Dynamic Chromatin Associated Ubiquitination with Cell Cycle

Dynamic chromatin associated ubiquitination with cell cycle

progression in human cancer cells

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Mansi Shyam Arora

Graduate Program in Molecular, Cellular and Developmental Biology

The Ohio State University

2014

Dissertation Committee:

Dr. Jeffrey Parvin, Advisor

Dr. Anita Hopper

Dr. Mark Parthun

Dr. Robin Wharton

Mansi Shyam Arora

2014

Abstract

In this dissertation work, we have analyzed the pattern of ubiquitin conjugates on human chromatin and its changes with the progression of cell cycle. Our work shows that during interphase, ubiquitination marks the transcribed regions of the genome. This ubiquitination correlates with the ubiquitination of H2B, is dependent on active transcription and is removed during mitosis. We had anticipated that all the ubiquitin associated with the transcribed regions would be removed from chromatin during mitosis, but contrary to our expectation, we found that at the promoters of active genes chromatin ubiquitination levels actually increase thus implying this modification as a possible mitotic bookmark.

In the second half of this project, we set out to identify the substrate modified by this post translational modification at these promoters and the enzymes involved in its deposition and removal before and after mitosis respectively. Our results show the surprising involvement of the SAGA associated deubiquitinase USP22 and the polycomb complex proteins BMI1 and RING1A in the regulation of this bookmark during mitosis. The polycomb complex proteins are thought to primarily regulate gene expression by transcriptional repression. Although some previous studies have implied the involvement

ii of the polycomb proteins in the regulation of active genes, their association with the transcriptional regulation of active genes during the mitosis to G1 transition has not been described before this work. Our data reveal that BMI1 and RING1A regulate the mitotic bookmarking by ubiquitination and their expression once the cells exit mitosis and enter

G1. They are also required for the progression of the cells through mitosis and entry into

G1 as well as progression through G1. We also show that lack of RING1A (and thus mitotic bookmarking by ubiquitination) is deleterious to the survival and proliferation of tissue culture cell lines thus presenting as a potential for novel targets for cancer therapy.

iii

Dedication

Dedicated to my husband and my family

Acknowledgments

First and foremost, I would like to express my deep gratitude towards my advisor Dr.

Jeffrey Parvin. This thesis would have been inconceivable without his invaluable guidance throughout the course of my time in his lab. Jeff has a great mentor, a good scientist and great person and I find myself extremely fortunate to be provided an opportunity to know him and work under his guidance. He not only helped me develop my research skills and values, but his faith and confidence in me has also helped me become an independent scientist.

I would also like to thank my committee members - Dr. Robin Wharton, Dr. Mark

Parthun and Dr. Anita Hopper for their helpful discussions during committee meetings and for always encouraging me to think critically of my work and to strive for higher academic and research standards. I will be forever grateful to Dr. Anita Hopper for her excellent career guidance, her eternally optimistic attitude and her kind words of encouragement and support whenever I needed them.

I would like to thank my lab mates and good friends, Zeina Kais and Huiwen Liu for their insightful suggestions and comments, and other members of the lab (past and present) who made the times in the Parvin Lab always fun and exciting.

The journey through grad school and life in Columbus would not have been as much fun had it not been for the awesome company of friends I was lucky enough to meet in this city. I thank you all for being there for me, always.

I dedicate this thesis to my parents who, despite coming from a traditional background, have gone against the tide and always encouraged me to achieve academic excellence and personal independence.

Last but not the least; I would like to express my deepest love and gratitude to my dear husband who from the time we met almost ten years ago and until now remains my best friend, biggest emotional support, academic critic, and inspiration to be my best. It would have been impossible to be where I am without him.

Vita

2007-Present……………….PhD Candidate, The Ohio State University, Columbus, OH

2006………………………...M.Sc., Biochemistry, M.S. University, Vadodara, India

2004………………………...B.Sc., Biochemistry, Gujarat University, Ahmedabad, India

Publications

1. Arora M, et al. (2012) Nucleic Acids Res. 40(20):10187-202. (Featured Article)

2. Liu HW, Zhang J, Heine GF, Arora M, et al. (2012) Nucleic Acids Res.

40(20):10172-86. (Featured Article)

3. Zhang J, Lu K, Xiang Y, Islam M, Kotian S, Kais Z, Lee C, Arora M, et al.

(2012) PLoS Comp Biol. 8(8):e1002656.

4. Johnson N, Cai D, Kennedy RD, Pathania S, Arora M, e al. (2009) Mol Cell. 14;

35(3):327-39.

5. Parvin JD, Kais Z, Arora M, et al. (2009) Proceedings of the Ohio Collaborative

Conference on Bioinformatics (OCCBIO): 71-75.

vii

Fields of Study

Major Field: Molecular, Cellular and Developmental Biology

viii

Table of Contents

Abstract ...... ii

Dedication ...... iv

Acknowledgments ...... v

Vita ...... vii

Publications ...... vii

Fields of Study ...... viii

Table of Contents ...... ix

List of Tables ...... xiii

List of Figures ...... xiv

Chapter 1: Dynamic ubiquitination of chromatin associated proteins through the cell cycle ...... 1

1.1 Chromatin: What is it? ...... 1

1.2 Epigenetic Vs. Dynamic: ...... 1

1.3 Post translational modifications: Writers, readers and erasers ...... 3

1.4 Polycomb repressive complex ...... 18

1.4 Epigenetic inheritance through cell cycle ...... 23

1.5 Cell cycle associated changes in ubiquitination ...... 29

Chapter 2: Rationale ...... 31

Chapter 3: Ubiquitination of chromatin associated proteins changes through the cell cycle

...... 33

3.1 ABSTRACT ...... 34

3.2 BACKGROUND ...... 35

3.3 MATERIALS AND METHODS ...... 37

Cell culture, cell cycle synchronization, transfection and reagents ...... 37

Chromatin Fractionation ...... 38

FACS analysis ...... 38

Chromatin Affinity Purification and Immuno Precipitation ...... 38

ChAP DNA preparation for Illumina GAII Sequencing ...... 40

Data analysis ...... 41

3.4 RESULTS ...... 44

3.4.1 Conjugation of ubiquitin to chromatin changes during the cell cycle: ...... 44

3.4.2 Ubiquitination mark redistributes in the genome during mitosis: ...... 54

3.4.3 Ubiquitination is enriched at active genes throughout the cell cycle: ...... 56

3.4.4 Ubiquitination at transcribed regions is sensitive to transcriptional inhibition: ... 60

3.4.5 RNF20 is required for ubiquitination of H2B associated with active transcription:

...... 60

3.4.6 Ubiquitination bookmarks promoters of a subset of active genes: ...... 64

3.4.7 Ubiquitination during mitosis correlates with genes carrying active histone marks

during interphase: ...... 72

3.5 DISCUSSION ...... 73

Chapter 4: Unexpected roles of polycomb proteins in positive regulation of actively transcribed genes...... 78

4.1 Abstract ...... 79

4.1 BACKGROUND ...... 79

4.2 Materials and Methods: ...... 82

Cell culture, cell cycle synchronization and transfections: ...... 82

Antibodies ...... 83

Flow cytometry ...... 83

ChIP and ChAP ...... 83

QPCR ...... 84

4.3 RESULTS ...... 84

4.3.1 Deubiquitinase USP22 regulates chromatin ubiquitination during mitosis...... 84

4.3.2 Polycomb repressive complex 1 associated proteins positively regulate promoter

ubiquitination in mitosis...... 87

4.3.3 RING1A regulates mitotic bookmarking by H3K4 trimethylation...... 90

4.3.4 Proliferation and cell cycle ...... 92

4.3.5 Chromatin ubiquitination at promoters during mitosis is essential for transcription

of the bookmarked genes in G1...... 96

4.3 DISCUSSION ...... 98

Chapter 5: Concluding remarks and future directions ...... 104

5.1 Summary of Results: ...... 104

5.2 Key remaining issues: ...... 106

5.2.1 Ubiquitinated substrate as the bookmark: ...... 106

5.2.2 Molecular mechanism of mitotic bookmarking by ubiquitination: ...... 108

5.2.4 Importance of ubiquitination bookmarking in cancer cells ...... 116

5.3 Significance: ...... 116

Bibliography ...... 118

Appendix A: Supplementary Data tables ...... 132

xii

List of Tables

Table 1: List of pathways that includes genes bookmarked by ubiquitination ...... 67

Table 2: Sequences of the primers used for qPCR to amplify the promoter and coding regions of the indicated genes...... 132

Table 3: List of proteins identified by LTQ mass spec in control but not RING1A depleted samples ...... 133

Table 4: Candidates from LTQ mass spec data selected for further testing ...... 136

Table 5: siRNA sequences used in this dissertation ...... 137

xiii

List of Figures

Figure 1: Readers, writers and erasers of chromatin modifications...... 3

Figure 2: Various post translational modifications of the core histones...... 4

Figure 3: Opposing effects of ubiquitinated H2B and H2A on transcription...... 12

Figure 4: Polycomb Repressive Complexes 1 &2...... 17

Figure 5: Mitotic retention of transcription factors and histone marks ...... 28

Figure 6: Ubiquitin fusion protein forms high molecular weight conjugates similar to the endogenous ubiquitin...... 45

Figure 7: Detection of HBT-ubiquitinated large subunit of RNAPII ...... 48

Figure 8: Synchronization of HeLa cells at different cell cycle stages...... 49

Figure 9: Distribution of the ubiquitin mark on chromatin through the cell cycle...... 52

Figure 10: Distribution of ubiquitination in the genome...... 53

Figure 11: Distribution of ubiquitination around the transcription start sites (TSS)...... 55

Figure 12: Chromatin ubiquitination on the transcribed regions is reduced upon transcriptional inhibition...... 59

Figure 13: Ub-H2B ChIP and ReCHIP in HeLa cells...... 62

xiv

Figure 14: RNF20 depletion reduces ubiquitination of regions downstream of TSS but not at promoters...... 63

Figure 15: UbH2B levels on the chromatin during mitosis...... 65

Figure 16: FACS analysis of synchronized HeLa cells...... 68

Figure 17: Chromatin ubiquitination at promoters is increased during mitosis...... 69

Figure 18: Ubiquitin marks on the chromatin correlate with active histone marks during all stages of the cell cycle...... 71

Figure 19: Effect of USP22 depletion on promoter ubiquitination in G1 phase of cell cycle...... 86

Figure 20: Effect of USP22 depletion on promoter ubiquitination in M phase of cell cycle...... 87

Figure 21: Effect of BMI-1 depletion on promoter ubiquitination during mitosis...... 89

Figure 22: Effect of depletion of RING1B or RING1A on promoter ubiquitination during mitosis...... 90

Figure 23: Effect of RING1A and RING1B depletion on other mitotic bookmarks...... 92

Figure 24: Proliferation of HeLa and U2OS cells after depletion of RING1A or RING1B.

...... 94

Figure 25: RING1A depletion leads to a cell cycle block in G1...... 94

Figure 26: Progression of HeLa cells through the cell cycle after RING1A depletion. ... 95

Figure 27: RING1A and BMI-1 depletion causes apoptosis during M to G1 transition. 96

Figure 28: Chromatin ubiquitination in G1 is reduced in absence of RING1A...... 98

Figure 29: TEV and USP2 protease cleavage sites on an ubiquitinated substrate...... 107

Figure 30: Hypothetical model showing changes in local chromatin on ubiquitination bookmarked genes...... 112

Figure 31: Hypothetical model showing ubiquitination at promoters as recognition mark for transcriptional machinery...... 114

xvi

Chapter 1: Dynamic ubiquitination of chromatin associated

proteins through the cell cycle

1.1 Chromatin: What is it?

In a eukaryotic cell, the DNA is not naked but in the form of chromatin. The eukaryotic chromatin is a complex of DNA wrapped around proteins showing a ‘beads on a string’ structure. The ‘beads’ are called nucleosomes that consist of DNA wrapped around eight proteins called histones. This ‘beads on string’ structure of chromatin is further condensed into highly compact chromatin fibers. The ‘euchromatin’ or the active chromatin is less condensed than the ‘heterochromatin’. During mitosis, all of the chromatin is highly condensed to allow equal division of the genetic material between the two daughter cells. Apart from histones, chromatin also includes ‘non-histone’ proteins such as various scaffolding proteins involved in architectural maintenance, transcription factors, DNA repair proteins, etc. that are either transiently or tightly bound (1).

1.2 Epigenetic Vs. Dynamic:

The word ‘epigenetic’ can be described as changes in gene expression or other cellular phenotype resulting from changes in a chromosome without alterations in the underlying

DNA sequence and which is passed on through mitosis/meiosis. The signals that lead to an epigenetic mark may be classified as epigenators, epigenetic initiators and epigenetic maintainers (2). Epigenators are signals that originate from the environment and trigger intracellular pathways to cause changes. Initiators respond to the signal from the epigenators and are the ones that define the precise chromosomal location of the epigenetic change (include DNA binding proteins or non-coding RNA). Maintainers act at the site of epigenetic change. They cannot initiate but work in sustaining the chromosome environment in subsequent generations. Best examples of maintainers are post transnationally modified histones (e.g. include H3K4 and H3K27 methylated by the trithorax or polycomb complexes respectively in homeotic gene expression, H3K9 and

H4K20 methylation in establishing transcriptional silencing and H4K16ac in mating type behavior in yeast).

However, not all histone modifications are ‘epigenetic’ in nature. Many modifications play a role in dynamic processes such as transcriptional induction and DNA repair. These modifications are not always passed on through the cell divisions but may change within a cycle depending on the presence or absence of cues that initiate them or actively remove them. Such modifications should be referred to as ‘dynamic histone marks’. For instance H2B gets ubiquitinated along with transcription but is dynamically deubiquitinated at the same time by the action of the deubiquitinase USP22. In addition, during mitosis, when most transcription comes to a halt, both H2B and H2A are deubiquitinated making them dynamic and not epigenetic histone modifications.

Figure 1: Readers, writers and erasers of chromatin modifications. The 'reader' proteins recognize and bind to the post translational modifications of histones. The 'writers' are enzymes that deposit the PTMs and 'erasers' are those that remove these marks.

1.3 Post translational modifications: Writers, readers and erasers

Processes such as transcription of genes and replication of DNA require direct accessibility to the DNA of the proteins involved. This accessibility can be modulated by varying the degree of compaction of the nucleosomes around the DNA. There are two major reversible mechanisms by which the chromatin can open up and make the DNA more accessible are – a) remodeling of the chromatin by displacing the histones which can be carried out by ‘chromatin remodeling’ complexes. b) Post translational modifications of the N terminus tails of the histone proteins. The main posttranslational modifications of the histone tail include ubiquitination, phosphorylation, methylation, acetylation, SUMOylation etc. Various chromatin associated proteins can carry out the

3 addition of these modifications and are referred to as readers. Some others act in reversing this process and are called ‘erasers’. Varieties of proteins with different types of domains are able to recognize and bind to these modifications specifically and are referred to as ‘readers’ (Figure 1). These reader proteins then recruit other chromatin modifying or remodeling enzymes to bring about different downstream effects. Recent proteomic studies have shown that histones can also be crotonylated (3). The major modifications are represented in Figure 2 and functions of some are discussed below.

Figure 2: Various post translational modifications of the core histones.

1.3.1. Phosphorylation:

The phosphorylation occurs on serine, threonine or tyrosine residues. Although a large number of phosphorylation sites have been identified, the biological function of most of them remains to be identified. Phosphorylated histones are involved in diverse nuclear processes. Three major processes that histone phosphorylation is involved in are DNA damage response pathways, regulation of transcription and chromatin compaction.

Phosphorylation of histone H3 on residues S10, T3, T11 and S28 is associated with chromosome compaction and segregation during mitosis and meiosis(4). Phosphorylation of H3S10 and S28 is carried out by Aurora kinase B (AURKB) at the prophase stage while they are dephosphorylated by PP1 (4-6) at the end of mitosis.

Phosphorylation of histones is now shown to be involved in various other functions.

H3S10ph is thought to regulate the binding of proteins to the chromatin. H3T3 is phosphorylated by the chromatin-associated kinase Haspin at the inner centromeric regions and is implicated in sister chromatid cohesion (7). In mammalian cells, DNA damage leads to the phosphorylation of the histone variant H2AX at serine 139 and is commonly referred to as γ-H2AX (8). Phosphorylation of H2AX is one of the first responses to DNA damage and is carried out by ATM or ATR protein kinases. γ-H2AX plays diverse roles in DNA damage response acting as a signaling platform for checkpoint activation(9). This modification is reversible by the action of phosphatases like PP2A, Wip1, PP6 or PP4 leading to recovery of the checkpoint (10-13). Recently, phosphorylation of H2AX has also been shown to function in apoptosis (4) along with

H2BS14ph (14,15).

In addition, phosphorylation of H3S10, T11 and S28 also play important roles in transcription regulation by controlling acetylation and methylation of histone H3. A complex crosstalk occurs between phosphorylation of these residues to regulate acetylation of H3, gene expression and cell proliferation. H3S28ph also regulates gene expression by promoting removal of repressive marks on H3K27 or H3K9 and by preventing removal of active methyl marks (16,17).

1.3.2. Methylation:

Methylation of histones occurs on all basic residues – arginine (R), lysine (K) and histidine (H). The most extensively studied methylations are of H3K4, H3K9, H3K27,

H3K36, H3K79 and H4K20 lysine modifications and H3R2, H3R8, H3R17, H3R26 and

H4R3 arginine modifications. Other methylated residues have also been identified in all major core histones by mass spectrometry analysis but their functions have not been identified. The methylation can be either activating or repressive depending on the amino acid and histone it occurs on. The effect is also specified by whether it’s mono-, di- or trimethylation of that lysine.

Methylation is a reversible modification. To date, a plethora of methyltransferases and demethylases have been identified. The methyltransferases catalyze the transfer of methyl groups from the methyl donor S-adenosylmethionine (SAM) to the histones (4). There are two major types of methyltransferases – SET domain containing and DOT1 like enzymes carry out lysine methylation while protein arginine methyltransferase (PRMT) family enzymes carry out arginine methylation. Since this study does not involve any

6 experiments with arginine-methylated histones, this introduction will only deal with histone lysine methylation.

Histone lysine methylation has been shown to control aspects of both short and long term transcriptional regulation being shown as both a dynamic and epigenetic mark as it can be a stable mark through generations. Along with the regulation of gene specific expression, this PTM of histones is also shown to regulate chromosomal structure and organization by contributing to the formation of the heterochromatin/euchromatin regions and chromatin boundaries. H3K4me2 is a global epigenetic mark in euchromatic regions while H3K9 methylation by Suv39h1 is a general mark of heterochromatic regions.

H3K79 methylation is also involved in preventing spreading of the heterochromatin.

Along with establishing heterochromatin/euchromatin regions, histone methylations are also associated with transcription status. In general, methylations on H3K4, K36 and K79 are associated with active transcription whereas methylation on H3K9, K27 and H4K20 are considered repressive marks. Studies in yeast show that yeast Set1 and Set2 are responsible for H3K4 and H3K36 methylation respectively at mRNA coding regions.

Trimethylation of H3K4 by Set1 occurs near the 5’ regions while the H3K36 methylation occurs in the body of the actively transcribed genes. In humans, H3K4 is methylated by either SET1A or SET1B enzymes of the SET methyltransferase protein complexes

(Drosophila dSet) or the MLL1-4 enzymes of the MLL complexes (Drosophila trithorax and trithorax like complex) (Millet T, 2001; Shilatifard, A, 2012). While in yeast, the

Set2 enzyme can mono-, di- or tri-methylate H3K36, this activity is divided between different enzymes in mammals. In humans, the Set1d enzyme catalyzes the trimethylation

7 of H3K36 while the NSD1, NSD2 and NSD3 catalyze the mono and dimethylation of this site (refs). Methylation of H3K79 is carried out by the DOT1L enzyme and occurs near the 5’ regions of actively transcribed genes.

Suv39h, G9a, SETBD1, Eu-HMTase1 and ESET can carry out the methylation of H3K9 in mammals. H3K9 methylation plays a context dependent role by either contributing to heterochromatin formation or specific gene repression by recruiting the protein HP1.

H4K20 is methylated by PR-Set7 enzyme while the polycomb protein EZH2 belonging to the polycomb repressive complex 2(PRC2) methylates H3K27. Methylated H3K27 acts as a recognition site for binding of the polycomb repressive complex-1 (PRC1) which then ubiquitinates histone H2A and represses RNAPII mediated transcriptional initiation and elongation at the modified target genes. The activities, components and regulation of the polycomb and the MLL complexes are described in more detail later in this chapter.

1.3.3. Acetylation:

Acetylation of histones is so far the most thoroughly analyzed PTM. It is catalyzed by histone acetyl transferases (HATs). This modification is also reversible by the action of histone deacetylases or HDACs. There are two major superfamilies of HATs – GNAT

(Gcn5 related N-acetyl transferase) and MYST (MOZ, Ybf2-Sas3, Sas2, Tip60). HDACs on the other hand can be classified into three different classes – class I (HDAC1, 2, 3 and

8), II (HDAC4, 5, 6, 7, 9, 10) and III (sirtuins). Acetylation occurs at a basal level on all core histones.

Acetylation of lysine residues neutralizes the positive charge on histones weakening the nucleosome-DNA or nucleosome-nucleosome interaction thus giving nuclear DNA

8 binding proteins more access to the DNA. Thus acetylated chromatin is associated with transcriptional competence whereas lack of acetylation is usually related to transcriptional repression. Histone acetylation acts not only by increasing chromatin accessibility but also by providing recognition sites for other chromatin binding proteins.

Proteins containing a bromodomain are known to interact with acetylated lysines. Other than its role in transcription modulation, histone lysine acetylation also functions in other cellular functions that require DNA access like DNA replication and repair. It has recently been shown that histone acetylation is associated with productive origin activation (18) and also shown to occur at DNA double strand breaks (19).

1.3.4. Ubiquitination

Ubiquitination of intracellular proteins has emerged as a critical regulatory modification of importance in most intracellular processes. The 8 KDa ubiquitin protein is attached to a lysine residue in a substrate protein by the action of three enzymes acting in a cascade –

E1, E2 and E3. In the first step, ubiquitin is activated by the E1 enzyme in an ATP dependent reaction, which is then conjugated to a cysteine residue in an E2 (ubiquitin conjugase) enzyme via a thio-ester bond. Finally, the ubiquitin molecule is transferred from the E2 to a target lysine catalyzed by the action of an ubiquitin-protein isopeptide ligase (E3) enzyme. Till date, a single E1, about 30-50 E2 and hundreds of E3 ubiquitin ligases have been identified in higher eukaryotes. The E3s are a large, diverse group of proteins, characterized by one of several defining motifs. These include a HECT

(homologous to E6-associated protein C-terminus), RING (really interesting new gene) or U-box (a modified RING motif without the full complement of Zn2+-binding ligands)

9 domain. In the ubiquitination cascade, the E3 ubiquitin ligase is responsible for substrate specification. A single ubiquitin may be added to the target lysine (referred to as monoubiquitination) or multiple ubiquitin molecules can be attached to the same lysine in in a chain leading to polyubiquitination of the substrate. Polyubiquitination may also refer to addition of ubiquitin molecules to multiple lysine residues in a protein.

Polyubiquitination of a substrate generally (but not always) leads to its degradation by the

26S proteasome whereas monoubiquitination marks the protein to signal for a particular function. Studies from the past couple of decades have made it clear that monoubiquitination of histones H2A and H2B is a critical regulatory PTM in several nuclear processes including transcription and DNA damage repair.

H2B monoubiquitination: In S. cerevisiae, the E2 Rad6 along with the E3 Bre-1 monoubiquitinate H2B (20,21) at lysine 123 (K123). In humans, RNF20 acts as the major

E3 ligase for H2B and knockdown of RNF20 significantly reduces levels of ubH2B in human cells (22,23) (Figure 3). Other candidates for H2B ubiquitin ligases also exist (for example Mdm2 (24) and BRCA1 (25,26), as they are able to ubiquitinate core histones in vitro. However, there in vivo role is currently unknown.

UbH2B is tightly associated with transcriptional activation. In yeast, Bre1 is recruited to promoters in an activator dependent fashion (20,27,28). These proteins then associate with RNA polymerase II (RNAPII) as it begins the process of transcription. Although recruitment of these enzymes is independent of the transcription, factors associated with the elongating form of RNAPII are required for ubiquitination of H2B. For e.g., PAF complex that associates with the elongating form of RNAPII is required for Rad6

10 mediated H2B ubiquitination (28,29). It is interesting to note that although in mammalian cells, ubH2B associates with transcribed regions of active genes (30), knockdown of

RNF20 affected the basal expression of only a subset of genes. Additional factors involved in transcription elongation are also required for ubH2B. UbH2B levels are also sensitive to transcriptional inhibition by RNAPII elongation inhibitors like α-amanitin or flavopiridol (31). These observations suggest that presence of ubH2B on coding regions of genes is a mark of active transcription. It is suggested that ubH2B may promote transcription elongation by facilitating passage of the elongating RNAPII by assisting the histone chaperone FACT in nucleosomal rearrangement (32). Contrary to this thought, there are also studies that show that ubH2B actually stabilizes the nucleosome instead of destabilizing it (33-35). These results suggest a widespread role of H2BK123ub in promoting nucleosome assembly across the genome, with negative consequences on assembly of RNAPII at promoters and positive consequences on elongation of RNAPII into the body of genes.

