Cytogenetics in Oncology and Haematology

Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Scope

The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It presents structured review articles ("cards") on genes, leukaemias, solid tumours, cancer-prone diseases, more traditional review articles on these and also on surrounding topics ("deep insights"), case reports in hematology, and educational items in the various related topics for students in Medicine and in Sciences.

Editorial correspondance

Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected]

Staff Mohammad Ahmad, Mélanie Arsaban, Mikael Cordon, Isabelle Dabin, Marie-Christine Jacquemot-Perbal, Maureen Labarussias, Anne Malo, Catherine Morel-Pair, Laurent Rassinoux, Sylvie Yau Chun Wan - Senon, Alain Zasadzinski. Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave Roussy Institute – Villejuif – France).

The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008.

The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS. Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Scope

Editorial correspondance

Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected]

The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Editor

Jean-Loup Huret (Poitiers, France) Editorial Board

Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section Alessandro Beghini (Milan, Italy) Genes Section Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections Judith Bovée (Leiden, The Netherlands) Solid Tumours Section Vasantha Brito-Babapulle (London, UK) Leukaemia Section Charles Buys (Groningen, The Netherlands) Deep Insights Section Anne Marie Capodano (Marseille, France) Solid Tumours Section Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections Antonio Cuneo (Ferrara, Italy) Leukaemia Section Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section Louis Dallaire (Montreal, Canada) Education Section Brigitte Debuire (Villejuif, France) Deep Insights Section François Desangles (Paris, France) Leukaemia / Solid Tumours Sections Enric Domingo-Villanueva (London, UK) Solid Tumours Section Ayse Erson (Ankara, Turkey) Solid Tumours Section Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections Anne Hagemeijer (Leuven, Belgium) Deep Insights Section Nyla Heerema (Colombus, Ohio) Leukaemia Section Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections Sakari Knuutila (Helsinki, Finland) Deep Insights Section Lidia Larizza (Milano, Italy) Solid Tumours Section Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section Edmond Ma (Hong Kong, China) Leukaemia Section Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections Yasmin Mehraein (Homburg, Germany) Cancer-Prone Diseases Section Fredrik Mertens (Lund, Sweden) Solid Tumours Section Konstantin Miller (Hannover, Germany) Education Section Felix Mitelman (Lund, Sweden) Deep Insights Section Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section Mariano Rocchi (Bari, Italy) Genes Section Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section Albert Schinzel (Schwerzenbach, Switzerland) Education Section Clelia Storlazzi (Bari, Italy) Genes Section Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections Dan Van Dyke (Rochester, Minnesota) Education Section Roberta Vanni (Montserrato, Italy) Solid Tumours Section Franck Viguié (Paris, France) Leukaemia Section José Luis Vizmanos (Pamplona, Spain) Leukaemia Section Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8)

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Volume 13, Number 8, August 2009

Table of contents

Gene Section

BIN1 (bridging integrator 1) 543 Mee Young Chang, George C Prendergast CFLAR (CASP8 and FADD-like apoptosis regulator) 549 Christophe Le Clorennec, Daniel B Longley, Timothy Wilson ELAVL1 (ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)) 556 Virginie Dormoy-Raclet, Imed-Eddine Gallouzi IGF1R (insulin-like growth factor 1 receptor) 559 Itay Bentov, Haim Werner MIR221 (microRNA 221) 562 Shiva Akhavan Tabasi, Ayse Elif Erson MIR222 (microRNA 222) 566 Shiva Akhavan Tabasi, Ayse Elif Erson PAF1 (Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)) 570 Shonali Deb, Moorthy P Ponnusamy, Surinder K Batra PTPN13 (Protein tyrosine phosphatase, non-receptor type 13) 573 Alessandro Beghini USP7 (ubiquitin specific peptidase 7 (herpes virus-associated)) 576 Kwang-Hyun Baek, Suresh Ramakrishna

Leukaemia Section

Chronic myelogenous leukaemia (CML) 580 Ali G Turhan t(3;21)(p12;q22) 587 Jean-Loup Huret t(8;17)(p12;q25) 588 Jean-Loup Huret t(X;21)(p11;q22) 589 Jean-Loup Huret

Solid Tumour Section

Nervous System: Glioma: an overview 591 Ivana Magnani

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Soft tissue tumors: Dermatofibrosarcoma protuberans 600 Kayuri Patel, Dolores Lopez-Terrada

Cancer Prone Disease Section

Maffucci syndrome 603 Twinkal C Pansuriya, Judith VMG Bovée Multiple osteochondromas (MO) 605 Christianne MA Reijnders, Judith VMG Bovée Ollier disease 608 Twinkal C Pansuriya, Judith VMG Bovée

Deep Insight Section

JAK2 mutations in myeloproliferative neoplasms 612 Naseema Gangat, Ayalew Tefferi

Case Report Section

A Case of Myelodysplastic Syndrome with a Translocation t(1;12)(p36;p13) 618 Ulrike Bacher, Torsten Haferlach, Claudia Haferlach Translocation t(5;17)(q13;q21) as the sole cytogenetic anomaly in acute myeloid leukemia after chemotherapy and allogeneic bone marrow transplantation for AML-M4: a case report 620 Elvira D Rodrigues Pereira Velloso, Cristina A Ratis, Edi Cabral, Denize Gonsalez, Nydia S Bacal, Cristóvão LP Mangueira

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8)

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Review

BIN1 (bridging integrator 1) Mee Young Chang, George C Prendergast Lankenau Institute for Medical Research, Lankenau Hospital, Wynnewood, Pennsylvania 19096, USA (MYC, GCP)

Published in Atlas Database: September 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/BIN1ID794ch2q14.html DOI: 10.4267/2042/44530 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

The murine Bin1 gene is similarly sized but localized Identity to a syntenic locus on mouse chromosome 8. Other names: AMPH-II; AMPH2; AMPHL; ALP; DKFZp547F068; MGC10367; SH3P9 Transcription HGNC (Hugo): BIN1 The Bin1 promoter is rich in CpG methylation residues and transcription of the gene produces more than 10 Location: 2q14.3 alternative transcripts that are from 2075 to 2637 bp mRNA in size: isoform 1 (2637 bp), isoform 2 (2508 DNA/RNA bp), isoform 3 (2376 bp), isoform 4 (2333 bp), isoform Description 5 (2412 bp), isoform 6 (2289 bp), isoform 7 (2283 bp), isoform 8 (2210) bp, isoform 9 (2165bp), and isoform The human BIN1 gene is encoded by at least 16 exons 10 (2075 bp). spanning at least 59,258 bps at chromosome 2q14-2q21 (nucleotides 127,522,078-127,581,334).

At least 10 alternate protein isoforms of Bin1 are expressed in different tissues. Isoforms 9 and 10 are ubiquitous. Isoform 8 is muscle- specific. Isoforms 1-7 are expressed predominantly in the central nervous system. Two tumor-specific isoforms include an exon termed 12A that is normally spliced into Bin1 mRNA only with other exons expressed in the central nervous system. These tumor-specific isoforms occur commonly in cancer and they represent loss of function with regard to tumor suppression activity and nuclear localization capability. BAR, BAR domain; SH3, SH3 domain; MBD, Myc binding domain; CLAP, clathrin-associated protein binding region; PI, phosphoinositide binding region. Exons are numbered by reference to Wechsler-Reya et al. (1997).

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 543 BIN1 (bridging integrator 1) Chang MY, Prendergast GC

