DOCSLIB.ORG

A Proteome Map of Axoglial Specializations Isolated and Purified

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Proteome Map of Axoglial Specializations Isolated and Purified GLIA 58:1949–1960 (2010) A Proteome Map of Axoglial Specializations Isolated and Purified from Human Central Nervous System AJIT S. DHAUNCHAK,1* JEFFREY K. HUANG,1,2 OMAR DE FARIA JUNIOR,1 ALEJANDRO D. ROTH,1,3 1 1 1 1 LILIANA PEDRAZA, JACK P. ANTEL, AMIT BAR-OR, AND DAVID R. COLMAN * 1The Montreal Neurological Institute (MNI) and Hospital, McGill University and the McGill University Health Centre, Department of Neurology and Neurosurgery, Program in NeuroEngineering of McGill University, 3801 University Avenue, Montreal H3A2B4, Canada 2Department of Veterinary Medicine, University of Cambridge, Cambridge, United Kingdom 3Department of Biology, University of Chile, Santiago, Chile KEY WORDS progressively diminishing the ability to perform even myelin; node of Ranvier; myelin inhibition; multiple sclero- the simplest motor tasks. Several animal models, either sis; white matter disorder genetically-engineered or carrying spontaneous muta- tions, mimic human white matter disorders. These con- ditions have shed light on the underlying pathology of ABSTRACT several leukodystrophies, including Pelizeaus-Merz- Compact myelin, the paranode, and the juxtaparanode are discrete domains that are formed on myelinated axons. In bacher disease (PMD), X-linked Adrenoleukodystrophy humans, neurological disorders associated with loss of (ALD), 18q Syndrome (shiverer mice), Metachromatic myelin, including Multiple Sclerosis, often also result in Leukodystrophy (MLD). However, the underlying causes disassembly of the node of Ranvier. Despite the impor- of demyelinating (e.g., multiple sclerosis) versus dysmye- tance of these domains in the proper functioning of the linating ailments (e.g., leukodystrophies) remain poorly CNS, their molecular composition and assembly mecha- understood. In addition, why mutations in certain nism remains largely unknown. We therefore performed a housekeeping genes like eukaryotic initiation factor 2 large-scale proteomics MudPIT screen for the identification family proteins (eIF2B a-to-gamma) or genes associated of proteins in human myelin and axogliasomal fractions. with peroxisomal disorders result in white matter loss is We identified over 1,000 proteins in these fractions. Since still unclear. A better understanding of the underlying even minor perturbations in neuron-glial interactions can uncouple the glial support of axons, the proteome map mechanisms of disease requires generation of the pro- presented here can be used as a reference library for teome and transcriptome map of human OLs and mye- ‘‘myelin health’’ and disease states, including white matter lin, as has been attempted for rodents (Dugas et al., disorders such as leukodystrophies and multiple sclero- 2006; Roth et al., 2006; Taylor and Pfeiffer, 2003; Taylor sis. VC 2010 Wiley-Liss, Inc. et al., 2004; Vanrobaeys et al., 2005; Werner et al., 2007; Yamaguchi et al., 2008). Accordingly, we modified the myelin-isolation protocol and purified myelin and axo- INTRODUCTION gliasomes from freshly dissected human white matter tissue. The axoglial structures are remarkably stable Myelin ensheathment by oligodendrocytes (OL) in the and retain junctional morphology upon extraction with human central nervous system (CNS) ensures rapid high concentration detergent. We performed a large- impulse conduction. In addition to insulation, myelin scale nongel-based proteome screen on the biochemi- has also been shown to trigger domain formation on the cally-isolated fractions. We identified over 750 proteins axon (Pedraza et al., 2001; Poliak and Peles, 2003). My- in the human myelin fraction and over 450 in the axo- elinated axonal segments (internodes) are flanked by short unmyelinated segments (nodes of