H2B ubiquitination also affects transcription by regulating other transcription associated histone marks like di and trimethylation of H3K4 and H3K79 (28,36-38). In yeast, the

COMPASS complex responsible for H3K4methylation associates with elongating form of RNAPII. UbH2B regulates the COMPASS by controlling the binding of Cps35, an important subunit of COMPASS (39). Cps35 may also regulate H3K79 methylation by

Dot1 enzyme.

Figure 3: Opposing effects of ubiquitinated H2B and H2A on transcription. Monoubiquitination of H2B (ubH2B) (left) is carried out by RNF20 associated with the elongating RNAPII and correlates with active transcription. Conversely, monoubiquitination of H2A (ubH2A) (right) is carried out by RING1B of the PRC1 complex and correlates with transcriptional repression.

H2A monoubiquitination: Contrary to ubH2B, ubH2A is associated with transcriptional silencing (Figure 3). Ubiquitination of H2A is carried out by two major E3 ubiquitin ligases – RING1B (RING2/RNF2) and 2A-HUB. RING1B is known to be part of three multi-protein complexes – Polycomb repressive complex 1 (PRC-1), E2F-6.com-

1 and FBXL-BcoR complex. PRC1 also contains two other ubiquitin ligases, BMI1 and a close homolog of RING1B called RING1A. However, the major ubH2A ligase activity of the PRC1 complex is attributed to RING1B whereas BMI plays an activating role for

RING1B. Although until recently PRC1 was thought to have a fixed composition of proteins, latest proteomic studies however show that PRC-1 may not represent a single complex but may be composed of different subunits in different cellular contexts(40). 12

E2F-6.com-1 and FBXL10-BcoR are also shown to be involved in transcriptional silencing of E2F and MYC responsive genes (41,42).

The second major H2A ubiquitin ligase, 2A-HUB (hRUL138) is part of the

NCoR/HDAC1/3 complex and promotes transcriptional silencing at promoters of chemokine genes. It is shown to play a role in inhibition of transcriptional initiation by inhibiting the recruitment of Spt16 subunit of the FACT complex to these genes (43). It is suggested that ubH2A also represses transcription by enhancing binding of the linker histone H1 to nucleosomes thereby leading to chromatin compaction.

UbH2A is also involved in DNA damage repair response pathway. Ubiquitination of

H2A by RING1B or RNF8 is induced by DNA damage where it is said to lead to DNA repair induced chromatin remodeling. RNF8 dependent ubH2A is also said to act as docking sites for repair machinery (44) (45). BRCA1, an important DNA repair pathway enzyme, also known to be an E3 ubiquitin ligase, maintains heterochromatin structure by ubiquitinating H2A at satellite regions maintaining their repression (46).

Histone deubiquitination: Ubiquitination of histones is a reversible modification. There are many histone deubiquitinases discovered so far. Most of these enzymes exhibit cell type and cellular context specificity but can show deubiquitinases activity towards either ubH2A or ubH2B. In S. cerevisiae, Ubp8 and Ubp10 deubiquitinate H2B. Ubp8 is a component of the yeast SAGA (Spt-Ada-Gcn5 acetyl transferase) complex (47,48). The drosophila ortholog for Ubp8 is NONSTOP and in humans, the ortholog is USP22.

USP22, like Ubp8, is also a part of the human SAGA complex where along with ENY2 and ATXN7L3 it makes up the deubiquitination module of this complex. Since ubH2B is

13 a mark of active transcription, one would think that USP22 and Ubp8 would be involved in suppression of gene activity. However, contradictory to logic, both Ubp8 and USP22 are involved in transcriptional activation (29) suggesting that a balance in ubiquitination and deubiquitination of H2B is needed for active transcription. Recent studies also support its role in gene activation and as an oncogene. USP22 is required for full activation of several target genes governed by p53, MYC and androgen receptor (49,50).

USP22 is also required for normal cell cycle progression as its depletion leads to cell cycle arrest in G1. Intracellular localization of this protein changes with the cell cycle being nuclear during interphase but dispersing into the cytoplasm during mitosis. A recent finding showed this gene to be associated with the 11-gene signature associated with increased risk and poor prognosis of cancers along with other well-known oncogenes such as Ki67, CCNB1, BMI1 and RNF2 (51). Studies now show that ubH2B does not just play a role in gene regulation at the level of transcription but also post transcriptionally. A new study shows a critical role for H2B deubiquitination in cotranscriptional pre-mRNA processing events by demonstrating that USP49 mediated regulation of ubH2B levels are important for pre-mRNA splicing (52).

USP7/HAUSP, another ubH2B deubiquitinase, is part of the polycomb complex PRC1 and is involved in epigenetic silencing of homeotic genes in flies (53). USP7 is also involved in stabilization of p53 by controlling ubiquitination and thus levels of Mdm2

(54,55). Other major deubiquitinases for ubH2A include Ubp-M, 2A-DUB, USP21,

USP3 and USP16 (56-59). Ubp-M is required for the expression of HOX genes, H3S10 phosphorylation by AURKB and for cell cycle progression through mitosis. 2A-DUB and

USP21 have a role in transcription initiation and is required for gene activation at a subset of promoters (59-61). USP3 and BRCC36 are involved in DNA repair. A

Drosophila protein Calypso is now shown to encode an ubiquitin specific protease BAP-

1 (61,62). BAP-1 along with the PcG protein ASX forms the deubiquitinating module of

PRC-1 called PR-DUB. BAP-1 binds to the PcG target genes and deubiquitinates ubH2A suggesting that just like ubH2B, a balance in ubH2A levels at target genes is essential for maintaining proper transcriptional silencing.

Although these USPs have been shown to act on histones, there is a growing list of non- histone substrates and novel functions for these DUBS. For e.g. USP22 was shown to regulate the ubiquitination levels of telomeric repeat binding factor 1 (TRF1) which is one of the main components of the telomere protective complex shelterin (63). It also controls cell proliferation by regulating ubiquitination of the transcriptional regulator

FBP-1 (64).

Ubiquitination of other core histones and histone variants: Ubiquitination at other core histones such as H3 and H1 have also been reported in different cellular context (65-

67). Histones H3 and H4 are ubiquitinated by CUL4-DDB-ROC1 complex upon UV irradiation. CUL4-DDB-ROC1-mediated histone ubiquitination weakens the interaction between histones and DNA and facilitates the recruitment of repair proteins to damaged

DNA (68). Ubiquitination of H3 has also been reported in elongating spermatids (65).

UbH1 was reported in Drosophila where TAF1, a part of the general transcription factor complex TFIID, was shown to be required for this ubiquitination possibly acting as the

E2 enzyme (66).

Ubiquitination of some histone variants has been reported (69,70). However, their functions are not studied in as much detail as ubiquitinated H2A (ubH2A) or ubiquitinated H2B (ubH2B).

1.3.5. SUMOylation: All four core histones can be SUMOylated in yeast resulting in transcriptional repression (71). Analogous to ubiquitination, SUMOylation is also dynamically regulated by the action of sumo E3 ligases and SENP proteases. In yeast,

SUMOylation of H2B occurs at K6/6 and K16/17. In humans, H4 is said to be the major

SUMOylated histone (72). Although most studies have implicated SUMOylation in transcriptional repression, recent reports suggest that this view is controversial showing that SUMO modified proteins (histones or non-histone proteins) are associated with genes highly transcribed. However, some still support the idea that SUMOylation is a repressive mark and suggest that although found at transcriptionally active genes, the role of sumo at these sites is to still keep the transcription levels in check (73).

Figure 4: Polycomb Repressive Complexes 1 &2. A) Core components of the Drosophila and human PRC1 and PRC2 complexes. The different homologs of the core components that make up alternative PRC1 complexes are indicated in the boxes. B) The hierarchical model of the recruitment of the PRC complexes. PRC2 is recruited first which methylates the histone H3 at K27 position. The PRC1 is recruited at these sites by recognition of the H3K27me3 mark by the CBX subunit. The RING proteins associated with the PRC1 complex ubiquitinate H2A leading to transcriptional silencing.

1.4 Polycomb repressive complex

The mammalian polycomb systems are multi-protein complexes made of various subunits encoded by the polycomb group protein (PcG) genes. These complexes epigenetically control the expression of genes important for cell fate decisions, embryogenesis, proliferation and stem cell self-renewal. There are two major types of the polycomb complexes, PRC1 and PRC2 (reviewed in Margueron, R. Nature 2011 & Simon JA,

Nature reviews 2009) (74,75). Together, these complexes epigenetically modify target promoters and lead to their transcriptional repression. Along with maintenance of pluripotency, the PRC complexes are required for maintenance of the stem cell proliferation. Loss of the PRC1 complex leads to a severe proliferation defect in the ES cells. This control of proliferation by the PRC complexes is thought to occur by regulation of the Ink4aA-Ink4B locus.

PRC2 complex: The PRC2 consists of core subunits EZH1/2, SUZ12, EED and

RbAp46/48 (in humans) (Figure 4A). The effector activity of the PRC2 is to methylate the histone H3 at lysine 27 (H3K27) which is carried out by the methyltransferase EZH2 or EZH1. Although both proteins carry out the same enzymatic activity, they are thought to be not interchangeable but serve at specific times and contexts. EZH1 and EZH2 exhibit different expression patterns, with EZH1 being present in dividing and differentiated cells and EZH2 only in actively dividing cells. PRC2-EZH1 complex also shows a lower H3K27 methyltransferase activity and distinct chromatin compacting properties as compared to PRC2-EZH2 (76). The EZH2 subunit is inactive on its own and must be assembled with SUZ12 and EED to produce methyltransferase activity (77-

79). Other than the core subunits, PRC2 can have alternate compositions and core subunit interactions. These and their regulation by phosphorylation have been reviewed previously (74,75,80). In Drosophila, polycomb proteins are recruited to specific DNA sequences called Polycomb Response Elements (PREs). In mammalian systems, no such

DNA sequences have been identified so far and exactly how these complexes are recruited to the chromatin is not clear yet. Several recent reports now implicate ncRNA such as Xist RNA as a strong candidate for PRC2 recruitment (81-83).

Genome wide localization studies show that PRC2 complex binds to the promoter regions and methylates the H3K27 at promoter chromatin of several target genes including Hox genes and several other developmental regulators. Besides methylation of H3K27, new reports are also uncovering other non-canonical functions for the PRC2 components. For example, it was recently shown that EZH2 functions in prostate cancer cells in a manner independent of other PRC2 subunits and, surprisingly, as a transcriptional activator (84).

EZH2 was also shown to function in constitutive activation of NF-kB target gene expression in ER-negative basal-like breast cancer cells and that this function of EZH2 is independent of its histone methyltransferase activity (85). Similarly, EZH1, an EZH2 paralog, was shown to associate with active epigenetic mark (H3K4me3), RNA polymerase II (RNAPII), and mRNA production (86). These studies suggest that the polycomb proteins may have additional roles that are different from their repressive functions in development.

PRC1 complex: Drosophila core PRC1 is composed of four subunits, Polycomb (Pc),

Sex combs extra (Sce) or dRING, Polyhomeotic (Ph), and Posterior sex combs (Psc)

(Figure 4A). Unlike the Drosophila complex, mammalian PRC1 is quite heterogeneous.

Each of the dPRC1 proteins have multiple orthologs in vertebrates classified respectively as the CBX, RING1B/RING1A, PHC, and BMI1/PCGF families that combine in various combinations to give rise to a multitude of PRC1 complexes (40). In the canonical PRC1, the CBX proteins have a chromodomain and are said to play a role in recruitment of the

PRC1 complex as it recognizes and bind the H3 methylated at K27 by the PRC2 complex

(Figure 4B). However, recent reports show chromatin binding of PRC1 independent of the H3K27 methylation status of the targets (87,88). RYBP, a protein that binds to the

RING1A and YY1 (a sequence specific transcription factor), was also thought to be involved in recruitment of the PRC1 complex via YY1 binding (88). Genome wide localization studies also show binding of PRC1 at locations independent of YY1 (and

PRC2) suggesting that mechanisms mediating recruitment of these complexes are still not clearly understood and need to be probed further.

The RING1B, RING1A and BMI1 are proteins containing the RING domain and possess

E3 ubiquitin ligase. Of the three, RING1B is the major ubiquitin ligase for H2A and

BMI1 acts to stimulate the E3 activity of RING1B (89,90). This enzyme is essential during development and mice lacking RING1B arrest in gastrulation and are embryonic lethal (91). Inactivation of RING1B leads to a severe reduction in the global levels of ubH2A. However, ubH2A on the Xi chromosome is maintained in the absence of either

RING1B or RING1A but not in cells lacking both suggesting some overlap in function between RING1B and RING1A (92). RING1A is a less efficient H2A ubiquitin ligase and is not the main H2A ubiquitin ligase for the PRC1 complex. In agreement with this

20 observation, mice lacking RING1A are viable but show skeletal deformities (93).

Proteomic approaches have discovered various other complexes that contain some of the

PRC1 complex proteins. For instance, E2F6.com-1 complex that binds to and represses

MYC and E2F6 responsive genes during the G0 stage of the cell cycle contains several polycomb proteins including RING1A, RING1B, MBLR (PCGF6), h-l3mbtl protein and

YAF2 (42). The BCOR repressor complex was also shown to contain PRC1 proteins like the RING1A/B, RYBP and NSPC1 that localized to and repressed the BCL6 gene targets

(94). These complexes raise the possibility that the RING1 proteins could have other functions not associated with the PRC1 complex. A complete understanding of these

PRC1 family complexes and their functional interrelationships are key issues for ongoing investigation.

Although H2A is the major substrate of these RING proteins it is not the only ubiquitination substrate for the RING1 proteins. BMI1 and RING1A duo act together to ubiquitinate TOP2A when treated with a topoisomerase inhibitor etoposide that leads to proteasomal degradation of the substrate (95), indicating that the RING1A protein could have hitherto undiscovered ubiquitination targets other than H2A.

The combined action of PRC complexes leads to transcriptional repression through ubiquitination of histone H2A or by chromatin compaction independent of its ubiquitination activity (96-98). These processes can together or by themselves lead to transcriptional repression by blocking the movement of RNAPII through elongation, can recruit complexes that repress transcription or may inhibit recruitment of complexes required for transcription (43,99-101).

Trithorax proteins: The trithorax group of genes acts antagonistically to the polycomb proteins and positive regulators of the HOX and other target genes that are important in development. The Trx genes are involved in the maintenance of active chromatin, tumorigenesis, stem cell renewal and proliferation through their roles in methylating histones and chromatin remodeling. The Trx proteins are classified into three classes – the SET domain containing enzymes, ATP dependent remodeling proteins and other Trx proteins that are not included in the first two classes. Most Trx proteins, like the polycomb proteins, are part of multiprotein complexes. As described earlier, the SET domain containing proteins (SET1A, SET1B and the MLL proteins) are histone methyltransferases that methylate histone H3K4 each methylating the H3K4 at a different set of target genes. In flies, TrxG complexes bind to DNA elements called TrxG response elements (TREs). These elements often coincide with PcG response elements (PREs). In mammals, these TRE sequences have not been identified so far. It is suggested that in mammals, the MLL1 and 2 proteins may bind to the CpG rich sites mediated by the

CXXC domain (102). Alternatively, MLL complexes can also be recruited to the target sites by interaction with sequence specific transcription factors or with the PAF elongation complex (103,104). Noncoding RNAs and pre-existing histone marks such as

H3K4me2 may also play a role in recruiting these complexes (105,106). The main function of the Trx group of proteins in yeast and mammals is to promote transcriptional elongation via H3K4me3. The other functions of the TrxG proteins may be to carry out histone modifications like acetylation that antagonize and inhibit the repressive

H3K27me3 by the PcG proteins. Although TrxG complexes are known to mediate stable

22 epigenetic inheritance, they also regulate gene expression in dynamic processes, such as the cell cycle and also in checkpoint activation after DNA damage. Thus, their deregulation may contribute to human leukemia.

1.4 Epigenetic inheritance through cell cycle

As defined above, a modification on the chromatin or DNA is termed epigenetic when it causes a change in the gene expression without causing a change in the underlying DNA sequence and is heritable through several generations (at least one). As imagined, such chromatin modifications are challenged twice during a single cell cycle – once during

DNA replication and next during mitosis. During these stages, especially mitosis, it is thought that not just the epigenetic marks but also the dynamic histone marks and other transcriptional machinery are disengaged from their targets. The question that arises then is how daughter cells remember the transcriptional program through cell division.

Understanding the mechanistic details about how the epigenetic marks are retained through these stages is a robust current research topic.

Inheritance through replication: During DNA replication in the S phase of the cell cycle, the chromatin is disassociated ahead of the moving replication fork. This leads to a perturbation of the epigenetic histone and DNA marks. However, once the DNA replication is completed these marks are reestablished and passed on to the next generation. How the disassembled chromatin and the associated histone modifications and DNA methylation returns to its original state is beginning to be understood. DNA replication occurs in an asymmetric manner with one strand being continuously synthesized whereas the lagging strand is synthesized discontinuously. The proliferating 23 cell nuclear antigen (PCNA) accumulates at the migrating replication fork on both the strands ensuring that replication occurs on these strands is coupled tightly. In addition to its role in DNA synthesis, PCNA also links DNA synthesis and the inheritance of epigenetic marks by interacting with many chromatin assembly and chromatin modifying factors (107,108). In addition to PCNA, other factors are likely to contribute to the crosstalk between the inheritance of genetic and epigenetic information. The maintenance of DNA methylation at the replication forks is ensured by binding of DNMT1 enzyme which is recruited to these sites by the protein NP95 (UHRF1) in mammals (109,110) both of which are proteins that bind to both the replication fork machinery and hemimethylated DNA that arises after replication. These mechanisms, together, ensure the proper inheritance of the DNA methylation on the newly synthesized strands.

For them to qualify as epigenetic marks, the post translational marks on histones also need to be maintained by adding them to the newly synthesized nucleosomes. During fork progression, the existing nucleosomes are disrupted and hence need to be reassembled post replication on both the new daughter strands as well as the parental strands. Both new and old histones are used when assembling the nucleosomes. The distribution of the new and old histones between the nucleosomes could be either random

(each strand gets a mix of nucleosomes each either containing only new or only old histones), mixed (each nucleosome consists of a mix of old and new histones) or asymmetric (one strand gets the old histones with the parental modifications while the other gets the new histones). The modifications on the parental histones dictate the modifications on the new histones. Current models suggest that the distribution of the

24 histones occurs in a random fashion and the maintenance of histone marks is achieved by utilizing the neighboring histone as a template. In such a case, a ‘reader’ protein that recognizes the mark on the parental histone is recruited which in turn recruits a chromatin modifier on the nearby new histone causing its modification similar to the parent histone.

An example of such mechanism can be seen in the maintenance of the heterochromatin protein HP1 (111). A similar self-maintaining mechanism has also been shown to maintain the H3K27me3 marks post replication in which the PRC2 complex binds to the existing methylation sites and propagates the signal to the nearby unmethylated histones

(112).

B) Inheritance through mitosis: Epigenetic information also needs to be retained through mitosis to transmit a phenotype specific gene expression memory to the next cell cycle. This inheritance can include faithful transmission of the centromeric chromatin,

RNAi based silencing and also of the lineage specific transcription factor occupancy or the transcriptional program of that particular cell type.

Centromere, the chromatin region where the mitotic spindle attaches during cell division, is a good example of epigenetic inheritance through mitosis. Centromeric chromatin is specified by presence of a specific type of histone H3 variant CENP-A. Replication of the centromeric DNA during S-phase dilutes the CENP-A levels. Newly synthesized CENP-

A is then deposited at the centromere during late mitotic stages with the help of specific deposition factors (113). HP1, the heterochromatin binding protein, is an important component of the centromere that recognizes and binds the H3K9me1 mark. The binding of HP1is destabilized by the phosphorylation of histone H3S10 during mitosis but the

25 methylation of H3K9 is maintained during this stage. This helps HP1 binding to be restored during G1.

During mitosis, when the chromatin is condensed, much of the transcriptional factors and other associated machinery is displaced from the chromatin and dispersed into the cytoplasm (114). This provides a window of opportunity for the cells to undergo major reprogramming of their transcriptional states. However, in most cases, the transcriptional states are maintained post this dramatic structural change in mitosis. Research done in the last couple of decades has shed light on several mechanisms that may be involved in regulating transcriptional memory through mitosis. These involve retention of histone marks, nuclease accessibility and of several transcription factors at a subset of their target genes during this stage. This process of transcriptional memory by marking these genes during mitosis is referred to as “mitotic bookmarking”. It is possible that one gene may be marked by a single mechanism while some may be marked by all of these mechanisms.

Histone modifications and DNA methylation persist through mitosis: Some histone modifications such as acetylation of H3 and its methylation at lysine 4 (H3K4me3) and lysine 79 (H3K79) are maintained at several genes during mitosis (115,116). As described above, H3K9me involved in the regulation of heterochromatin, is also maintained on the mitotic chromosomes. Histone variants have also been shown to be involved in this process. For example, histone H3.3 is said to mark the promoters of transcriptionally active genes during mammalian cell division (117,118).

Several transcription factors remain bound to their targets during mitosis: Recent evidence suggests that not all the transcription factors are displaced from the mitotic chromatin but a part of them are retained at a subset of their promoters during mitosis

(Figure 5). For example, FOXI1, MLL1, RUNX2, GATA1, BRD4, FOXA1 are all shown to remain bound to a subset of their target promoters in a cell type specific manner during mitosis (119-123). These target promoters could be part of their existing binding sites in interphase or could be novel mitosis specific sites that are bound by these factors specifically during mitosis but not during interphase. Some of these factors (for e.g.

MLL1, FOXA1 and BRD4 but not GATA1) bookmark specifically those genes that are highly transcribed during interphase. This suggests that the binding of these factors possibly facilitates their transcription during G1. In support of this, it was recently shown that gene bookmarking accelerates the kinetics of post-mitotic transcriptional reactivation (124). Apart from sequence specific transcription factors, other proteins from the general transcriptional machinery such as TFIID and TFIIIC are also involved in bookmarking. TFIID plays a role in bookmarking by recruiting the phosphatase PP2A at its binding sites which in turn leads to evacuation of condensin protein from there. This is suggested to lead to a less condensed status of the chromatin at the TFIID bookmarked genes thus facilitating faster binding of the transcriptional machinery during G1

(125,126). BRD4 recruits the P-TEFB kinase during late mitosis (telophase) to its target genes thus helping the initiation of transcription at these sites during G1. Several other transcription factors have been shown to associate with mitotic chromosomes but the function of this binding has not been elucidated well (127). As an example, polycomb

27 proteins BMI1 and RING1 bind to the mitotic chromosomes albeit in much smaller quantities as compared to the interphase (128). However, the functions of this binding are not yet clear.

Figure 5: Mitotic retention of transcription factors and histone marks

Inheritance of transcriptional states by structural changes in chromatin: Although mitotic chromatin is highly condensed, studies show that hypersensitivity of specific sites to nucleases and chemical probes persist through mitosis. For example, DNAse I hypersensitive sites remain in the promoter region of hsp70 in mitotic chromatin (114).

This region of the hsp70 gene contains DNA sequences that are important for stress inducible transcription. Another study has shown that perturbations caused by KMnO4 persisted in the promoter regions of genes such as c-Myc that needed to be reactivated 28 immediately after exiting mitosis (129). These results suggest a more structurally open configuration of these promoters of highly transcribed genes during mitosis. As described above in case of TFIID binding, although mechanisms of some of these have been explained, the mechanistic details of bookmarking by most transcription factors still remains to be elucidated.

Although encouraging, these are by no means a comprehensive list of modifications and factors that play a role in mitotic bookmarking and novel factors involved in this process are continuously identified. Our work recently identified ubiquitination at the promoter chromatin of a subset of genes that are highly transcribed during interphase to be labeled by this mark during mitosis (31). The dynamics of ubiquitination at these sites and the enzymes involved in this process are the focus of this dissertation work.

1.5 Cell cycle associated changes in ubiquitination

Variation in histone ubiquitination has been associated with cell cycle progression. Both ubH2A and ubH2B are present in S and G2 phase but are deubiquitinated at prophase and then re-ubiquitinated in anaphase (130). H2A deubiquitination by Ubp-M precedes phosphorylation of histone H3, chromosome condensation and progression into mitosis

(56). However, there are instances of ubiquitinated histones being present on the chromatin during mitosis. For example, ubH2A enriched at the inactive X chromosome persists through mitosis (131). Similarly, ubiquitinated histone H3 is present on elongating spermatids in rat testes (65).

Additional evidence for an important role of ubiquitination of chromatin during the cell cycle comes from the mouse G2 phase mutant cell line ts85, which has a temperature 29 sensitive mutation in the ubiquitin activating enzyme E1 (132,133). These cells when cultured at non-permissive temperatures are blocked in G2 and have reduced ubH2A levels (133,134). Deubiquitination of histones H2A and H2B by USP3 is required for progression through the S phase and for genomic stability (57). Although it is evident that changes in histone ubiquitination are crucial for cell cycle progression, how the global distribution of these ubiquitin marks at genomic loci changes during cell cycle progression has not been studied.

Chapter 2: Rationale

Ubiquitination of chromatin associated proteins, mainly histones, is known to regulate multiple processes and plays a role in almost all chromatin associated functions. Given that the chromatin undergoes a lot of changes as the cells progress through the cell cycle, changes in the associated process and the dynamics of ubiquitination is also expected.

