DOCSLIB.ORG

A Comparative Study of Eya1 and Eya4 Protein Function and Its Implication in Branchio-Oto-Renal Syndrome and DFNA10

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Comparative Study of Eya1 and Eya4 Protein Function and Its Implication in Branchio-Oto-Renal Syndrome and DFNA10 JARO 5: 295–304 (2004) DOI: 10.1007/s10162-004-4044-3 JAROJournal of the Association for Research in Otolaryngology A Comparative Study of Eya1 and Eya4 Protein Function and Its Implication in Branchio-oto-renal Syndrome and DFNA10 1 2 3 4 YUZHOU ZHANG, BOYD M. KNOSP, MARK MACONOCHIE, RICK A. FRIEDMAN, 1 RICHARD J.H. SMITH 1Molecular Otolaryngology Research Laboratories, University of Iowa, Iowa City, IA 52242, USA 2The University of Iowa ITS Research Service, University of Iowa, Iowa City, IA 52242, USA 3School of Life Sciences, University of Sussex, Falmer, Brighton, BN1 9QG, UK 4House Ear Institute, Los Angeles, CA 90057, USA Received: 24 October 2003; Accepted: 29 March 2004; Online publication: 30 July 2004 ABSTRACT loinsufficiency as the cause of BOR syndrome and DFNA10. Allele variants of EYA1 and EYA4, two members of the Keywords: Eya gene family, Six gene family, branchio- vertebrate Eya gene family, underlie two types of oto-renal syndrome, DFNA10, haploinsufficiency inherited human deafness, branchio-oto-renal (BOR) syndrome and DFNA10, respectively. To clarify how mutations in these two genes and their encoded proteins impact the normal biology of hearing, we completed a number of functional studies using the yeast-two-hybrid system. We verified that bait con- INTRODUCTION structs of the homologous region (Eya1HR and Eya4HR) interact with Six1 prey constructs, although The vertebrate Eya gene family is comprised of four no interaction with Dach1 prey was demonstrable. To transcriptional activators that interact with other compare interaction affinities, we evaluated a-galac- proteins in a conserved regulatory hierarchy to en- tosidase activity after cotransformation of Eya1HR/ sure normal embryologic development. The structure Six1 and Eya4HR/Six1 and found that the latter of these proteins as deduced from their cDNA se- interaction was weaker. By immunofluorescence quences includes a highly conserved 271-amino acid staining, we showed Eya4HR localization to the carboxy terminus called the eya-homologous region cytoplasm. After coexpression of Six1, Eya4HR was (eyaHR) and a more divergent proline–serine–thre- translocated to the nucleus. Results with Eya1HR onine (PST)-rich (34%–41%) transactivation domain were similar. Translation of mutant constructs at the amino terminus (eya variable region, eyaVR) (Eya4HRR564X and Eya1HRR539X) could not be dem- (Zimmerman et al. 1997) (Fig. 1). Studies in Dro- onstrated. Using dual Eya-containing constructs (with sophila indicate that the eyaHR mediates interactions two wild-type alleles or wild-type and mutant alleles), with the gene products of so (sine oculis) and dac we confirmed no translation of the mutant allele, (dachshund), and that expression of both eya and so even if the mutation was nontruncating. These results is initiated by ey (eyeless) (Bonini et al. 1993, 1997; are consistent with clinical data and implicate hap- Pignoni et al. 1997). The vertebrate orthologs of so are members of the Six gene family and similarly bind with Eya proteins, inducing nuclear translocation of Correspondence to: Richard J.H. Smith Æ Department of Otolaryngol- the resultant protein complex (Ohto et al. 1999). ogy Æ University of Iowa Æ 200 Hawkins Drive Æ Iowa City, IA 52242. Telephone: (319) 356-3612; fax: (319) 356-4547; email: richard- Amino terminal transcriptional activation also has [email protected] been demonstrated for the Drosophila eya and murine 295 296 Y. ZHANG ET AL.: Eya1 and Eya4 Function and Branchio-oto-renal Syndrome FIG. 1. Schematic illustrating the structure of the