Ranvier). Volt- Additional Supporting Information may be found in the online version of this age-gated sodium channels are clustered at these nodes, article. limiting depolarization to this sharply demarcated zone; Grant sponsors: Rio Tinto Alcan, The Molson Foundation, The Myelin Repair Foundation, Center of Excellence Award [(2007) Government of Canada], MS Soci- as a result, action potentials ‘‘jump’’ from one node to ety of Canada Postdoctoral Fellowship. the next. The region immediately flanking the node is *Correspondence to: Ajit S. Dhaunchak, The Montreal Neurological Institute termed the paranode and the outermost domain is called (MNI) and Hospital, McGill University and the McGill University Health Centre, Department of Neurology and Neurosurgery, Program in NeuroEngineer- the juxta-paranode. For simplicity, we have termed the ing of McGill University, 3801 University Avenue, Montreal H3A2B4, Canada. axonal specializations together with the overlying and E-mail: [email protected] and David R. Colman, The Montreal Neurolog- ical Institute (MNI) and Hospital, McGill University and the McGill University attached glial paranodal loops as the ‘‘axoglial appara- Health Centre, Department of Neurology and Neurosurgery, Program in Neuro- tus’’ (Huang et al., 2005; Pedraza et al., 2001). How Engineering of McGill University, 3801 University Avenue, Montreal H3A2B4, Canada. E-mail: [email protected] these microdomains are assembled is a major focus of Received 26 March 2010; Accepted 22 July 2010 research efforts. DOI 10.1002/glia.21064 Genetic perturbations resulting in white matter Published online 9 September 2010 in Wiley Online Library (wileyonlinelibrary. abnormalities are eventually lethal in humans, often com) VC 2010 Wiley-Liss, Inc. 1950 DHAUNCHAK ET AL. glial fraction. When comparing the myelin proteome 4°C, the 0.32/1.0 M interface (crude myelin membranes), library to that of the axoglial compartment, we found and 1.0/1.25 M interface (axogliasomes) were collected, overlapping but distinct proteomes. We identified pro- diluted 1:1 with ice cold H2O and pelleted at 100,000g teins of diverse classes including metabolic, biosynthesis, for 1 h to concentrate the membranes. The axogliasomes and degradation machineries. The proteome map pre- and myelin fractions were hypoosmotically shocked by sented here is much larger than previously determined homogenization in 20 vol. of ice cold H2O, containing 20 in murine counterparts and we report over 400 proteins mM Tris pH 7.5 and 0.1 mM PMSF, incubated for 30 that were not known to be components of myelin. We also min on ice and rehomogenized. The shocked membranes present a proteome map of the axoglial fraction with over were pelleted at 40,000g for 20 min, resuspended in 0.32 400 proteins that were not described previously (Huang M sucrose and refloated to respective interfaces by ultra- et al., 2005). The proteome map presented here may centrifugation at 100,000g for 3 h. The collected mem- include novel autoantigens in multiple sclerosis, disease- branes were shocked once again before pelleting, and associated proteins in the discrete OL domains, and novel recovered for subsequent experiments. molecules inhibiting regeneration in the CNS. The human proteome map presented here thus can be used as Immunoblotting an atlas for myelin health and disease. Equal amounts of protein resolved on denaturing SDS-gel were transferred to PVDF membranes (Milli- MATERIALS AND METHODS pore). The membranes were rinsed briefly in TBST (25 Antibodies and Reagents mM Tris pH 7.4, 27 mM KCl, 137 mM NaCl, 0.1% Tween 20) and blocked for at least 1 h at room tempera- Monoclonal mouse obtained from following sources: ture in blocking buffer (5% nonfat dry milk in TBST). anti-PSD-95 (K28/43) and anti-panNeurofascin (A12/18) Primary antibody diluted in blocking buffer was applied from Neuromab, anti-Actin (A1978 Sigma), anti-Gfap for at