JARO 5: 295–304 (2004) DOI: 10.1007/s10162-004-4044-3 JAROJournal of the Association for Research in Otolaryngology A Comparative Study of Eya1 and Eya4 Protein Function and Its Implication in Branchio-oto-renal Syndrome and DFNA10 1 2 3 4 YUZHOU ZHANG, BOYD M. KNOSP, MARK MACONOCHIE, RICK A. FRIEDMAN, 1 RICHARD J.H. SMITH 1Molecular Otolaryngology Research Laboratories, University of Iowa, Iowa City, IA 52242, USA 2The University of Iowa ITS Research Service, University of Iowa, Iowa City, IA 52242, USA 3School of Life Sciences, University of Sussex, Falmer, Brighton, BN1 9QG, UK 4House Ear Institute, Los Angeles, CA 90057, USA Received: 24 October 2003; Accepted: 29 March 2004; Online publication: 30 July 2004 ABSTRACT loinsufficiency as the cause of BOR syndrome and DFNA10. Allele variants of EYA1 and EYA4, two members of the Keywords: Eya gene family, Six gene family, branchio- vertebrate Eya gene family, underlie two types of oto-renal syndrome, DFNA10, haploinsufficiency inherited human deafness, branchio-oto-renal (BOR) syndrome and DFNA10, respectively. To clarify how mutations in these two genes and their encoded proteins impact the normal biology of hearing, we completed a number of functional studies using the yeast-two-hybrid system. We verified that bait con- INTRODUCTION structs of the homologous region (Eya1HR and Eya4HR) interact with Six1 prey constructs, although The vertebrate Eya gene family is comprised of four no interaction with Dach1 prey was demonstrable. To transcriptional activators that interact with other compare interaction affinities, we evaluated a-galac- proteins in a conserved regulatory hierarchy to en- tosidase activity after cotransformation of Eya1HR/ sure normal embryologic development. The structure Six1 and Eya4HR/Six1 and found that the latter of these proteins as deduced from their cDNA se- interaction was weaker. By immunofluorescence quences includes a highly conserved 271-amino acid staining, we showed Eya4HR localization to the carboxy terminus called the eya-homologous region cytoplasm. After coexpression of Six1, Eya4HR was (eyaHR) and a more divergent proline–serine–thre- translocated to the nucleus. Results with Eya1HR onine (PST)-rich (34%–41%) transactivation domain were similar. Translation of mutant constructs at the amino terminus (eya variable region, eyaVR) (Eya4HRR564X and Eya1HRR539X) could not be dem- (Zimmerman et al. 1997) (Fig. 1). Studies in Dro- onstrated. Using dual Eya-containing constructs (with sophila indicate that the eyaHR mediates interactions two wild-type alleles or wild-type and mutant alleles), with the gene products of so (sine oculis) and dac we confirmed no translation of the mutant allele, (dachshund), and that expression of both eya and so even if the mutation was nontruncating. These results is initiated by ey (eyeless) (Bonini et al. 1993, 1997; are consistent with clinical data and implicate hap- Pignoni et al. 1997). The vertebrate orthologs of so are members of the Six gene family and similarly bind with Eya proteins, inducing nuclear translocation of Correspondence to: Richard J.H. Smith Æ Department of Otolaryngol- the resultant protein complex (Ohto et al. 1999). ogy Æ University of Iowa Æ 200 Hawkins Drive Æ Iowa City, IA 52242. Telephone: (319) 356-3612; fax: (319) 356-4547; email: richard- Amino terminal transcriptional activation also has [email protected] been demonstrated for the Drosophila eya and murine 295 296 Y. ZHANG ET AL.: Eya1 and Eya4 Function and Branchio-oto-renal Syndrome FIG. 1. Schematic illustrating the structure of the Eya4 protein associated with EyaHR isoform g. Isoform d lacks the 5’ 28 base pairs showing its EyaVR and EyaHR domains. In embryonic tissue, all of exon 8, and encodes a putative protein that lacks the EyaHR (A). EyaVR isoforms (a,b,c) are associated with EyaHR isoform f and Expression profiles are tissue specific (B). VR, variable region; HR, occasionally isoform e; in adult tissue, all EyaVR isoforms (a,b,c) are homologous region. Eya1–3 gene products, an additional indication that are no abnormalities aside from late-onset hearing Eya interactions and pathways are conserved across loss (De Leenheer et al. 2001). species (Pignoni et al. 1997; Xu et al. 1997). These phenotypic differences are surprising given Expression of Eya genes is present in a wide variety the expression profiles of EYA1 and EYA4 in of tissues early in embryogenesis, and although each embryogenesis. Both genes are expressed early in the gene has a unique expression pattern there is otic vesicle in rodent inner ears, although in situ extensive overlap. For example, murine studies have hybridization studies we have done show a spatial shown that Eya1, Eya2, and Eya4 are all expressed in variability in Eya4 expression that is