Eya4 protein associated with EyaHR isoform g. Isoform d lacks the 5’ 28 base pairs showing its EyaVR and EyaHR domains. In embryonic tissue, all of exon 8, and encodes a putative protein that lacks the EyaHR (A). EyaVR isoforms (a,b,c) are associated with EyaHR isoform f and Expression profiles are tissue specific (B). VR, variable region; HR, occasionally isoform e; in adult tissue, all EyaVR isoforms (a,b,c) are homologous region. Eya1–3 gene products, an additional indication that are no abnormalities aside from late-onset hearing Eya interactions and pathways are conserved across loss (De Leenheer et al. 2001). species (Pignoni et al. 1997; Xu et al. 1997). These phenotypic differences are surprising given Expression of Eya genes is present in a wide variety the expression profiles of EYA1 and EYA4 in of tissues early in embryogenesis, and although each embryogenesis. Both genes are expressed early in the gene has a unique expression pattern there is otic vesicle in rodent inner ears, although in situ extensive overlap. For example, murine studies have hybridization studies we have done show a spatial shown that Eya1, Eya2, and Eya4 are all expressed in variability in Eya4 expression that is not seen with the presomitic mesoderm and head mesenchyme, but Eya1 expression (Wayne et al. 2001). After the otic only Eya1 and Eya4 are expressed in the otic vesicle vesicle differentiates into auditory and vestibular (Ohto et al. 1999). Eya3 expression is restricted to components, Eya4 becomes concentrated in cells of craniofacial and branchial arch mesenchyme in re- the upper cochlear duct destined to develop into the gions underlying or surrounding the Eya1-, 2-, or 4- stria vascularis and Reissner’s membrane, while Eya1 expressing cranial placodes (Heanue et al. 1999). is expressed in the floor of the cochlear duct in an Allele variants of EYA1 and EYA4 underlie two area that gives rise to the organ of Corti. Throughout types of inherited human deafness, branchio-oto-re- development, Eya1 expression is maintained in nal (BOR) syndrome (Abdelhak et al. 1997b) and derivatives of the neuroepithelium of the cochlear DFNA10 (Wayne et al. 2001), respectively. The clini- duct floor, while Eya4 expression shifts only from the cal phenotype in persons with BOR syndrome is upper cochlear duct to the neuroepithelium of the characterized by numerous congenital anomalies cochlear duct floor at embryonic day 18.5 (E18.5) involving the branchial arch system, inner and middle (Wayne et al. 2001). ears, and kidneys, with the most common features These data suggest a disjunct between the expres- being deafness (98.5%), preauricular pits (83.6%), sion pattern of Eya4 and the DFNA10 phenotype. branchial anomalies (68.5%), renal anomalies Since there is overlap in expression of Eya1 and Eya4 (38.2%), and external ear abnormalities (31.5%) during embryogenesis, this disjunct may reflect (Chen et al. 1995). In persons with DFNA10, there functional redundancy of Eya4 to Eya1 in develop- Y. ZHANG ET AL.: Eya1 and Eya4 Function and Branchio-oto-renal Syndrome 297 TABLE 1 Primers for Eya constructs Forward Reverse Amino acid sites Eya4FR cgatcatatgtggcagtggcaagagaagt (N) attcgtcgacacaatggatccccagctaga (S) 1–616 Eya4VL cgatcatatgtggcagtggcaagagaagt (N) ctatgtcgaccggaggtggggagagatta (S) 1–341 Eya4HR Caatcatatgagaagttctgggtcaaagtctcg (N) ctatgaattcacaatggatccccagctaga (E) 322–616 Eya1HR cgatcatatgcgaggttcagatgggaagtc (N) tgatgaattccagtgtcaagttggcaggaa (E) 296–591 Eya4HR1 Caatcatatgagaagttctgggtcaaagtctcg (N) actcgaattccaaacaaaggttcgcacta (E) 322–444 Eya4HR2 cagtcatatgctccggatggaagaaatgat (N) actagaattcgaatcagctgggttgtcgtt (E) 384–530 Eya4HR3 tcgatcatatggcagagatcgaaggcctaac (N) ctatgaattcacaatggatccccagctaga (E) 493–616 Eya4HR4 Caatcatatgagaagttctgggtcaaagtctcg (N) actagaattcgaatcagctgggttgtcgtt (E) 322–530 Eya4HR5 cagtcatatgctccggatggaagaaatgat (N) ctatgaattcacaatggatccccagctaga (E) 384–616 Eya4HR6 Eya4HR1+Eya4HR3 Del 49aa (444–493) A restriction enzyme site (underlined) was added to the 5’flank of each primer. N = NdeI, E = EcoRI, S = SalI ment but not in the mature organ system. In this several truncated forms of Eya4HR (Table 1, Fig. article, we compare the function of Eya1 and Eya4 to 2A). Six1 and Dach1 were rescued from Six1/RCAS clarify how mutations in these two genes and their and Dach1/pBS vectors and fused with the Gal-4 encoded proteins impact the normal biology of activation domain of pGADT7 (prey). hearing and result in BOR syndrome and DFNA10, To construct mammalian expression plasmids, c- respectively. myc-tagged Eya1HR or Eya4HR was subcloned into pBudCE4.1 (Invitrogen, Carlsbad, CA) under control of the CMV promoter. HA-tagged Six1 was inserted MATERIALS AND METHODS into another multicloning site of the same vector under control of the EF-1a promoter. Flag-tagged Expression profiling Dach1 was subcloned into p3XFIag-CMV-10 vector To determine whether novel isoforms of Eya4 exist, (Sigma-Aldrich, St. Louis, MO). expression studies were performed against a panel of cDNA from different tissues using two sets of primers: Yeast-two-hybrid assays Set 1 for detecting variants in Eya4VR (AF in exon 4,5’-TGGTTGGAGGCAGTGATACA-3’; AR in exon The MATCHMAKER 3 Gal-4 Yeast-Two-Hybrid (Y2H) 9,5’-TGGCAACATCACACCAAGAT-3’) and Set 2 for system (Clontech, Palo Alto, CA) was selected for detecting variants in Eya4HR (BF in exon 13, 5’- yeast interaction assays and library screening. Co- AACGACAACCCAGCTGATTC-3’;BRex19 in exon 19, transformations were completed using the lithium 5’-GGTTAGCAGCGTGCTCCTCA-3’; and BRex20 in acetate method to introduce each of the pGBKT7 bait exon 20, 5’-TTTTTGCTGCCTGCTCTTCT-3’). constructs and each of the pGADT7 prey constructs into yeast AH109. Yeast mating library screening was performed by Expression constructs single lithium acetate transformation to introduce To subclone Eya, total RNAwas isolated from E11 bait Eya4HR to yeast AH109 (mat a). Transformed mouse embryos and skeleton muscle using the Rneasy AH109 was
Load more

Recommended publications
  • DNA Methylation Profiling Identifies the HOXA11 Gene As an Early Diagnostic and Prognostic Molecular Marker in Human Lung Adenocarcinoma
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 20), pp: 33100-33109 Research Paper DNA methylation profiling identifies the HOXA11 gene as an early diagnostic and prognostic molecular marker in human lung adenocarcinoma Qun Li1,2,*, Chang Chen3, Xiaohui Ren1, Weihong Sun1,* 1Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai Jiao Tong University School of Medicine, Shanghai, 200031, China 2The State Key Laboratory of Medical Genomics, Shanghai Key Laboratory of Hypertension, Ruijin Hospital, Shanghai Institute of Hypertension, Shanghai Jiao Tong University School of Medicine, Shanghai, 200025, China 3Department of Orthodontics, The First Affiliated Hospital of Zhengzhou University, Stomatological College Zhengzhou University, Zhengzhou, 450052, China *These authors contributed equally to this work Correspondence to: Weihong Sun, email: [email protected] Keywords: HOXA11, hypermethylation, lung adenocarcinoma, adenocarcinoma in situ, prognosis Received: October 11, 2016 Accepted: March 14, 2017 Published: March 23, 2017 Copyright: Li et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT DNA hypermethylation plays important roles in carcinogenesis by silencing key genes. The goal of our study was to identify pivotal genes using MethyLight and assessed their diagnostic and prognostic values in lung adenocarcinoma (AD). In the present study, we detected DNA methylation at sixteen loci promoter regions in twenty one pairs of primary human lung AD tissues and adjacent non-tumor lung (AdjNL) tissues using the real-time PCR (RT-PCR)-based method MethyLight.