least 1 h at room temperature (or overnight at (G-9269 Sigma), anti-Gapdh (G8795 Sigma), anti-Tubu- 4°C). After four washes in TBS-T, HRP-conjugated sec- lin (AA12.1 Hybridoma Bank, Iowa), claudin-11/OSP (a ondary antibodies were applied for 45 min, washed four gift of Dr. Alexander Gow, Wayne State University, times in TBS-T and developed using Enhanced Chemilu- Detroit, MI), anti-sodium channel (K58/35 Sigma), anti- minescence Detection kit (PerkinElmer). PLP clone 3F4 (Dhaunchak and Nave, 2007). Polyclonal rabbit were anti-Caspr (Tait et al., 2000), anti-Calnexin (3811-100 Biovision), anti-CNP (Bernier et al., 1987), Immunohistochemistry anti-OMgp (H-222 SantaCruz), anti-14-3-3 (K-19 Santa- Cruz), anti-MAG (Salzer et al., 1987), anti-MBP CNS tissues were obtained from postnatal day 18 rat spi- (Pedraza et al., 1997), Adam23 (a gift of Dr. Charles nal cords or brains after intercardial perfusion with 4% ffrench-Constant, Cambridge University, Cambridge, PFA, cryo-protected through a 12, 15, and 20% sucrose se- UK), Crmp-2 (a gift of Dr. Jerome Honnorat, INSERM riesandembeddedbyrapidfreezinginTissueTekOCTfor U433, France), plasmolipin (a gift of Dr. Victor Sapirst- cryosectioning. For sodium channel staining, the rats were ein, The Nathan Klein Institute, Orangeburg, NY), All perfused transcardially via 4% paraformaldehyde filled 30- chemicals and reagents used were from Sigma. cm3 syringes for no more than 5 min, and dissected tissues were postfixed for another 5–10 min before cryoprotection. Longitudinal and transverse sections (15 lm) were gener- Isolation and Purification of Myelin and Axoglial atedandplacedonSuperfrost/Plusglassslides(Fisher),and Apparatus Fractions stored at 280°C until use. PNS tissues were obtained from P18 rat sciatic nerves, fixed for 15 min in 4% paraformald- We obtained myelin from human tissue excised from hyde, transferred to 1X PBS, cut longitudinally, transferred
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Loss of At-Catenin Alters the Hybrid Adhering Junctions in the Heart and Leads to Dilated Cardiomyopathy and Ventricular Arrhythmia Following Acute Ischemia
    1058 Research Article Loss of aT-catenin alters the hybrid adhering junctions in the heart and leads to dilated cardiomyopathy and ventricular arrhythmia following acute ischemia Jifen Li1,*, Steven Goossens2,3,`, Jolanda van Hengel2,3,`, Erhe Gao1, Lan Cheng1, Koen Tyberghein2,3, Xiying Shang1, Riet De Rycke2, Frans van Roy2,3,* and Glenn L. Radice1 1Center for Translational Medicine, Department of Medicine, Thomas Jefferson University, Philadelphia, PA, USA 2Department for Molecular Biomedical Research, Flanders Institute for Biotechnology (VIB), B-9052 Ghent, Belgium 3Department of Biomedical Molecular Biology, Ghent University, B-9052 Ghent, Belgium *Authors for correspondence ([email protected]; [email protected]) `These authors contributed equally to this work Accepted 4 October 2011 Journal of Cell Science 125, 1058–1067 ß 2012. Published by The Company of Biologists Ltd doi: 10.1242/jcs.098640 Summary It is generally accepted that the intercalated disc (ICD) required for mechano-electrical coupling in the heart consists of three distinct junctional complexes: adherens junctions, desmosomes and gap junctions. However, recent morphological and molecular data indicate a mixing of adherens junctional and desmosomal components, resulting in a ‘hybrid adhering junction’ or ‘area composita’. The a-catenin family member aT-catenin, part of the N-cadherin–catenin adhesion complex in the heart, is the only a-catenin that interacts with the desmosomal protein plakophilin-2 (PKP2). Thus, it has been postulated that aT-catenin might serve as a molecular integrator of the two adhesion complexes in the area composita. To investigate the role of aT-catenin in the heart, gene targeting technology was used to delete the Ctnna3 gene, encoding aT-catenin, in the mouse.