Some study has been done in understanding ubiquitination changes through the cell cycle. The enzyme Ubp-M is deubiquitinates histone H2A before the onset of mitosis.

Evidence for an important role of ubiquitination of chromatin during the cell cycle comes from the observation that this deubiquitination is a prerequisite for chromosomal condensation. Additional support for importance of cell cycle regulation of chromatin ubiquitination comes from the mouse G2 phase mutant cell line ts85, which has a temperature sensitive mutation in the ubiquitin activating enzyme E1 (132,133). These cells when cultured at non-permissive temperatures are blocked in G2 and have reduced ubH2A levels (133,134). Deubiquitination of histones H2A and H2B by USP3 is required for progression through the S phase and for genomic stability (57). Although it is evident that changes in histone ubiquitination are crucial for cell cycle progression, how the

31 global distribution of these ubiquitin marks at genomic loci changes during cell cycle progression has not been studied.

In this study we analyzed the ubiquitination status of the chromatin associated proteins change during the different stages of the cell cycle. We used an unbiased approach to detect ubiquitination of all the chromatin proteins by chromatin affinity purification

(ChAP) specific to the ubiquitin protein and not to any specific ubiquitinated substrate.

This method was used to detect the changes in ubiquitination of all the chromatin proteins regardless of the type of substrate or function of the modification. This helped us uncover a novel phenomenon associated with the chromatin that may have been undetected had we used the conventional ChIP approach by using an antibody to a specific ubiquitinated substrate as has been done before.

Chapter 3: Ubiquitination of chromatin associated proteins

changes through the cell cycle

Arora M, Zhang J, Heine G, Liu HW, Ozer G, Huang K, Parvin JD. (2012) Promoters Active in Interphase are Bookmarked during Mitosis by Ubiquitination. Nucleic Acids Res. 40(20):10187-202. (Featured Article)

Author contributions:

• Arora, M & Parvin JD designed the experiments.

• Zhang J, Ozer G and Huang K performed bioinformatics analysis for the high

throughput data

• Liu HW contributed to discussions about data interpretation

• Heine G provided preliminary data

3.1 ABSTRACT

We analyzed modification of chromatin by ubiquitination in human cells and whether this mark changes through the cell cycle. HeLa cells were synchronized at different stages, and regions of the genome with ubiquitinated chromatin were identified by affinity purification coupled with next generation sequencing. Mapping of the ubiquitin mark on the chromatin at points in the cell cycle indicated that during interphase, ubiquitin marked the chromatin on the transcribed regions of about 70% of highly active genes and deposition of this mark was sensitive to transcriptional inhibition. Promoters of nearly half of the active genes had a low but positive level of ubiquitination during interphase.

Interestingly, the level of this modification at promoters increased markedly during mitosis. The ubiquitination at the coding regions in interphase but not at promoters during mitosis was enriched for ubH2B and dependent on the presence of RNF20. Ubiquitin labeling of both, promoters during mitosis and transcribed regions during interphase, correlated with active histone marks H3K4me3 and H3K36me3 but not a repressive histone modification, H3K27me3. The high level of ubiquitination at the promoter chromatin during mitosis was transient and was removed within 2h after the cells exited mitosis and entered the next cell cycle. These results reveal that the ubiquitination of promoter chromatin during mitosis is a bookmark identifying active genes during chromosomal condensation in mitosis, and we suggest that this process facilitates transcriptional reactivation post mitosis.

3.2 BACKGROUND

During the eukaryotic cell cycle, the chromosomes undergo large structural changes, including reversible post-translational modifications of the histone proteins and other chromatin-associated proteins. One of the major posttranslational modifications of histones is ubiquitination, primarily on H2A and H2B, although ubiquitinated H3 and H1 have also been reported in different cellular processes (65-67). Apart from the core histones, ubiquitination of some histone variants has also been reported (69,70).

Monoubiquitinated H2B (ubH2BK120) is associated with transcribed regions of active genes where it is ubiquitinated by the E3 ubiquitin ligase RNF20 associated with the PAF complex (23,30,32,135). Unlike ubH2B, monoubiquitinated H2A (ubH2A) is associated with transcriptionally repressed regions of the genome. UbH2A has been shown to be concentrated on the inactive X chromosome and other heterochromatic regions (46,92).

UbH2A is deposited on the chromatin of silenced genes by the action of the polycomb group repressive complex (PRC-1) containing the Ring finger protein Ring 1b (90).

However, there are some known instances of ubH2A being associated with transcriptionally active genes, for example, ubH2A is present at the 5' end of the actively transcribed mouse dihydrofolate reductase gene and also associated with the poised genes, hsp70 and copia (136,137). Given the role of ubiquitinated histones in gene regulation, several ubiquitin specific proteases that catalyze removal of ubiquitin moiety from these histones also regulate gene expression as both stimulators and repressors

(138).

Additional evidence for an important role of ubiquitination of chromatin during the cell cycle comes from the mouse G2 phase mutant cell line ts85, which has a temperature sensitive mutation in the ubiquitin activating enzyme E1 (132,133). These cells when cultured at non-permissive temperatures are blocked in G2 and have reduced ubH2A levels (133,134). Deubiquitination of histones H2A and H2B by USP3 is required for progression through the S phase and for genomic stability (57). Although it is evident that changes in histone ubiquitination are crucial for cell cycle progression, how the global distribution of these ubiquitin marks at genomic loci changes during cell cycle progression has not been studied.

In this work, we studied the global pattern of ubiquitin conjugates on human chromatin and how it changes with the progression of cell cycle. We find that during interphase, ubiquitination marks the transcribed regions of the genome. We had anticipated that ubiquitin would be removed from chromatin during mitosis, but contrary to our

36 expectation, we found that at the promoters of active genes chromatin ubiquitination levels actually increase.

3.3 MATERIALS AND METHODS

Cell culture, cell cycle synchronization, transfection and reagents

HeLa cells were grown in DMEM supplemented with 10% BS, glutamax, penicillin/streptomycin and sodium pyruvate (Invitrogen). HeLa cells expressing the

HBT tagged Ubiquitin (HeLa-Ub) (139) were grown in DMEM containing biotin (0.5

µM, Sigma Aldrich) and puromycin (1.5 ug/ml, Invitrogen). Cells were either arrested by a thymidine-nocodazole block or released for 0 (mitosis), 4 or 7 (G1) hours or with a double thymidine block and released for 0, 2, 4, 6, 8, 10 or 12h. For transcription inhibition, HeLa-Ub cells were treated with flavopiridol (1µM) or α-amanitin (50µg/ml) for 3 and 5 hours respectively before crosslinking for ChAP. For western blots, antibodies used in this study were anti-Ubiquitin (140), Streptavidin-HRP (GE healthcare), anti-Rabbit IgG (GE healthcare), anti-phospho H3 (Ser28) (Millipore -07-

145), alexafluor647 tagged anti-Rabbit (Invitrogen - A21244), anti-RNF20 (Novus

Biologicals - NB100-2242), anti-Lamin-B (Abcam - ab16048), anti-ubH2B (cell signaling technology) and anti-TFIIH p89 subunit (141).

HeLa cells were transfected twice with 100 picomoles of siRNA against RNF20 (sense strand: 5' - AAGAAG GCA GCU GUU GAA GAU - 3') or to luciferase (GL2) using

Oligofectamine (Invitrogen) using manufacturer's protocol at 48hr interval. Cells were

37 blocked using thymidine or nocodazole 24 h after the second round of transfection and collected for chromatin affinity purification the next day.

Chromatin Fractionation

Chromatin fractionation was done as previously described (142). Briefly, nuclei were prepared by lysing HeLa cells in buffer containing 0.3% NP-40. Nuclei were collected by centrifugation at 2000g for 5 min and were then lysed in PIPES buffer containing EDTA and protease inhibitors. The chromatin fraction was pelleted by centrifugation at 6000g for 20 min at 4ºC. The chromatin fraction was washed with PIPES buffer three times before adding SDS loading buffer to the samples For Figure 6D, chromatin was prepared as described below for chromatin affinity purification using uncrosslinked HeLa cells.

FACS analysis

FACS analysis was done on at least 10,000 cells stained with propidium iodide from each stage of the cell cycle using a BD FACScalibur machine in the OSUCCC Analytic

Cytometry shared resource. Data was analyzed using the FlowJo software. For phospho-

H3 and propidium iodide stained cells, cells were first incubated with anti-phospho-H3 for 2h, then with Alexaflour 687 labeled goat anti-rabbit for 1 h and last with propidium iodide.

Chromatin Affinity Purification and Immuno Precipitation

Chromatin affinity purification (ChAP) samples for sequencing by Illumina GA II were prepared as follows. Chromatin affinity purification was based on a standard ChIP method (143) with modification of a two-step affinity purification. HeLa-Ub cells were 38 cross-linked with 1% formaldehyde (Sigma) and the reaction stopped by adding 1/20 volume of 2.5 M glycine. The cross-linked material was then washed with PBS, lysed as for the ChIP protocol and sonicated to an average DNA fragment size of 200 bp. All buffers were freshly supplemented with 10 mM N-Ethylmaleimide (Sigma), 1 mM PMSF

(Sigma), 1X Protease inhibitor cocktail (Sigma). The sheared chromatin was incubated with 375 µl Ni-NTA beads (Qiagen) for 16h at 4°C.An aliquot of the input DNA was saved prior to immunoprecipitation as reference sample. After washing in 6 ml of wash buffer I (50 mM Tris pH 8; 0.01% SDS; 1.1% Triton X-100; 150 mM NaCl), chromatin fragments were eluted in 3 cycles of 2 ml elution buffer I (50 mM Tris pH 8; 0.01% SDS;

1.1% Triton X-100; 150 mM NaCl; 300 mM Imidazole). The nickel eluate was incubated with 375 µl of avidin beads (Thermo Scientific) for 6h at 4°C. After washing in 1 ml of wash buffer II (50 mM Tris pH 8; 1% SDS; 1.1% Triton X-100; 1M NaCl) followed by two washes in low salt buffer (50 mM Tris pH 8; 1% SDS; 1.1% Triton X-100; 0.5 M

NaCl), then two washes with 1 ml TE buffer (100 mM Tris pH 8; 10 mM EDTA; 50 mM

NaCl). Crosslinks were reversed by adding 2 ml of elution buffer (50 mM Tris pH 8; 10 mM EDTA; 1% SDS; 200 mM NaCl) to the beads and incubating at 65°C for 15h. The supernatant was collected and diluted 1:2 with TE buffer. The eluate was treated with

RNase (0.2 mg/ml final concentration; Sigma) for 2h at 37°C, followed by adding

Proteinase K (0.2 µg/ml final concentration; Sigma) for 2h at 55°C, and DNA was extracted in phenol/chloroform/isomyl alcohol, and the DNA was precipitated in 200 mM

NaCl (final concentration), 30 µg of glycogen (Ambion), 2x of the volume of ice cold

100% ethanol and incubation at -20°C for 1h followed by centrifugation. The pellet was

39 washed in 500 µl of 70% ethanol, then the DNA was finally recovered, and its concentration was quantified by Picogreen assay (Invitrogen).

For chromatin immunoprecipitation (ChIP), chromatin was prepared as above for chromatin affinity purification. The chromatin was pre-cleared using protein-A sepharose beads for 1 hr, then applied to protein-A beads that were incubated with either 10 µl of anti-ubH2B or Rabbit-IgG (mock). Protein-A bound immune complexes were washed once with IP wash buffer 1 (20mM Tris pH 8, 2mM EDTA, 50mM NaCl, 1% Triton X-

100, 0.01% SDS), twice with IP high salt wash buffer (20mM Tris pH 8, 2mM EDTA,

500mM NaCl, 1% Triton X-100, 0.01% SDS), once with IP wash buffer 2 (10mM Tris pH 8, 1mM EDTA, 250mM LiCl, 1% NP-40 and 1% deoxycholic acid) and twice with

TE buffer (100 mM Tris pH 8; 10 mM EDTA; 50 mM NaCl). Immune complexes were eluted from protein-A beads by incubating at 65ºC for 30 min with rotation. Cross-link reversal and downstream steps were carried out as described above for ChAP. Re-ChIP was done by first performing affinity purification of ubiquitinated chromatin using avidin beads as described above. After washing, the bound ubiquitinated substrates from the avidin beads were eluted by cleavage using TEV protease. Eluted chromatin was diluted with Lysis buffer III and was then used for ChIP using anti-ubH2B, anti-H2B or rabbit

IgG antibody.

ChAP DNA preparation for Illumina GAII Sequencing

ChAP DNA samples were then prepared for ChIP-sequencing library construction following the Illumina ChIP-Seq Sample Prep protocol. Briefly, the DNA samples were blunt-ended by using End-it DNA End-Repair Kit (Epicentre) according to the 40 manufacturer's instructions. dA overhangs were then added and Illumina adapters ligated.

Adapter-ligated DNA was subject to 15 cycles of PCR before size selection of 200-300 bp by agarose gel electrophoresis. Amplified DNA was recovered using the MinElute

PCR purification kit (Qiagen). The purified DNA was quantified with an Agilent

Bioanalyzer and diluted to a working concentration of 10 nM prior to sequencing.

Sequencing on an Illumina GAII instrument was carried out at the Nucleic Acid Shared

Resource of The Ohio State University Comprehensive Cancer Center. Primary analysis of ChAP-Seq datasets: the image analysis and base calling were performed using

Illumina Genome Analysis pipeline. The sequencing reads were aligned to the human genome UCSC build hg18. Only uniquely aligned reads were used for further analysis and multiple reads were eliminated to reduce PCR-generated artifacts. The aligned reads were further used for peak finding algorithm.

Data analysis

Ingenuity Pathway Analysis: Ingenuity Pathway Analysis was done using standard methods. A gene list containing the top 1000 genes that were ubiquitinated in mitosis were analyzed.

ChAP-Seq peak finding: FindPeaks 4.0.10 was used to generate peaks for all the ChAP-

Seq and ChIP-Seq data with options of subpeaks 0.5, trim 0.2. A minimum height threshold for each dataset was established so that FDR is less than 0.1% based on the

Monte-Carlo simulation of that dataset.

Principle Component Analysis of ChAP-Seq datasets: For each sample, chr1 tag counts histogram (without the centromeric region to avoid biased due to the high tag 41 counts) was used for PCA analysis using Matlab, with a bin-size 1kb. The first three principle components were plotted in Matlab program.

Histogram of genome-wide tag counts: Raw tags were counted in a 1kb bin-size for every chromosome for each sample using a Matlab code.

Sorting peaks into different annotated regions: RefSeq database was used to obtain promoter (5kb upstream of a TSS), exon, intron, and transcribed region DNA sequences.

Gene desert (Intergenic gaps larger than 1Mb) data were obtained from a published report

(144). CpG island region co-ordinates were obtained from UCSC genome browser website. The small intergenic region (<1 Mb) refers to the genome region that excludes all above annotations. A peak was sorted to a specific region if there is at least 1bp overlap with that region. A peak can be sorted into different annotated region if there are overlaps between the two regions. Active and inactive promoters were classified based on

GEO database asynchronous HeLa cell gene expression microarray dataset GDS885.

Gene expression was grouped based on their expression levels, and high activity promoters were defined from the top 20 percentile gene groups, while low activity promoters were defined from the bottom 20 percentile groups. Each contains about 2400 genes.

Extended TSS region tag density profiling: The RefSeq database was used to obtain start and end coordinates of 10kb up and downstream of TSS for each gene that is included in the GDS885 dataset. The extended TSS regions of 12013 genes were used.

Raw tags were extended according to the average length of each ChAP sample. A Matlab code was used to compute the average tag density of 5bp bin along the extended TSS

42 region. To generate the average TSS tag density profile, the tag density data from three biological replicates of the same cell stage sample were first normalized by their respective total tag counts then averaged. In the TSS heatmap, each row corresponds to an extended TSS region of a gene, which is 10kb up and downstream of a TSS. The normalized and averaged densities (from the three replicates) were used. In the sorted

TSS heatmap, the rows(genes) were arranged according to either to the asynchronized

HeLa cell microarray dataset GDS885 or the synchronized HeLa cell microarray dataset

(GSE26922) gene expression level from low to high of S12 stage (equivalent of G1 stage) (145,146). For the former, 12013 probes of GDS885 were used; for the latter, the

11660 overlapping genes between GDS885 and GSE26922 were used.

Ubiquitin ChAP-Seq and histone methylation data comparison: Publicly available

HeLa cell ChIP-Seq datasets, including H3K4me3 (GSM566169), H3K36me3

(GSM766169), and H3K27me3 (GSM566170) were downloaded from the GEO database. For all ChIP-Seq datasets, the raw reads were extended to 200bp. Peaks were generated using FindPeaks 4.0.10 with subpeaks option on. RefSeq gene promoter (5kb upstream of a TSS) and transcribed region were used to search for peaks that have at least

90% of its range overlapping with specific annotated regions of a specific gene. Genes with ChAP-seq/ChiP-seq peaks overlapping a specific annotated region of that gene were obtained using BEDTools (147) from each datasets, and the gene lists from different datasets were crosschecked to generate Venn diagram. qPCR analysis: For qPCR analysis, ChAP or ChIP chromatin was prepared as described above. For ChAP, affinity purification was performed using only avidin beads to purify

43 the ubiquitinated chromatin instead of sequential purification on nickel and avidin beads.

Input sample was saved before purification and was treated similar to the affinity purified

DNA. Affinity purified DNA or immunoprecipitated DNA and input DNA were used as a template for qPCR.

3.4 RESULTS

3.4.1 Conjugation of ubiquitin to chromatin changes during the cell cycle:

In this study, we hypothesized that the ubiquitination of chromatin components was dynamic through the cell cycle. From published results (30,135), we anticipated finding the chromatin on the transcribed portion of active genes to be transiently ubiquitinated.

We were particularly interested in comparing late S phase chromatin when the heterochromatin of the newly replicated DNA would be established. To our surprise and as will be discussed below, we found ubiquitin to be dynamically associated with the chromatin on regulatory portions of active genes.

Continued

Figure 6: Ubiquitin fusion protein forms high molecular weight conjugates similar to the endogenous ubiquitin. A) Schematic diagram of the expressed tagged ubiquitin protein with the hexahistidine peptide, the biotinylation domain, and the cleavage site for the TEV protease at its amino terminus. B) Immunoblot showing ubiquitinated proteins in whole cell lysates from HeLa (lane 1) and HeLa-Ub (lane 2) cells. The recombinant ubiquitin protein in the HeLa-Ub cells is indicated by a black arrowhead. C) Immunoblot analysis of ubiquitinated substrates in chromatin fractions from HeLa (lanes 1, 3, and 3*) and HeLa-Ub cells (lanes 2, 4, and 4*). Lanes 1 and 2 show ubiquitin conjugates on the chromatin using an ubiquitin-specific antibody. Lanes 3 and 4 show biotinylated conjugates using 45

Figure 6 continued streptavidin linked with HRP. Lanes 3* and 4* are a longer exposure of the samples in lanes 3 and 4 to show higher molecular weight substrates. Red arrows indicate migration of mono-ubiquitinated H2A/H2B in HeLa cells at ~23KD and in HeLa-Ub cells at ~37KD. D) Immunoblot analysis of input (chromatin) and streptavidin affinity purified chromatin samples from HeLa and HeLa-Ub cells using antibodies indicated on the left side of the blots. Chromatin was prepared as for the ChAP-Seq samples with the exception that non crosslinked cells were used. Input lanes show 2% of the total chromatin sample used for affinity purification. The identity of bands when known is indicated on the right side of the blots with black arrows. * indicates non-specific bands. ** indicates a band detected with the H2A antibody in the affinity purified sample that has a migration consistent with monoubiquitinated H2A.

We established, using a published vector (139), a HeLa derived cell line that expresses the ubiquitin fusion protein with an amino-terminal tag encoding hexahistidine and a biotin bound peptide (referred to as HeLa-Ub) (Figure 6A). This 19 kD fusion protein is expressed at levels similar to the endogenous 8 kD ubiquitin as detected as monomeric proteins in crude whole cell extracts (Figure 6B). We detected minor changes in the overall pattern of ubiquitination in the HeLa-Ub cells presumably due to the increased mass of the tagged ubiquitin molecule (Figure 6B). To determine if this tagged ubiquitin can be conjugated to chromatin substrates at efficiency similar to the endogenous ubiquitin protein, we fractionated chromatin from HeLa and HeLa-Ub cells and detected ubiquitinated substrates using anti-ubiquitin antibody and a streptavidin-HRP antibody that detects the biotinylated fusion protein. Immunoblot analysis shows that the tagged

(biotinylated) ubiquitin forms higher molecular weight conjugates similar to the endogenous protein on the chromatin (Figure 6C). In both cell lines, there is a prominent

46 ubiquitin containing band with migration consistent with a molecular mass of ~23kD, and in the HeLa-Ub cells a protein of ~35kD is detected via the biotin tag. This band migrates at a position consistent with monoubiquitinated H2A or H2B, and in the HeLa-

Ub cells the corresponding protein with the fusion tag would be predicted to migrate at this molecular mass (see below and Figure 6D). There is a biotinylated protein band in

HeLa cell chromatin with an estimated mass of 12-15 kD (Figure 6C, lane 3). This may be an endogenously biotinylated protein which is likely to be removed from the affinity- purified ubiquitin containing samples by the metal ion affinity purification step

(described below). Direct biotinylation of histones or any other proteins can only contribute minor background to the subsequent results since similar analysis using untagged HeLa cell chromatin revealed only background level signal.(Figure 9A, top tracing). We fractionated chromatin from HeLa and HeLa-Ub cells and affinity purified biotinylated chromatin proteins by streptavidin beads. Immunoblot analysis using an anti- ubiquitin antibody showed the presence of high molecular weight ubiquitinated proteins that were purified by this approach (Figure 6D, bottom panel). We also detected monoubiquitinated H2B (at ~35kD) that was modified using the tagged ubiquitin (HB- ubH2B) in the streptavidin purified chromatin from the HeLa-Ub cells but not from HeLa cells (lanes 3 and 4, Figure 6D, top panel). The tagged ubiquitin molecule was a substrate for some ubiquitin ligases but not others. We were unable to detect ubiquitinated H2A in the affinity purified chromatin sample using an ubH2A specific antibody that recognizes

H2A ubiquitinated at lysine 119. Another study has reported detection of ubH2A using the same HB-tagged ubiquitin fusion protein by mass spectrometry analysis (148), but

47 this tagged ubH2A had low abundance in our samples. Thus, the tagged ubiquitin could be ligated to H2B, but not to H2A, suggesting that this reagent is not suitable for scoring silencing by the Polycomb complex, but it is useful for other chromatin modifiers. As another test of the tagged ubiquitin we asked if RNA Polymerase II is polyubiquitinated

(149,150) by the tagged ubiquitin molecule and we found that the tagged ubiquitin was incorporated into the polyubiquitin chain on the largest subunit of RNAPII (Figure 7).

Figure 7: Detection of HBT-ubiquitinated large subunit of RNAPII Polyubiquitination of large subunit of RNAPII utilizing the HB tagged ubiquitin protein. Whole cell extract from HeLa and HeLa-Ub (Ub5) cells was affinity purified using streptavidin agarose beads. Lanes 1 and 2 represent the input (2% of total) from the indicated cell line and lanes 3 and 4 represent the affinity purified proteins. 8WG16 antibody (151) was used to detect the large subunit of RNAPII. Polyubiquitinated RNAPII was detected in the affinity purified sample from the HeLa-Ub cells expressing the HB tagged ubiquitin but not in the HeLa sample.

Figure 8: Synchronization of HeLa cells at different cell cycle stages.

A) Diagram representing the points in the cell cycle where HeLa cells used in this study were synchronized. B) FACS analysis evaluating cell cycle synchrony at the indicated stage. X axis represents the DNA content per cell as gauged by propidium iodide staining and Y axis represents the number of cells.

To identify ubiquitinated regions of the chromatin, we used metal ion affinity purification via the hexahistidine tag, followed by purification on avidin agarose via the biotin tag on the ubiquitin fusion molecule. In particular, the streptavidin-biotin affinity purification permitted us to apply stringent washes of the bound chromatin. This method is similar to the standard ChIP method, but since the purification steps did not use an antibody, we called the procedure Chromatin Affinity Purification (ChAP). Following this sequential affinity purification, the bound DNA was sequenced on the Illumina Genome Analyzer

II. To determine cell cycle specific ubiquitinated regions of the genome, ChAP-Seq was performed using HeLa-Ub cells synchronized at several distinct cell cycle stages by a 49 double thymidine or thymidine-nocodazole block and release strategy (see methods for details; Figure 8). As a control to determine non-specific background, affinity purified

DNA from asynchronously growing HeLa cells that did not express the tagged ubiquitin

(untagged HeLa control) was sequenced similarly as the above samples. Sequencing of the affinity purified DNA from the synchronized cells resulted in 10-30 million unique reads that were mapped to the human genome.

Mapping of the ubiquitin mark on interphase chromatin indicated that it was distributed unevenly through the length of the chromosome with ubiquitination being more enriched in some regions as compared to the others. As an example, the distribution of ubiquitin on chromosome 3 at the indicated cell cycle stages is shown in Figure 9A. A very low background signal was obtained using control HeLa cells not expressing the tagged protein, indicating the specificity of the affinity purification method (brown tracing in

Figure 9A). Comparison of ubiquitination in the different interphase samples showed that at a chromosomal scale, no evident large scale changes occurred in ubiquitination through these points in the cell cycle. In contrast to the interphase samples, distribution of ubiquitin changed considerably on the mitotic chromatin indicating a global redistribution of this post translational mark during cell division (orange tracing in Figure 9A).