    [Show full text]
  • Genetic Alterations of Protein Tyrosine Phosphatases in Human Cancers
    Oncogene (2015) 34, 3885–3894 © 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc REVIEW Genetic alterations of protein tyrosine phosphatases in human cancers S Zhao1,2,3, D Sedwick3,4 and Z Wang2,3 Protein tyrosine phosphatases (PTPs) are enzymes that remove phosphate from tyrosine residues in proteins. Recent whole-exome sequencing of human cancer genomes reveals that many PTPs are frequently mutated in a variety of cancers. Among these mutated PTPs, PTP receptor T (PTPRT) appears to be the most frequently mutated PTP in human cancers. Beside PTPN11, which functions as an oncogene in leukemia, genetic and functional studies indicate that most of mutant PTPs are tumor suppressor genes. Identification of the substrates and corresponding kinases of the mutant PTPs may provide novel therapeutic targets for cancers harboring these mutant PTPs. Oncogene (2015) 34, 3885–3894; doi:10.1038/onc.2014.326; published online 29 September 2014 INTRODUCTION tyrosine/threonine-specific phosphatases. (4) Class IV PTPs include Protein tyrosine phosphorylation has a critical role in virtually all four Drosophila Eya homologs (Eya1, Eya2, Eya3 and Eya4), which human cellular processes that are involved in oncogenesis.1 can dephosphorylate both tyrosine and serine residues. Protein tyrosine phosphorylation is coordinately regulated by protein tyrosine kinases (PTKs) and protein tyrosine phosphatases 1 THE THREE-DIMENSIONAL STRUCTURE AND CATALYTIC (PTPs). Although PTKs add phosphate to tyrosine residues in MECHANISM OF PTPS proteins, PTPs remove it. Many PTKs are well-documented oncogenes.1 Recent cancer genomic studies provided compelling The three-dimensional structures of the catalytic domains of evidence that many PTPs function as tumor suppressor genes, classical PTPs (RPTPs and non-RPTPs) are extremely well because a majority of PTP mutations that have been identified in conserved.5 Even the catalytic domain structures of the dual- human cancers are loss-of-function mutations.
    [Show full text]
  • Phosphatome Rnai Screen Identifies Eya1 As a Positive Regulator of Hedgehog Signal Transduction
    Phosphatome RNAi Screen Identifies Eya1 as a Positive Regulator of Hedgehog Signal Transduction The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Eisner, Adriana. 2013. Phosphatome RNAi Screen Identifies Eya1 as a Positive Regulator of Hedgehog Signal Transduction. Doctoral dissertation, Harvard University. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:11181213 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Phosphatome RNAi Screen Identifies Eya1 as a Positive Regulator of Hedgehog Signal Transduction A dissertation presented by Adriana Eisner to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Neurobiology Harvard University Cambridge, Massachusetts June 2013 © 2013 Adriana Eisner All rights reserved. Dissertation Advisor: Dr. Rosalind Segal Adriana Eisner Phosphatome RNAi Screen Identifies Eya1 as a Positive Regulator of Hedgehog Signal Transduction Abstract The Hedgehog (Hh) signaling pathway is vital for vertebrate embryogenesis and aberrant activation of the pathway can cause tumorigenesis in humans. In this study, we used a phosphatome RNAi screen for regulators of Hh signaling to identify a member of the Eyes Absent protein family, Eya1, as a positive regulator of Hh signal transduction. Eya1 is both a phosphatase and transcriptional regulator. Eya family members have been implicated in tumor biology, and Eya1 is highly expressed in a particular subtype of medulloblastoma (MB).