    [Show full text]
  • Cell-Cell Interactions
    7 Cell-Cell Interactions Concept Outline 7.1 Cells signal one another with chemicals. Receptor Proteins and Signaling between Cells. Receptor proteins embedded in the plasma membrane change shape when they bind specific signal molecules, triggering a chain of events within the cell. Types of Cell Signaling. Cell signaling can occur between adjacent cells, although chemical signals called hormones act over long distances. 7.2 Proteins in the cell and on its surface receive signals from other cells. Intracellular Receptors. Some receptors are located within the cell cytoplasm. These receptors respond to lipid- soluble signals, such as steroid hormones. Cell Surface Receptors. Many cell-to-cell signals are water-soluble and cannot penetrate membranes. Instead, the signals are received by transmembrane proteins protruding out from the cell surface. 7.3 Follow the journey of information into the cell. FIGURE 7.1 Persimmon cells in close contact with one another. These Initiating the Intracellular Signal. Cell surface receptors plant cells and all cells, no matter what their function, interact often use “second messengers” to transmit a signal to the with their environment, including the cells around them. cytoplasm. Amplifying the Signal: Protein Kinase Cascades. Surface receptors and second messengers amplify signals as id you know that each of the 100 trillion cells of your they travel into the cell, often toward the cell nucleus. Dbody shares one key feature with the cells of tigers, bumblebees, and persimmons (figure 7.1)—a feature that 7.4 Cell surface proteins mediate cell-cell interactions. most bacteria and protists lack? Your cells touch and com- The Expression of Cell Identity.
    [Show full text]
  • Vocabulario De Morfoloxía, Anatomía E Citoloxía Veterinaria
    Vocabulario de Morfoloxía, anatomía e citoloxía veterinaria (galego-español-inglés) Servizo de Normalización Lingüística Universidade de Santiago de Compostela COLECCIÓN VOCABULARIOS TEMÁTICOS N.º 4 SERVIZO DE NORMALIZACIÓN LINGÜÍSTICA Vocabulario de Morfoloxía, anatomía e citoloxía veterinaria (galego-español-inglés) 2008 UNIVERSIDADE DE SANTIAGO DE COMPOSTELA VOCABULARIO de morfoloxía, anatomía e citoloxía veterinaria : (galego-español- inglés) / coordinador Xusto A. Rodríguez Río, Servizo de Normalización Lingüística ; autores Matilde Lombardero Fernández ... [et al.]. – Santiago de Compostela : Universidade de Santiago de Compostela, Servizo de Publicacións e Intercambio Científico, 2008. – 369 p. ; 21 cm. – (Vocabularios temáticos ; 4). - D.L. C 2458-2008. – ISBN 978-84-9887-018-3 1.Medicina �������������������������������������������������������������������������veterinaria-Diccionarios�������������������������������������������������. 2.Galego (Lingua)-Glosarios, vocabularios, etc. políglotas. I.Lombardero Fernández, Matilde. II.Rodríguez Rio, Xusto A. coord. III. Universidade de Santiago de Compostela. Servizo de Normalización Lingüística, coord. IV.Universidade de Santiago de Compostela. Servizo de Publicacións e Intercambio Científico, ed. V.Serie. 591.4(038)=699=60=20 Coordinador Xusto A. Rodríguez Río (Área de Terminoloxía. Servizo de Normalización Lingüística. Universidade de Santiago de Compostela) Autoras/res Matilde Lombardero Fernández (doutora en Veterinaria e profesora do Departamento de Anatomía e Produción Animal.
