJ, Drenth A, et al. Evolu- Lévesque, personal communication). In com- tionary relationships among Phytophthora spe- was cured without surgery bya1yearcourse cies deduced from rDNA sequence analysis. ∼ 8 parison, the sequence was 95% homologous of terbinafine and itraconazole. For the Mycological Res 1996;100:437–43. with other Pythium species and ∼90% homolo- cornea, however, it would be diYcult to imag- 2 White TJ, Bruns T, Lee S, et al. Amplification gous with other genera of oomycetes (BLAST ine a successful outcome given the destructive and direct sequencing of fungal ribosomal RNA database, NIH, Bethesda, MD, USA). nature of the organism, the slow response if genes for phylogenetics. In: Innis M, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols. any to most antimicrobial agents, the probable San Diego: Academic Press, 1990:315–22. COMMENT delay in identification, and the need to prevent 3 Mendoza L, Hernandez F, Ajello L. Life cycle of P insidiosum is an aquatic, filamentous organ- further tissue invasion. Transplantation may the human and animal oomycete pathogen ism that produces heterokont, biflagellate be the best option. Pythium insidiosum. J Clin Microbiol 1993;31: The introduction of corticosteroids in the 2967–73. (Published erratum appears in J Clin zoospores, placing it as an oomycete in the Microbiol 1994;32:276.) kingdom Chromista. The only other human management of fungal keratitis and, presum- 4 Higgins DG, Bleasby AJ, Fuchs R. CLUSTAL V: pathogen in this kingdom is Rhinosporidium ably, Pythium infection, must be approached improved software for multiple sequence align- seeberi, the agent of rhinosporidiosis. Oomyc- with great caution. We gave prednisolone in ment. Comput Appl Biosci 1992;8:189–91. etes have a diploid genome and a cell wall the hope of reducing inflammation in the 5 Imwidthaya P, Srimuang S. ImmunodiVusion consisting of cellulosic compounds and gly- grafted cornea without encouraging a recur- test for diagnosing human pythiosis. Mycopatho- logia 1989;106:109–12. can, features which distinguish them from the rence of the disease. It was fortunate that, 6 Thianprasit M, Chaiprasert A, Imwidthaya P. fungal groups of the kingdom Fungi. The apparently, no infectious elements had been Human pythiosis. Curr Top Med Mycol 1996;7: identification of an oomycete in our patient left in the eye. 43–54. can explain the PAS result and the lack of 7 Triscott JA, Weedon D, Cabana E. Human sub- PAUL R BADENOCH response to antifungals, there being no chitin cutaneous pythiosis. J Cutan Pathol 1993;20: DOUGLAS J COSTER 267–71. or ergosterol in the cell wall, respectively. In Department of Ophthalmology, Flinders University of 8 Shenep JL, English BK, Kaufman L, et al. addition to our genetic approach to confirm- South Australia and Flinders Medical Centre, Bedford Successful medical therapy for deeply invasive ing the identification, serological tests have Park, South Australia facial infection due to Pythium insidiosum in a 5 child. Clin Infect Dis 1998;27:1388–93. been developed in Bangkok and at the Cent- BRUCE L WETHERALL ers for Disease Control, Atlanta. 9 Virgile R, Perry HD, Pardanani B, et al. Human HELEN T BRETTIG infectious corneal ulcer caused by Pythium Oomycetes play an important part in the Department of Clinical Microbiology and Infectious insidiosum. Cornea 1993;12:81–3. decomposition and recycling of decaying mat- Diseases, Flinders Medical Centre, Bedford Park, South 10 Murdoch D, Parr D. Pythium insidiosum kerati- ter. Some species are parasitic on crops and Australia tis. Aust NZ J Ophthalmol 1997;25:177–9. http://bjo.bmj.com/ on October 1, 2021 by guest. Protected copyright.

www.bjophthalmol.com