    [Show full text]
  • Robles JTO Supplemental Digital Content 1
    Supplementary Materials An Integrated Prognostic Classifier for Stage I Lung Adenocarcinoma based on mRNA, microRNA and DNA Methylation Biomarkers Ana I. Robles1, Eri Arai2, Ewy A. Mathé1, Hirokazu Okayama1, Aaron Schetter1, Derek Brown1, David Petersen3, Elise D. Bowman1, Rintaro Noro1, Judith A. Welsh1, Daniel C. Edelman3, Holly S. Stevenson3, Yonghong Wang3, Naoto Tsuchiya4, Takashi Kohno4, Vidar Skaug5, Steen Mollerup5, Aage Haugen5, Paul S. Meltzer3, Jun Yokota6, Yae Kanai2 and Curtis C. Harris1 Affiliations: 1Laboratory of Human Carcinogenesis, NCI-CCR, National Institutes of Health, Bethesda, MD 20892, USA. 2Division of Molecular Pathology, National Cancer Center Research Institute, Tokyo 104-0045, Japan. 3Genetics Branch, NCI-CCR, National Institutes of Health, Bethesda, MD 20892, USA. 4Division of Genome Biology, National Cancer Center Research Institute, Tokyo 104-0045, Japan. 5Department of Chemical and Biological Working Environment, National Institute of Occupational Health, NO-0033 Oslo, Norway. 6Genomics and Epigenomics of Cancer Prediction Program, Institute of Predictive and Personalized Medicine of Cancer (IMPPC), 08916 Badalona (Barcelona), Spain. List of Supplementary Materials Supplementary Materials and Methods Fig. S1. Hierarchical clustering of based on CpG sites differentially-methylated in Stage I ADC compared to non-tumor adjacent tissues. Fig. S2. Confirmatory pyrosequencing analysis of DNA methylation at the HOXA9 locus in Stage I ADC from a subset of the NCI microarray cohort. 1 Fig. S3. Methylation Beta-values for HOXA9 probe cg26521404 in Stage I ADC samples from Japan. Fig. S4. Kaplan-Meier analysis of HOXA9 promoter methylation in a published cohort of Stage I lung ADC (J Clin Oncol 2013;31(32):4140-7). Fig. S5. Kaplan-Meier analysis of a combined prognostic biomarker in Stage I lung ADC.
    [Show full text]
  • Phosphatases Page 1
    Phosphatases esiRNA ID Gene Name Gene Description Ensembl ID HU-05948-1 ACP1 acid phosphatase 1, soluble ENSG00000143727 HU-01870-1 ACP2 acid phosphatase 2, lysosomal ENSG00000134575 HU-05292-1 ACP5 acid phosphatase 5, tartrate resistant ENSG00000102575 HU-02655-1 ACP6 acid phosphatase 6, lysophosphatidic ENSG00000162836 HU-13465-1 ACPL2 acid phosphatase-like 2 ENSG00000155893 HU-06716-1 ACPP acid phosphatase, prostate ENSG00000014257 HU-15218-1 ACPT acid phosphatase, testicular ENSG00000142513 HU-09496-1 ACYP1 acylphosphatase 1, erythrocyte (common) type ENSG00000119640 HU-04746-1 ALPL alkaline phosphatase, liver ENSG00000162551 HU-14729-1 ALPP alkaline phosphatase, placental ENSG00000163283 HU-14729-1 ALPP alkaline phosphatase, placental ENSG00000163283 HU-14729-1 ALPPL2 alkaline phosphatase, placental-like 2 ENSG00000163286 HU-07767-1 BPGM 2,3-bisphosphoglycerate mutase ENSG00000172331 HU-06476-1 BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 ENSG00000162813 HU-09086-1 CANT1 calcium activated nucleotidase 1 ENSG00000171302 HU-03115-1 CCDC155 coiled-coil domain containing 155 ENSG00000161609 HU-09022-1 CDC14A CDC14 cell division cycle 14 homolog A (S. cerevisiae) ENSG00000079335 HU-11533-1 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) ENSG00000081377 HU-06323-1 CDC25A cell division cycle 25 homolog A (S. pombe) ENSG00000164045 HU-07288-1 CDC25B cell division cycle 25 homolog B (S. pombe) ENSG00000101224 HU-06033-1 CDKN3 cyclin-dependent kinase inhibitor 3 ENSG00000100526 HU-02274-1 CTDSP1 CTD (carboxy-terminal domain,
    [Show full text]
  • Genetic Investigations of Sporadic Inclusion Body Myositis and Myopathies with Structural Abnormalities and Protein Aggregates in Muscle