    [Show full text]
  • Tropomodulin Isoform-Specific Regulation of Dendrite Development and Synapse Formation
    This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version. Research Articles: Cellular/Molecular Tropomodulin Isoform-Specific Regulation of Dendrite Development and Synapse Formation Omotola F. Omotade1,3, Yanfang Rui1,3, Wenliang Lei1,3, Kuai Yu1, H. Criss Hartzell1, Velia M. Fowler4 and James Q. Zheng1,2,3 1Department of Cell Biology, Emory University School of Medicine, Atlanta, GA 30322. 2Department of Neurology 3Center for Neurodegenerative Diseases, Emory University School of Medicine, Atlanta, GA 30322. 4Department of Molecular Medicine, Scripps Research Institute, La Jolla, CA 92037 DOI: 10.1523/JNEUROSCI.3325-17.2018 Received: 22 November 2017 Revised: 25 September 2018 Accepted: 2 October 2018 Published: 9 October 2018 Author contributions: O.F.O. and J.Q.Z. designed research; O.F.O., Y.R., W.L., and K.Y. performed research; O.F.O. and J.Q.Z. analyzed data; O.F.O. and J.Q.Z. wrote the paper; Y.R., H.C.H., V.M.F., and J.Q.Z. edited the paper; V.M.F. contributed unpublished reagents/analytic tools. Conflict of Interest: The authors declare no competing financial interests. This research project was supported in part by research grants from National Institutes of Health to JQZ (GM083889, MH104632, and MH108025), OFO (5F31NS092437-03), VMF (EY017724) and HCH (EY014852, AR067786), as well as by the Emory University Integrated Cellular Imaging Microscopy Core of the Emory Neuroscience NINDS Core Facilities grant (5P30NS055077). We would like to thank Dr. Kenneth Myers for his technical expertise and help throughout the project. We also thank Drs.
    [Show full text]
  • Conditional Ablation of P130cas/BCAR1 Adaptor Protein
    Camacho Leal et al. Cell Communication and Signaling (2018) 16:73 https://doi.org/10.1186/s12964-018-0289-z RESEARCH Open Access Conditional ablation of p130Cas/BCAR1 adaptor protein impairs epidermal homeostasis by altering cell adhesion and differentiation Maria del Pilar Camacho Leal†, Andrea Costamagna†, Beatrice Tassone, Stefania Saoncella, Matilde Simoni, Dora Natalini, Aurora Dadone, Marianna Sciortino, Emilia Turco, Paola Defilippi, Enzo Calautti‡ and Sara Cabodi*‡ Abstract Background: p130 Crk-associated substrate (p130CAS; also known as BCAR1) is a scaffold protein that modulates many essential cellular processes such as cell adhesion, proliferation, survival, cell migration, and intracellular signaling. p130Cas has been shown to be highly expressed in a variety of human cancers of epithelial origin. However, few data are available regarding the role of p130Cas during normal epithelial development and homeostasis. Methods: To this end, we have generated a genetically modified mouse in which p130Cas protein was specifically ablated in the epidermal tissue. Results: By using this murine model, we show that p130Cas loss results in increased cell proliferation and reduction of cell adhesion to extracellular matrix. In addition, epidermal deletion of p130Cas protein leads to premature expression of “late” epidermal differentiation markers, altered membrane E-cadherin/catenin proteins localization and aberrant tyrosine phosphorylation of E-cadherin/catenin complexes. Interestingly, these alterations in adhesive properties in absence
    [Show full text]
  • Cooperative Coupling of Cell-Matrix and Cell–Cell Adhesions in Cardiac Muscle