To determine if these ubiquitination patterns on the genome were reproducible, ChAP-

Seq for each cell cycle stage was performed in triplicate. The percentage of peak overlaps ranged from 60-85% when comparing all of the peaks in the G1 samples, the mid-S samples (S2), and the M phase samples (Supplementary Table 2). We did observe a somewhat lower level of overlap in the peaks of genome locations with ubiquitination

50 during the beginning of S phase (S0) and late S phase (S4). As will be discussed below, we observed some unanticipated features in the samples derived from cells in mitosis.

Data obtained from all the replicates were also compared for consistency using principal component analysis (PCA). For this analysis, the sequencing data from each replicate was plotted on a 3D graph with each point representing a single ChAP-Seq sample and each color representing a particular cell cycle stage (Figure 9B). As seen from the graph, biological repeats of the same point in the cell cycle plotted closer to each other than to the other stages suggesting that there are real differences in chromatin ubiquitination as cells traverse the cell cycle. Of note, the mitotic samples were distinct from the interphase samples supporting the observation that the ubiquitination pattern on interphase chromatin is very different from the pattern in the mitotic samples.

Figure 9: Distribution of the ubiquitin mark on chromatin through the cell cycle. A) Each track displays raw ChAP-Seq data for each cell cycle stage (G1-blue, S0- green, S2- red, S4- purple, M- orange) across the length of chromosome 3. The ‘untagged’ track (brown, top) shows the background signal obtained by nickel and avidin affinity purification of chromatin using the HeLa cells that do not express the fusion protein. B) Principal component analysis (PCA) of the ChAP-Seq data reveals differences among stages of the cell cycle. PCA of each ChAP-Seq dataset is represented as a 3D graph. The three principal components are denoted by the three axes in the graph. Each sample is denoted by a point of a specific color based on its cell cycle stage (as specified in panel A).

Figure 10: Distribution of ubiquitination in the genome. A) Enrichment of ubiquitination peaks in the specified region of the genome is shown as fold enrichment on a log2 scale relative to the frequency of that element in the human genome. Each color histogram represents data from a specific cell cycle stage (as in 2B above). Peak enrichment for a region was calculated as described in the Methods. Fold enrichment of peaks for each element was calculated from the ratio of percentage of peaks in that sample mapping to the element to the percentage of genome represented by that element and then converting it to log scale. Error bars denote standard error of mean (SEM) based on three biological replicates. Genomic element types are indicated on the x-axis. B) Percentage of peaks annotated in different genomic regions in each cell cycle stage is shown using different colors. Black bars represent the percentage of the genome represented by the specified region. Error bars indicate standard error of mean for an average of three biological replicates. C) Peak distribution between exon 1 and other exons in G1 (blue) and mitotic (orange) cells. Y axis denotes percentage of the total number of peaks on the indicated genomic element (on the X axis). G1 and mitotic cells have equal percentage of total peaks in exon 1 but mitotic cells have considerably lower number of peaks in exons downstream as compared to the G1 cells.

3.4.2 Ubiquitination mark redistributes in the genome during mitosis:

Visualizing ubiquitination on the chromosomal scale suggested that ubiquitin mapped unevenly across the genome, being more enriched in certain regions of the genome than the others. To identify regions of the genome that were preferentially marked by this modification, sequence data obtained from ChAP-Seq were translated into peaks of ubiquitin enriched genomic regions using a peak calling software, FindPeaks. For each sample, the number of peaks mapping to a specific type of genomic element was calculated and expressed as percentage of total peaks in that sample (Figure 10B). To determine if there is an enrichment of ubiquitination on a particular type of element, the percentages of peaks in each region were expressed as fold change over the percentages of genome represented by that region (Figure 10A). We found that the majority of ubiquitination in interphase was mapped to the gene and gene regulatory regions of the genome. During mitosis ubiquitination in the introns was sharply reduced while inactive regions like gene deserts (gaps >1Mb) were modestly enriched for this modification.

Surprisingly, we did not see a reduction in the number of peaks mapped to CpG islands, promoters, or exons during this stage. Further classification of the ubiquitination signal mapping to exon 1 and all other exons showed that while the number of peaks mapping to exon 1 during mitosis is similar to that during G1, this number is considerably reduced in all other exons (Figure 10C) suggesting that during mitosis some ubiquitination is observed just downstream of the TSS, near the promoters. This observation is consistent with the profiling of ubiquitination around the TSS in mitosis in Figure 11 A.

Continued Figure 11: Distribution of ubiquitination around the transcription start sites (TSS). A) Normalized ubiquitin tag density on a 20 kb region across the transcription start site (TSS, bent arrow) for highly active, medium and silent genes for the indicated cell cycle stage. Genes were classified in groups based on their mRNA abundance as obtained from HeLa microarray data: highest abundance (red, 90-100 percentiles), medium high abundance (blue, 80-90 percentiles), medium (pink, 50-60 percentiles), low (green, 10-20 percentiles) and very low (black, 0-10 percentiles). Each curve represents the average ubiquitin tag density around the TSS of 1200 genes from three biological replicates.

Figure 11 continued B) Heatmaps of ubiquitin tag density around the TSS for 12,013 genes. The TSS for all genes is at the center column of the heatmap and genes are arranged in rows based on their mRNA abundance level from lowest (top) to highest (bottom). The normalized tag density of ubiquitin along the length of the gene (x-axis) is indicated in black. C) Percentage of promoters/transcribed regions of highly active (90-100 percentiles) or low activity genes (0-10 percentiles) marked by ubiquitination during mitosis (M) or G1.

3.4.3 Ubiquitination is enriched at active genes throughout the cell cycle:

Stable promoter ubiquitination during mitosis led us to probe the distribution of ubiquitination around this region. To gain further insight into the relationship between ubiquitination and transcription levels of genes, we compared the expression levels of ubiquitination target genes in interphase and mitosis using publically available gene expression data from HeLa cells. Genes were classified into deciles based on their expression level (mRNA abundance) and for each group of genes average ubiquitination intensity was calculated in a 20kb region (10kb on each side) flanking the transcription start site (TSS indicated by the bent arrow; Figure 11A) (70). The most active genes (90-

100%) were represented by the red tracing; the second decile of active genes (80-90%) was represented by the blue tracing, and down to inactive genes (0-10%) in black. The results from the three biological replicates were averaged and normalized to the other samples (see Methods), and the relative sequence tag density of ubiquitinated chromatin is on the y-axis of the tracings.

During interphase, ubiquitination marked the transcribed region of genes and this mark showed a strong direct correlation with the level of gene expression. This signal possibly

56 represents the histone H2B ubiquitinated at lysing 120 (ubH2BK120) as ubiquitination of this histone has been previously linked to transcribed regions of active genes (30) although presence of other ubiquitinated substrates, such as ubiquitinated large subunit of

RNA polymerase II, cannot be ruled out. A smaller ubiquitination signal was observed in the promoter regions, which also correlated with the expression level. These patterns of ubiquitination around the TSS were maintained in G1 and through S phase. During mitosis, ubiquitination associated with the transcribed region was dramatically reduced downstream of the TSS. Surprisingly, contrary to the ubiquitination levels in the transcribed region, the average ubiquitination levels of chromatin at promoters increased during mitosis. This ubiquitination level also correlated well to the mRNA levels as seen during interphase – genes that are active during interphase have ubiquitination over their promoter during mitosis (Figure 11A, upper left). This observation was surprising since most epigenetic marks are erased, not increased, during mitosis (114). In most instances of reported promoter ubiquitination have been associated with silenced promoters

(34,89), but in this study, since the ubH2A was not abundantly labeled with the tagged ubiquitin, we detected examples of gene activation correlated with promoter ubiquitination. Consistent with our observation, there are reports of histone modifications associated with active genes that mark previously active promoters in mitosis (115,116).

The above analysis of the density of ubiquitin tags mapped relative to the TSS was based on averaging the gene promoters and on the transcriptional activity of each group. In order to evaluate each gene, rather than an average for a decile of genes, we generated a heat map of the raw ubiquitination signal at the TSS of 12,000 genes arranged from top to

57 bottom of the heat map according to the abundance of their mRNA with highest abundance genes in the lower part of the graph and the low abundance ones at the top of the heat map. The TSS of all genes is at the center column (Figure 11B). As seen from the traces for high mRNA abundance genes (lower half of the heat map), during interphase ubiquitination was mostly present downstream of the TSS (right half of the heat map). However, we did not observe this downstream ubiquitination for all the high expression genes but only 70% of the high expression genes (defined as the top two deciles in mRNA abundance) had ubiquitin mark associated with their transcribed regions (Figure 11B-11C). This indicates that not all, but rather a subset of actively transcribed genes have ubiquitinated chromatin over transcribed DNA. It remains a formal possibility that the ubiquitination on the transcribed regions of the remaining 30% of the genes may have been missed due to technical reasons. During mitosis, 41% of the promoters of the high expression genes were marked with ubiquitin while the signal from the transcribed regions was lost (Figure 11B and 11C, M). This observation was consistent with the reduction in total peaks in the transcribed region (introns) during mitosis (Figure 10).

Figure 12: Chromatin ubiquitination on the transcribed regions is reduced upon transcriptional inhibition. A) Normalized ubiquitin tag densities are shown as an average of two experiments from cells blocked in early S phase with (S0+amanitin; right) or without (S0; left) treatment with α-amanitin. Different color tracings show ubiquitination levels in different groups of genes as described in Figure 11. B) Chromatin ubiquitination at select promoters and transcribed regions of high expression genes from cells treated with either flavopiridol or DMSO (control). Chromatin ubiquitination is reduced at both transcribed and promoters in flavopiridol treated cells as compared to control cells (*p<0.05).

3.4.4 Ubiquitination at transcribed regions is sensitive to transcriptional inhibition:

To test whether the loss of downstream ubiquitination during mitosis was associated with lack of transcription, we inhibited RNAPII dependent transcription using α-amanitin during S phase and analyzed the effect on chromatin ubiquitination by ChAP-Seq. We observed that treatment of S phase cells with α-amanitin resulted in a significant, though not complete, reduction in the ubiquitination at the transcribed regions for most high expression genes when compared to the untreated sample (Figure 12A). We also observed a reduction in the promoter ubiquitination during S phase after treatment with

α-amanitin. We also tested by ChAP-qPCR the effect of flavopirodol, a CDK inhibitor, on chromatin ubiquitination. Consistent with the results obtained using α-amanitin, treatment of asynchronously growing cells with flavopiridol resulted in reduction of ubiquitination at both promoters and transcribed region (Figure 12B).

3.4.5 RNF20 is required for ubiquitination of H2B associated with active transcription:

The PAF complex associated with transcription elongation is known to carry an E3 ubiquitin ligase activity that ubiquitinates histone H2B (28,32,135). We reasoned that this region of enriched ubiquitination over the transcribed portion of the genes is present during interphase due to transcriptional elongation activity and may be due to the ubiquitination of the histone H2B but is lost during mitosis as there is a general inhibition of transcription during this period. To verify if the ubiquitination on coding regions of the active genes detected by our chromatin affinity purification approach is indeed due to

60 ubH2B, we first confirmed detection of ubH2B at these regions by ChIP using anti- ubH2B antibody (Figure 13A). We then performed sequential affinity purification for the ubiquitin tag followed by immunoprecipitation using either antibody specific to ubH2b, antibody specific to H2B or a control rabbit IgG antibody (27) . Re-ChIP results showed that the ubH2B signal was enriched in the affinity tag purified chromatin sample (Figure

13B). To further confirm that the ChAP-Seq results on the coding regions during interphase represent ubiquitinated H2B, we compared our ChAP-Seq data with two publically available ubH2B ChIP-Seq data (GSM818830 and GSM264618) (30,152). 53 and 62% of the genes with ubH2B peaks from these datasets were also found to be ubiquitinated in our ChAP-Seq data (Figure 13C).

Since most promoter ubiquitination was associated with highly active genes, we reasoned that the E3 ubiquitin ligase responsible for this modification must also be one that associates with active genes. Since RNF20 is the E3 ubiquitin ligase that associates with active transcription elongation complexes, we tested its role in promoter and transcribed region ubiquitination during interphase and during mitosis. RNF20 was depleted by a specific siRNA, resulting in a decrease in ubH2B levels (Figure 14A). Depletion of

RNF20 by siRNA in HeLa-Ub cells reduced both the ubiquitination and ubH2B levels associated with the transcribed regions of the tested genes during interphase (Figure 14B and 14D). As expected, depletion of RNF20 significantly reduced the level of ubiquitination over the coding sequence. By contrast, depletion of RNF20 had no effect on ubiquitination of promoters during mitosis (Figure 14C), indicating that the E3

61 ubiquitin ligase responsible for promoter modification is different from the one required for ubiquitination on transcribed regions of active genes.

Figure 13: Ub-H2B ChIP and ReCHIP in HeLa cells. A) ChIP analysis of ubH2B at the indicated promoters and transcribed regions in asynchronous HeLa cells. Enrichment was calculated as % of input sample. Rabbit IgG was used for mock ChIPs. B) Sequential ubiquitin ChAP followed by ubH2B (black) or H2B (dark grey) ChIP. Enrichment of ubH2B or H2B in the ChAP signal was determined by qPCR after the sequential ChIP. Ct values obtained after ChIP using indicated antibody were normalized to the chromatin input for ChAP and expressed on the y axis. C) Table presenting comparison of ubiquitin ChAP-Seq data to published ubH2B ChIP- Seq datasets.

Figure 14: RNF20 depletion reduces ubiquitination of regions downstream of TSS but not at promoters. A) Western blot analysis shows levels of RNF20 protein and ubH2B in HeLa cells after transfection with either a control siRNA (GL2; lane 1) or RNF20-specific siRNA (lane 2). Lamin-B and TFIIH (89 kDa subunit) levels serve as loading controls. B) And C) ChAP results showing ubiquitination at the promoters regions of indicated genes in mitosis (B) or at the transcribed regions during interphase (C) after transfection with control (black) or RNF20 (gray) siRNA. Ct values obtained in each sample were normalized to the input DNA value and the % input values thus obtained were further normalized to the % input values obtained in the control sample. D) ChIP analysis of ubH2B levels at promoters and transcribed regions in asynchronously growing HeLa cells transfected with control (black) or RNF20 (gray) siRNA. UbH2B specific antibody was used to immunoprecipitate ubH2B enriched DNA. The immunoprecipitated DNA and input DNA were amplified using primers specific to either promoters or transcribed region of the genes labeled on the X axis and enrichment is denoted as % of input sample on the Y axis (*p<0.05).

3.4.6 Ubiquitination bookmarks promoters of a subset of active genes:

Consistent with the fact that transcriptional activity in the cell is reduced to a minimum during mitosis, ubiquitination at transcribed regions was reduced to minimum during this stage. However, there was an increase in the ubiquitination at the promoters of a set of genes that are expressed at high levels during interphase. There is a report of ubiquitination of H2B at promoters of active genes (33). The transient boost observed in promoter chromatin ubiquitination during mitosis may be a generalization of this earlier observation. To test if ubH2B is enriched at promoters during mitosis, we determined levels of ubH2B at promoters and coding regions during interphase and mitosis by ChIP- qPCR. As has been previously reported (30), ubH2B was enriched at transcribed regions and slightly at the promoters during interphase, but we failed to detect any enrichment of ubH2B at the promoters or the coding regions during mitosis (Figure 13A and 15). This observation suggests that H2B (H2BK120) is not the ubiquitinated substrate at the promoters during mitosis and corroborates the previously published observation that H2B is deubiquitinated before onset of mitosis (130).

Figure 15: UbH2B levels on the chromatin during mitosis. ChIP analysis of ubH2B using ubH2B specific antibody (black) or a mock (rabbit IgG) (grey) antibody at promoters and transcribed regions of indicated genes in mitosis.

To validate the above observations made from ChAP-Seq data, the ubiquitination level at promoters and coding regions of selected high expression genes was determined in cells blocked in mitosis and released for 0, 4 and 7 h by ChAP-qPCR. FACS analysis of propidium iodide stained cells showed that >90% of the cell population was in mitosis after the thymidine-nocodazole block with no release (0 h), about ~60-70% cells were in

G1 after 4 h and 80% of the cells were in G1 phase 7 h post release from the block

(Figure 16). Consistent with the ChAP-Seq data, promoter ubiquitination was highest at 0 h while the level of ubiquitination decreased as cells exited mitosis and entered the G1 phase with lowest at 7 h post release for promoters of genes that are active during 65 interphase (Figure 17A, left panel). At the promoter of a gene that is not expressed in these cells (IL2) the promoter ubiquitination was low and did not change as cells traversed the cell cycle. These results indicated that promoter ubiquitination was abundant during mitosis and was removed once the cells entered G1. In contrast to ubiquitination at the promoters, ubiquitination at the transcribed regions was at the lowest at 0 h and steadily increased as the cells exited mitosis (at 4 h and 7 h) representing ubiquitination due to transcription of these genes (Figure 17A, right panel). To determine at what point in the cell cycle the promoter chromatin becomes ubiquitinated, we performed a time course after release from a double thymidine block for 6, 8, 10, and 12 hours. At time points correlating with G2, 6 and 8 hours post release, ubiquitination at these promoters was low. Promoter chromatin ubiquitination reached the highest level at

10 hours and was again reduced at 12 hours (Figure 17B, left panel). These results were most consistent with the marking of chromatin at promoters by ubiquitination specifically during mitosis and removed once the cells enter G1. Ubiquitination at the transcribed regions was high immediately before mitosis and immediately after (Figure 17B, right panel). However, the ubiquitin was detected associated with the transcribed regions in the sample taken 10 hours post release (S10), probably due to synchrony of the cells being not a tight as when they were blocked in mitosis using nocodazole. Flow cytometry analysis of phospho-H3 and propidium iodide labeled cells revealed that at 10 hours post release about 30% of the cells were in mitosis (phospho-H3 positive) and by 12 hours post thymidine release, most cells had completed mitosis and entered G1 phase (Figure

17B). Based on these results, we suggest that the ubiquitination peak at the promoters

66 during mitosis functions as a bookmark to facilitate the resumption of transcription of these genes when the cells re-enter interphase.

Table 1: List of pathways that includes genes bookmarked by ubiquitination

Figure 16: FACS analysis of synchronized HeLa cells. A) FACS cell cycle analysis of cells blocked using a thymidine-nocodazole treatment followed by release in fresh media for 0, 4 and 7 hours. B) FACS analysis of propidium iodide and phospho-H3 (Ser28) stained cells blocked by a double-thymidine block and released for 6 (S6), 8 (S8), 10 (S10) and 12 (S12) hours. Upper right quadrant shows the percentage of cells in mitosis (4N and phospho-H3 positive). C) Histogram showing percentage of mitotic cells in the above samples.

Figure 17: Chromatin ubiquitination at promoters is increased during mitosis. A) Ubiquitination determined using ChAP-PCR at promoters (left) and transcribed regions (right) of the indicated genes at 0, 4 and 7 h post release from a thymidine- nocodazole block. B) Ubiquitination, measured using ChAP-PCR, at indicated promoters and transcribed regions at 6, 8, 10 and 12 h post release from a double thymidine block. Ct values obtained by qPCR for each sample were normalized to the Ct value for input DNA and represented in the graph as “% input values” on the y axes. C) Ubiquitination at promoters and transcribed regions of select genes known to be expressed in G1, RPS14, RPL19, FOS, RAD21, and a housekeeping gene expressed throughout cell cycle, GAPDH. Histograms of ubiquitin marks for each gene are labeled during mitosis (orange tracing) and during G1 (blue tracing). The TSS is denoted by the bent arrow.

Gene ontology analysis of the top 1000 genes whose promoters are ubiquitinated during mitosis revealed that ubiquitination tended to occur at genes encoding cell cycle regulators and those involved in protein synthesis, gene expression and DNA replication and repair (Table 1). The cell cycle genes included many that are required in G1 or at

G1/S transition (p-value = 6.13E-08). The concentrations of the ubiquitin mark at promoter and transcribed regions of select genes known to be expressed in G1 are shown in Figure 17C. As an example, the GAPDH gene had a high concentration of promoter ubiquitination during mitosis, and during G1 the promoter ubiquitination was not detected but ubiquitination over the transcribed portion of the gene was abundantly detected. These data indicated that ubiquitination occurs during mitosis at promoters of a subset of genes that are highly expressed during interphase. To understand if there is a correlation between mitotic promoter bookmarking and gene expression in G1, we obtained another publically available gene expression dataset (GSE26922) (146) and sorted the genes according to their mRNA abundance in G1 and mapped ubiquitination at these genes during both mitosis and G1. From these heatmaps, we observed that genes highly expressed in G1 were also the most ubiquitinated on their chromatin and at their

TSS during mitosis (Figure 18A). Further, 75% of genes with bookmarked promoters during mitosis were ubiquitinated during G1 (data not shown), corroborating that genes bookmarked by ubiquitination at promoters during mitosis are expressed at high levels during G1.

Figure 18: Ubiquitin marks on the chromatin correlate with active histone marks during all stages of the cell cycle. A) Heatmaps show ubiquitination in M and G1 phases of the cell cycle (as in Figure 3B), H3K4me3, and H3K27me3 tag density around the TSS of 12,013 genes expressed in HeLa cells. Rows in the heatmap represent genes that are arranged from top to bottom based on mRNA abundance during G1 phase of cell cycle. mRNA abundance in G1 was obtained from expression microarray data synchronized in G1 (S12, GSE26922) B) Venn diagrams showing overlap in the genes that are marked by either H3K4me3, H3K36me3 or H3K27me3 and ubiquitination in the transcribed region in G1 (left) or in the promoter regions (right). Total number of genes marked by the modification is shown in parenthesis and the number of genes marked by both modifications is indicated in on the Venn diagram overlap.

3.4.7 Ubiquitination during mitosis correlates with genes carrying active histone marks during interphase:

Monoubiquitination of histone H2B precedes histone H3K4 trimethylation (36,37) – a posttranslational modification linked with active genes (153). Our results indicated that ubiquitination during mitosis mapped preferentially to chromatin at the promoters of highly expressed genes (Figures 11A and 18A). To determine if these genes were marked by other active or repressive epigenetic marks, we compared our ubiquitin localization data with three major histone modifications linked to gene expression – H3K4me3 (active gene mark at promoters) (153-155), H3K36me3 (active gene mark on gene bodies) (156-

158) and H3K27me3 (repressed gene mark) (159). We obtained publically available

ChIP-Seq datasets for the three modifications and identified the genes that are marked by each and compared them to the ubiquitination data from mitosis and G1. Genes ubiquitinated in mitosis and G1 correlated with the genes with the highest level of

H3K4me3 labeling near the promoter (R= 0.6932) (Figure 18A). By contrast, there was no apparent correlation between promoter ubiquitination and H3K27me3 (R= 0.1306)

(Figure 18). During G1 phase, 75% of genes with ubiquitinated chromatin on their transcribed regions were also marked by H3K4me3 and 60% were marked by

H3K36me3, whereas only 11% of these genes were marked by the repressive mark

H3K27me3 (Figure 18B). Active genes are ubiquitinated in the chromatin on the transcribed sequences by the PAF elongation complex via the RNF20 subunit (23).

Many active genes were not ubiquitinated over the coding DNA, and we suggest that either the ubiquitination of chromatin by the elongation complex was not essential for

72 transcription of every gene or that the ubiquitination tag on some genes was more labile than on other genes.

85% of genes whose promoter chromatin was ubiquitinated during mitosis also carried the H3K4me3 mark and 61% carried H3K36me3 mark during interphase (Figure 18B).

Since the histone methylation data are obtained from asynchronously growing cells, this high overlap suggested that genes with promoter ubiquitination during mitosis were active during interphase. A recent study showed that MLL1, an H3K4 methyltransferase activity, remains bound to promoters of some of its target genes during mitosis (119).

However, the relevant physical interactions causing MLL to bind specifically to these promoters were not determined. To determine if ubiquitination also occurs at these MLL occupied genes, we compared MLL occupancy to ubiquitination during mitosis. We compared the ubiquitination status of 70 promoters that were bound by MLL1 and ChIP-

PCR validated during this stage revealed that 88% of these promoters were also ubiquitinated during mitosis (data not shown). This correlation between MLL occupancy,

H3K4me3 and ubiquitination suggests that apart from interphase, ubiquitination may also be required as a mark recognized by MLL1 to bind to its target promoters during mitosis.

3.5 DISCUSSION

In this study we investigated changes in the ubiquitin mark on the chromatin throughout the human cell cycle. We observed that during interphase, ubiquitination primarily marked the transcribed regions of the genome with a preference for genes with high mRNA levels. Apart from the coding regions, promoters and CpG islands were also

73 labeled by this modification. Deposition of the ubiquitin mark on the transcribed regions was dependent on active transcription since cells in mitosis or inhibition of RNAPII elongation by α-amanitin or by flavopiridol reduced the levels of ubiquitination in the transcribed regions. Depletion of the ubiquitin ligase associated with transcription elongation, RNF20, reduced the abundance of the ubH2B over the downstream sequences of active genes and at promoters. H2B is known to be co-transcriptionally ubiquitinated at high expression genes by RNF20, an E3 ubiquitin ligase associated with the transcription elongation complex PAF (135). Contrary to our expectation, we noticed that not all high expression genes were ubiquitinated in their transcribed regions with only about 70% of the genes possessing this mark. This observation indicated that ubiquitination of H2B may not be essential for all transcribed genes. Consistent with this idea, studies done in fission yeast and human cells reveal that loss of ubiquitinated H2B or of RNF20 affects the transcription of only a subset of genes (160).