    Genetic Investigations of Sporadic Inclusion Body Myositis and Myopathies with Structural Abnormalities and Protein Aggregates in Muscle Qiang Gang MRC Centre for Neuromuscular Diseases and UCL Institute of Neurology Supervised by Professor Henry Houlden, Dr Conceição Bettencourt and Professor Michael Hanna Thesis submitted for the degree of Doctor of Philosophy University College London 2016 1 Declaration I, Qiang Gang, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Signature………………………………………………………… Date……………………………………………………………... 2 Abstract The application of whole-exome sequencing (WES) has not only dramatically accelerated the discovery of pathogenic genes of Mendelian diseases, but has also shown promising findings in complex diseases. This thesis focuses on exploring genetic risk factors for a large series of sporadic inclusion body myositis (sIBM) cases, and identifying disease-causing genes for several groups of patients with abnormal structure and/or protein aggregates in muscle. Both conventional and advanced techniques were applied. Based on the International IBM Genetics Consortium (IIBMGC), the largest sIBM cohort of blood and muscle tissue for DNA analysis was collected as the initial part of this thesis. Candidate gene studies were carried out and revealed a disease modifying effect of an intronic polymorphism in TOMM40, enhanced by the APOE ε3/ε3 genotype. Rare variants in SQSTM1 and VCP genes were identified in seven of 181 patients, indicating a mutational overlap with neurodegenerative diseases. Subsequently, a first whole-exome association study was performed on 181 sIBM patients and 510 controls. This reported statistical significance of several common variants located on chromosome 6p21, a region encompassing genes related to inflammation/infection.
    [Show full text]
  • Terminal Variable Region of EYA4 Gene Causes Dominant Hearing Loss Without Cardiac Phenotype
    Received: 2 May 2020 | Revised: 31 October 2020 | Accepted: 17 November 2020 DOI: 10.1002/mgg3.1569 ORIGINAL ARTICLE Early truncation of the N-terminal variable region of EYA4 gene causes dominant hearing loss without cardiac phenotype Yanfang Mi1 | Danhua Liu2,8 | Beiping Zeng3,4 | Yongan Tian3,4 | Hui Zhang5 | Bei Chen1 | Juanli Zhang6 | Hong Xue7 | Wenxue Tang8,2,4 | Yulin Zhao1 | Hongen Xu2 1Department of Otorhinolaryngology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, China 2Precision Medicine Center, Academy of Medical Science, Zhengzhou University, Zhengzhou, China 3BGI College, Zhengzhou University, Zhengzhou, China 4Henan Institute of Medical and Pharmaceutical Sciences, Zhengzhou University, Zhengzhou, China 5Department of Cardiology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, China 6Henan Province Medical Instrument Testing Institute, Zhengzhou, China 7Sanglin Biotechnology Ltd, Zhengzhou, China 8The Second Affiliated Hospital of Zhengzhou University, Zhengzhou, China Correspondence Yulin Zhao, Department of Abstract Otorhinolaryngology, the First Affiliated Background: Autosomal dominant hearing loss (ADHL) accounts for about 20% of Hospital of Zhengzhou University, all hereditary non-syndromic HL. Truncating mutations of the EYA4 gene can cause Jianshedong Road No.1, Zhengzhou 450052, China. either non-syndromic ADHL or syndromic ADHL with cardiac abnormalities. It has Email: [email protected] been proposed that truncations of the C-terminal Eya domain lead to non-syndromic Hongen Xu, Precision Medicine Center, HL, whereas early truncations of the N-terminal variable region cause syndromic HL Academy of Medical Science, Zhengzhou with cardiac phenotype. University, Daxuebei Road No. 40, Zhengzhou 450052, China. Methods: The proband and all the other hearing impaired members of the family un- Email: [email protected] derwent a thorough clinical and audiological evaluation.