    Cooperative coupling of cell-matrix and cell–cell adhesions in cardiac muscle Megan L. McCaina, Hyungsuk Leea,1, Yvonne Aratyn-Schausa, André G. Kléberb, and Kevin Kit Parkera,2 aDisease Biophysics Group, Wyss Institute for Biologically Inspired Engineering, School of Engineering and Applied Sciences, Harvard University, Cambridge, MA 02138; and bDepartment of Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215 Edited by Robert Langer, Massachusetts Institute of Technology, Cambridge, MA, and approved May 1, 2012 (received for review February 21, 2012) Adhesion between cardiac myocytes is essential for the heart to serve as cues for remodeling adhesions and assembling tissues. In function as an electromechanical syncytium. Although cell-matrix vitro studies have demonstrated that cytoskeletal tension (27) and and cell–cell adhesions reorganize during development and dis- exogenous cyclic strain (28, 29) promote cell–cell adhesion and ease, the hierarchical cooperation between these subcellular struc- tissue assembly in many cell types. Culturing noncardiac cells tures is poorly understood. We reasoned that, during cardiac on stiff substrates tips the balance of adhesion in favor of focal development, focal adhesions mechanically stabilize cells and tis- adhesions and away from cell–cell adhesions (30–32), suggesting sues during myofibrillogenesis and intercalated disc assembly. As that mechanical forces can modulate the assembly or disassembly the intercalated disc matures, we postulated that focal
    [Show full text]
  • Catenin Controls Vinculin Binding
    ARTICLE Received 4 Feb 2014 | Accepted 25 Jun 2014 | Published 31 Jul 2014 DOI: 10.1038/ncomms5525 Force-dependent conformational switch of a-catenin controls vinculin binding Mingxi Yao1,*, Wu Qiu2,3,*, Ruchuan Liu2,3, Artem K. Efremov1, Peiwen Cong1,4, Rima Seddiki5, Manon Payre5, Chwee Teck Lim1,6, Benoit Ladoux1,5,Rene´-Marc Me`ge5 & Jie Yan1,3,6,7 Force sensing at cadherin-mediated adhesions is critical for their proper function. a-Catenin, which links cadherins to actomyosin, has a crucial role in this mechanosensing process. It has been hypothesized that force promotes vinculin binding, although this has never been demonstrated. X-ray structure further suggests that a-catenin adopts a stable auto-inhibitory conformation that makes the vinculin-binding site inaccessible. Here, by stretching single a- catenin molecules using magnetic tweezers, we show that the subdomains MI vinculin- binding domain (VBD) to MIII unfold in three characteristic steps: a reversible step at B5pN and two non-equilibrium steps at 10–15 pN. 5 pN unfolding forces trigger vinculin binding to the MI domain in a 1:1 ratio with nanomolar affinity, preventing MI domain refolding after force is released. Our findings demonstrate that physiologically relevant forces reversibly unfurl a- catenin, activating vinculin binding, which then stabilizes a-catenin in its open conformation, transforming force into a sustainable biochemical signal. 1 Mechanobiology Institute, National University of Singapore, Singapore 117411, Singapore. 2 Department of Physics, National University of Singapore, Singapore 117542, Singapore. 3 College of Physics, Chongqing University, No. 55 Daxuecheng South Road, Chongqing 401331, China. 4 Singapore-MIT Alliance for Research and Technology, National University of Singapore, Singapore 117543, Singapore.