Isoforms 9 and 10 are ubiquitous in expression. includes the so-called F-BAR and I-BAR adapter Isoform 8 is expressed specifically in skeletal muscle. proteins. Isoforms 1-7 are expressed predominantly in the central Membrane binding and tubulation: The Bin1 BAR nervous system. domain can mediate binding and tubulation of curved An aberrant isoform has been reported to be expressed membranes. Crystal structures of the BAR domains specifically in tumor cells. from human BIN1 and its fruit fly homolog reveal a Pseudogene dimeric banana-shaped 6-alpha-helix bundle that can nestle against the charged head groups on a curved None reported. lipid bilayer. Structural studies implicate specific alpha-helices in tubulation activity. Biochemical Protein analyses implicate Bin1 in vesicle fission and fusion processes, with the SH3 domain providing an essential Description contribution to these processes through the recruitment Bin1 contains N-terminal BAR (Bin1/Amphihysin/Rvs) of dynamins. domain with predicted coiled-coil structure and a C- Vesicle trafficking: Bin1 is implicated in endocytosis terminal SH3 domain. Bin1 encodes proteins of 409 to and intracellular endosome traffic through interactions 593 amino acids; isoform 1 (593 aa), isoform 2 (550 with Rab5 guanine nucleotide exchange factors (Rab aa), isoform 3 (506 aa), isoform 4 (497 aa), isoform 5 GEFs) and the sorting nexin protein Snx4. Complexes (518 aa), isoform 6 (482 aa), isoform 7 (475 aa), of neuronal Amph-I with neuron-specific isoforms of isoform 8 (454 aa), isoform 9 (439 aa), and isoform 10 Bin1 (Amph-II) have been implicated in synaptic (409 aa). Isoform 10 is the smallest and isoform 1 is the vesicle recycling in the brain. Genetic studies of the largest in size. Also, Bin1 has predicted molecular Bin1 homolog in budding yeast indicate an essential weight of 45432 to 64568 Da; isoform 1 (64568 Da), role in endocytosis, however, this role appears to be isoform 2 (59806 Da), isoform 3 (55044 Da), isoform 4 non-essential for homologs in fission yeast, fruit flies, (54817 Da), isoform 5 (56368 Da), isoform 6 (52889 and mice. Da), isoform 7 (51606 Da), isoform 8 (50054 Da), Cell polarity: genetic analyses of the Bin1 homologs in isoform 9 (48127 Da), and isoform 10 (45432 Da). yeast and fruit flies suggest a integrative function in Isoforms 9 and 10 are ubiquitous in expression. cell polarity, possibly mediated by effects on actin Isoform 8 is expressed specifically in skeletal muscle. organization and vesicle trafficking. In budding yeast, Isoforms 1-7 are expressed predominantly in the central the Bin1 homolog RVS167 lies at a central nodal point nervous system. These 10 different splice isoforms for integrating cell polarity signaling. Genetic ablation differ widely in subcellular localization, tissue of the Bin1 homolog in fruit flies causes distribution, and ascribed functions, with isoforms 1-7 mislocalization of the cell polarity complex predominantly cytosolic but isoforms 8-10 found in Dlg/Scr/Lgl, normally localized to the tight junction, both the nucleus and/or cytosol of certain cell types. that is implicated in epithelial polarity and suppression Expression of tumor-like growths in flies. Transcription: Ubiquitous and muscle-specific isoforms Bin1 is widely expressed. Patterns of isoform of Bin1 that can localize to the nucleus can bind to c- expression are noted above in the diagram legend. Myc and suppress its transcriptional transactivation Localisation activity. Tethering the BAR domain of Bin1 to DNA is Bin1 is localized both in nuclear and cytosolic in the sufficient to repress transcription. Genetic studies in cerebral cortex and cerebellum of brain. Bin1 is fission yeast demonstrate that the functional homolog localized mainly in nuclear in bone marrow cells hob1+ is essential to silence transcription of whereas it is localized mainly in cytosolic in peripheral heterochromatin at telomeric and centromeric lymphoid cells. Bin1 is nuclear or nucleocytosolic in chromosomal loci by supporting a Rad6-Set1 pathway basal cells of skin, breast, or prostate, whereas it is of transcriptional repression. cytosolic or plasma membrane localized in Muscle function: Mutations of the human BIN1 gene gastrointestinal cells. are associated with centronuclear myopathy, a disorder marked by severe muscle weakness. Mouse genetic Function studies indicate that Bin1 is required for cardiac Bin1 encodes members of the BAR development. In skeletal muscle, Bin1 localizes to T (Bin/Amphiphysin/Rvs) adapter family which have tubules where it appears to support ion flux. In vitro been implicated in membrane dynamics, such as vesicle studies of terminal muscle differentiation implicate fusion and trafficking, specialized membrane Bin1 in myoblast cell cycle arrest and fusion during organization, actin organization, cell polarity, stress tubule formation. signaling, transcription, and tumor suppression. BAR Apoptosis and Senescence: Bin1 is crucial for the adapter proteins are now recognized to be part of a function of default pathways of classical apoptosis or larger superfamily of structurally related proteins that senescence triggered by the Myc or Raf oncogenes in

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 544 BIN1 (bridging integrator 1) Chang MY, Prendergast GC

primary cells. In human tumor cells, enforced K35N and D151N. Another mutation that has been expression of Bin1 triggers a non-classical program of identified, K575X, generates a prematurely terminated cell death that is caspase independent and associated Bin1 protein implicated in loss of function. with activation of serine proteases. Somatic Tumor suppression: Attenuation of Bin1 function by silencing or missplicing is a frequent event in multiple Loss of heterozygosity of Bin1 in cases of metastatic human cancers including breast, prostate, skin, lung, prostate cancer has been reported in the absence of and colon cancers. In breast cancer, attenuated mutation of the remaining allele. Infrequent instances expression of Bin1 is associated with increased of gene deletions have been reported in breast tumor metastasis and poor clinical outcome. In human tumor cell lines. cells, ectopic expression of ubiquitous or muscle Bin1 Epigenetics isoforms causes growth arrest or caspase-independent Attentuated expression or missplicing occurs in many cell death. A Bin1 missplicing event that occurs cases of breast, prostate, lung, skin, brain and colon frequently in human cancers is sufficient to extinguish cancers. Expression analyses have identified Bin1 these activities. In primary rodent cells, Bin1 inhibits missplicing as among the most common missplicing oncogenic co-transformation by Myc, adenovirus E1A, events occurring in cancer. or mutant p53 but not SV40 T antigen. Mouse genetic studies establish that loss of Bin1 causes lung and liver cancers during aging. In mice where breast or colon Implicated in tumors are initiated by carcinogen treatment, Bin1 Centronuclear myopathy deletion causes progression to more aggressive malignant states. Oncogenically transformed cells Note lacking Bin1 exhibit reduced susceptibility to apoptosis Germ-line mutations of Bin1 are associated with and increased proliferation, invasion, immune escape, formation of this rare familial disorder characterized by and tumor formation. Activation of metalloproteinase abnormal centralization of nuclei in muscle fibers and MMP9 and immunosuppressive enzyme indoleamine severe muscle weakness. In five affected individuals 2,3-dioxygenase (IDO) have been implicated studied from three non-sanguineous families, two respectively in invasion and immune escape caused by mutations extinguishing the membrane binding activity Bin1 loss. of the BAR domain were identified along one mutation Null phenotype in mouse: Bin1 knockout mice are causing a prematurely terminated Bin1 polypeptide. perinatal lethal owing to myocardial hypertrophy where Cardiomyopathy myofibrils of ventricular cardiomyocytes are severely Note disorganized. Genetic mosaic mice display increased Dilated cardiomyopathy (DCM) is a leading cause of susceptibility to inflammation, premalignant lesions in heart failure with as much as >25% of cases of familial prostate and pancreas, and formation of liver and lung etiology. A whole genome screen performed in a three- carcinoma. Female mosaic mice exhibit increased generation family with 12 affected individuals with fecundity during aging. Tissue-specific gene ablation in autosomal dominant familial DCM defined linkage to skin or breast facilitates carcinogenesis. chromosome 2q14-q22 where the human BIN1 gene is Homology located. While BIN1 was not specifically identified as The longest Bin1 alternate splice variant in human the germane locus, mouse studies indicate that genetic brain exhibits 71% amino acid sequences similarity and ablation causes cardiomyopathy during development. 55% amino acid sequence identity with amphiphysin-I Moreover, in mice where Bin1 is ablated after birth in a (amph-I). Bin1 is also closely related to the mammalian tissue-specific manner in cardiomyocytes, a progressive amphiphysin-like genes Bin2 and Bin3. Genetic cardiomyopathy develops consistent with the homologs of Bin1 that exist in budding and fission possibility that Bin1 loss of function may be a cause of yeast (RVS167 and hob1+) and in fruit flies DCM. (amphiphysin) are well-characterized. Breast Cancer Oncogenesis Mutations Breast cancer is the second leading cause of cancer Germinal death in women following lung cancer. Bin1 expression is attenuated significantly in >50% of cases of Germ-line mutations leading to nonsynonymous malignant breast cancer by immunohistochemical or alterations in Bin1 have been associated with the RT-PCR analysis. Reduced levels of Bin1 are familial muscle weakness disorder centronuclear correlated to increased nodal metastasis and reduced myopathy, a disorder characterized by abnormal survival in low or middle grade carcinomas. Mouse centralization of nuclei in muscle fibers. Two missense genetic studies indicate that Bin1 is non-essential for alterations the BAR domain that have been identified as mammary gland development but that it is needed for loss of function mutations for membrane binding are

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 545 BIN1 (bridging integrator 1) Chang MY, Prendergast GC