    [Show full text]
  • The Human Phosphatase Interactome
    FEBS Letters 586 (2012) 2732–2739 journal homepage: www.FEBSLetters.org Review The human phosphatase interactome: An intricate family portrait ⇑ Francesca Sacco a,1, Livia Perfetto a,1, Luisa Castagnoli a, Gianni Cesareni a,b, a Department of Biology, University of Rome ‘‘Tor Vergata’’, Rome, Italy b Research Institute ‘‘Fondazione Santa Lucia’’, Rome, Italy article info abstract Article history: The concerted activities of kinases and phosphatases modulate the phosphorylation levels of Received 23 March 2012 proteins, lipids and carbohydrates in eukaryotic cells. Despite considerable effort, we are still miss- Revised 8 May 2012 ing a holistic picture representing, at a proteome level, the functional relationships between Accepted 8 May 2012 kinases, phosphatases and their substrates. Here we focus on phosphatases and we review and inte- Available online 21 May 2012 grate the available information that helps to place the members of the protein phosphatase super- Edited by Marius Sudol, Giulio Superti-Furga families into the human protein interaction network. In addition we show how protein interaction and Wilhelm Just domains and motifs, either covalently linked to the phosphatase domain or in regulatory/adaptor subunits, play a prominent role in substrate selection. Keywords: Ó 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Human phosphatome Phosphatase family classification Substrate recognition specificity 1. Introduction protein kinases. 428 are known or predicted to phosphorylate ser- ine and threonine residues, while the remaining 90 are members of Phosphorylation is a widespread post-translational modifica- the tyrosine kinase family [3,12]. By contrast, in the human gen- tion governing signal propagation [1].
    [Show full text]
  • A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression
    Supplementary Materials A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression Table S1. Statistically significant DEGs (Adj. p-value < 0.01) derived from meta-analysis for samples irradiated with high doses of HZE particles, collected 6-24 h post-IR not common with any other meta- analysis group. This meta-analysis group consists of 3 DEG lists obtained from DGEA, using a total of 11 control and 11 irradiated samples [Data Series: E-MTAB-5761 and E-MTAB-5754]. Ensembl ID Gene Symbol Gene Description Up-Regulated Genes ↑ (2425) ENSG00000000938 FGR FGR proto-oncogene, Src family tyrosine kinase ENSG00000001036 FUCA2 alpha-L-fucosidase 2 ENSG00000001084 GCLC glutamate-cysteine ligase catalytic subunit ENSG00000001631 KRIT1 KRIT1 ankyrin repeat containing ENSG00000002079 MYH16 myosin heavy chain 16 pseudogene ENSG00000002587 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 ENSG00000003056 M6PR mannose-6-phosphate receptor, cation dependent ENSG00000004059 ARF5 ADP ribosylation factor 5 ENSG00000004777 ARHGAP33 Rho GTPase activating protein 33 ENSG00000004799 PDK4 pyruvate dehydrogenase kinase 4 ENSG00000004848 ARX aristaless related homeobox ENSG00000005022 SLC25A5 solute carrier family 25 member 5 ENSG00000005108 THSD7A thrombospondin type 1 domain containing 7A ENSG00000005194 CIAPIN1 cytokine induced apoptosis inhibitor 1 ENSG00000005381 MPO myeloperoxidase ENSG00000005486 RHBDD2 rhomboid domain containing 2 ENSG00000005884 ITGA3 integrin subunit alpha 3 ENSG00000006016 CRLF1 cytokine receptor like
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • Integrin-Linked Kinase Controls Renal Branching Morphogenesis Via Dual Specificity Phosphatase 8