not seen with the presomitic mesoderm and head mesenchyme, but Eya1 expression (Wayne et al. 2001). After the otic only Eya1 and Eya4 are expressed in the otic vesicle vesicle differentiates into auditory and vestibular (Ohto et al. 1999). Eya3 expression is restricted to components, Eya4 becomes concentrated in cells of craniofacial and branchial arch mesenchyme in re- the upper cochlear duct destined to develop into the gions underlying or surrounding the Eya1-, 2-, or 4- stria vascularis and Reissner’s membrane, while Eya1 expressing cranial placodes (Heanue et al. 1999). is expressed in the floor of the cochlear duct in an Allele variants of EYA1 and EYA4 underlie two area that gives rise to the organ of Corti. Throughout types of inherited human deafness, branchio-oto-re- development, Eya1 expression is maintained in nal (BOR) syndrome (Abdelhak et al. 1997b) and derivatives of the neuroepithelium of the cochlear DFNA10 (Wayne et al. 2001), respectively. The clini- duct floor, while Eya4 expression shifts only from the cal phenotype in persons with BOR syndrome is upper cochlear duct to the neuroepithelium of the characterized by numerous congenital anomalies cochlear duct floor at embryonic day 18.5 (E18.5) involving the branchial arch system, inner and middle (Wayne et al. 2001). ears, and kidneys, with the most common features These data suggest a disjunct between the expres- being deafness (98.5%), preauricular pits (83.6%), sion pattern of Eya4 and the DFNA10 phenotype. branchial anomalies (68.5%), renal anomalies Since there is overlap in expression of Eya1 and Eya4 (38.2%), and external ear abnormalities (31.5%) during embryogenesis, this disjunct may reflect (Chen et al. 1995). In persons with DFNA10, there functional redundancy of Eya4 to Eya1 in develop- Y. ZHANG ET AL.: Eya1 and Eya4 Function and Branchio-oto-renal Syndrome 297 TABLE 1 Primers for Eya constructs Forward Reverse Amino acid sites Eya4FR cgatcatatgtggcagtggcaagagaagt (N) attcgtcgacacaatggatccccagctaga (S) 1–616 Eya4VL cgatcatatgtggcagtggcaagagaagt (N) ctatgtcgaccggaggtggggagagatta (S) 1–341 Eya4HR Caatcatatgagaagttctgggtcaaagtctcg (N) ctatgaattcacaatggatccccagctaga (E) 322–616 Eya1HR cgatcatatgcgaggttcagatgggaagtc (N) tgatgaattccagtgtcaagttggcaggaa (E) 296–591 Eya4HR1 Caatcatatgagaagttctgggtcaaagtctcg (N) actcgaattccaaacaaaggttcgcacta (E) 322–444 Eya4HR2 cagtcatatgctccggatggaagaaatgat (N) actagaattcgaatcagctgggttgtcgtt (E) 384–530 Eya4HR3 tcgatcatatggcagagatcgaaggcctaac (N) ctatgaattcacaatggatccccagctaga (E) 493–616 Eya4HR4 Caatcatatgagaagttctgggtcaaagtctcg (N) actagaattcgaatcagctgggttgtcgtt (E) 322–530 Eya4HR5 cagtcatatgctccggatggaagaaatgat (N) ctatgaattcacaatggatccccagctaga (E) 384–616 Eya4HR6 Eya4HR1+Eya4HR3 Del 49aa (444–493) A restriction enzyme site (underlined) was added to the 5’flank of each primer. N = NdeI, E = EcoRI, S = SalI ment but not in the mature organ system. In this several truncated forms of Eya4HR (Table 1, Fig. article, we compare the function of Eya1 and Eya4 to 2A). Six1 and Dach1 were rescued from Six1/RCAS clarify how mutations in these two genes and their and Dach1/pBS vectors and fused with the Gal-4 encoded proteins impact the normal biology of activation domain of pGADT7 (prey). hearing and result in BOR syndrome and DFNA10, To construct mammalian expression plasmids, c- respectively. myc-tagged Eya1HR or Eya4HR was subcloned into pBudCE4.1 (Invitrogen, Carlsbad, CA) under control of the CMV promoter. HA-tagged Six1 was inserted MATERIALS AND METHODS into another multicloning site of the same vector under control of the EF-1a promoter. Flag-tagged Expression profiling Dach1 was subcloned into p3XFIag-CMV-10 vector To determine whether novel isoforms of Eya4 exist, (Sigma-Aldrich, St. Louis, MO). expression studies were performed against a panel of cDNA from different tissues using two sets of primers: Yeast-two-hybrid assays Set 1 for detecting variants in Eya4VR (AF in exon 4,5’-TGGTTGGAGGCAGTGATACA-3’; AR in exon The MATCHMAKER 3 Gal-4 Yeast-Two-Hybrid (Y2H) 9,5’-TGGCAACATCACACCAAGAT-3’) and Set 2 for system (Clontech, Palo Alto, CA) was selected for detecting variants in Eya4HR (BF in exon 13, 5’- yeast interaction assays and library screening. Co- AACGACAACCCAGCTGATTC-3’;BRex19 in exon 19, transformations were completed using the lithium 5’-GGTTAGCAGCGTGCTCCTCA-3’; and BRex20 in acetate method to introduce each of the pGBKT7 bait exon 20, 5’-TTTTTGCTGCCTGCTCTTCT-3’). constructs and each of the pGADT7 prey constructs into yeast AH109. Yeast mating library screening was performed by Expression constructs single lithium acetate transformation to introduce To subclone Eya, total RNAwas isolated from E11 bait Eya4HR to yeast AH109 (mat a). Transformed mouse embryos and skeleton muscle using the Rneasy AH109 was