the rapid kinetics of ductolobular remodeling during most primary tumors, even at slightly elevated levels pregnancy and weaning. In mammary gland tumors relative to benign tissues, but it is frequently grossly initiated by the ras-activating carcinogen 7,12- attenuated in expression or inactivated by aberrant dimethylbenzanthracene (DMBA), Bin1 loss strongly splicing in metastatic tumors and androgen- accentuates the formation of poorly differentiated independent tumor cell lines. Ectopic expression tumors characterized by low tubule formation, high suppresses the growth of prostate cancer cell lines in mitotic indices, and high degree of nuclear vitro. Mouse genetic studies indicate that Bin1 loss is pleomorphism. Bin1 loss facilitates tumor progression associated with an increased incidence of prostate at several intrinsic levels, including increased inflammation, atrophy, hypertrophy, and intraepithelial proliferation, survival, and motility of mouse mammary neoplasia during aging. epithelial cells (MMECs) established from DMBA- Neuroblastoma induced tumors. Oncogenesis Lung Cancer Neuroblastoma (NB) is the most common solid tumor Oncogenesis of childhood and is responsible for 15% of childhood Lung cancer is a leading cause of death from cancer. cancer-related deaths. Bin1 expression is grossly Bin1 expression has been reported to be attenuated reduced in MYCN amplified and metastatic NB significantly in cases of lung adenocarcinoma by compared with MYCN single-copy and localized NB immunohistochemical analysis. Mouse genetic studies as evaluated by real-time RT-PCR. Enforced demonstrate that Bin1 loss is associated with formation expression of Bin1 in MYCN amplified human NB cell of lung adenocarcinoma during aging, indicating that lines markedly inhibits colony formation. Bin1 attenuation drives disease incidence. Chronic Inflammation Colon Cancer Note Mouse genetic studies indicate that Bin1 loss increases Oncogenesis the general incidence of chronic inflammation in the Colorectal cancer is the third most common cancer in heart, pancreas, liver, and prostate. the developed world. Bin1 expression has been reported to be attenuated significantly in ~50% of cases Female Fecundity of colon cancer by Immunohistochemical analysis. Note Mouse genetic studies indicate that, in colon tumors Mouse genetic studies indicate that mosaic loss of Bin1 initiated by treatment with the carcinogen increases reproductive physiology during aging. dimethylhydrazine (DMH), Bin1 loss facilitates Specifically, female mosaic mice exhibit extended progression to more aggressive tumors with a higher fecundity during aging, retaining reproductive multiplicity. capability ~6 months longer than control mice. Skin Cancer Breakpoints Oncogenesis Skin cancer is the most common form of cancer. Basal Note cell cancer and squamous cell cancer are most common None reported. and treatable whereas melanoma is less common and deadlier. Studies of human melanoma revealed that To be noted Bin1 is inappropriately expressed as tumor cell-specific isoforms that include exon 12A, which is alternately Note spliced into isoforms found in the central nervous N/A system but not normally on its own in melanocytes or other non-neuronal cells. This aberrant splicing event References abolishes the tumor suppressor functions of Bin1 based Cher ML, Bova GS, Moore DH, Small EJ, Carroll PR, Pin SS, on the loss of its anti-oncogenic and programmed cell Epstein JI, Isaacs WB, Jensen RH. Genetic alterations in death inducing activities in oncogenically transformed untreated metastases and androgen-independent prostate cancer detected by comparative genomic hybridization and cells and melanoma cells. Mouse genetic studies allelotyping. Cancer Res. 1996 Jul 1;56(13):3091-102 indicate that Bin1 loss facilitates skin carcinogenesis. Sakamuro D, Elliott KJ, Wechsler-Reya R, Prendergast GC. Prostate Cancer BIN1 is a novel MYC-interacting protein with features of a Oncogenesis tumour suppressor. Nat Genet. 1996 Sep;14(1):69-77 Prostate cancer is the leading cause of death in men Butler MH, David C, Ochoa GC, Freyberg Z, Daniell L, Grabs older than 55 years of age. Loss of heterozygosity of D, Cremona O, De Camilli P. Amphiphysin II (SH3P9; BIN1), a member of the amphiphysin/Rvs family, is concentrated in the the human BIN1 gene has been reported in ~40% of cortical cytomatrix of axon initial segments and nodes of cases of metastatic prostate cancer. Bin1 is expressed in ranvier in brain and around T tubules in skeletal muscle. J Cell Biol. 1997 Jun 16;137(6):1355-67

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 546 BIN1 (bridging integrator 1) Chang MY, Prendergast GC

Wechsler-Reya R, Sakamuro D, Zhang J, Duhadaway J, Tajiri T, Liu X, Thompson PM, Tanaka S, Suita S, Zhao H, Prendergast GC. Structural analysis of the human BIN1 gene. Maris JM, Prendergast GC, Hogarty MD. Expression of a Evidence for tissue-specific transcriptional regulation and MYCN-interacting isoform of the tumor suppressor BIN1 is alternate RNA splicing. J Biol Chem. 1997 Dec reduced in neuroblastomas with unfavorable biological 12;272(50):31453-8 features. Clin Cancer Res. 2003 Aug 15;9(9):3345-55 Wechsler-Reya RJ, Elliott KJ, Prendergast GC. A role for the Kojima C, Hashimoto A, Yabuta I, Hirose M, Hashimoto S, putative tumor suppressor Bin1 in muscle cell differentiation. Kanaho Y, Sumimoto H, Ikegami T, Sabe H. Regulation of Mol Cell Biol. 1998 Jan;18(1):566-75 Bin1 SH3 domain binding by phosphoinositides. EMBO J. 2004 Nov 10;23(22):4413-22 Ge K, DuHadaway J, Du W, Herlyn M, Rodeck U, Prendergast GC. Mechanism for elimination of a tumor suppressor: aberrant Muller AJ, DuHadaway JB, Donover PS, Sutanto-Ward E, splicing of a brain-specific exon causes loss of function of Bin1 Prendergast GC. Targeted deletion of the suppressor gene in melanoma. Proc Natl Acad Sci U S A. 1999 Aug bin1/amphiphysin2 accentuates the neoplastic character of 17;96(17):9689-94 transformed mouse fibroblasts. Cancer Biol Ther. 2004 Dec;3(12):1236-42 Jung M, Poepping I, Perrot A, Ellmer AE, Wienker TF, Dietz R, Reis A, Osterziel KJ. Investigation of a family with autosomal Pineda-Lucena A, Ho CS, Mao DY, Sheng Y, Laister RC, dominant dilated cardiomyopathy defines a novel locus on Muhandiram R, Lu Y, Seet BT, Katz S, Szyperski T, Penn LZ, chromosome 2q14-q22. Am J Hum Genet. 1999 Arrowsmith CH. A structure-based model of the c-Myc/Bin1 Oct;65(4):1068-77 protein interaction shows alternative splicing of Bin1 and c-Myc phosphorylation are key binding determinants. J Mol Biol. 2005 Ge K, Duhadaway J, Sakamuro D, Wechsler-Reya R, Aug 5;351(1):182-94 Reynolds C, Prendergast GC. Losses of the tumor suppressor BIN1 in breast carcinoma are frequent and reflect deficits in Casal E, Federici L, Zhang W, Fernandez-Recio J, Priego EM, programmed cell death capacity. Int J Cancer. 2000 Feb Miguel RN, DuHadaway JB, Prendergast GC, Luisi BF, Laue 1;85(3):376-83 ED. The crystal structure of the BAR domain from human Bin1/amphiphysin II and its implications for molecular Ge K, Minhas F, Duhadaway J, Mao NC, Wilson D, recognition. Biochemistry. 2006 Oct 31;45(43):12917-28 Buccafusca R, Sakamuro D, Nelson P, Malkowicz SB, Tomaszewski J, Prendergast GC. Loss of heterozygosity and Dawson JC, Legg JA, Machesky LM. Bar domain proteins: a tumor suppressor activity of Bin1 in prostate carcinoma. Int J role in tubulation, scission and actin assembly in clathrin- Cancer. 2000 Apr 15;86(2):155-61 mediated endocytosis. Trends Cell Biol. 2006 Oct;16(10):493-8 Hogarty MD, Liu X, Thompson PM, White PS, Sulman EP, Itoh T, De Camilli P. BAR, F-BAR (EFC) and ENTH/ANTH Maris JM, Brodeur GM. BIN1 inhibits colony formation and domains in the regulation of membrane-cytosol interfaces and induces apoptosis in neuroblastoma cell lines with MYCN membrane curvature. Biochim Biophys Acta. 2006 amplification. Med Pediatr Oncol. 2000 Dec;35(6):559-62 Aug;1761(8):897-912 Razzaq A, Robinson IM, McMahon HT, Skepper JN, Su Y, Ren G, Vajjhala P, Lee JS, Winsor B, Munn AL. The BAR Zelhof AC, Jackson AP, Gay NJ, O'Kane CJ. Amphiphysin is domain proteins: molding membranes in fission, fusion, and necessary for organization of the excitation-contraction phagy. Microbiol Mol Biol Rev. 2006 Mar;70(1):37-120 coupling machinery of muscles, but not for synaptic vesicle endocytosis in Drosophila. Genes Dev. 2001 Nov Tajiri T, Tanaka S, Higashi M, Kinoshita Y, Takahashi Y, 15;15(22):2967-79 Tatsuta K, Suita S. Biological diagnosis for neuroblastoma using the combination of highly sensitive analysis of prognostic Zelhof AC, Bao H, Hardy RW, Razzaq A, Zhang B, Doe CQ. factors. J Pediatr Surg. 2006 Mar;41(3):560-6 Drosophila Amphiphysin is implicated in protein localization and membrane morphogenesis but not in synaptic vesicle Chang MY, Boulden J, Katz JB, Wang L, Meyer TJ, Soler AP, endocytosis. Development. 2001 Dec;128(24):5005-15 Muller AJ, Prendergast GC. Bin1 ablation increases susceptibility to cancer during aging, particularly lung cancer. Lee E, Marcucci M, Daniell L, Pypaert M, Weisz OA, Ochoa Cancer Res. 2007 Aug 15;67(16):7605-12 GC, Farsad K, Wenk MR, De Camilli P. Amphiphysin 2 (Bin1) and T-tubule biogenesis in muscle. Science. 2002 Aug Chang MY, Boulden J, Sutanto-Ward E, Duhadaway JB, Soler 16;297(5584):1193-6 AP, Muller AJ, Prendergast GC. Bin1 ablation in mammary gland delays tissue remodeling and drives cancer progression. DuHadaway JB, Du W, Donover S, Baker J, Liu AX, Sharp Cancer Res. 2007 Jan 1;67(1):100-7 DM, Muller AJ, Prendergast GC. Transformation-selective apoptotic program triggered by farnesyltransferase inhibitors Chitu V, Stanley ER. Pombe Cdc15 homology (PCH) proteins: requires Bin1. Oncogene. 2003 Jun 5;22(23):3578-88 coordinators of membrane-cytoskeletal interactions. Trends Cell Biol. 2007 Mar;17(3):145-56 DuHadaway JB, Lynch FJ, Brisbay S, Bueso-Ramos C, Troncoso P, McDonnell T, Prendergast GC. Ghaneie A, Zemba-Palko V, Itoh H, Itoh K, Sakamuro D, Immunohistochemical analysis of Bin1/Amphiphysin II in Nakamura S, Soler AP, Prendergast GC. Bin1 attenuation in human tissues: diverse sites of nuclear expression and losses breast cancer is correlated to nodal metastasis and reduced in prostate cancer. J Cell Biochem. 2003 Feb 15;88(3):635-42 survival. Cancer Biol Ther. 2007 Feb;6(2):192-4 Leprince C, Le Scolan E, Meunier B, Fraisier V, Brandon N, De Nicot AS, Toussaint A, Tosch V, Kretz C, Wallgren-Pettersson Gunzburg J, Camonis J. Sorting nexin 4 and amphiphysin 2, a C, Iwarsson E, Kingston H, Garnier JM, Biancalana V, Oldfors new partnership between endocytosis and intracellular A, Mandel JL, Laporte J. Mutations in amphiphysin 2 (BIN1) trafficking. J Cell Sci. 2003 May 15;116(Pt 10):1937-48 disrupt interaction with dynamin 2 and cause autosomal recessive centronuclear myopathy. Nat Genet. 2007 Muller AJ, Baker JF, DuHadaway JB, Ge K, Farmer G, Sep;39(9):1134-9 Donover PS, Meade R, Reid C, Grzanna R, Roach AH, Shah N, Soler AP, Prendergast GC. Targeted disruption of the Ramalingam A, Farmer GE, Stamato TD, Prendergast GC. murine Bin1/Amphiphysin II gene does not disable endocytosis Bin1 interacts with and restrains the DNA end-binding protein but results in embryonic cardiomyopathy with aberrant myofibril complex Ku. Cell Cycle. 2007 Aug 1;6(15):1914-8 formation. Mol Cell Biol. 2003 Jun;23(12):4295-306