Histone H2A is ubiquitinated by the polycomb repressive complex (PRC1) at promoters of silenced and imprinted genes (89,90) and heterochromatic regions in mammalian cells

(46). Our detection method did not detect Polycomb-mediated monoubiquitination of

H2A, since the tagged-ubiquitin was not coupled to H2A. It is important to note that the ubH2A was present in the sample but not detected. We thus focus on the presence of the tagged-ubiquitin in the genome-wide analysis, and we make no conclusions about where it was not detected.

A surprising and interesting finding of this work was that ubiquitination on the chromatin surrounding the promoters increased dramatically at mitosis – a time when most

74 transcription factors are removed from the condensed chromosomes. This modification was not a common feature of all promoters but was specifically seen at promoters of genes that were transcribed during G1 phase. The deposition of ubiquitin on chromatin at the promoters during mitosis was a separate phenomenon than the marking of transcribed regions with ubiquitin. The latter process is a consequence of active transcription, but the marking of promoters was not affected by treatment with α-amanitin (data not shown).

We also compared the genes ubiquitinated in mitosis with those carrying another post translational chromatin modification –SUMOylation (73). We find that about 50% of the genes carrying the ubiquitin bookmark during mitosis have SUMO-1 associated with their promoters during interphase (p-value< 2.2E-16). Thus our data support the concept that SUMOylation is a mark for active genes.

A dramatic reduction in the levels of histone H2A and H2B ubiquitination occurs before the start of mitosis (161) and deubiquitination of H2A precedes chromatin condensation during mitosis (56). Our results from the ChIP analysis of ubH2B at promoters during mitosis are consistent with this previous observation and show that ubH2B, although modestly enriched at promoters during interphase, shows no enrichment at these sites during mitosis. Thus, H2B is ruled out as the substrate ubiquitinated and acting as the bookmark during mitosis. Since we were unable to detect ubH2A in our affinity purified samples, we can also rule out involvement of ubH2A as the bookmarked substrate in this stage.

Other histone modifications and transcription factors have been shown to remain associated with the mitotic chromatin (162). For example, MLL binds to mitotic

75 chromatin and occupies a specific set of promoters differing from the genes it occupies during interphase (119). Interestingly, almost 90% of the promoters bound by MLL were also ubiquitinated. It is plausible then that ubiquitination of the chromatin at promoters may act as a recognition mark for MLL or other transcription factors to bind to specific sets of promoters in mitosis. Conversely, it can also be envisioned that some of these transcription factors may act to recruit an E3 ubiquitin ligase, which may then modify the chromatin leading to downstream effects.

Consistent with our observation of ubiquitination on promoters during mitosis, the E1 ubiquitin activating enzyme has been shown to associate with mitotic chromatin in HeLa cells (163). Mammalian cells express hundreds of E3 ubiquitin ligases. Which enzyme is responsible for this specific post-translational modification of the chromatin at promoters during mitosis? Based on the loss of function phenotype and association with active genes, we tested some plausible candidates for this function. Although depletion of

RNF20 affected ubiquitination of the transcribed regions in interphase, its depletion did not affect the ubiquitination of promoters during mitosis. We inferred from this result that ubiquitination of the promoters during mitosis and of the transcribed regions during interphase are two separate phenomena requiring the actions of different E3 ubiquitin ligases. We tested several other reasonable candidates, including TAF1, which is identical to the gene CCG1 implicated in regulation of cell cycle progression through G1

(164,165). The TAF1-containing TFIID complex is also known to bind to the mitotic chromosomes (125) and TAF1 monoubiquitinates histone H1 in Drosophila (66).

Considering its homology to E1 or E2 ubiquitin ligases, it has been proposed to be a

76 histone specific ubiquitin activating/conjugating enzyme. Although depletion of TAF1 caused a G1 block in the HeLa cells as expected, its absence did not affect the ubiquitination at promoters during mitosis (data not shown). Other candidate proteins are in the process of being tested.

In summary, we show that ubiquitination on the human chromatin is dynamic through the cell cycle with global pattern changing with cell cycle progression. Our data also suggests that ubiquitination of specific promoters may be a mode of cellular transcriptional memory to mark active genes while the silenced chromatin transits through mitosis.

Chapter 4: Unexpected roles of polycomb proteins in positive

regulation of actively transcribed genes.

Arora M, Banerjee, T, Parvin JD. Manuscript in preparation

Author contributions:

• Arora, M & Parvin JD designed the experiments.

• Arora, M performed the experiments

• Banerjee, T cloned the RING1A and BMI1 plasmids

4.1 Abstract

In a previous study we discovered chromatin ubiquitination as a potential mitotic bookmark. In this study, we show the surprising involvement of the SAGA associated deubiquitinase USP22 and the polycomb complex proteins BMI1 and RING1A in the regulation of this bookmark during mitosis. The polycomb complex proteins are thought to primarily regulate gene expression by transcriptional repression. Although some previous studies have implied the involvement of the polycomb proteins in the regulation of active genes, their association with the transcriptional regulation of active genes during the mitosis to G1 transition has not been described before this work. Our data reveal that

BMI1 and RING1A regulate the mitotic bookmarking by ubiquitination and their expression once the cells exit mitosis and enter G1. They are also required for the progression of the cells through mitosis and entry into G1 as well as progression through

G1. We also show that lack of RING1A (and thus mitotic bookmarking by ubiquitination) is deleterious to the survival and proliferation of tissue culture cell lines thus presenting as a potential for novel targets for cancer therapy.

4.1 BACKGROUND

During mitosis, when the chromatin is condensed, global silencing of transcription occurs along with the displacement of the majority of general and tissue-/gene-specific transcriptional factors and other associated machinery from the chromatin (114). This provides a window of opportunity for the cells to undergo major reprogramming of their

79 transcriptional states, but, in most cases, cellular identity needs to be maintained and gene expression patterns are accurately restored upon exit from mitosis.

Published research shows that not all information is lost during this stage and a subset of factors remain bound to mitotic chromosomes, providing a molecular bookmark to direct proper chromatin reassembly (31,127,162,166). This process of transcriptional memory by molecularly marking these genes during mitosis is referred to as “mitotic bookmarking”. This involves retention of histone modifications and histone variants and distortions in the chromatin such as nuclease accessibility (31,116,117). In addition, it is now known that several transcription factors are also retained at a subset of their target genes during this stage. The factors that regulate the retention of these transcription factors at these mitosis specific sites as opposed to their interphase binding sites are not well understood (119,123).

We recently discovered that an additional mechanism of gene bookmarking in HeLa cells occurs by ubiquitination of the proteins associated with the regulatory regions of active genes during cell division (31). This bookmark is not placed on all genes but only on a specific set of genes that are highly expressed in these cells soon after finishing mitosis.

The bookmarking occurs specifically during mitosis and is removed as soon as the cells divide and enter the next phase of the cell cycle.

In this study, we sought to identify the enzymes responsible for this modification and discovered an unexpected positive role of polycomb group proteins BMI1 and RING1A and a deubiquitinase USP22 in mitotic bookmarking of active genes by ubiquitination.

Polycomb group (PcG) proteins form two major types of the polycomb complexes -

PRC1 typically consisting of core proteins BMI1, RING1B/RING1A, CBX4 and PHC1 and PRC2 consisting of core proteins EZH2, SUZ12, EED and RbAp46/48 (reviewed in

(74,75)). Together, these complexes act in keeping stem cells in a pluripotent state by transcriptional silencing of genes that regulate differentiation. Other complexes containing some of these PcG proteins have also been reported (42,94). The discovery of these complexes raises the possibility that some of the PcG proteins could have other functions not associated with the PRC1 complex. The primary function of the PRC1 complex is to monoubiquitinate histone H2A that is mediated by the RING1B ubiquitin ligase whereas BMI1 acts to stimulate the E3 activity of RING1B (89,90). RING1A is a less efficient H2A ubiquitin ligase and is not the main H2A ubiquitin ligase for the PRC1 complex. Although H2A is the major substrate of these RING1 proteins it is not the only ubiquitination substrate for the RING1 proteins. BMI1 and RING1A (but not RING1B) ubiquitinate TOP2A when treated with a topoisomerase inhibitor etoposide leading to proteasomal degradation of TOP2A (95), indicating that the RING1A protein could have hitherto undiscovered ubiquitination targets other than H2A.

The deubiquitinase USP22 is part of the human SAGA deubiquitination module that deubiquitinates ubH2B and is involved in transcriptional activation (29). Recent studies also show that USP22 can deubiquitinate and regulate the stability of other non-histone substrates (64). In addition, USP22 is required for full activation of several target genes governed by transcription factors such as p53, MYC and androgen receptor (49,50) and for normal cell cycle progression as its depletion leads to cell cycle arrest in G1. A recent

81 finding showed USP22 and BMI1 to be associated with the 11-gene signature associated with increased risk and poor prognosis of cancers along with other well-known oncogenes such as Ki67 and CCNB1 (51).

In this study we tested USP22 as candidate deubiquitinase acting to remove mitotic ubiquitin bookmarks in early G1. Contrary to our hypothesis, our results indicate that

USP22 and the PcG proteins BMI1 and RING1A all stimulate the ubiquitination of the chromatin at the promoters bookmarked during mitosis and also the expression of the bookmarked genes once the cells exit mitosis and enter G1. In addition, our data reveal that ubiquitination at the bookmarked promoters during mitosis is required for the function of another mitotic bookmark, H3K4me3. We also show that bookmarking of genes by ubiquitination is a crucial process and its perturbation is deleterious to the survival and proliferation of tissue culture cell lines thus presenting as a potential for novel targets for cancer therapy.

4.2 Materials and Methods:

Cell culture, cell cycle synchronization and transfections:

HeLa cells were grown in DMEM supplemented with 10% BS, glutamax, penicillin/streptomycin and sodium pyruvate (Invitrogen). HeLa cells expressing the

HBT tagged Ubiquitin (HeLa-Ub) (139) were grown in DMEM containing biotin (0.5

µM, Sigma Aldrich) and puromycin (1.5 ug/ml, Invitrogen). Cells were arrested either by a thymidine-nocodazole block and released for 0 (mitosis), 4 or 7 (G1) hours or with a double thymidine block and released for 0, 2, 4, 6, 8, 10 or 12h. Cells were transfected 82 with siRNA using oligofectamine (life technologies) or plasmids using lipofectamine

2000 (life technologies).

Cells were synchronized in mitosis using a thymidine-nocodazole block by treating them with thymidine for 18 hours, releasing in thymidine free media for 3 hours followed by a

12-hour nocodazole block. To yield cells synchronized in G1, HeLa cells were first blocked in mitosis followed by release into a nocodazole free media for 5 hours.

Antibodies

The antibodies used in this study are anti- USP22, RING1B, RING1A, BMI1, α-tubulin,

GAPDH, H3K4me3, H3K79me2 and phospho-H3 (S10).

Flow cytometry

FACS analysis was done on at least 10,000 cells stained with propidium iodide from each stage of the cell cycle using a BD FACScalibur machine in the OSUCCC Analytic

Cytometry shared resource. Data was analyzed using the FlowJo software. For phospho-

H3 and propidium iodide stained cells, cells were first incubated with anti-phospho-H3 for 2h, then with Alexaflour 687 labeled goat anti-rabbit for 1 h and last with propidium iodide.

ChIP and ChAP

Chromatin immunoprecipitation and affinity purification were performed as described in section 3.3 of this dissertation.

QPCR

For qPCR analysis, ChAP or ChIP chromatin was prepared as described above. For

ChAP, affinity purification was performed using only avidin beads to purify the ubiquitinated chromatin instead of sequential purification on nickel and avidin beads.

Input sample was saved before purification and was treated similar to the affinity purified

DNA. Affinity purified DNA or immunoprecipitated DNA and input DNA were used as a template for qPCR.

4.3 RESULTS

4.3.1 Deubiquitinase USP22 regulates chromatin ubiquitination during mitosis.

We have previously shown that the chromatin at the promoters of genes that are actively transcribed during interphase is ubiquitinated in mitosis. This ‘mitotic bookmark’ is absent in G1 cells and is probably removed as the cells exit mitosis and enter G1 by the action of a deubiquitinases (31). USP22, a deubiquitinase associated with the human

SAGA complex, deubiquitinates histones H2A, H2B and other non-histone substrates

(64). USP22 regulates cell proliferation and its down regulation leads to accumulation of cells in the G1 phase of the cell cycle (64,167). Based on these previously published observations, we asked if USP22 is involved in regulation of the mitotic bookmarking by ubiquitination. We hypothesized that USP22 deubiquitinates the promoter chromatin during the M to G1 transition and this deubiquitination is essential for the transcription of the bookmarked genes during G1. To test this hypothesis, we depleted the USP22 levels using siRNA in HeLa cells and determined the effect of this depletion on the promoter 84 ubiquitination during early G1. Ubiquitination at the promoters was analyzed by chromatin affinity purification followed by qPCR (ChAP-qPCR) as described previously

(31). We anticipated that depletion of USP22 would cause an apparent increase in the promoter chromatin ubiquitination during G1. However, contrary to our expectation, loss of USP22 led to a further reduction in the already low levels of promoter ubiquitination observed in G1 (Figure 19). This prompted us to examine the effect of loss of USP22 on the promoter ubiquitination in mitosis. Interestingly, ubiquitination at the promoter regions during mitosis was also severely reduced in absence of this deubiquitinase suggesting that USP22 plays a positive role in the regulation of the ubiquitination mediated mitotic promoter bookmarking (Figure 20).

Figure 19: Effect of USP22 depletion on promoter ubiquitination in G1 phase of cell cycle. A) Hypothetical model of anticipated effects of USP22 depletion on promoter ubiquitination and transcription once the cells exit mitosis and enter G1. B) Immunoblot showing reduction in USP22 protein levels after transfection with USP22 specific siRNA. C) Normalized % input levels of ubiquitination at promoter regions of select genes as measured by ChAP-qPCR. The input levels obtained after treatment with USP22 siRNA (red) were normalized to the % input measured after transfection with control siRNA (GL2 siRNA, blue).

Figure 20: Effect of USP22 depletion on promoter ubiquitination in M phase of cell cycle. A) Normalized % input levels of ubiquitination at promoter regions of select genes as measured by ChAP-qPCR. The input levels obtained after treatment with USP22 siRNA (red) were normalized to the % input measured after transfection with control siRNA (GL2 siRNA, blue). B) A model depicting the status of promoter ubiquitination and transcription in presence (top) or absence (bottom) of USP22.

4.3.2 Polycomb repressive complex 1 associated proteins positively regulate promoter ubiquitination in mitosis.

Since our results showed that USP22, a deubiquitinase, positively regulates the ubiquitination at promoter chromatin during mitosis, we deduced that it probably does so indirectly by regulating the levels or the activity of an E3 ubiquitin ligase involved in this process. USP22 has been shown to positively regulate the BMI1 protein levels in

HCT116 colorectal cancer cells (167). BMI1 is a homolog of the Drosophila Psc protein and is part of the polycomb repressive complex-1 (PRC1) along with two other E3 ubiquitin ligases, RING1A and RING1B and its main function is to enhance the H2A 87 ubiquitination activity of RING1B (and probably also RING1A). To determine if BMI1 and the other RING1 proteins play a role in ubiquitination of the chromatin at the promoters of the interphase active genes, we depleted these proteins using siRNA mediated knockdown and examined the effect on level of ubiquitination at promoters.

HeLa cells were treated with siRNA and synchronized in mitosis using a thymidine- nocodazole block and ubiquitination at the promoters was analyzed by ubiquitin ChAP- qPCR. Immunoblot analysis showed a clear depletion of the specified proteins following siRNA treatment. Interestingly, while RING1B – the major effector E3 ubiquitin ligase of the PRC1 complex had no effect on these levels, BMI1 and RING1A depletion caused a significant reduction in the level of ubiquitination at the promoters (Figure 21 & 22). Our previously published results also show that the canonical substrate of the PRC1 E3 ubiquitin ligases, histone H2A ubiquitinated at lysine 119 is not the ubiquitinated protein at these promoters (31). These results suggest that the promoter chromatin of genes bookmarked during mitosis is modified by ubiquitination of a protein specifically regulated by the BMI1-RING1A duo but not affected by the RING1B enzyme. So far, not many substrates that are specific to RING1A but not RING1B have been identified. We tested the ubiquitination of one such substrate TOP2A that is ubiquitinated by RING1A but not RING1B (95). We were, however, unable to detect any ubiquitinated TOP2A during mitosis (data not shown) ruling it out as the ubiquitinated substrate present at the bookmarked promoters. These results suggest that a novel previously unidentified

RING1A substrate is ubiquitinated at the bookmarked promoters during mitosis.

Figure 21: Effect of BMI-1 depletion on promoter ubiquitination during mitosis. A) Immunoblot showing levels of BMI1 after transfection with the indicated siRNA. RHA serves as the loading control. B) Promoter ubiquitination as determined by ChAP- qPCR after transfection with BMI-1 siRNA (grey).

B A

C D

Figure 22: Effect of depletion of RING1B or RING1A on promoter ubiquitination during mitosis. A) & B) Promoter ubiquitination as determined by ChAP-qPCR after transfection with either RING1B (A, grey) or RING1A (B, red). Levels after transfection with control siRNA are in blue. C) & D) Immunoblot showing depletion of RING1B and RING1A after the indicated siRNA treatment. GL2 is the control siRNA. Histone H4 and alpha- tubulin serve as the loading controls.

4.3.3 RING1A regulates mitotic bookmarking by H3K4 trimethylation.

Some other factors including histone marks and transcription factors have been shown to persist at a subset of their target genes during mitosis and have been suggested to act as mitotic bookmarks. Since different histone modifications are known to cross talk in several cases, we hypothesized that these different bookmarking mechanisms may

90 interact and affect one or more other bookmarks. Since depletion of RING1A led to a loss of the ubiquitin bookmark at the promoters during mitosis, we examined if loss of ubiquitination affects other mitotic bookmarks. We tested the effect of RING1A and

RING1B depletion on the levels of two of the previously defined mitotic bookmarks namely H3K4me3 and H3K79me2 at these promoters. HeLa cells were transfected with either RING1A or RING1B siRNA and synchronized in mitosis using a thymidine- nocodazole treatment. Enrichment of H3K4me3 or H3K79me2 at select promoters was determined by performing ChIP-PCR using antibodies specific to these modifications.

We observed that depletion of RING1A but not RING1B led to a dramatic reduction in the H3K4me3 levels at the promoters of high expression genes (Figure 23). However, these depletions had no effect on H3K79me2 levels at the same promoters. We asked if this reduction in H3K4me3 levels is specific to mitosis or if deposition of this mark is affected throughout the cell cycle including interphase. Examining the effect of RING1A depletion on HeK4me3 levels during interphase showed that this reduction observed in the H3K4me3 levels was not a secondary effect caused by its reduction during interphase, as the H3K4me3 levels in interphase remained unchanged following RING1A depletion.

These results together suggest that there may be a crosstalk between H3K4me3 and ubiquitination occurring at these promoter sites specifically during mitosis. They also show that ubiquitination at these promoters is essential for H3K4me3 maintenance during cell division.

Figure 23: Effect of RING1A and RING1B depletion on other mitotic bookmarks. A) ChIP analysis of H3K79me2 levels at promoters in mitotic HeLa cells transfected with control (blue) or RING1A (red) siRNA. H3K79me2 specific antibody was used to immunoprecipitate DNA enriched for this modification. B) & C) ChIP analysis of H3K4me3 levels at promoters in mitotic (B) or asynchronously growing (C) HeLa cells transfected with control (blue), RINGA (red) or RING1B (green) siRNA. For A, B & C, ChIP using rabbit IgG was done to provide as a mock control. The immunoprecipitated DNA and input DNA were amplified using primers specific to the promoters of the indicated genes labeled on the X axis and enrichment is denoted as fold enrichment over mock on the Y axis.

4.3.4 Proliferation and cell cycle

We hypothesized that if bookmarking by ubiquitination is an important process for the cancer cells, abrogation of this process by depletion of RIN1A will affect their survival 92 and/or proliferation. To test this, we depleted RING1A or RING1B in HeLa or U2OS cells using siRNA. 48hrs post transfection; two thousand cells were seeded onto 6 well dishes. The cells were harvested at an interval of every 2 days for a total of 6 days and the total number was counted using a hemocytometer. While RING1B depleted cells behaved almost the same as the control cells, RING1A depleted cells failed to proliferate and were much less in numbers throughout the time course studied (Figure 24). This could be either due to a proliferation block or cell death or a combination of both. To test for proliferation block, we checked for any abnormalities in the cell cycle profiles of the

RING1A depleted cells. Cells were harvested and fixed 48 hours post transfection with the specified siRNA and the amount of DNA content was measured by staining with propidium iodide. The cell cycle profiles of control and RING1A depleted cells were then analyzed using a flow cytometer. RING1A depleted cells showed a higher accumulation of cells in the 2N peak as compared to the control cells indicating an arrest in the G1 phase of the cell cycle (Figure 25). When HeLa cells were blocked in the 2N stage by treating them with a double thymidine block and released into fresh thymidine-free medium, as opposed to the control cells that progressed into the DNA synthesis stage, a small population of the RING1A depleted cells failed to progress into the S phase and stayed arrested in the G1 (Figure 26). These observations indicate that RING1A is not only required for ubiquitination at the promoters during mitosis but also needed for normal progression through the cell cycle.

Figure 24: Proliferation of HeLa and U2OS cells after depletion of RING1A or RING1B. HeLa or U2OS cells were transfected with the indicated siRNA and seeded onto 6 well plates 48hours post transfection. Cells were counted using the hemocytometer at 2 day intervals indicated on the X axis. Number of cells is represented on the Y axis.

Figure 25: RING1A depletion leads to a cell cycle block in G1. FACS analysis evaluating cell cycle stage distribution in control (left) or RING1A depleted (right) cells. X axis represents the DNA content per cell as gauged by propidium iodide staining and Y axis represents the number of cells.

Figure 26: Progression of HeLa cells through the cell cycle after RING1A depletion. FACS analysis of propidium iodide and phospho-H3 (Ser10) stained cells blocked by a double-thymidine block and released for the indicated number of hours. Lower left quadrant represents G1 (2N, phosphor-H3 negative) cells, upper left quadrant represents S and G2 cells (>2N, phosphor-H3 negative) and the upper right quadrant represents the cells in mitosis (4N and phospho-H3 positive).

Figure 27: RING1A and BMI-1 depletion causes apoptosis during M to G1 transition. FACS analysis evaluating cell cycle stage distribution in control (GL2, left), RING1A depleted (center) or BMI-1 depleted (right) cells. X axis represents the DNA content per cell as gauged by propidium iodide staining and Y axis represents the number of cells. Top row represent histograms of cells blocked in mitosis by a thymidine-nocodazole block. Bottom row represents cells that have been released from the nocodazole block for 7 hours to allow entry into G1.

4.3.5 Chromatin ubiquitination at promoters during mitosis is essential for transcription of the bookmarked genes in G1.

Since loss of RING1A led to a decrease in the mitotic bookmarking of genes highly transcribed during mitosis, we hypothesized that RING1A mediated promoter ubiquitination may play a role in the transcription of the bookmarked genes during G1.

To test the effect of RING1A loss on the transcription of these genes during early G1, we

96 blocked the cells in mitosis using a thymidine nocodazole block and then released them into a nocodazole free media for 5 hours to let the cells exit mitosis and progress into G1.

To determine the efficacy of the thymidine-nocodazole block and release from mitosis to

G1, we performed propidium iodide staining of these cells. We expected that 5 hours after release into fresh nocodazole free medium, most of the cells should exit mitosis

(4N) and enter the G1 (2N) stage. Interestingly, although the RING1A depleted cells were able to exit mitosis (as seen by the reduction in the 4N peak at 5 hrs.), we did not see an increase in the 2N population of cells (Figure 27). Instead, we observed an accumulation of sub-2N or apoptotic cells. An ubiquitin specific chromatin affinity purification followed by qPCR was performed using these cells to determine chromatin ubiquitination on the transcribed regions as indicators of transcription. As anticipated, the loss of RING1A caused a severe reduction in the ubiquitination at the transcribed of regions of highly active genes suggesting a severe decline in the transcription of these genes (Figure28). These results together suggest that mitotic bookmarking via RING1A mediated ubiquitination is important and loss of this process has severe consequences on the transcription of the bookmarked genes during G1 and on the survival of the HeLa cells. Whether this process is important in all cancer cells and in normal proliferating cells still remains to be determined.

Figure 28: Chromatin ubiquitination in G1 is reduced in absence of RING1A. Ubiquitin at the coding regions of the indicated genes as determined by ChAP-qPCR of cells transfected with RING1A or RING1B siRNA and synchronized in G1 using a thymidine-nocodazole block. Ubiquitination at the coding regions represents the transcriptional activity at these sites.