    [Show full text]
  • Effect of Exercise Training on Tropomodulin-2 Gene Expression in Cerebellum of Diabetic Rats
    ORGINAL ARTICLE Effect of Exercise Training on Tropomodulin-2 Gene Expression in Cerebellum of Diabetic Rats Seyed Jalal Taherabadi 1, Masoud Rahmati 1*, Rahim Mirnasuri 1, Abdolreza Kazemi 2 Abstract 1. Department of Sport Sciences, Lorestan Objective: It is well documented that exercise training (ET) University, Khoram Abad, Iran. imposes beneficial effects on diabetes mellitus and its complication 2. Department of Sport Sciences, Vali-E-Asr University of Rafsanjan, Kerman, Iran. such as diabetic peripheral neuropathy (DPN). Regarding the importance of tropomodulin-2 (TMOD2) in nervous system plasticity, this protein may be recognized as a candidate mechanism for ET-induced neuroplasticity. The aim of this study was to *Correspondence: investigate the effects of ET on cerebellar gene expression of Masoud Rahmati, PhD, Department of TMOD2 in rats with DPN. Sport Sciences, Lorestan University, Materials and Methods: Animals were randomly divided into Khoram Abad, Iran. three groups: healthy control (C), diabetic control (DC) and diabetic Tel: (98) 912 452 5538 trained (DT). Diabetes was induced by a single intraperitoneal Email: [email protected] injection of streptozotocin. Behavioral nociception assessment was carried out by Von Frey Filaments and tail-flick tests. TMOD2 gene expression was assessed by real time-PCR . Received: 17 February 2019 Results: The mRNA levels of TMOD2 increased to 0.50-fold ( P- value: 0.005) in comparison of the sedentary controls after 6 weeks Accepted: 21 June 2019 of DPN. Also, TMOD2 gene expression in DT group was decreased Published in August 2019 to -0.68-fold changes in comparison of the C group ( P-value: 0.001).
    [Show full text]
  • Serum Albumin OS=Homo Sapiens
    Protein Name Cluster of Glial fibrillary acidic protein OS=Homo sapiens GN=GFAP PE=1 SV=1 (P14136) Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Cluster of Isoform 3 of Plectin OS=Homo sapiens GN=PLEC (Q15149-3) Cluster of Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2 (P68871) Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Cluster of Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 (Q13509) Cluster of Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 (P60709) Cluster of Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 (P68363) Cluster of Isoform 2 of Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 (Q13813-2) Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 Cluster of Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 (Q01082) Cluster of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM PE=1 SV=4 (P14618) Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Cluster of ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide OS=Homo sapiens GN=ATP1A2 PE=3 SV=1 (B1AKY9) Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Cluster of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 (P12814) 60 kDa heat shock protein, mitochondrial OS=Homo
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • A Unique and Specific Interaction Between Αt-Catenin and Plakophilin
    2126 Research Article A unique and specific interaction between ␣T-catenin and plakophilin-2 in the area composita, the mixed-type junctional structure of cardiac intercalated discs Steven Goossens1,2,*, Barbara Janssens1,2,*,‡, Stefan Bonné1,2,§, Riet De Rycke1,2, Filip Braet1,2,¶, Jolanda van Hengel1,2 and Frans van Roy1,2,** 1Department for Molecular Biomedical Research, VIB and 2Department of Molecular Biology, Ghent University, B-9052 Ghent, Belgium *These authors contributed equally to this work ‡Present address: Wiley-VCH, Boschstrasse 12, D-69469 Weinheim, Germany §Present address: Diabetes Research Center, Brussels Free University (VUB), Laarbeeklaan 103, B-1090 Brussels, Belgium ¶Present address: Australian Key Centre for Microscopy and Microanalysis, The University of Sydney, NSW 2006, Australia **Author for correspondence (e-mail: [email protected]) Accepted 24 April 2007 Journal of Cell Science 120, 2126-2136 Published by The Company of Biologists 2007 doi:10.1242/jcs.004713 Summary Alpha-catenins play key functional roles in cadherin- desmosomal proteins in the heart localize not only to the catenin cell-cell adhesion complexes. We previously desmosomes in the intercalated discs but also at adhering reported on ␣T-catenin, a novel member of the ␣-catenin junctions with hybrid composition. We found that in the protein family. ␣T-catenin is expressed predominantly in latter junctions, endogenous plakophilin-2 colocalizes with cardiomyocytes, where it colocalizes with ␣E-catenin at the ␣T-catenin. By providing an extra link between the intercalated discs. Whether ␣T- and ␣E-catenin have cadherin-catenin complex and intermediate filaments, the specific or synergistic functions remains unknown. In this binding of ␣T-catenin to plakophilin-2 is proposed to be a study we used the yeast two-hybrid approach to identify means of modulating and strengthening cell-cell adhesion specific functions of ␣T-catenin.
    [Show full text]