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 547 BIN1 (bridging integrator 1) Chang MY, Prendergast GC

Ramalingam A, Prendergast GC. Bin1 homolog hob1 supports Wajapeyee N, Serra RW, Zhu X, Mahalingam M, Green MR. a Rad6-Set1 pathway of transcriptional repression in fission Oncogenic BRAF induces senescence and apoptosis through yeast. Cell Cycle. 2007 Jul 1;6(13):1655-62 pathways mediated by the secreted protein IGFBP7. Cell. 2008 Feb 8;132(3):363-74 Kinney EL, Tanida S, Rodrigue AA, Johnson JK, Tompkins VS, Sakamuro D. Adenovirus E1A oncoprotein liberates c-Myc This article should be referenced as such: activity to promote cell proliferation through abating Bin1 expression via an Rb/E2F1-dependent mechanism. J Cell Chang MY, Prendergast GC. BIN1 (bridging integrator 1). Atlas Physiol. 2008 Sep;216(3):621-31 Genet Cytogenet Oncol Haematol. 2009; 13(8):543-548.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 548 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Review

CFLAR (CASP8 and FADD-like apoptosis regulator) Christophe Le Clorennec, Daniel B Longley, Timothy Wilson Drug Resistance Group, Centre for Cancer Research and Cell Biology, Queen's University Belfast, Belfast, Northern Ireland (CLC, DBL, TW)

Published in Atlas Database: September 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/CFLARID40065ch2q33.html DOI: 10.4267/2042/44531 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

(Hofmann, 1999). These proteins are principally Identity composed of two homologous DED regions, which are Other names: CASH; CASP8AP1; CLARP; Casper; found in a wide family of DED-containing proteins, FLAME; FLAME-1; FLAME1; FLIP; I-FLICE; including procaspase-8, procaspase-10 and FADD, MRIT; USURPIN; c-FLIP; c-FLIPL; c-FLIPR; c- which are components of the DISC (Death Inducing FLIPS Signalling Complex) formed by death receptors such as HGNC (Hugo): CFLAR Fas (CD95), DR4 (TRAIL-R1) and DR5 (TRAIL-R2) (Ashkenazi and Dixit, 1999). The v-FLIP proteins were Location: 2q33.1 first identified in gamma-herpesviruses, such as the Kaposi-associated human herpesvirus-8 (HHV-8), the DNA/RNA equine herpesvirus-2 (EHV-2), the herpesvirus saimiri Description (HVS) and found in the rhesus rhadinovirus (RRV) (Bertin et al., 1997; Hu et al., 1997; Searles et al., 1999; 14 exons; DNA size 48 kb. Thome et al., 1997). Two additional v-FLIP variants Transcription with carboxy-terminal extensions of unknown function are found in the human molluscipoxvirus (MCV) FLIPL: mRNA size: 2243 nucleotides (nt); coding (Bertin et al., 1997; Hu et al., 1997; Thome et al., sequence: 1443 nt; FLIPS: mRNA size: 1062 nt; coding 1997). sequence: 666 nt. Soon after the discovery of v-FLIP proteins, the mammalian cellular counterparts were identified, and Protein called c-FLIP proteins (also called CASH, Casper, Note CLARP, FLAME, I-FLICE, MRIT or usurpin). Among In 1997, a new family of viral genes encoding viral 13 distinct c-FLIP splice variants which have been FLIP (v-FLIP, Fas-associated death domain (FADD)- reported, only three are expressed as proteins: the 55 like interleukin-1 beta converting enzyme (FLICE) kDa long form (c-FLIPL), the 26 kDa short form (c- inhibitory protein) were identified as proteins FLIPS) and the 24 kDa short form of c-FLIP (c- containing the Death Effector Domain (DED) which FLIPR), identified in the Raji B-cell line (Golks et al., interact with certain caspases: caspase 8 (also termed 2005; Budd et al., 2006). FLICE) and caspase 10

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 549 CFLAR (CASP8 and FADD-like apoptosis regulator) Le Clorennec C, et al.

Genomic Organization and splice variants of c-FLAR (c-FLIP) gene. Schematic representation of the structure of the 48kb c-FLAR gene, which contains 14 exons and is transcribed into 11 alternative splice forms. The start and stop sites for translation of the various splice forms are indicated as arrowheads and asterisks, respectively. Only 3 proteins are expressed at the protein level: FLIPS, FLIPR and FLIPL (adapted from Djerbi M et al 2001).

Description The short form c-FLIPS is composed of 221 amino c-FLIPL is composed of 480 amino acids and contains acids and has the same structure as vFLIP proteins, a longer carboxy-terminus than cFLIPS. c-FLIPL except that in addition to the two DEDs of cFLIPS, a closely resembles the overall structure of procaspase-8 carboxy-terminal tail composed of approximatively 20 and procaspase-10 (Figure 2). c-FLIPL contains two amino acids is present that seems to be crucial for its DEDs followed by a caspase-like domain. However, ubiquitinylation and subsequent proteasomal the C-terminal caspase-like domain of c-FLIPL lacks degradation (Poukkula et al., 2005). caspase enzymatic activity, owing to the substitution of The short form c-FLIPR is composed of 213 amino several amino acids, including the crucial cysteine acids, contains two DEDs and lacks the additional residue in the Gln-Ala-Cys-X-Gly motif (X: any amino carboxy terminal amino acids present in c-FLIPS acid) and the histidine residue in the His-Gly motif (Golks et al., 2005). (Cohen, 1997). These two residues are necessary for caspase catalytic activity and are conserved in all Expression caspases. c-FLIPL contains two conserved aspartic-acid c-FLIPL is expressed in many tissues, most abundantly cleavage sites: Asp-198, between DED2 and the p20- in the heart, skeletal muscle, lymphoid tissues and like domain; and Asp-376, between the p20- and p10- kidney. c-FLIP is abundantly and constitutively like domains, both of which can be cleaved during Fas- expressed in a wide array of normal cell types, and TRAIL-induced apoptosis (Irmler, 1997; Scaffidi including neurons, cardiac myocytes, endothelial cells, et al., 1999; Golks et al., 2006). This leads to the keratinocytes, pancreatic beta cells, dendritic cells generation of p43-FLIP, which is implicated in the (DCs), macrophages, CD34+ haematopoietic stem cells activation of different signalling pathways such as NF- and spermatocytes (Ashany et al., 1999; Bouchet, 2002; kappa B pathway (Kataoka and Tschopp, 2004). In Davidson et al., 2003; Desbarats, 2003; Giampietri, addition to NF-kappaB signaling, c-FLIPL has also 2003; Kiener, 1997; Kim et al., 2002; Maedler, 2002; been shown to activate Erk signaling pathway by Marconi, 2004; Rescigno, 2000). binding to Raf-1 (Kataoka, 2000; Park et al., 2001).