4.3 DISCUSSION

Bookmark ubiquitination

In a previous study, we discovered that the chromatin on promoters of genes that were active during G1 phase of the cell cycle was ubiquitinated during mitosis (31). The ubiquitination centered on -100 relative to the transcription start site, and it was only

98 present during mitosis. The enzymes that mediate the bookmark ubiquitination were not known. In this study, we show that the deubiquitinase USP22 and two E3 ubiquitin ligases, BMI1 and RING1A, positively regulate the mitotic bookmarking by ubiquitination of the promoters of genes actively transcribed during interphase. Though depletion of RING1A causes mitotic bookmarking to be reduced to baseline levels, it is formally possible that it is not the ligase that mediates the bookmark ubiquitination but an upstream regulator of the actual factor. We also show that RING1A regulates modification of these promoters by another mitotic bookmark, H3K4me3. This process of bookmarking via ubiquitination is important as inhibition of this process by depletion of either of these ubiquitin ligases leads to transcriptional deregulation during G1 and a cell cycle and proliferation arrest. Both BMI1 and RING1A are subunits of the polycomb repressive complex 1. Since polycomb repressive complex is typically associated with repression of transcription via epigenetic mechanisms, it was surprising to find components of this silencing complex associated with the activation of gene expression via bookmark ubiquitination. Of interest, the major PRC1 subunit that catalyzes the

H3K27 ubiquitination is the RING1B subunit, but depletion of RING1B had no effect on bookmark ubiquitination. This suggests that the function of RING1A and BMI1 in bookmark ubiquitination may be independent of the polycomb complex.

USP22 is a deubiquitinase that is part of the hSAGA complex and is required for activator dependent gene activation and normal cell cycle progression (49,167,168).

Based on these previous observations, upon depletion of USP22, we had anticipated that

USP22 would play a role in removal of the ubiquitination bookmark once the cells enter

G1. However, our results indicate that USP22 is in fact required for the deposition of the bookmark during mitosis. The role of USP22 may be indirect, by regulating the stability of BMI1, which in turn directly promotes mitotic bookmarking by ubiquitination. Earlier results had suggested that USP22 regulates the stability of BMI1 (167). We speculate that the loss of mitotic bookmarking and the downstream effects of this loss on the transcription during G1 may contribute to the G1 cell cycle arrest observed upon USP22 depletion.

Our results indicate that RING1A and BMI1 are both required for normal progression through the cell cycle. HeLa cells depleted of these proteins are either blocked in G1 or undergo apoptosis when synchronized in mitosis using a nocodazole block and then released into G1. It is possible that BMI1 and RING1A regulate the cell cycle via transcription silencing function as components of PRC1, rather than via the bookmark ubiquitination. In regards to this, BMI1 and the RING1B subunit are known to modulate apoptosis through regulation of pro-apoptotic genes like Bim, though these results did not investigate the function of RING1A (169). In addition, RING1A was a hit in an RNAi screen for proteins required for mitotic entry suggesting that RING1A may act as a cell cycle regulator (170). Consistent with this observation, we see reduced numbers of mitotic cells in the cell cycle progression assay upon RING1A depletion. The defect in mitotic entry observed upon RING1A depletion may be independent of its role in mitotic bookmarking of promoters as it suggests a role for this protein in cell cycle regulation prior to entry into mitosis.

100

Polycomb protein subunits that activate transcription

Polycomb proteins are involved in transcriptional repression. However, our results show that BMI1 and RING1A are positive regulators of transcription in G1 as absence of these enzymes (and thus ubiquitin bookmark) has a deleterious effect on the transcription levels during early G1. At this point, it is difficult to establish that these effects are solely due to absence of the mitotic bookmarks and not because of other interphase effects caused by the depletion of these proteins. Although conventionally linked to transcriptionally silenced genes, several recent reports link polycomb proteins to active transcription.

MEL18 (a BMI1 homolog) and RING1A bind to actively transcribed cytokine genes in differentiated T cells and are required for their transcription (171). EZH1 and SUZ12, components of the PRC2 complex have been shown to co-occupy sites of active transcription in embryonic stem cells along with RNAPII (86). Differing from its homolog, EZH2 is a co-activator of transcription factors such as androgen receptor (AR) and NF-kB (84,85). Whether these proteins regulate mitotic bookmark ubiquitination remains to be determined. Although these above studies have shown polycomb proteins regulating active genes, the current study is the first to implicate their involvement in mitotic bookmarking of active genes.

Interestingly, although BMI1 and RING1A depletions had profound effects on the ubiquitination at the promoters during mitosis, RING1B – the canonical and effector ubiquitin ligase of the PRC1 complex was not essential for this process. These results indicate PRC1-independent roles of BMI1 and RING1A. It is plausible that BMI1 and

RING1A may form a novel complex along with other polycomb or non-polycomb group

101 of proteins. In this context, BMI1 and RING1A have been shown to ubiquitinate topoisomerase IIA independent of the RING1B enzyme and thus PRC1 complex. It is from our results that the BMI1-RING1A duo has other unidentified substrates that still remain to be identified.

Cross talk with other mitotic bookmarks

Several other mitotic bookmarks including some histone modifications and some transcription factors have been identified (115,116). We show that at least one of these bookmarks, i.e. H3K4me3 is sensitive to RING1A depletion. Interestingly, MLL1, the enzyme responsible for catalyzing this modification of H3K4 is also retained at specific sites on the condensed chromosomes (119). It would be tempting to speculate that

RING1A may affect the levels of H3K4me3 at these promoters during mitosis by regulating the binding of the MLL1 enzyme. However, Blobel and colleagues showed that the levels of H3K4me3 during mitosis are actually independent of MLL1 binding thus suggesting an alternate mechanism by which RING1A would regulate this modification.

The majority of the transcription factors involved in mitotic bookmarking have been shown to bind to only a subset of their target sites bound during interphase. Some even bind to novel sites that are not bound during interphase but only during mitosis. What determines transcription factor binding to this specific subset of their target sites during mitosis is not known. We speculate that modification of these target sites by ubiquitination during mitosis may act as a recognition motif and thus play a role in mitosis specific binding of these transcription factors.

102

The precise mechanism by which ubiquitination mediated by BMI1 and RING1A acts as a mitotic bookmark and aids in post mitotic transcription also remains to be elucidated.

Some reports show that some polycomb proteins bind to transcriptionally active and silenced genes (100,172). It is suggested that the role of this binding is similar to their canonical role of transcriptional repression and although they bind to actively transcribed genes they actually work in restricting the level of transcription at these sites. Since actively transcribed genes need to be silenced during mitosis, the polycomb proteins may play a similar silencing role at these sites during mitosis. However, as we could not detect any ubH2A at the sites of bookmarking (31), we believe that this may not be the case.

103

Chapter 5: Concluding remarks and future directions

5.1 Summary of Results:

In this dissertation study, we asked if the ubiquitination status of the chromatin associated proteins change during the different stages of the cell cycle. We used an unbiased approach to detect ubiquitination of all the chromatin proteins by chromatin affinity purification (ChAP) specific to the ubiquitin protein and not to any specific ubiquitinated substrate. This method was used to detect the changes in ubiquitination of all the chromatin proteins regardless of the type of substrate or function of the modification.

This helped us uncover a novel phenomenon associated with the chromatin that may have been undetected had we used the conventional ChIP approach by using an antibody to a specific ubiquitinated substrate as has been done before.

The ubiquitination of the proteins associated with the chromatin is not stable but quite dynamic through the cell cycle. During interphase, the ubiquitination is not distributed evenly throughout the genome but is enriched in gene rich regions and is associated with active transcription. The ubiquitination associated with the transcribed regions during interphase can be attributed to the ubiquitination of histone H2B.

We show, for the first time, an involvement of this posttranslational modification in maintenance of the transcriptional memory through cell division. The promoter 104 chromatin of genes that undergo active transcription at some point during the interphase is ‘bookmarked’ by ubiquitination during mitosis when the chromosomes are condensed for cell division and most of the transcription process has come to a halt. Another surprising finding of this study is the requirement of the polycomb proteins BMI1 and

RING1A (enzymes that are associated with transcriptionally silenced genes) and a deubiquitinase USP22 in deposition of this bookmark during mitosis. Although RING1B has been shown to be developmentally indispensable and often implicated in several tumors, it has no apparent role in the mitotic bookmarking process described in this project. The bookmarking via ubiquitination by these ubiquitin ligases is important for normal cell growth since abrogation of this process by depletion of these enzymes leads to severe phenotypes such as cell cycle and proliferation block and cell death.

Several key questions are raised from these current observations. For instance, since we use a substrate-unbiased ubiquitin specific chromatin affinity purification approach, we do not know the identity of the protein (or proteins) modified by ubiquitination at the promoter chromatin during mitosis. We also need to determine if mono-ubiquitination or poly-ubiquitination and the type of ubiquitin linkage that modify the protein/s. To further our understanding of the bookmarking process in general, we also need to understand the exact molecular mechanism by which ubiquitination aids in the bookmarking of these promoters thus helping with transcription in G1. In this regard, it will be also useful to determine how ubiquitination affects the other bookmarks whose downstream effects on transcription have already been defined. Finally, it is crucial to identify the differences

105 and the importance of bookmark ubiquitination in cancer cells over normal non- cancerous cells.

5.2 Key remaining issues:

5.2.1 Ubiquitinated substrate as the bookmark:

To understand the process of mitotic bookmarking by the subunit proteins of the polycomb complex, it is necessary to identify the target substrate ubiquitinated at the promoters during mitosis. The main function of the ubiquitin ligases associated with the

PRC1 complex is to ubiquitinate histone H2A. However, our results from chapter 3 show that the canonical substrate of the polycomb complex, H2A ubiquitinated at lysine 119 is not enriched at these sites during mitosis and hence does not play a role in mitotic bookmarking. We have also demonstrated in chapter 4 that TOP2A, the only BMI1-

RING1A specific substrate identified so far, is not ubiquitinated during mitosis. Since no other RING1A specific substrates have as yet been identified, mass spectrometry is the best approach to determine candidates that are ubiquitinated during this time by these enzymes. There are two ways to prepare the sample for mass spectrometry -

A. Analysis of all chromatin associated ubiquitinated proteins: In this method,

the chromatin fraction will be obtained from the HeLa-Ub cells expressing the

tagged ubiquitin. The chromatin and chromatin-associated proteins will then be

subjected to affinity purification using avidin and nickel beads as was done for

ChAP. The non-specifically bound proteins will be washed off using low salt

wash buffers. The ubiquitinated proteins bound to the avidin beads can be cleaved

106 off using either the TEV protease retaining the ubiquitin moiety on the substrates or by using USP2 protease that would release the unmodified substrate by cleaving off the bond between ubiquitin and the modified protein (Figure 29).

Another option is to do an on-bead digest of the purified proteins using trypsin.

The proteins can then be prepared for analysis by mass spectrometry as required by the mass spec core facility at OSU.

Figure 29: TEV and USP2 protease cleavage sites on an ubiquitinated substrate.

Preliminary results: We performed a pilot version of the above-described experiment by chromatin affinity purification followed by on-bead trypsin digest of the avidin bound ubiquitinated proteins. The purified and trypsin digested protein samples were analyzed by LTQ LC-MS. To identify ubiquitinated proteins that are specifically affected by RING1A, we performed MS on another chromatin sample that was obtained from HeLa-Ub cells that were depleted for 107

RING1A. This experiment yielded few hits with a reliable mass spec score. This

could be possible if the on-bead digest was not complete and hence the instrument

had a low input. It is also quite likely that the protein substrate fell off the beads

while washing since the proteins were not crosslinked to the beads before the

washes. This experiment needs to be repeated with either a different approach to

purify the samples or by using a higher sensitivity mass spec analysis with

appropriate quality controls at each step. Crosslinking of the samples, before

affinity purification may also be helpful in case the ubiquitinated substrate is a

non-histone protein loosely bound to the chromatin.

B. Analysis of RING1A interacting chromatin proteins: Another method of

substrate identification can be to isolate the RING1A (and BMI1) interacting

proteins by RING1A immunoprecipitation followed by mass spectrometry. The

ubiquitinated peptides could then be identified from the mass spec data using

proper data analysis software.

For both the above approaches, samples will be prepared from chromatin obtained

from HeLa-Ub cells synchronized in mitosis. It is possible that this approach will

identify multiple candidates. These candidate proteins will further be prioritized

based on their ability to bind within 150bp of the transcription start sites. These

shortlisted substrates will be validated by using western blot or IP techniques.

5.2.2 Molecular mechanism of mitotic bookmarking by ubiquitination:

The results presented in this dissertation show that bookmarking via mitotic promoter chromatin ubiquitination controlled by RING1A and BMI1 is essential for G1 108 transcription of highly transcribed genes. To understand the role of BMI1-RING1A enzymes, it is essential to determine a) how these enzymes are selectively retained at selected sites during mitosis and b) how their selective retention influences transcriptional reactivation post mitosis.

A) Mitotic retention at selective sites: Although several transcription factors are retained on the mitotic chromosomes, it is not known what distinguishes sites bound in interphase versus sites specifically occupied during mitosis. It is suggested that DNA sequence or the local chromatin environment may influence binding of these factors.

Genome wide occupancy studies of two such factors, GATA1 and FOXA1 have not revealed any specific DNA motifs that can regulate mitosis specific binding (122,123) although some transcription factors such as RUNX2 were shown to have affinity to repetitive sequence elements (120). At present there are no known chromatin features that affect mitosis specific binding excepting FOXA1 that favors sites of high nucleosome density. Apart from DNA sequence and local chromatin context, histone modifications could also play a role in specifying these sites. For instance, mitotic binding of RUNX2 at specific sites is associated with high levels of H3K4me2 while GATA1 bound sites are enriched for repressive marks such as H3K9me3 and H3K27me3 (121,122). However, it is unclear if these modifications are the cause or the consequence of the binding of these factors. Since we now know for the first time an enzyme that can be depleted to disrupt the bookmarking process, we have an opportunity to discover whether these bookmark modifications are cause or consequence.

109

We will first perform chromatin IP experiments to test if RING1A and BMI1 occupy the bookmarked promoters during mitosis. Assuming the chromatin IP experiments give positive results, we will then determine genome wide occupancy of RING1A and BMI1 in mitosis by performing ChIP-Seq studies. Results from ChIP-Seq experiments will help us determine the overlap between RING1A/BMI1 binding and promoter ubiquitination. It will also aid in finding specific chromatin context or DNA motifs that may be responsible for mitosis specific binding of these proteins.

It will be also useful to identify other proteins that may act along with the BMI1 and

RING1A proteins to regulate the ubiquitination bookmarking levels. Identification of these proteins may help in understanding how the activity of the BMI1/RING1A proteins is regulated at these sites during the cell cycle. It may also provide additional targets for drug therapy. To determine other components of the ubiquitination bookmarking pathway, we will also identify the BMI1/RING1A interacting proteins by analyzing the mass spectrometric data from the experiments described in section 5.3.1.

B) Mechanism of transcriptional memory: The mechanisms by which the mitotic bookmarking of specific genes affects the transcriptional reactivation kinetics have been studied before. Ubiquitination at the promoters may regulate G1 transcription using similar mechanisms. Two major mechanisms proposed for mitotic bookmarking are a) local changes in promoter architecture of the bookmarked genes b) providing a mark for recognition by the transcriptional machinery during early G1.

110

1) Changes in promoter architecture

The general transcription factor TBP occupies a subset of promoters during

mitosis and recruits the phosphatase PP2A that then dephosphorylates CAP-G

condensin subunit. Dephosphorylation of condensin prevents binding to the

chromatin and thus antagonizes local chromatin compaction (126). As a result of

this decompaction, these sites remain accessible to the DNAse I enzyme

maintaining DNAse I hypersensitivity. Interestingly, the Drosophila Barren

protein (a homolog of the CAP-H subunit of the condensin complex) colocalizes

and directly interacts with the PH polycomb complex protein (173). Such an

interaction has not been confirmed in mammalian systems as yet. YY1, another

PcG protein is also shown to interact with the condensin and cohesin complex

along with the PRC2 complex component EZH2 (174). However, the effects of

these interactions on the local chromatin structure are not known.

We hypothesize that the ubiquitination of the chromatin at the promoters of the

bookmarked genes may modulate the local chromatin architecture causing it to be

in a more open state than the non-bookmarked genes. The open chromatin of the

bookmarked genes would then facilitate easier binding of the transcription

machinery once the cells exit mitosis and enter G1 (Figure 30).

To test if chromatin ubiquitination at these promoters plays a role in modulating

the chromatin compaction levels, we can test for changes in DNAse I

hypersensitivity at these sites after depletion of RING1A and BMI1. If chromatin

ubiquitination occurs upstream and is necessary for chromatin decompaction, loss

111

of RING1A will lead to a reduction in the sensitivity to the DNAse I enzyme.

Additionally, we can also determine changes in condensin binding at these

promoters post RING1A depletion.

Figure 30: Hypothetical model showing changes in local chromatin on ubiquitination bookmarked genes.

2) Recognition mark by transcriptional machinery

RING1A mediated ubiquitination at the bookmarked promoters may not lead to

any discernable changes in the local chromatin architecture as described above.

An alternative way it could aid in transcriptional reactivation is if ubiquitination

acts as a recognition mark for binding of one or more general transcription factors 112 thus acting as a platform for faster assembly of the transcriptional machinery on these promoters as compared to the non-bookmarked genes (Figure 31). The BET family transcription factor BRD4 persists at specific target sites during mitosis and facilitates transcriptional reactivation by recruiting P-TEFb to these promoters during late mitosis (telophase) (175,176). To test if the ubiquitin bookmark utilizes a similar mechanism, we need to first determine if P-TEFb binding to promoters is a general mechanism for all bookmarked promoters. We can then test if binding of P-TEFb is regulated by modulation of the chromatin ubiquitination. We can also test for binding kinetics of other general transcription factors including RNAPII at these sites in absence of ubiquitination.

113

Figure 31: Hypothetical model showing ubiquitination at promoters as recognition mark for transcriptional machinery.

3) Recognition mark for other deposition of other bookmarks

A third and indirect way by which bookmark ubiquitination may affect

transcription in G1 is by regulating the deposition of other mitotic bookmarks. As

mentioned above, it is not known how transcription factors are selectively

retained at specific sites during mitosis. We hypothesize that ubiquitination may

aid in marking the promoters acting as a recognition mark for binding of other

bookmarking factors. Our results indicate that ubiquitination at the promoters is a

prerequisite for at least one mitotic bookmark – H3K4me3. Disruption of 114 bookmark ubiquitination by depletion of RING1A enzyme leads to a dramatic loss of H3K4me3 levels at these promoters and this loss is specifically observed on the mitotic levels of this histone modification with no effects on the interphase levels.

Ubiquitination at these promoters may recruit a histone methyltransferase that catalyzes the H3K4me3 levels or may prevent the action of a demethylase thereby stabilizing the H3K4me3 levels. This can be tested by determining if RING1A depletion leads to a reduction in binding of MLL1 (or another H3K4 methyltransferase such as SET1) or an increase in binding of a demethylase such as LSD1 by performing ChIP against these proteins.

Our results also indicate that ubiquitination may not be a general upstream regulator of all mitotic bookmarks. Of the two histone modifications known to persist during mitosis that we tested, while H3K4me3 showed a dependence on ubiquitination, H3K79me2 was not affected by the absence of ubiquitination.

Conversely, depletion of DOT1L, the enzyme catalyzing H3K79me2, also had no effect on mitotic promoter ubiquitination (data not shown).

The interrelationship between another mitotic bookmark, histone H4K5 acetylation, histone acetylation binding proteins such as BRD4 and ubiquitination remains to be determined. Performing ChIP against the specific modifications and transcription factors after RING1A depletion can easily test whether a cross talk between acetylation and ubiquitination occurs at these bookmarked promoters during mitosis. If cross talk does exist, it would also strengthen the hypothesis

115

wherein ubiquitination affects G1 transcription by modulating P-TEFb binding

via regulation of acetylation and BRD4 binding.

5.2.4 Importance of ubiquitination bookmarking in cancer cells

Cancer cells have abnormal gene expression and gain newer identities as compared to the normal cells they arise from. However, similar to normal cells, gene bookmarking may help cancer cells remember their identities through multiple rounds of division. The precise bookmarking phenomenon may differ in cancerous cells as compared to normal cells as the expression of bookmarking agents may be aberrant in these cells.

Through our experiments using HeLa cells, we have shown that promoter bookmarking during mitosis is a process that is important for survival and proliferation of these cells.

We would like to determine if this ubiquitination is a general requirement for survival of both cancerous and non-cancerous cells. Additionally, we want to establish whether all or only specific types of cancers are addicted to these bookmarking processes for survival.

To address these questions, we will first determine if bookmark ubiquitination occurs in multiple cancer cell types and normal cells by performing ubiquitin specific ChAP.

Necessity of this process in these cell types will be tested by determining survival of these cells after abrogation of the bookmarking by RING1A depletion.

5.3 Significance:

An important question in biology is how daughter cells remember the set of genes that were expressed in the previous generation. Bookmarking of genes during mitosis helps achieve this by marking the genes active in the previous generation. Hence,

116 understanding the mechanisms of this process is important. Our work thus far has discovered a hitherto unknown phenomenon of gene bookmarking via ubiquitination in cancer cells. We find that three enzymes – USP22, BMI1 and RING1A are essential for this modification and are crucial for cell survival. Perturbing the levels of this modification by loss of these enzymes causes proliferation block and cell death in cancer cells.

BMI1 and USP22 are frequently overexpressed in several types of tumors but the known functions of these proteins have not been able to fully explain their tumorigenic potential.

RING1A has usually been studied as an enzyme that performs redundant PRC1 specific functions for the canonical homolog RING1B and the function of RING1A independent of its function as a RING1B substitute has not been studied. The results provided in this study lead to several other questions which when solved will help provide novel insights into the function of these polycomb proteins and USP22.

Further delineation of the mechanism and downstream effects of bookmark ubiquitination will strengthen the link between gene bookmarking and its role in survival and propagation of cancer cells. Understanding the process in depth will also provide with specific targets of gene-bookmarking mechanisms and could offer novel options for targeted therapy, with enhanced specificity and reduced off-target activity.

117

Bibliography

1. Dutta, B., Adav, S.S., Koh, C.G., Lim, S.K., Meshorer, E. and Sze, S.K. (2012) Elucidating the temporal dynamics of chromatin-associated protein release upon DNA digestion by quantitative proteomic approach. Journal of proteomics, 75, 5493-5506. 2. Berger, S.L., Kouzarides, T., Shiekhattar, R. and Shilatifard, A. (2009) An operational definition of epigenetics. Genes & development, 23, 781-783. 3. Tan, M., Luo, H., Lee, S., Jin, F., Yang, J.S., Montellier, E., Buchou, T., Cheng, Z., Rousseaux, S., Rajagopal, N. et al. (2011) Identification of 67 histone marks and histone lysine crotonylation as a new type of histone modification. Cell, 146, 1016-1028. 4. Wei, Y., Yu, L., Bowen, J., Gorovsky, M.A. and Allis, C.D. (1999) Phosphorylation of histone H3 is required for proper chromosome condensation and segregation. Cell, 97, 99-109. 5. Goto, H., Tomono, Y., Ajiro, K., Kosako, H., Fujita, M., Sakurai, M., Okawa, K., Iwamatsu, A., Okigaki, T., Takahashi, T. et al. (1999) Identification of a novel phosphorylation site on histone H3 coupled with mitotic chromosome condensation. The Journal of biological chemistry, 274, 25543-25549. 6. Goto, H., Yasui, Y., Nigg, E.A. and Inagaki, M. (2002) Aurora-B phosphorylates Histone H3 at serine28 with regard to the mitotic chromosome condensation. Genes to cells : devoted to molecular & cellular mechanisms, 7, 11-17. 7. Dai, J., Sultan, S., Taylor, S.S. and Higgins, J.M. (2005) The kinase haspin is required for mitotic histone H3 Thr 3 phosphorylation and normal metaphase chromosome alignment. Genes & development, 19, 472-488. 8. Rogakou, E.P., Pilch, D.R., Orr, A.H., Ivanova, V.S. and Bonner, W.M. (1998) DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139. The Journal of biological chemistry, 273, 5858-5868. 9. van Attikum, H. and Gasser, S.M. (2005) The histone code at DNA breaks: a guide to repair? Nature reviews. Molecular cell biology, 6, 757-765.