    BASIC RESEARCH www.jasn.org Integrin-linked Kinase Controls Renal Branching Morphogenesis via Dual Specificity Phosphatase 8 †‡ Joanna Smeeton,* Priya Dhir,* Di Hu,* Meghan M. Feeney,* Lin Chen,* and † Norman D. Rosenblum* § *Program in Developmental and Stem Cell Biology, and §Division of Nephrology, The Hospital for Sick Children, Toronto, Ontario, Canada; and †Departments of Paediatrics, and ‡Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada ABSTRACT Integrin-linked kinase (ILK) is an intracellular scaffold protein with critical cell-specific functions in the embryonic and mature mammalian kidney. Previously, we demonstrated a requirement for Ilk during ureteric branching and cell cycle regulation in collecting duct cells in vivo. Although in vitro data indicate that ILK controls p38 mitogen-activated protein kinase (p38MAPK) activity, the contribution of ILK- p38MAPK signaling to branching morphogenesis in vivo is not defined. Here, we identified genes that are regulated by Ilk in ureteric cells using a whole-genome expression analysis of whole-kidney mRNA in mice with Ilk deficiency in the ureteric cell lineage. Six genes with expression in ureteric tip cells, including Wnt11, were downregulated, whereas the expression of dual-specificity phosphatase 8 (DUSP8) was upregulated. Phosphorylation of p38MAPK was decreased in kidney tissue with Ilk deficiency, but no significant decrease in the phosphorylation of other intracellular effectors previously shown to control renal morphogenesis was observed. Pharmacologic inhibition of p38MAPK activity in murine inner med- ullary collecting duct 3 (mIMCD3) cells decreased expression of Wnt11, Krt23,andSlo4c1.DUSP8over- expression in mIMCD3 cells significantly inhibited p38MAPK activation and the expression of Wnt11 and Slo4c1. Adenovirus-mediated overexpression of DUSP8 in cultured embryonic murine kidneys decreased ureteric branching and p38MAPK activation.
    [Show full text]
  • EYA4 Is Inactivated Biallelically at a High Frequency in Sporadic Lung Cancer and Is Associated with Familial Lung Cancer Risk
    Oncogene (2014) 33, 4464–4473 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc ORIGINAL ARTICLE EYA4 is inactivated biallelically at a high frequency in sporadic lung cancer and is associated with familial lung cancer risk IM Wilson1,12, EA Vucic1,12, KSS Enfield1, KL Thu1, YA Zhang2, R Chari1,3, WW Lockwood1,4, N Radulovich5, DT Starczynowski6, JP Bana´th1, M Zhang1, A Pusic1, M Fuller1, KM Lonergan1, D Rowbotham1,JYee7, JC English8, TPH Buys1, SA Selamat9, IA Laird-Offringa9, P Liu10, M Anderson10,MYou10, MS Tsao5, CJ Brown11, KL Bennewith1, CE MacAulay1, A Karsan1, AF Gazdar2, S Lam1 and WL Lam1 In an effort to identify novel biallelically inactivated tumor suppressor genes (TSGs) in sporadic invasive and preinvasive non-small- cell lung cancer (NSCLC) genomes, we applied a comprehensive integrated multiple ‘omics’ approach to investigate patient- matched, paired NSCLC tumor and non-malignant parenchymal tissues. By surveying lung tumor genomes for genes concomitantly inactivated within individual tumors by multiple mechanisms, and by the frequency of disruption in tumors across multiple cohorts, we have identified a putative lung cancer TSG, Eyes Absent 4 (EYA4). EYA4 is frequently and concomitantly deleted, hypermethylated and underexpressed in multiple independent lung tumor data sets, in both major NSCLC subtypes and in the earliest stages of lung cancer. We found that decreased EYA4 expression is not only associated with poor survival in sporadic lung cancers but also that EYA4 single-nucleotide polymorphisms are associated with increased familial cancer risk, consistent with EYA4s proximity to the previously reported lung cancer susceptibility locus on 6q.
    [Show full text]