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 550 CFLAR (CASP8 and FADD-like apoptosis regulator) Le Clorennec C, et al.

Overview of c-FLIP isoforms and v-FLIP isoforms. All the c-FLIP proteins carry two tandem death effector domains (DEDs). c-FLIPL also contains a caspase 8-like domain. The sites cleaved by procaspase-8 or by active caspase-8 are shown. Total number of amino acids is given. c-FLIP is highly expressed in various types of tumour apoptosis induced by several death receptors, including cells, including colorectal carcinoma (Ryu et al., 2001; FAS, tumour-necrosis factor (TNF) receptor 1 Ullenhag et al., 2007), gastric carcinoma (Nam et al., (TNFR1), TNF-related apoptosis-inducing ligand 2003; Zhou et al., 2004), pancreatic carcinoma (Elnemr (TRAIL) receptor 1 (TRAILR1; also known as DR4), et al., 2001), Hodgkin's lymphoma (Dutton et al., 2004; TRAILR2 (also known as DR5) and TNFR-related Mathas et al., 2004; Thomas et al., 2002), B cell apoptosis-mediating protein (TRAMP; also known as chronic lymphocytic leukemia (MacFarlane et al., DR3). Due to its high structural homology with 2002; Olsson et al., 2001), melanoma (Griffith et al., procaspase-8, FLIP interferes with caspase-8 activation 1998), ovarian carcinoma (Abedini et al., 2004; at the death-inducing signalling complex (DISC), Mezzanzanica et al., 2004), cervical carcinoma (Wang which is formed after death receptor ligation et al., 2007), bladder urothelial carcinoma and prostate (Ashkenazi and Dixit, 1999). The inhibition of Death carcinoma (Korkolopoulou et al., 2004; Zhang et al., Receptor-mediated apoptosis by FLIP is due to 2004). competition between the DEDs of FLIP and All of these tumours are often resistant to death procaspase-8/10 for recruitment to the adaptor protein receptor-mediated apoptosis. The expression of c-FLIP FADD at the DISC (Irmler, 1997; Srinivasula, 1997). has been proven to be one of the major determinants of Procaspase-8 recruitment to the DISC results in its the resistance to death ligands such as FasL and TRAIL homodimerization and two sequential cleavage steps (TNF-related apoptosis-inducing ligand), and numerous that generate p10 and p18 fragments that reports have shown that down-regulation of c-FLIP heterodimerize to form fully active (p10-p18) 2 caspase- results in sensitizing various resistant tumour cells to 8 that dissociates from the DISC (Krammer et al., death ligands (Kim et al., 2000; Longley et al., 2006; 2007). Ricci et al., 2004; Wilson et al., 2007). When the death receptors are stimulated by their Localisation corresponding ligand, they recruit the adapter molecule FADD. FADD can then recruit DED containing c-FLIP proteins are localized in the cytosol. proteins, e.g. caspase-8, and form a DISC. c-FLIP Function inhibits caspase-8 activation at the DISC. c-FLIPL and c-FLIPS have been shown to block death receptor- In many studies, in vitro, FLIP proteins (v-FLIP, c- mediated apoptosis by forming a proteolytically FLIPR, c-FLIPS and c-FLIPL) protect cells against inactive heterodimer with

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 551 CFLAR (CASP8 and FADD-like apoptosis regulator) Le Clorennec C, et al.

Schematic diagram of c-FLIP recruitment to the DISC. All the c-FLIP proteins carry two tandem death effector domains (DEDs), which can bind FADD and procaspase-8. c-FLIPL is structurally very similar to procaspase-8 apart from the active site of c-FLIP in which cysteine 360 has been substituted by a tyrosine, and in another active site, histidine 317 has been substituted by an arginine in c-FLIPL. procaspase-8 (Golks et al., 2005; Krueger et al., 2001). remain bound at the DISC (Krueger et al., 2001). However, cleavage is blocked at different stages. For c- Recently, it has been proposed that the DISC-bound FLIPS and c-FLIPR, both cleavage steps required for caspase 8/FLIP complex has catalytic activity that is procaspase-8 activation are completely blocked. In not capable of generating a pro-apoptotic signal, but contrast, c-FLIPL allows partial cleavage of that can cleave local substrates such as RIP (receptor- procaspase-8 at the DISC (Figure 3). When a molecule interacting protein) (Micheau, 2002). of procaspase-8 and c-FLIPL come into contact at the DISC, a conformational change in the two molecules Implicated in occurs. This leads to the autocatalytic cleavage of the p10 subunit from procaspase-8. c-FLIPL is also Hodgkin's lymphoma (cHD) partially cleaved by the procaspase-8 molecule to Note generate a p12 subunit. However, cleavage is stopped Classical Hodgkin's lymphoma (cHL), a common at this stage and no p18 subunit is generated from human lymphoma, has been proposed to be derived caspase-8. It has been hypothesised that the second from germinal centre (GC) B cells in the majority of reciprocal trans-catalytic cleavage step cannot occur cases (Kuppers et al., 2002). Among tumour-forming because of the lack of the cysteine residue at the active cells, the malignant Hodgkin/Reed-Sternberg (HRS) site of c-FLIPL (Micheau, 2002). The resulting cells, which represents the malignant population of cleavage products are p41/43- and p10-caspase-8 cHD disease, are rare and represent only 1% of cells in products; and p43- and p12-c-FLIPL intermediates. affected lymph nodes. HRS cells have lost their B cell Furthermore, Kreuger et al demonstrated that the phenotype, including immunoglobulin (Ig) expression p41/43-caspase-8 and p43-c-FLIPL intermediates

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 552 CFLAR (CASP8 and FADD-like apoptosis regulator) Le Clorennec C, et al.

(Schwering et al., 2003). Usually, B cells with non- with clinically active MS. FLIPL and FLIPS were functional Ig expression undergo apoptosis. found to be specifically overexpressed in T cells of MS Disease patients, indicating that abnormally high FLIP Hodgkin/Reed-Sternberg (HRS) cells are most often expression levels might extend the viability of resistant to Death receptor-mediated apoptosis such as potentially pathogenic, autoreactive T cells in the is mediated by FasL or TRAIL. The expression of c- context of this disease (Semra et al., 2001; Sharief, FLIP has been proven to be one of the major 2000). determinants of this resistance. HRS cells have been shown to overexpress c-FLIP proteins in a NF-kappa References B-dependent manner. Some studies have shown that the Bertin J, Armstrong RC, Ottilie S, Martin DA, Wang Y, Banks high level of c-FLIP prevent the activation of caspase-8 S, Wang GH, Senkevich TG, Alnemri ES, Moss B, Lenardo by inhibition of procaspase-8 processing. To remove MJ, Tomaselli KJ, Cohen JI. Death effector domain-containing herpesvirus and poxvirus proteins inhibit both Fas- and this resistance to Death receptor mediated apoptosis, TNFR1-induced apoptosis. Proc Natl Acad Sci U S A. 1997 some reports have shown that specific down-regulation Feb 18;94(4):1172-6 of c-FLIP by small interfering RNA Cohen GM. Caspases: the executioners of apoptosis. Biochem oligoribonucleotides strategies is sufficient to sensitize J. 1997 Aug 15;326 ( Pt 1):1-16 HRS cells to Fas and TRAIL-induced apoptosis (Mathas et al., 2004). Hu S, Vincenz C, Buller M, Dixit VM. A novel family of viral death effector domain-containing molecules that inhibit both Colorectal cancer (CRC) CD-95- and tumor necrosis factor receptor-1-induced apoptosis. J Biol Chem. 1997 Apr 11;272(15):9621-4 Note Irmler M, Thome M, Hahne M, Schneider P, Hofmann K, Colorectal cancer is a major cause of cancer mortality. Steiner V, Bodmer JL, Schröter M, Burns K, Mattmann C, Response rates in the advanced disease setting are of Rimoldi D, French LE, Tschopp J. Inhibition of death receptor the order of 45% to 50% for the most effective drug signals by cellular FLIP. Nature. 1997 Jul 10;388(6638):190-5 combinations. Drug resistance is a major problem in Kiener PA, Davis PM, Starling GC, Mehlin C, Klebanoff SJ, this disease (and other cancers) and is often the result Ledbetter JA, Liles WC. Differential induction of apoptosis by of insufficient apoptosis induced by chemotherapy. Fas-Fas ligand interactions in human monocytes and macrophages. J Exp Med. 1997 Apr 21;185(8):1511-6 Disease Clinical studies have demonstrated significantly Srinivasula SM, Ahmad M, Ottilie S, Bullrich F, Banks S, Wang Y, Fernandes-Alnemri T, Croce CM, Litwack G, Tomaselli KJ, elevated c-FLIP expression in colorectal tumours (Ryu Armstrong RC, Alnemri ES. FLAME-1, a novel FADD-like anti- et al., 2001), suggesting that c-FLIP may be play a role apoptotic molecule that regulates Fas/TNFR1-induced in the pathogenesis of this disease. Indeed, c-FLIP(L) apoptosis. J Biol Chem. 1997 Jul 25;272(30):18542-5 overexpression was associated with poor prognosis in Thome M, Schneider P, Hofmann K, Fickenscher H, Meinl E, colorectal cancer patients (Ullenhag et al., 2007). Neipel F, Mattmann C, Burns K, Bodmer JL, Schroter M, Scaffidi C, Krammer PH, Peter ME, Tschopp J.. Viral FLICE- Graves' disease inhibitory proteins (FLIPs) prevent apoptosis induced by death Note receptors. Nature. 1997 Apr 3;386(6624):517-21. Graves' disease is an autoimmune form of Griffith TS, Chin WA, Jackson GC, Lynch DH, Kubin MZ.. hyperthyroidism. In the context of this disease, Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells. J Immunol. 1998 Sep 15;161(6):2833-40. lymphocyte TH2 cells infiltrate the thyroid gland and, via production of IL4 and IL10, stimulate thyrocytes to Ashany D, Savir A, Bhardwaj N, Elkon KB. Dendritic cells are resistant to apoptosis through the Fas (CD95/APO-1) pathway. become more resistant to Fas-mediated apoptosis, in J Immunol. 1999 Nov 15;163(10):5303-11 part by upregulation of c-FLIP and Bcl-XL (Stassi, 2000). Ashkenazi A, Dixit VM. Apoptosis control by death and decoy receptors. Curr Opin Cell Biol. 1999 Apr;11(2):255-60 Multiple sclerosis (MS) Conlon P, Oksenberg JR, Zhang J, Steinman L. The immunobiology of multiple sclerosis: an autoimmune disease Note of the central nervous system. Neurobiol Dis. 1999 Multiple sclerosis (MS): a neuroinflammatory disease Jun;6(3):149-66 that is thought to have an autoimmune basis due to Hofmann K. The modular nature of apoptotic signaling autoreactive T cells responding to myelin self-antigens proteins. Cell Mol Life Sci. 1999 Jul;55(8-9):1113-28 (Conlon et al., 1999). Autoimmune diseases such as Scaffidi C, Schmitz I, Krammer PH, Peter ME. The role of c- MS can result from the lack of elimination of FLIP in modulation of CD95-induced apoptosis. J Biol Chem. pathogenic, autoreactive lymphocytes. 1999 Jan 15;274(3):1541-8 Disease Searles RP, Bergquam EP, Axthelm MK, Wong SW. In this disease, the pathological upregulation of FLIP Sequence and genomic analysis of a Rhesus macaque levels in T cells might contribute to the accumulation rhadinovirus with similarity to Kaposi's sarcoma-associated of lymphocytes in cortical-spinal-fluid and herpesvirus/human herpesvirus 8. J Virol. 1999 accumulation of activated-peripheral T cells in patients Apr;73(4):3040-53