118

10. Chowdhury, D., Keogh, M.C., Ishii, H., Peterson, C.L., Buratowski, S. and Lieberman, J. (2005) gamma-H2AX dephosphorylation by protein phosphatase 2A facilitates DNA double-strand break repair. Molecular cell, 20, 801-809. 11. Chowdhury, D., Xu, X., Zhong, X., Ahmed, F., Zhong, J., Liao, J., Dykxhoorn, D.M., Weinstock, D.M., Pfeifer, G.P. and Lieberman, J. (2008) A PP4- phosphatase complex dephosphorylates gamma-H2AX generated during DNA replication. Molecular cell, 31, 33-46. 12. Douglas, P., Zhong, J., Ye, R., Moorhead, G.B., Xu, X. and Lees-Miller, S.P. (2010) Protein phosphatase 6 interacts with the DNA-dependent protein kinase catalytic subunit and dephosphorylates gamma-H2AX. Molecular and cellular biology, 30, 1368-1381. 13. Macurek, L., Lindqvist, A., Voets, O., Kool, J., Vos, H.R. and Medema, R.H. (2010) Wip1 phosphatase is associated with chromatin and dephosphorylates gammaH2AX to promote checkpoint inhibition. Oncogene, 29, 2281-2291. 14. Ajiro, K. (2000) Histone H2B phosphorylation in mammalian apoptotic cells. An association with DNA fragmentation. The Journal of biological chemistry, 275, 439-443. 15. de la Barre, A.E., Angelov, D., Molla, A. and Dimitrov, S. (2001) The N-terminus of histone H2B, but not that of histone H3 or its phosphorylation, is essential for chromosome condensation. The EMBO journal, 20, 6383-6393. 16. Lau, P.N. and Cheung, P. (2011) Histone code pathway involving H3 S28 phosphorylation and K27 acetylation activates transcription and antagonizes polycomb silencing. Proceedings of the National Academy of Sciences of the United States of America, 108, 2801-2806. 17. Metzger, E., Imhof, A., Patel, D., Kahl, P., Hoffmeyer, K., Friedrichs, N., Muller, J.M., Greschik, H., Kirfel, J., Ji, S. et al. (2010) Phosphorylation of histone H3T6 by PKCbeta(I) controls demethylation at histone H3K4. Nature, 464, 792-796. 18. Unnikrishnan, A., Gafken, P.R. and Tsukiyama, T. (2010) Dynamic changes in histone acetylation regulate origins of DNA replication. Nature structural & molecular biology, 17, 430-437. 19. Xu, Y. and Price, B.D. (2011) Chromatin dynamics and the repair of DNA double strand breaks. Cell cycle, 10, 261-267. 20. Hwang, W.W., Venkatasubrahmanyam, S., Ianculescu, A.G., Tong, A., Boone, C. and Madhani, H.D. (2003) A conserved RING finger protein required for histone H2B monoubiquitination and cell size control. Molecular cell, 11, 261-266. 21. Wood, A., Krogan, N.J., Dover, J., Schneider, J., Heidt, J., Boateng, M.A., Dean, K., Golshani, A., Zhang, Y., Greenblatt, J.F. et al. (2003) Bre1, an E3 ubiquitin ligase required for recruitment and substrate selection of Rad6 at a promoter. Molecular cell, 11, 267-274. 22. Kim, J., Hake, S.B. and Roeder, R.G. (2005) The human homolog of yeast BRE1 functions as a transcriptional coactivator through direct activator interactions. Molecular cell, 20, 759-770. 23. Zhu, B., Zheng, Y., Pham, A.D., Mandal, S.S., Erdjument-Bromage, H., Tempst, P. and Reinberg, D. (2005) Monoubiquitination of human histone H2B: the 119

factors involved and their roles in HOX gene regulation. Molecular cell, 20, 601- 611. 24. Minsky, N. and Oren, M. (2004) The RING domain of Mdm2 mediates histone ubiquitylation and transcriptional repression. Molecular cell, 16, 631-639. 25. Chen, A., Kleiman, F.E., Manley, J.L., Ouchi, T. and Pan, Z.Q. (2002) Autoubiquitination of the BRCA1*BARD1 RING ubiquitin ligase. The Journal of biological chemistry, 277, 22085-22092. 26. Thakar, A., Parvin, J. and Zlatanova, J. (2010) BRCA1/BARD1 E3 ubiquitin ligase can modify histones H2A and H2B in the nucleosome particle. Journal of biomolecular structure & dynamics, 27, 399-406. 27. Kao, C.F., Hillyer, C., Tsukuda, T., Henry, K., Berger, S. and Osley, M.A. (2004) Rad6 plays a role in transcriptional activation through ubiquitylation of histone H2B. Genes & development, 18, 184-195. 28. Wood, A., Schneider, J., Dover, J., Johnston, M. and Shilatifard, A. (2003) The Paf1 complex is essential for histone monoubiquitination by the Rad6-Bre1 complex, which signals for histone methylation by COMPASS and Dot1p. The Journal of biological chemistry, 278, 34739-34742. 29. Osley, M.A. (2006) Regulation of histone H2A and H2B ubiquitylation. Brief Funct Genomic Proteomic, 5, 179-189. 30. Minsky, N., Shema, E., Field, Y., Schuster, M., Segal, E. and Oren, M. (2008) Monoubiquitinated H2B is associated with the transcribed region of highly expressed genes in human cells. Nature cell biology, 10, 483-488. 31. Arora, M., Zhang, J., Heine, G.F., Ozer, G., Liu, H.W., Huang, K. and Parvin, J.D. (2012) Promoters active in interphase are bookmarked during mitosis by ubiquitination. Nucleic acids research, 40, 10187-10202. 32. Pavri, R., Zhu, B., Li, G., Trojer, P., Mandal, S., Shilatifard, A. and Reinberg, D. (2006) Histone H2B monoubiquitination functions cooperatively with FACT to regulate elongation by RNA polymerase II. Cell, 125, 703-717. 33. Batta, K., Zhang, Z., Yen, K., Goffman, D.B. and Pugh, B.F. (2011 ) Genome-wide function of H2B ubiquitylation in promoter and genic regions. Genes & development, 25, 2254-2265. 34. Chandrasekharan, M.B., Huang, F. and Sun, Z.W. (2009) Ubiquitination of histone H2B regulates chromatin dynamics by enhancing nucleosome stability. Proceedings of the National Academy of Sciences of the United States of America, 106, 16686-16691. 35. Best, J.D., Berghmans, S., Hunt, J.J., Clarke, S.C., Fleming, A., Goldsmith, P. and Roach, A.G. (2008) Non-associative learning in larval zebrafish. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology, 33, 1206-1215. 36. Dover, J., Schneider, J., Tawiah-Boateng, M.A., Wood, A., Dean, K., Johnston, M. and Shilatifard, A. (2002) Methylation of histone H3 by COMPASS requires ubiquitination of histone H2B by Rad6. The Journal of biological chemistry, 277, 28368-28371.

120

37. Kim, J., Guermah, M., McGinty, R.K., Lee, J.S., Tang, Z., Milne, T.A., Shilatifard, A., Muir, T.W. and Roeder, R.G. (2009) RAD6-Mediated transcription-coupled H2B ubiquitylation directly stimulates H3K4 methylation in human cells. Cell, 137, 459-471. 38. Briggs, S.D., Xiao, T., Sun, Z.W., Caldwell, J.A., Shabanowitz, J., Hunt, D.F., Allis, C.D. and Strahl, B.D. (2002) Gene silencing: trans-histone regulatory pathway in chromatin. Nature, 418, 498. 39. Lee, J.S., Shukla, A., Schneider, J., Swanson, S.K., Washburn, M.P., Florens, L., Bhaumik, S.R. and Shilatifard, A. (2007) Histone crosstalk between H2B monoubiquitination and H3 methylation mediated by COMPASS. Cell, 131, 1084-1096. 40. Gao, Z., Zhang, J., Bonasio, R., Strino, F., Sawai, A., Parisi, F., Kluger, Y. and Reinberg, D. (2012) PCGF homologs, CBX proteins, and RYBP define functionally distinct PRC1 family complexes. Molecular cell, 45, 344-356. 41. Sanchez, C., Sanchez, I., Demmers, J.A., Rodriguez, P., Strouboulis, J. and Vidal, M. (2007) Proteomics analysis of Ring1B/Rnf2 interactors identifies a novel complex with the Fbxl10/Jhdm1B histone demethylase and the Bcl6 interacting corepressor. Molecular & cellular proteomics : MCP, 6, 820-834. 42. Ogawa, H., Ishiguro, K., Gaubatz, S., Livingston, D.M. and Nakatani, Y. (2002) A complex with chromatin modifiers that occupies E2F- and Myc-responsive genes in G0 cells. Science, 296, 1132-1136. 43. Zhou, W., Zhu, P., Wang, J., Pascual, G., Ohgi, K.A., Lozach, J., Glass, C.K. and Rosenfeld, M.G. (2008) Histone H2A monoubiquitination represses transcription by inhibiting RNA polymerase II transcriptional elongation. Molecular cell, 29, 69-80. 44. Huen, M.S., Grant, R., Manke, I., Minn, K., Yu, X., Yaffe, M.B. and Chen, J. (2007) RNF8 transduces the DNA-damage signal via histone ubiquitylation and checkpoint protein assembly. Cell, 131, 901-914. 45. Mailand, N., Bekker-Jensen, S., Faustrup, H., Melander, F., Bartek, J., Lukas, C. and Lukas, J. (2007) RNF8 ubiquitylates histones at DNA double-strand breaks and promotes assembly of repair proteins. Cell, 131, 887-900. 46. Zhu, Q., Pao, G.M., Huynh, A.M., Suh, H., Tonnu, N., Nederlof, P.M., Gage, F.H. and Verma, I.M. (2011) BRCA1 tumour suppression occurs via heterochromatin-mediated silencing. Nature, 477, 179-184. 47. Daniel, J.A., Torok, M.S., Sun, Z.W., Schieltz, D., Allis, C.D., Yates, J.R., 3rd and Grant, P.A. (2004) Deubiquitination of histone H2B by a yeast acetyltransferase complex regulates transcription. The Journal of biological chemistry, 279, 1867-1871. 48. Henry, K.W., Wyce, A., Lo, W.S., Duggan, L.J., Emre, N.C., Kao, C.F., Pillus, L., Shilatifard, A., Osley, M.A. and Berger, S.L. (2003) Transcriptional activation via sequential histone H2B ubiquitylation and deubiquitylation, mediated by SAGA-associated Ubp8. Genes & development, 17, 2648-2663. 49. Zhang, X.Y., Varthi, M., Sykes, S.M., Phillips, C., Warzecha, C., Zhu, W., Wyce, A., Thorne, A.W., Berger, S.L. and McMahon, S.B. (2008) The putative cancer 121

stem cell marker USP22 is a subunit of the human SAGA complex required for activated transcription and cell-cycle progression. Mol Cell, 29, 102-111. 50. Zhao, Y., Lang, G., Ito, S., Bonnet, J., Metzger, E., Sawatsubashi, S., Suzuki, E., Le Guezennec, X., Stunnenberg, H.G., Krasnov, A. et al. (2008) A TFTC/STAGA module mediates histone H2A and H2B deubiquitination, coactivates nuclear receptors, and counteracts heterochromatin silencing. Mol Cell, 29, 92-101. 51. Glinsky, G.V., Berezovska, O. and Glinskii, A.B. (2005) Microarray analysis identifies a death-from-cancer signature predicting therapy failure in patients with multiple types of cancer. The Journal of clinical investigation, 115, 1503-1521. 52. Zhang, Z., Jones, A., Joo, H.Y., Zhou, D., Cao, Y., Chen, S., Erdjument-Bromage, H., Renfrow, M., He, H., Tempst, P. et al. (2013) USP49 deubiquitinates histone H2B and regulates cotranscriptional pre-mRNA splicing. Genes & development, 27, 1581-1595. 53. van der Knaap, J.A., Kumar, B.R., Moshkin, Y.M., Langenberg, K., Krijgsveld, J., Heck, A.J., Karch, F. and Verrijzer, C.P. (2005) GMP synthetase stimulates histone H2B deubiquitylation by the epigenetic silencer USP7. Molecular cell, 17, 695-707. 54. Cummins, J.M., Rago, C., Kohli, M., Kinzler, K.W., Lengauer, C. and Vogelstein, B. (2004) Tumour suppression: disruption of HAUSP gene stabilizes p53. Nature, 428, 1 p following 486. 55. Li, M., Brooks, C.L., Kon, N. and Gu, W. (2004) A dynamic role of HAUSP in the p53-Mdm2 pathway. Molecular cell, 13, 879-886. 56. Joo, H.Y., Zhai, L., Yang, C., Nie, S., Erdjument-Bromage, H., Tempst, P., Chang, C. and Wang, H. (2007) Regulation of cell cycle progression and gene expression by H2A deubiquitination. Nature, 449, 1068-1072. 57. Nicassio, F., Corrado, N., Vissers, J.H., Areces, L.B., Bergink, S., Marteijn, J.A., Geverts, B., Houtsmuller, A.B., Vermeulen, W., Di Fiore, P.P. et al. (2007) Human USP3 is a chromatin modifier required for S phase progression and genome stability. Curr Biol, 17, 1972-1977. 58. Nakagawa, T., Kajitani, T., Togo, S., Masuko, N., Ohdan, H., Hishikawa, Y., Koji, T., Matsuyama, T., Ikura, T., Muramatsu, M. et al. (2008) Deubiquitylation of histone H2A activates transcriptional initiation via trans-histone cross-talk with H3K4 di- and trimethylation. Genes & development, 22, 37-49. 59. Zhu, P., Zhou, W., Wang, J., Puc, J., Ohgi, K.A., Erdjument-Bromage, H., Tempst, P., Glass, C.K. and Rosenfeld, M.G. (2007) A histone H2A deubiquitinase complex coordinating histone acetylation and H1 dissociation in transcriptional regulation. Molecular cell, 27, 609-621. 60. Jensen, D.E. and Rauscher, F.J., 3rd. (1999) BAP1, a candidate tumor suppressor protein that interacts with BRCA1. Annals of the New York Academy of Sciences, 886, 191-194. 61. Scheuermann, J.C., de Ayala Alonso, A.G., Oktaba, K., Ly-Hartig, N., McGinty, R.K., Fraterman, S., Wilm, M., Muir, T.W. and Muller, J. (2010) Histone H2A

122

deubiquitinase activity of the Polycomb repressive complex PR-DUB. Nature, 465, 243-247. 62. Jensen, D.E., Proctor, M., Marquis, S.T., Gardner, H.P., Ha, S.I., Chodosh, L.A., Ishov, A.M., Tommerup, N., Vissing, H., Sekido, Y. et al. (1998) BAP1: a novel ubiquitin hydrolase which binds to the BRCA1 RING finger and enhances BRCA1-mediated cell growth suppression. Oncogene, 16, 1097-1112. 63. Atanassov, B.S., Evrard, Y.A., Multani, A.S., Zhang, Z., Tora, L., Devys, D., Chang, S. and Dent, S.Y. (2009) Gcn5 and SAGA regulate shelterin protein turnover and telomere maintenance. Molecular cell, 35, 352-364. 64. Atanassov, B.S. and Dent, S.Y. (2011) USP22 regulates cell proliferation by deubiquitinating the transcriptional regulator FBP1. EMBO reports, 12, 924-930. 65. Chen, H.Y., Sun, J.M., Zhang, Y., Davie, J.R. and Meistrich, M.L. (1998) Ubiquitination of histone H3 in elongating spermatids of rat testes. The Journal of biological chemistry, 273, 13165-13169. 66. Pham, A.D. and Sauer, F. (2000) Ubiquitin-activating/conjugating activity of TAFII250, a mediator of activation of gene expression in Drosophila. Science, 289, 2357-2360. 67. Weake, V.M. and Workman, J.L. (2008) Histone ubiquitination: triggering gene activity. Molecular cell, 29, 653-663. 68. Wang, H., Zhai, L., Xu, J., Joo, H.Y., Jackson, S., Erdjument-Bromage, H., Tempst, P., Xiong, Y. and Zhang, Y. (2006) Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Molecular cell, 22, 383-394. 69. Sarcinella, E., Zuzarte, P.C., Lau, P.N., Draker, R. and Cheung, P. (2007) Monoubiquitylation of H2A.Z distinguishes its association with euchromatin or facultative heterochromatin. Molecular and cellular biology, 27, 6457-6468. 70. Ogawa, Y., Ono, T., Wakata, Y., Okawa, K., Tagami, H. and Shibahara, K.I. (2005) Histone variant macroH2A1.2 is mono-ubiquitinated at its histone domain. Biochemical and biophysical research communications, 336, 204-209. 71. Nathan, D., Ingvarsdottir, K., Sterner, D.E., Bylebyl, G.R., Dokmanovic, M., Dorsey, J.A., Whelan, K.A., Krsmanovic, M., Lane, W.S., Meluh, P.B. et al. (2006) Histone sumoylation is a negative regulator in Saccharomyces cerevisiae and shows dynamic interplay with positive-acting histone modifications. Genes & development, 20, 966-976. 72. Shiio, Y. and Eisenman, R.N. (2003) Histone sumoylation is associated with transcriptional repression. Proceedings of the National Academy of Sciences of the United States of America, 100, 13225-13230. 73. Liu, H.W., Zhang, J., Heine, G.F., Arora, M., Gulcin Ozer, H., Onti-Srinivasan, R., Huang, K. and Parvin, J.D. (2012) Chromatin modification by SUMO-1 stimulates the promoters of translation machinery genes. Nucleic acids research, 40, 10172-10186. 74. Margueron, R. and Reinberg, D. (2011) The Polycomb complex PRC2 and its mark in life. Nature, 469, 343-349.

123

75. Simon, J.A. and Kingston, R.E. (2009) Mechanisms of polycomb gene silencing: knowns and unknowns. Nature reviews. Molecular cell biology, 10, 697-708. 76. Margueron, R., Li, G., Sarma, K., Blais, A., Zavadil, J., Woodcock, C.L., Dynlacht, B.D. and Reinberg, D. (2008) Ezh1 and Ezh2 maintain repressive chromatin through different mechanisms. Molecular cell, 32, 503-518. 77. Cao, R. and Zhang, Y. (2004) SUZ12 is required for both the histone methyltransferase activity and the silencing function of the EED-EZH2 complex. Molecular cell, 15, 57-67. 78. Ketel, C.S., Andersen, E.F., Vargas, M.L., Suh, J., Strome, S. and Simon, J.A. (2005) Subunit contributions to histone methyltransferase activities of fly and worm polycomb group complexes. Molecular and cellular biology, 25, 6857- 6868. 79. Pasini, D., Bracken, A.P. and Helin, K. (2004) Polycomb group proteins in cell cycle progression and cancer. Cell cycle, 3, 396-400. 80. O'Meara, M.M. and Simon, J.A. (2012) Inner workings and regulatory inputs that control Polycomb repressive complex 2. Chromosoma, 121, 221-234. 81. Pandey, R.R., Mondal, T., Mohammad, F., Enroth, S., Redrup, L., Komorowski, J., Nagano, T., Mancini-Dinardo, D. and Kanduri, C. (2008) Kcnq1ot1 antisense noncoding RNA mediates lineage-specific transcriptional silencing through chromatin-level regulation. Molecular cell, 32, 232-246. 82. Tsai, M.C., Manor, O., Wan, Y., Mosammaparast, N., Wang, J.K., Lan, F., Shi, Y., Segal, E. and Chang, H.Y. (2010) Long noncoding RNA as modular scaffold of histone modification complexes. Science, 329, 689-693. 83. Zhao, J., Sun, B.K., Erwin, J.A., Song, J.J. and Lee, J.T. (2008) Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science, 322, 750-756. 84. Xu, K., Wu, Z.J., Groner, A.C., He, H.H., Cai, C., Lis, R.T., Wu, X., Stack, E.C., Loda, M., Liu, T. et al. (2012) EZH2 oncogenic activity in castration-resistant prostate cancer cells is Polycomb-independent. Science, 338, 1465-1469. 85. Lee, S.T., Li, Z., Wu, Z., Aau, M., Guan, P., Karuturi, R.K., Liou, Y.C. and Yu, Q. (2011) Context-specific regulation of NF-kappaB target gene expression by EZH2 in breast cancers. Mol Cell, 43, 798-810. 86. Mousavi, K., Zare, H., Wang, A.H. and Sartorelli, V. (2012) Polycomb protein Ezh1 promotes RNA polymerase II elongation. Mol Cell, 45, 255-262. 87. Yu, M., Mazor, T., Huang, H., Huang, H.T., Kathrein, K.L., Woo, A.J., Chouinard, C.R., Labadorf, A., Akie, T.E., Moran, T.B. et al. (2012) Direct recruitment of polycomb repressive complex 1 to chromatin by core binding transcription factors. Molecular cell, 45, 330-343. 88. Tavares, L., Dimitrova, E., Oxley, D., Webster, J., Poot, R., Demmers, J., Bezstarosti, K., Taylor, S., Ura, H., Koide, H. et al. (2012) RYBP-PRC1 complexes mediate H2A ubiquitylation at polycomb target sites independently of PRC2 and H3K27me3. Cell, 148, 664-678. 89. Cao, R., Tsukada, Y. and Zhang, Y. (2005) Role of Bmi-1 and Ring1A in H2A ubiquitylation and Hox gene silencing. Mol Cell, 20, 845-854. 124

90. Wang, H., Wang, L., Erdjument-Bromage, H., Vidal, M., Tempst, P., Jones, R.S. and Zhang, Y. (2004) Role of histone H2A ubiquitination in Polycomb silencing. Nature, 431, 873-878. 91. Voncken, J.W., Roelen, B.A., Roefs, M., de Vries, S., Verhoeven, E., Marino, S., Deschamps, J. and van Lohuizen, M. (2003) Rnf2 (Ring1b) deficiency causes gastrulation arrest and cell cycle inhibition. Proceedings of the National Academy of Sciences of the United States of America, 100, 2468-2473. 92. de Napoles, M., Mermoud, J.E., Wakao, R., Tang, Y.A., Endoh, M., Appanah, R., Nesterova, T.B., Silva, J., Otte, A.P., Vidal, M. et al. (2004) Polycomb group proteins Ring1A/B link ubiquitylation of histone H2A to heritable gene silencing and X inactivation. Dev Cell, 7, 663-676. 93. del Mar Lorente, M., Marcos-Gutierrez, C., Perez, C., Schoorlemmer, J., Ramirez, A., Magin, T. and Vidal, M. (2000) Loss- and gain-of-function mutations show a polycomb group function for Ring1A in mice. Development, 127, 5093-5100. 94. Gearhart, M.D., Corcoran, C.M., Wamstad, J.A. and Bardwell, V.J. (2006) Polycomb group and SCF ubiquitin ligases are found in a novel BCOR complex that is recruited to BCL6 targets. Molecular and cellular biology, 26, 6880-6889. 95. Alchanati, I., Teicher, C., Cohen, G., Shemesh, V., Barr, H.M., Nakache, P., Ben- Avraham, D., Idelevich, A., Angel, I., Livnah, N. et al. (2009) The E3 ubiquitin- ligase Bmi1/Ring1A controls the proteasomal degradation of Top2alpha cleavage complex - a potentially new drug target. PloS one, 4, e8104. 96. Francis, N.J., Kingston, R.E. and Woodcock, C.L. (2004) Chromatin compaction by a polycomb group protein complex. Science, 306, 1574-1577. 97. Grau, D.J., Chapman, B.A., Garlick, J.D., Borowsky, M., Francis, N.J. and Kingston, R.E. (2011) Compaction of chromatin by diverse Polycomb group proteins requires localized regions of high charge. Genes & development, 25, 2210-2221. 98. Eskeland, R., Leeb, M., Grimes, G.R., Kress, C., Boyle, S., Sproul, D., Gilbert, N., Fan, Y., Skoultchi, A.I., Wutz, A. et al. (2010) Ring1B compacts chromatin structure and represses gene expression independent of histone ubiquitination. Molecular cell, 38, 452-464. 99. Stock, J.K., Giadrossi, S., Casanova, M., Brookes, E., Vidal, M., Koseki, H., Brockdorff, N., Fisher, A.G. and Pombo, A. (2007) Ring1-mediated ubiquitination of H2A restrains poised RNA polymerase II at bivalent genes in mouse ES cells. Nature cell biology, 9, 1428-1435. 100. Brookes, E., de Santiago, I., Hebenstreit, D., Morris, K.J., Carroll, T., Xie, S.Q., Stock, J.K., Heidemann, M., Eick, D., Nozaki, N. et al. (2012) Polycomb associates genome-wide with a specific RNA polymerase II variant, and regulates metabolic genes in ESCs. Cell stem cell, 10, 157-170. 101. Breiling, A., Turner, B.M., Bianchi, M.E. and Orlando, V. (2001) General transcription factors bind promoters repressed by Polycomb group proteins. Nature, 412, 651-655.