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 553 CFLAR (CASP8 and FADD-like apoptosis regulator) Le Clorennec C, et al.

Kataoka T, Budd RC, Holler N, Thome M, Martinon F, Irmler M, Küppers R, Schwering I, Bräuninger A, Rajewsky K, Burns K, Hahne M, Kennedy N, Kovacsovics M, Tschopp J. Hansmann ML. Biology of Hodgkin's lymphoma. Ann Oncol. The caspase-8 inhibitor FLIP promotes activation of NF- 2002;13 Suppl 1:11-8 kappaB and Erk signaling pathways. Curr Biol. 2000 Jun 1;10(11):640-8 MacFarlane M, Harper N, Snowden RT, Dyer MJ, Barnett GA, Pringle JH, Cohen GM. Mechanisms of resistance to TRAIL- Kim K, Fisher MJ, Xu SQ, el-Deiry WS. Molecular determinants induced apoptosis in primary B cell chronic lymphocytic of response to TRAIL in killing of normal and cancer cells. Clin leukaemia. Oncogene. 2002 Oct 3;21(44):6809-18 Cancer Res. 2000 Feb;6(2):335-46 Maedler K, Fontana A, Ris F, Sergeev P, Toso C, Oberholzer Rescigno M, Piguet V, Valzasina B, Lens S, Zubler R, French J, Lehmann R, Bachmann F, Tasinato A, Spinas GA, Halban L, Kindler V, Tschopp J, Ricciardi-Castagnoli P. Fas PA, Donath MY. FLIP switches Fas-mediated glucose engagement induces the maturation of dendritic cells (DCs), signaling in human pancreatic beta cells from apoptosis to cell the release of interleukin (IL)-1beta, and the production of replication. Proc Natl Acad Sci U S A. 2002 Jun interferon gamma in the absence of IL-12 during DC-T cell 11;99(12):8236-41 cognate interaction: a new role for Fas ligand in inflammatory responses. J Exp Med. 2000 Dec 4;192(11):1661-8 Micheau O, Thome M, Schneider P, Holler N, Tschopp J, Nicholson DW, Briand C, Grütter MG. The long form of FLIP is Sharief MK. Increased cellular expression of the caspase an activator of caspase-8 at the Fas death-inducing signaling inhibitor FLIP in intrathecal lymphocytes from patients with complex. J Biol Chem. 2002 Nov 22;277(47):45162-71 multiple sclerosis. J Neuroimmunol. 2000 Nov 1;111(1-2):203- 9 Thomas RK, Kallenborn A, Wickenhauser C, Schultze JL, Draube A, Vockerodt M, Re D, Diehl V, Wolf J. Constitutive Stassi G, Di Liberto D, Todaro M, Zeuner A, Ricci-Vitiani L, expression of c-FLIP in Hodgkin and Reed-Sternberg cells. Am Stoppacciaro A, Ruco L, Farina F, Zummo G, De Maria R. J Pathol. 2002 Apr;160(4):1521-8 Control of target cell survival in thyroid autoimmunity by T helper cytokines via regulation of apoptotic proteins. Nat Davidson SM, Stephanou A, Latchman DS. FLIP protects Immunol. 2000 Dec;1(6):483-8 cardiomyocytes from apoptosis induced by simulated ischemia/reoxygenation, as demonstrated by short hairpin- Djerbi M, Darreh-Shori T, Zhivotovsky B, Grandien A. induced (shRNA) silencing of FLIP mRNA. J Mol Cell Cardiol. Characterization of the human FLICE-inhibitory protein locus 2003 Nov;35(11):1359-64 and comparison of the anti-apoptotic activity of four different flip isoforms. Scand J Immunol. 2001 Jul-Aug;54(1-2):180-9 Desbarats J, Birge RB, Mimouni-Rongy M, Weinstein DE, Palerme JS, Newell MK. Fas engagement induces neurite Elnemr A, Ohta T, Yachie A, Kayahara M, Kitagawa H, growth through ERK activation and p35 upregulation. Nat Cell Fujimura T, Ninomiya I, Fushida S, Nishimura GI, Shimizu K, Biol. 2003 Feb;5(2):118-25 Miwa K. Human pancreatic cancer cells disable function of Fas receptors at several levels in Fas signal transduction pathway. Giampietri C, Petrungaro S, Coluccia P, D'Alessio A, Starace Int J Oncol. 2001 Feb;18(2):311-6 D, Riccioli A, Padula F, Srinivasula SM, Alnemri E, Palombi F, Filippini A, Ziparo E, De Cesaris P. FLIP is expressed in Krueger A, Schmitz I, Baumann S, Krammer PH, Kirchhoff S. mouse testis and protects germ cells from apoptosis. Cell Cellular FLICE-inhibitory protein splice variants inhibit different Death Differ. 2003 Feb;10(2):175-84 steps of caspase-8 activation at the CD95 death-inducing signaling complex. J Biol Chem. 2001 Jun 8;276(23):20633-40 Longley DB, Harkin DP, Johnston PG. 5-fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer. Olsson A, Diaz T, Aguilar-Santelises M, Osterborg A, Celsing 2003 May;3(5):330-8 F, Jondal M, Osorio LM. Sensitization to TRAIL-induced apoptosis and modulation of FLICE-inhibitory protein in B Nam SY, Jung GA, Hur GC, Chung HY, Kim WH, Seol DW, chronic lymphocytic leukemia by actinomycin D. Leukemia. Lee BL. Upregulation of FLIP(S) by Akt, a possible inhibition 2001 Dec;15(12):1868-77 mechanism of TRAIL-induced apoptosis in human gastric cancers. Cancer Sci. 2003 Dec;94(12):1066-73 Park SJ, Kim YY, Ju JW, Han BG, Park SI, Park BJ. Alternative splicing variants of c-FLIP transduce the differential Schwering I, Bräuninger A, Klein U, Jungnickel B, Tinguely M, signal through the Raf or TRAF2 in TNF-induced cell Diehl V, Hansmann ML, Dalla-Favera R, Rajewsky K, Küppers proliferation. Biochem Biophys Res Commun. 2001 Dec R. Loss of the B-lineage-specific gene expression program in 21;289(5):1205-10 Hodgkin and Reed-Sternberg cells of Hodgkin lymphoma. Blood. 2003 Feb 15;101(4):1505-12 Ryu BK, Lee MG, Chi SG, Kim YW, Park JH. Increased expression of cFLIP(L) in colonic adenocarcinoma. J Pathol. Abedini MR, Qiu Q, Yan X, Tsang BK. Possible role of FLICE- 2001 May;194(1):15-9 like inhibitory protein (FLIP) in chemoresistant ovarian cancer cells in vitro. Oncogene. 2004 Sep 16;23(42):6997-7004 Semra YK, Seidi OA, Sharief MK. Overexpression of the apoptosis inhibitor FLIP in T cells correlates with disease Dutton A, O'Neil JD, Milner AE, Reynolds GM, Starczynski J, activity in multiple sclerosis. J Neuroimmunol. 2001 Feb Crocker J, Young LS, Murray PG. Expression of the cellular 15;113(2):268-74 FLICE-inhibitory protein (c-FLIP) protects Hodgkin's lymphoma cells from autonomous Fas-mediated death. Proc Natl Acad Bouchet D, Tesson L, Ménoret S, Charreau B, Mathieu P, Sci U S A. 2004 Apr 27;101(17):6611-6 Yagita H, Duisit G, Anegon I. Differential sensitivity of endothelial cells of various species to apoptosis induced by Kataoka T, Tschopp J. N-terminal fragment of c-FLIP(L) gene transfer of Fas ligand: role of FLIP levels. Mol Med. 2002 processed by caspase 8 specifically interacts with TRAF2 and Oct;8(10):612-23 induces activation of the NF-kappaB signaling pathway. Mol Cell Biol. 2004 Apr;24(7):2627-36 Kim H, Whartenby KA, Georgantas RW 3rd, Wingard J, Civin CI. Human CD34+ hematopoietic stem/progenitor cells express Korkolopoulou P, Goudopoulou A, Voutsinas G, Thomas- high levels of FLIP and are resistant to Fas-mediated Tsagli E, Kapralos P, Patsouris E, Saetta AA. c-FLIP apoptosis. Stem Cells. 2002;20(2):174-82 expression in bladder urothelial carcinomas: its role in resistance to Fas-mediated apoptosis and clinicopathologic correlations. Urology. 2004 Jun;63(6):1198-204

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 554 CFLAR (CASP8 and FADD-like apoptosis regulator) Le Clorennec C, et al.

Marconi A, Atzei P, Panza C, Fila C, Tiberio R, Truzzi F, turnover of c-FLIPshort is determined by its unique C-terminal Wachter T, Leverkus M, Pincelli C. FLICE/caspase-8 activation tail. J Biol Chem. 2005 Jul 22;280(29):27345-55 triggers anoikis induced by beta1-integrin blockade in human keratinocytes. J Cell Sci. 2004 Nov 15;117(Pt 24):5815-23 Budd RC, Yeh WC, Tschopp J. cFLIP regulation of lymphocyte activation and development. Nat Rev Immunol. 2006 Mathas S, Lietz A, Anagnostopoulos I, Hummel F, Wiesner B, Mar;6(3):196-204 Janz M, Jundt F, Hirsch B, Jöhrens-Leder K, Vornlocher HP, Bommert K, Stein H, Dörken B. c-FLIP mediates resistance of Longley DB, Wilson TR, McEwan M, Allen WL, McDermott U, Hodgkin/Reed-Sternberg cells to death receptor-induced Galligan L, Johnston PG. c-FLIP inhibits chemotherapy- apoptosis. J Exp Med. 2004 Apr 19;199(8):1041-52 induced colorectal cancer cell death. Oncogene. 2006 Feb 9;25(6):838-48 Mezzanzanica D, Balladore E, Turatti F, Luison E, Alberti P, Bagnoli M, Figini M, Mazzoni A, Raspagliesi F, Oggionni M, Krammer PH, Arnold R, Lavrik IN. Life and death in peripheral Pilotti S, Canevari S. CD95-mediated apoptosis is impaired at T cells. Nat Rev Immunol. 2007 Jul;7(7):532-42 receptor level by cellular FLICE-inhibitory protein (long form) in Rogers KM, Thomas M, Galligan L, Wilson TR, Allen WL, wild-type p53 human ovarian carcinoma. Clin Cancer Res. Sakai H, Johnston PG, Longley DB. Cellular FLICE-inhibitory 2004 Aug 1;10(15):5202-14 protein regulates chemotherapy-induced apoptosis in breast Ricci MS, Jin Z, Dews M, Yu D, Thomas-Tikhonenko A, Dicker cancer cells. Mol Cancer Ther. 2007 May;6(5):1544-51 DT, El-Deiry WS. Direct repression of FLIP expression by c- Ullenhag GJ, Mukherjee A, Watson NF, Al-Attar AH, myc is a major determinant of TRAIL sensitivity. Mol Cell Biol. Scholefield JH, Durrant LG. Overexpression of FLIPL is an 2004 Oct;24(19):8541-55 independent marker of poor prognosis in colorectal cancer Zhang X, Jin TG, Yang H, DeWolf WC, Khosravi-Far R, Olumi patients. Clin Cancer Res. 2007 Sep 1;13(17):5070-5 AF. Persistent c-FLIP(L) expression is necessary and sufficient Wang W, Wang S, Song X, Sima N, Xu X, Luo A, Chen G, to maintain resistance to tumor necrosis factor-related Deng D, Xu Q, Meng L, Lu Y, Ma D. The relationship between apoptosis-inducing ligand-mediated apoptosis in prostate c-FLIP expression and human papillomavirus E2 gene cancer. Cancer Res. 2004 Oct 1;64(19):7086-91 disruption in cervical carcinogenesis. Gynecol Oncol. 2007 Zhou XD, Yu JP, Liu J, Luo HS, Chen HX, Yu HG. Jun;105(3):571-7 Overexpression of cellular FLICE-inhibitory protein (FLIP) in Wilson TR, McLaughlin KM, McEwan M, Sakai H, Rogers KM, gastric adenocarcinoma. Clin Sci (Lond). 2004 Apr;106(4):397- Redmond KM, Johnston PG, Longley DB. c-FLIP: a key 405 regulator of colorectal cancer cell death. Cancer Res. 2007 Jun Golks A, Brenner D, Fritsch C, Krammer PH, Lavrik IN. 15;67(12):5754-62 c-FLIPR, a new regulator of death receptor-induced apoptosis. This article should be referenced as such: J Biol Chem. 2005 Apr 15;280(15):14507-13 Le Clorennec C, Longley DB, Wilson T. CFLAR (CASP8 and Poukkula M, Kaunisto A, Hietakangas V, Denessiouk K, FADD-like apoptosis regulator). Atlas Genet Cytogenet Oncol Katajamäki T, Johnson MS, Sistonen L, Eriksson JE. Rapid Haematol. 2009; 13(8):549-555.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 555 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Mini Review

ELAVL1 (ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)) Virginie Dormoy-Raclet, Imed-Eddine Gallouzi Department of Biochemistry, McGill University, 3655 Promenade Sir William Osler, Montreal, Quebec H3G 1Y6, Canada (VDR, IEG)

Published in Atlas Database: September 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/ELAVL1ID44237ch19p13.html DOI: 10.4267/2042/44532 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

HuR nucleocytoplasmic shuttling (HNS) domain. It has Identity been shown that the HNS domain regulates the Other names: ELAV1; HUR; HuR; Hua; MelG localization of HuR by mediating its association with HGNC (Hugo): ELAVL1 adaptor proteins for nuclear export such as pp32/PHAP-I and APRIL and with import factors Location: 19p13.2 transportin-1, transportin-2, and importin. DNA/RNA Expression Description Ubiquitously expressed. The ELAV1 gene, located on the minus strand, Localisation encompasses 47072 bp with 6 exons and 5 introns. Predominantly nuclear but shuttles between the nuclear Transcription and the cytoplasm. mRNA of 2,3 kb but a second putative poly(A) signal Function is described leading to a 6 kb mRNA. HuR belongs to the ELAV/Hu family (embryonic lethal Coding sequence from 168 to 1148 b. abnormal vision phenotype in flies) of RNA-binding proteins (RBPs). Like other Hu/ELAVL RBPs, HuR Protein contains 3 RRM through which it binds to specific Description mRNA and influences their post-transcriptional expression. HuR exhibits a high affinity for adenosine The HuR protein consists of 326 aa (36 kDa). HuR has and uracil- (AU-) rich elements (ARE) leading to the three highly conserved motifs belonging to the RNA stabilization and/or transport of its target host recognition motif (RRM) superfamily and a hinge messages. region between RRMs 2 and 3 named the

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 556 ELAVL1 (ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)) Dormoy-Raclet V, Gallouzi IE