125

102. Thomson, J.P., Skene, P.J., Selfridge, J., Clouaire, T., Guy, J., Webb, S., Kerr, A.R., Deaton, A., Andrews, R., James, K.D. et al. (2010) CpG islands influence chromatin structure via the CpG-binding protein Cfp1. Nature, 464, 1082-1086. 103. Muntean, A.G., Tan, J., Sitwala, K., Huang, Y., Bronstein, J., Connelly, J.A., Basrur, V., Elenitoba-Johnson, K.S. and Hess, J.L. (2010) The PAF complex synergizes with MLL fusion proteins at HOX loci to promote leukemogenesis. Cancer cell, 17, 609-621. 104. Lin, C.H., Lin, C., Tanaka, H., Fero, M.L. and Eisenman, R.N. (2009) Gene regulation and epigenetic remodeling in murine embryonic stem cells by c-Myc. PloS one, 4, e7839. 105. Wang, K.C., Yang, Y.W., Liu, B., Sanyal, A., Corces-Zimmerman, R., Chen, Y., Lajoie, B.R., Protacio, A., Flynn, R.A., Gupta, R.A. et al. (2011) A long noncoding RNA maintains active chromatin to coordinate homeotic gene expression. Nature, 472, 120-124. 106. Milne, T.A., Kim, J., Wang, G.G., Stadler, S.C., Basrur, V., Whitcomb, S.J., Wang, Z., Ruthenburg, A.J., Elenitoba-Johnson, K.S., Roeder, R.G. et al. (2010) Multiple interactions recruit MLL1 and MLL1 fusion proteins to the HOXA9 locus in leukemogenesis. Molecular cell, 38, 853-863. 107. Zhang, Z., Shibahara, K. and Stillman, B. (2000) PCNA connects DNA replication to epigenetic inheritance in yeast. Nature, 408, 221-225. 108. Shibahara, K. and Stillman, B. (1999) Replication-dependent marking of DNA by PCNA facilitates CAF-1-coupled inheritance of chromatin. Cell, 96, 575-585. 109. Sharif, J., Muto, M., Takebayashi, S., Suetake, I., Iwamatsu, A., Endo, T.A., Shinga, J., Mizutani-Koseki, Y., Toyoda, T., Okamura, K. et al. (2007) The SRA protein Np95 mediates epigenetic inheritance by recruiting Dnmt1 to methylated DNA. Nature, 450, 908-912. 110. Bostick, M., Kim, J.K., Esteve, P.O., Clark, A., Pradhan, S. and Jacobsen, S.E. (2007) UHRF1 plays a role in maintaining DNA methylation in mammalian cells. Science, 317, 1760-1764. 111. Taverna, S.D., Li, H., Ruthenburg, A.J., Allis, C.D. and Patel, D.J. (2007) How chromatin-binding modules interpret histone modifications: lessons from professional pocket pickers. Nature structural & molecular biology, 14, 1025- 1040. 112. Hansen, K.H., Bracken, A.P., Pasini, D., Dietrich, N., Gehani, S.S., Monrad, A., Rappsilber, J., Lerdrup, M. and Helin, K. (2008) A model for transmission of the H3K27me3 epigenetic mark. Nature cell biology, 10, 1291-1300. 113. Jansen, L.E., Black, B.E., Foltz, D.R. and Cleveland, D.W. (2007) Propagation of centromeric chromatin requires exit from mitosis. The Journal of cell biology, 176, 795-805. 114. Martinez-Balbas, M.A., Dey, A., Rabindran, S.K., Ozato, K. and Wu, C. (1995) Displacement of sequence-specific transcription factors from mitotic chromatin. Cell, 83, 29-38.

126

115. Valls, E., Sanchez-Molina, S. and Martinez-Balbas, M.A. (2005) Role of histone modifications in marking and activating genes through mitosis. The Journal of biological chemistry, 280, 42592-42600. 116. Kouskouti, A. and Talianidis, I. (2005) Histone modifications defining active genes persist after transcriptional and mitotic inactivation. EMBO J, 24, 347-357. 117. Chow, C.M., Georgiou, A., Szutorisz, H., Maia e Silva, A., Pombo, A., Barahona, I., Dargelos, E., Canzonetta, C. and Dillon, N. (2005) Variant histone H3.3 marks promoters of transcriptionally active genes during mammalian cell division. EMBO reports, 6, 354-360. 118. Ng, R.K. and Gurdon, J.B. (2008) Epigenetic memory of an active gene state depends on histone H3.3 incorporation into chromatin in the absence of transcription. Nature cell biology, 10, 102-109. 119. Blobel, G.A., Kadauke, S., Wang, E., Lau, A.W., Zuber, J., Chou, M.M. and Vakoc, C.R. (2009) A reconfigured pattern of MLL occupancy within mitotic chromatin promotes rapid transcriptional reactivation following mitotic exit. Mol Cell, 36, 970-983. 120. Young, D.W., Hassan, M.Q., Pratap, J., Galindo, M., Zaidi, S.K., Lee, S.H., Yang, X., Xie, R., Javed, A., Underwood, J.M. et al. (2007) Mitotic occupancy and lineage-specific transcriptional control of rRNA genes by Runx2. Nature, 445, 442-446. 121. Young, D.W., Hassan, M.Q., Yang, X.Q., Galindo, M., Javed, A., Zaidi, S.K., Furcinitti, P., Lapointe, D., Montecino, M., Lian, J.B. et al. (2007) Mitotic retention of gene expression patterns by the cell fate-determining transcription factor Runx2. Proceedings of the National Academy of Sciences of the United States of America, 104, 3189-3194. 122. Kadauke, S., Udugama, M.I., Pawlicki, J.M., Achtman, J.C., Jain, D.P., Cheng, Y., Hardison, R.C. and Blobel, G.A. (2012) Tissue-specific mitotic bookmarking by hematopoietic transcription factor GATA1. Cell, 150, 725-737. 123. Caravaca, J.M., Donahue, G., Becker, J.S., He, X., Vinson, C. and Zaret, K.S. (2013) Bookmarking by specific and nonspecific binding of FoxA1 pioneer factor to mitotic chromosomes. Genes & development, 27, 251-260. 124. Zhao, R., Nakamura, T., Fu, Y., Lazar, Z. and Spector, D.L. (2011) Gene bookmarking accelerates the kinetics of post-mitotic transcriptional re-activation. Nature cell biology, 13, 1295-1304. 125. Christova, R. and Oelgeschlager, T. (2002) Association of human TFIID- promoter complexes with silenced mitotic chromatin in vivo. Nature cell biology, 4, 79-82. 126. Xing, H., Vanderford, N.L. and Sarge, K.D. (2008) The TBP-PP2A mitotic complex bookmarks genes by preventing condensin action. Nature cell biology, 10, 1318-1323. 127. Kadauke, S. and Blobel, G.A. (2013) Mitotic bookmarking by transcription factors. Epigenetics & chromatin, 6, 6. 128. Follmer, N.E., Wani, A.H. and Francis, N.J. (2012) A polycomb group protein is retained at specific sites on chromatin in mitosis. PLoS genetics, 8, e1003135. 127

129. Michelotti, E.F., Sanford, S. and Levens, D. (1997) Marking of active genes on mitotic chromosomes. Nature, 388, 895-899. 130. Wu, R.S., Kohn, K.W. and Bonner, W.M. (1981) Metabolism of ubiquitinated histones. The Journal of biological chemistry, 256, 5916-5920. 131. Smith, K.P., Byron, M., Clemson, C.M. and Lawrence, J.B. (2004) Ubiquitinated proteins including uH2A on the human and mouse inactive X chromosome: enrichment in gene rich bands. Chromosoma, 113, 324-335. 132. Mayer, A., Gropper, R., Schwartz, A.L. and Ciechanover, A. (1989) Purification, characterization, and rapid inactivation of thermolabile ubiquitin-activating enzyme from the mammalian cell cycle mutant ts85. The Journal of biological chemistry, 264, 2060-2068. 133. Finley, D., Ciechanover, A. and Varshavsky, A. (1984) Thermolability of ubiquitin-activating enzyme from the mammalian cell cycle mutant ts85. Cell, 37, 43-55. 134. Mita, S., Yasuda, H., Marunouchi, T., Ishiko, S. and Yamada, M. (1980) A temperature-sensitive mutant of cultured mouse cells defective in chromosome condensation. Exp Cell Res, 126, 407-416. 135. Xiao, T., Kao, C.F., Krogan, N.J., Sun, Z.W., Greenblatt, J.F., Osley, M.A. and Strahl, B.D. (2005) Histone H2B ubiquitylation is associated with elongating RNA polymerase II. Molecular and cellular biology, 25, 637-651. 136. Barsoum, J. and Varshavsky, A. (1985) Preferential localization of variant nucleosomes near the 5'-end of the mouse dihydrofolate reductase gene. The Journal of biological chemistry, 260, 7688-7697. 137. Levinger, L. and Varshavsky, A. (1982) Selective arrangement of ubiquitinated and D1 protein-containing nucleosomes within the Drosophila genome. Cell, 28, 375-385. 138. Atanassov, B.S., Koutelou, E. and Dent, S.Y. (2011) The role of deubiquitinating enzymes in chromatin regulation. FEBS Lett, 585, 2016-2023. 139. Tagwerker, C., Flick, K., Cui, M., Guerrero, C., Dou, Y., Auer, B., Baldi, P., Huang, L. and Kaiser, P. (2006) A tandem affinity tag for two-step purification under fully denaturing conditions: application in ubiquitin profiling and protein complex identification combined with in vivocross-linking. Molecular & cellular proteomics : MCP, 5, 737-748. 140. Sankaran, S., Crone, D.E., Palazzo, R.E. and Parvin, J.D. (2007) Aurora-A kinase regulates breast cancer associated gene 1 inhibition of centrosome-dependent microtubule nucleation. Cancer research, 67, 11186-11194. 141. Horwitz, A.A., Affar el, B., Heine, G.F., Shi, Y. and Parvin, J.D. (2007) A mechanism for transcriptional repression dependent on the BRCA1 E3 ubiquitin ligase. Proceedings of the National Academy of Sciences of the United States of America, 104, 6614-6619. 142. Remboutsika, E., Lutz, Y., Gansmuller, A., Vonesch, J.L., Losson, R. and Chambon, P. (1999) The putative nuclear receptor mediator TIF1alpha is tightly associated with euchromatin. Journal of cell science, 112 ( Pt 11), 1671-1683.

128

143. Lee, T.I., Johnstone, S.E. and Young, R.A. (2006) Chromatin immunoprecipitation and microarray-based analysis of protein location. Nature protocols, 1, 729-748. 144. Rosenfeld, J.A., Wang, Z., Schones, D.E., Zhao, K., DeSalle, R. and Zhang, M.Q. (2009) Determination of enriched histone modifications in non-genic portions of the human genome. BMC genomics, 10, 143. 145. Carson, J.P., Zhang, N., Frampton, G.M., Gerry, N.P., Lenburg, M.E. and Christman, M.F. (2004) Pharmacogenomic identification of targets for adjuvant therapy with the topoisomerase poison camptothecin. Cancer research, 64, 2096- 2104. 146. Sadasivam, S., Duan, S. and DeCaprio, J.A. (2012) The MuvB complex sequentially recruits B-Myb and FoxM1 to promote mitotic gene expression. Genes & development, 26, 474-489. 147. Quinlan, A.R. and Hall, I.M. (2010) BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics, 26, 841-842. 148. Meierhofer, D., Wang, X., Huang, L. and Kaiser, P. (2008) Quantitative analysis of global ubiquitination in HeLa cells by mass spectrometry. Journal of proteome research, 7, 4566-4576. 149. Mitsui, A. and Sharp, P.A. (1999) Ubiquitination of RNA polymerase II large subunit signaled by phosphorylation of carboxyl-terminal domain. Proceedings of the National Academy of Sciences of the United States of America, 96, 6054-6059. 150. Starita, L.M., Horwitz, A.A., Keogh, M.C., Ishioka, C., Parvin, J.D. and Chiba, N. (2005) BRCA1/BARD1 ubiquitinate phosphorylated RNA polymerase II. The Journal of biological chemistry, 280, 24498-24505. 151. Thompson, N.E., Aronson, D.B. and Burgess, R.R. (1990) Purification of eukaryotic RNA polymerase II by immunoaffinity chromatography. Elution of active enzyme with protein stabilizing agents from a polyol-responsive monoclonal antibody. J Biol Chem, 265, 7069-7077. 152. Fujiki, R., Hashiba, W., Sekine, H., Yokoyama, A., Chikanishi, T., Ito, S., Imai, Y., Kim, J., He, H.H., Igarashi, K. et al. (2011) GlcNAcylation of histone H2B facilitates its monoubiquitination. Nature, 480, 557-560. 153. Santos-Rosa, H., Schneider, R., Bannister, A.J., Sherriff, J., Bernstein, B.E., Emre, N.C., Schreiber, S.L., Mellor, J. and Kouzarides, T. (2002) Active genes are tri-methylated at K4 of histone H3. Nature, 419, 407-411. 154. Schneider, R., Bannister, A.J., Myers, F.A., Thorne, A.W., Crane-Robinson, C. and Kouzarides, T. (2004) Histone H3 lysine 4 methylation patterns in higher eukaryotic genes. Nature cell biology, 6, 73-77. 155. Ng, H.H., Robert, F., Young, R.A. and Struhl, K. (2003) Targeted recruitment of Set1 histone methylase by elongating Pol II provides a localized mark and memory of recent transcriptional activity. Molecular cell, 11, 709-719. 156. Kizer, K.O., Phatnani, H.P., Shibata, Y., Hall, H., Greenleaf, A.L. and Strahl, B.D. (2005) A novel domain in Set2 mediates RNA polymerase II interaction and couples histone H3 K36 methylation with transcript elongation. Molecular and cellular biology, 25, 3305-3316. 129

157. Li, J., Moazed, D. and Gygi, S.P. (2002) Association of the histone methyltransferase Set2 with RNA polymerase II plays a role in transcription elongation. The Journal of biological chemistry, 277, 49383-49388. 158. Sun, X.J., Wei, J., Wu, X.Y., Hu, M., Wang, L., Wang, H.H., Zhang, Q.H., Chen, S.J., Huang, Q.H. and Chen, Z. (2005) Identification and characterization of a novel human histone H3 lysine 36-specific methyltransferase. The Journal of biological chemistry, 280, 35261-35271. 159. Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H., Tempst, P., Jones, R.S. and Zhang, Y. (2002) Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science, 298, 1039-1043. 160. Shema, E., Tirosh, I., Aylon, Y., Huang, J., Ye, C., Moskovits, N., Raver-Shapira, N., Minsky, N., Pirngruber, J., Tarcic, G. et al. (2008) The histone H2B-specific ubiquitin ligase RNF20/hBRE1 acts as a putative tumor suppressor through selective regulation of gene expression. Genes & development, 22, 2664-2676. 161. Mueller, R.D., Yasuda, H., Hatch, C.L., Bonner, W.M. and Bradbury, E.M. (1985) Identification of ubiquitinated histones 2A and 2B in Physarum polycephalum. Disappearance of these proteins at metaphase and reappearance at anaphase. The Journal of biological chemistry, 260, 5147-5153. 162. Sarge, K.D. and Park-Sarge, O.K. (2009) Mitotic bookmarking of formerly active genes: keeping epigenetic memories from fading. Cell Cycle, 8, 818-823. 163. Cook, J.C. and Chock, P.B. (1991) Association of ubiquitin-activating enzyme with HeLa cell chromosomes during mitosis. Proceedings of the National Academy of Sciences of the United States of America, 88, 11388-11392. 164. Sekiguchi, T., Miyata, T. and Nishimoto, T. (1988) Molecular cloning of the cDNA of human X chromosomal gene (CCG1) which complements the temperature-sensitive G1 mutants, tsBN462 and ts13, of the BHK cell line. The EMBO journal, 7, 1683-1687. 165. Hisatake, K., Hasegawa, S., Takada, R., Nakatani, Y., Horikoshi, M. and Roeder, R.G. (1993) The p250 subunit of native TATA box-binding factor TFIID is the cell-cycle regulatory protein CCG1. Nature, 362, 179-181. 166. Zaidi, S.K., Young, D.W., Montecino, M., Lian, J.B., Stein, J.L., van Wijnen, A.J. and Stein, G.S. (2010) Architectural epigenetics: mitotic retention of mammalian transcriptional regulatory information. Molecular and cellular biology, 30, 4758- 4766. 167. Liu, Y.L., Jiang, S.X., Yang, Y.M., Xu, H., Liu, J.L. and Wang, X.S. (2012) USP22 acts as an oncogene by the activation of BMI-1-mediated INK4a/ARF pathway and Akt pathway. Cell biochemistry and biophysics, 62, 229-235. 168. Li, Z.H., Yu, Y., Du, C., Fu, H., Wang, J. and Tian, Y. (2013) RNA interference- mediated USP22 gene silencing promotes human brain glioma apoptosis and induces cell cycle arrest. Oncology letters, 5, 1290-1294. 169. Jagani, Z., Wiederschain, D., Loo, A., He, D., Mosher, R., Fordjour, P., Monahan, J., Morrissey, M., Yao, Y.M., Lengauer, C. et al. (2010) The Polycomb group protein Bmi-1 is essential for the growth of multiple myeloma cells. Cancer research, 70, 5528-5538. 130

170. Stegmeier, F., Rape, M., Draviam, V.M., Nalepa, G., Sowa, M.E., Ang, X.L., McDonald, E.R., 3rd, Li, M.Z., Hannon, G.J., Sorger, P.K. et al. (2007) Anaphase initiation is regulated by antagonistic ubiquitination and deubiquitination activities. Nature, 446, 876-881. 171. Jacob, E., Hod-Dvorai, R., Schif-Zuck, S. and Avni, O. (2008) Unconventional association of the polycomb group proteins with cytokine genes in differentiated T helper cells. The Journal of biological chemistry, 283, 13471-13481. 172. Schaaf, C.A., Misulovin, Z., Gause, M., Koenig, A., Gohara, D.W., Watson, A. and Dorsett, D. (2013) Cohesin and polycomb proteins functionally interact to control transcription at silenced and active genes. PLoS genetics, 9, e1003560. 173. Lupo, R., Breiling, A., Bianchi, M.E. and Orlando, V. (2001) Drosophila chromosome condensation proteins Topoisomerase II and Barren colocalize with Polycomb and maintain Fab-7 PRE silencing. Molecular cell, 7, 127-136. 174. Pan, X., Papasani, M., Hao, Y., Calamito, M., Wei, F., Quinn Iii, W.J., Basu, A., Wang, J., Hodawadekar, S., Zaprazna, K. et al. (2013) YY1 controls Igkappa repertoire and B-cell development, and localizes with condensin on the Igkappa locus. The EMBO journal, 32, 1168-1182. 175. Yang, Z., He, N. and Zhou, Q. (2008) Brd4 recruits P-TEFb to chromosomes at late mitosis to promote G1 gene expression and cell cycle progression. Molecular and cellular biology, 28, 967-976. 176. Dey, A., Nishiyama, A., Karpova, T., McNally, J. and Ozato, K. (2009) Brd4 marks select genes on mitotic chromatin and directs postmitotic transcription. Molecular biology of the cell, 20, 4899-4909.

131

Appendix A: Supplementary Data tables

Promoters Fwd primer Rev primer

GAPDH 5'-GCTGGGCTCCGGCTCCAATT-3' 5'-GGACGGGGACCCTTACACGC-3'

RPS14 5'-GGTCGGGTTCCGGAAGACGC-3' 5'-ACCTCACCCCGCGGGTGTAG-3'

RPL19 5'-CGCCTGCGCAATCCAGCTGA-3' 5'-AGACATGCGCAGCAAGGGTTCC-3'

RPL7A 5’-CCGCCGCCCAAGATGGTGAG-3’ 5’-GGCAGCGGATACAGCCGGAA-3’

RPL3 5’-CCTTCGGAGTGCACCAGCGG-3’ 5’-TTGCTTTAGGGGCACGGGCG-3’

MYC 5’-CGTGGCAATGCGTTGCTGGG-3’ 5’-GCGCGTTCAGAGCGTGGGAT-3’

EIF6 5’-AGCCCAGCAGGGGAGTGGAG-3’ 5’-TCCGTCTCTGGCTGCGCTCT-3’

5'- 5'-

AACCCCCAAAGACTGACTGAATGGA- CCCCACCCCCTTAAAGAAAGGAGGA-

IL2 3' 3'

Coding

GAPDH 5'-CTGGGGCTGGCATTGCCCTC-3' 5'-GGCGCCAGACCCTGCACTTT-3'

Continued

Table 2: Sequences of the primers used for qPCR to amplify the promoter and coding regions of the indicated genes.

132

Table 2 continued

RPS14 5'-GCCTGAAGGCTGCACCCCAAA-3' 5'-GCAGCTCCCTCGCCCCATGA-3'

RPL19 5'-GGCCTGGGTAGTGGCCCGTT-3' 5'-TTCTGAGCAGCCGGCGCAAA-3'

MYC GTCCATGCCATAACCCAGCTGTCT CCAGCCACCCTTACTCCTCTCACC

EIF6 TGCCCAAATGCACTGTCGATGGA TGCCCTTAGGACTTGAAGCAAGTTC

5'- 5'-GGACAAGCCTCATCCCAAACTCCA-

IL2 TCTGCCTGCTTTCTGTGAAACTCAA-3' 3'

Gene Description Score Other relevant details (notes) name HS90B Heat shock protein 186 Cytosolic. Ubiquitinated in presence of HSP 90-beta OS STUB1-UBE2D1 4F2 4F2 cell-surface 178 Amino acid transport. antigen heavy chain LAT1 Large neutral amino 115 Cytosolic/membranous. acids transporter small subunit 1 S39A7 Zinc transporter 104 Cytosolic/membranous. SLC39A7 UBE2S Ubiquitin- 94 Essential factor of the APC/C for degradation conjugating enzyme of substrates to promote exit from mitosis. E2 S Ubiquitinated and degraded in G1. Continued

Table 3: List of proteins identified by LTQ mass spec in control but not RING1A depleted samples

133

Table 3 continued:

UBA1 Ubiquitin-like 92 modifier-activating enzyme 1 UBE2T Ubiquitin- 77 MMC induced DNA damage repair. conjugating enzyme Ubiquitinates FANCD2 through FANCL. E2 T Autoubiqituinated.

LDHB L-lactate 76 dehydrogenase B chain S39AE Zinc transporter 68 Membranous. Zn/Fe transport. ZIP14 TFR1 Transferrin receptor 65 protein 1 R13AX Putative 60S 61 Ribonucleoprotein. ribosomal protein L13a-like MGC87657 SPG20 Spartin 59 Endosomal trafficking. Microtubule dynamics. Known to be ubiquitinated. Interacts with aip4 aip5. KPYM Pyruvate kinase 54 isozymes M1/M2 Nuclear fragile X 52 Nuclear in G1, cytoplasmic in G2/M. mental retardation- phosphorylated by ATM/ATR. RNA binding. interacting protein 2

RAD23B UV excision repair 45 Binds to proteasome and poly-ub substrates protein RAD23 simultaneously. XPC: RAD23B induces a homolog B bend in DNA upon binding. XPC: RAD23B stimulates the activity of DNA glycosylases TDG and SMUG1. nuclear in G1 cytoplasmic in M. Continued

134

Table 3 continued:

MPCP Phosphate carrier 43 Mitochondrial transport protein protein, mitochondrial CI174 Uncharacterized 35 protein C9orf174 ZN281 Zinc finger protein 34 Involved in txn regulation. Core txn factor in 281 ESCs. KD causes osteogenic diffn of human multipotent cells. Mouse homolog important for maintenance of pluripotency. Associates with UTX (H3K27 demethylase) which also associates with ASH2L. UTX regulates association of PRC1 complex. FDFT Squalene synthase 31 TUT4 Terminal 29 Suppressor of miRNA biosynthesis. Causes uridylyltransferase degradation of let-7. Degradation of pre-let-7 4 contributes to the maintenance of embryonic stem (ES) cells and is required for ES cells to maintain pluripotency. Promotes cell proliferation independent of its RNA binding and uridyltransferase activity by promoting G1-S transition. Binds to Oct4. MGAP MAX gene- 28 Transcription factor. Part of the E2F6.com associated protein (binds to MYC and E2F responsive genes in G0 but not G1), PRC1 complex. CDK1 Cyclin-dependent 27 Obvious mitosis related functions kinase 1 DOC10 Dedicator of 27 cytokinesis protein 10 PI51C Phosphatidylinositol 27 4-phosphate 5- kinase type-1 gamma TEX15 Testis-expressed 26 Testis specific. Also expressed in several sequence 15 protein cancers. Mouse Tex15 needed for DNA repair and chromosome synapses in meiosis. ZKSC3 Zinc finger protein 25 Transcription factor. Promotes cancer cell with KRAB and migration. Promotes survival in anoikis SCAN domains 3 (inhibits apoptosis in cell suspension). Regulates cyclin D2 expression.

135

Gene name Functional and other relevant details 1 MGAP (MAX gene Pros Part of a complex (E2F6.com) that is known to interact associated protein) with Ring1A. Location may be right - as the complex binds to E2F and Myc responsive genes. E2Fs were also enriched in the TF binding analysis that was done by bioinformatics. Complex binds to promoters in G0 and promotes activation in G1. Cons No data on MGA or E2F6 complex with regards to mitosis (may not be a con as such). Technically, there was only one peptide that was recognized for this protein in MS. So may not be a reliable hit. Cannot think of a hypothetical situation where one member of the complex (Ring1a) might ubiquitinate another protein of the same complex. Also, this complex does not contain BMI1 but another PCGF - PCGF6. 2 ZNF281 (GC-box Pros Binds to Myc (y2h and MS data). Known for a role in binding zinc finger maintenance of pluripotency. Binds to demethylase 1) UTX which regulates PRC1 binding. cons Ub data does not overlap with H3K27me so ZNF281 binding to UTX may not be relevant. 3 RAD23B pros Another protein XRCC4 was identified in the TF binding analysis by the bioinformatics core. cons DNA repair protein. 4 ZKSCAN3 pros Ub peptide was identified in MS. Promotes survival in anoikis - a cell suspension situation - also faced during mitosis. cons Nothing else really points to a role at promoters in mitosis.

Table 4: Candidates from LTQ mass spec data selected for further testing

136

Gene name 5'-3' Sense strand sequence

RING1B (95) GCACAAAUGAGCCUUUAAAAACCdAdA

RING1A GAGUGUCCUACCUGCCGdTdT

BMI1 CUAUCGUCCAAUUUGCUUUdTdT

USP22 CCACAAAGCAGCUCACUAUdTdT

RNF20 AAGAAGGCAGCUGUUGAAGAUdTdT

TOP2A CAAGAAGUGUUCAGCUGUAdTdT

TAF1 (TAFII250) UGGAGUGGAAAUCCUCACUGUCCUC

Table 5: siRNA sequences used in this dissertation

137