In addition to its role as an mRNA stabilizer and stabilize the message encoding the inducible NO transporter, HuR has been shown to mediate the synthase enzyme. translation of mRNAs and rarely to repress translation. Hypertension Moreover, HuR plays a key role in the enhancement of Disease caspase-dependent apoptosis induced by extreme stress Chronic hypertension is associated with functional and conditions. In response to a lethal stress, HuR morphological alterations of the vessel wall (ie, accumulates in the cytoplasm, where it undergoes dysfunctional vascular endothelium and thickening of caspase-mediated cleavage. This cleavage appears to be the smooth muscle layer). The pathomechanisms important for pp32/PHAP-I - mediated enhancement of accounting for hypertension-induced vascular the caspase-dependent apoptosis. HuR was shown to alterations are likely to be multifactorial. HuR is not play others critical functions in cells responding to only an important factor controlling vascular gene immune stimuli, nutrient availability, and exposure to expression, but it is also subject to control by damaging agents. Similarly, it has an important vasoactive factors that regulate cGMP and cAMP regulatory function in the progression of cells through levels and downregulate its expression. the division cycle, the implementation of differentiation programs, the promotion of cell migration, cell Paraneoplastic neurological disease invasion and a malignant phenotype, and the inhibition Disease of replicative senescence. Paraneoplastic enecephalomyelitis/sensory neuronopathy (PEM/SSN) is characterized by the Mutations presence of a common autoantibody, referred to as anti- Note Hu or type I anti-neuronal nuclear antibody (ANNA-1). No HuR mutations have been found in cancer or other The target of these antibodies is the family of Hu diseases. antigens (Hel-N1, HuC, HuD and HuR). Implicated in References Fan XC, Steitz JA. Overexpression of HuR, a nuclear- Cancer cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J. 1998 Jun 15;17(12):3448- Oncogenesis 60 Breast, lung, colon and ovary cancer. Expression of HuR is increased in all cancer tissues compared to the King PH, Redden D, Palmgren JS, Nabors LB, Lennon VA. Hu antigen specificities of ANNA-I autoantibodies in normal-tissue counterparts. It exists a consistent paraneoplastic neurological disease. J Autoimmun. 1999 correlation between HuR expression levels and Dec;13(4):435-43 advancing stages of malignancy. Brennan CM, Steitz JA. HuR and mRNA stability. Cell Mol Life Cachexia Sci. 2001 Feb;58(2):266-77 Disease van der Giessen K, Di-Marco S, Clair E, Gallouzi IE. RNAi- mediated HuR depletion leads to the inhibition of muscle cell Cachexia, characterized by the excessive loss of differentiation. J Biol Chem. 2003 Nov 21;278(47):47119-28 skeletal muscle, is frequently seen in patients with chronic diseases such as cancer. The bioactive gas Di Marco S, Mazroui R, Dallaire P, Chittur S, Tenenbaum SA, Radzioch D, Marette A, Gallouzi IE. NF-kappa B-mediated nitric oxide has been identified as an important player MyoD decay during muscle wasting requires nitric oxide in cancer-induced cachexia because NO is directly synthase mRNA stabilization, HuR protein, and nitric oxide involved in the loss of MyoD mRNA (a key factor release. Mol Cell Biol. 2005 Aug;25(15):6533-45 needed for the myogenic process, which is destabilized Klöss S, Rodenbach D, Bordel R, Mülsch A. Human-antigen R during cachexia) and muscle fiber. These events are (HuR) expression in hypertension: downregulation of the mediated by the ability of HuR to associate and mRNA stabilizing protein HuR in genetic hypertension. Hypertension. 2005 Jun;45(6):1200-6

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 557 ELAVL1 (ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)) Dormoy-Raclet V, Gallouzi IE

López de Silanes I, Lal A, Gorospe M. HuR: post- Mazroui R, Di Marco S, Clair E, von Roretz C, Tenenbaum SA, transcriptional paths to malignancy. RNA Biol. 2005 Keene JD, Saleh M, Gallouzi IE. Caspase-mediated cleavage Jan;2(1):11-3 of HuR in the cytoplasm contributes to pp32/PHAP-I regulation of apoptosis. J Cell Biol. 2008 Jan 14;180(1):113-27 Dormoy-Raclet V, Ménard I, Clair E, Kurban G, Mazroui R, Di Marco S, von Roretz C, Pause A, Gallouzi IE. The RNA- This article should be referenced as such: binding protein HuR promotes cell migration and cell invasion by stabilizing the beta-actin mRNA in a U-rich-element- Dormoy-Raclet V, Gallouzi IE. ELAVL1 (ELAV (embryonic dependent manner. Mol Cell Biol. 2007 Aug;27(15):5365-80 lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)). Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8):556-558.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 558

Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Mini Review

IGF1R (insulin-like growth factor 1 receptor) Itay Bentov, Haim Werner Department of Human Molecular Genetics and Biochemistry, Sackler School of Medecine, Tel Aviv University,Tel Aviv 69978, ISRAEL (IB, HW)

Published in Atlas Database: September 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/IGF1RID40928ch15q26.html DOI: 10.4267/2042/44533 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

glycopeptide. The length of the IGF1R precursor is Identity 1367 amino acids. Precursor chains include a 30-amino Other names: CD221; IGFIR; JTK13; MGC142170; acid leader peptide rich in hydrophobic residues, which MGC142172; MGC18216 is involved in the transfer of the nascent protein into the HGNC (Hugo): IGF1R endoplasmic reticulum. Partially processed proreceptors form disulfide-linked dimers that are Location: 15q26.3 subsequently glycosylated and proteolytically cleaved at a basic tetrapeptide sequence to yield mature α and β DNA/RNA subunits. The mature heterotetramers have a β-α-α-β Description conformation. The α subunit is entirely extracellular and includes a The IGF1R gene contains 21 exons spanning cysteine-rich region and several potential N-linked approximately 100-kb of genomic DNA. glycosylation sites (Asn-X-Ser/Thr motifs). The Transcription cysteine-rich domain of the IGF1R is important for high-affinity IGF1 binding. The IGF1R mRNA is a 11242-base, single-stranded The β subunit features a unique hydrophobic sequence linear molecule. Various hormones and growth factors that constitutes the transmembrane domain. The were shown to regulate IGF1R gene transcription. cytoplasmic portion of the β subunit contains a tyrosine Specifically, growth factors and oncogenic agents kinase enzymatic domain. Inside this catalytic region associated with positive stimulation of cell division there is a glycine-rich conserved element that were shown to upregulate IGF1R gene expression participates in the transfer of the phosphate moiety of whereas negative modulators of cell growth (e.g., ATP to specific substrates. tumor suppressors) usually cause a reduction in IGF1R gene expression. Growth factors that stimulate IGF1R Expression gene transcription include, among others, basic The IGF1R is abundantly expressed in the embryo, fibroblast growth factor (bFGF) and platelet-derived with significant reduction in expression levels at adult growth factor (PDGF). In addition, IGF1R gene stages. expression is regulated by steroid hormones. Thus, estradiol was shown to increase, while progesterone Localisation decreased, IGF1R mRNA levels in breast cancer cells. The IGF1R is essentially expressed by most organs and tissues. Very high levels are detected in brain. Protein Extremely low levels are seen in liver, due to downregulation by hepatic IGF1. Description Function The IGF1R is a cell-surface tyrosine kinase receptor The IGF1R is involved in growth, development, and that is synthesized as a single polypeptide chain which differentiation processes. The IGF1R displays a very is then processed to yield an around 180-kDa

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 559 IGF1R (insulin-like growth factor 1 receptor) Bentov Y, Werner H

strong antiapoptotic activity and protects IGF1R- presented with height and weight above the 97th expressing cells from programmed cell death. percentile and showed accelerated cellular growth. IGF1R is vital for cell survival, as illustrated by the lethal phenotype of mice in which the IGF1R gene was Implicated in disrupted by homologous recombination. During normal ontogenesis, the IGF1R is expressed at every Various tumors developmental period, including the oocyte stage. Late Note embryonic and adult stages, in which the percentage of Clinical and experimental data collected over the past rapidly proliferating cells declines, are associated with 25 years have suggested that the IGF1R gene exhibits a an overall reduction in IGF1R mRNA levels. pattern of expression in malignant cells that reflects its IGF1R is involved in normal growth, development, and pro-survival role. Using a variety of techniques, differentiation processes. IGF1R mediates the including IGF binding and radio-receptor assays, biological roles of both the IGF1 and IGF2 ligands. Northern and Western blottings, and IGF1R binds IGF1 and IGF2 with high affinity, and immunohistochemical and in situ hybridization insulin with significantly reduced affinity. IGF1R analyses, most studies consistently showed that the displays a very potent antiapoptotic activity, protecting IGF1R is expressed at high levels in primary tumors IGF1R-expressing cells from programed cell death. and cancer-derived cells. These tumors include, among Activation of the IGF1R by locally-produced or others, breast, prostate, ovarian, colon, hematopoietic, circulating IGF1 or IGF2 leads to autophosphorylation rhabdomyosarcoma, and renal cancers. These of the tyrosine kinase domain, with ensuing activation augmented IGF1R levels reflect a reversal to more of the Ras-Raf-MAP kinase and PI3K-PKB/Akt primitive, less differentiated, ontogenetic stages that, in signaling pathways. Activation of these cytoplasmic most species and body organs, are characterized by mediators is critical in order for the IGF1R to exert its very high concentrations of IGF1R mRNA and IGF mitogenic and antiapoptotic activities. binding sites. Whereas the molecular mechanisms that The biological actions of the IGF1R are modulated by a lead to increased IGF1R gene expression in cancer family of IGF-binding proteins (IGFBPs) that includes remain largely unexplained, the dogma that emerged at least six members (IGFBP1, IGFBP2, IGFBP3, postulated that IGF1R expression is a fundamental IGFBP4, IGFBP5, IGFBP6). IGFBPs control IGF1R prerequisite for cellular transformation. The appeal of action by regulating the bioavailability of the IGF1 and this paradigm resides in the fact that enhanced IGF1R IGF2 ligands. The affinity of the IGFBPs for the levels and IGF1 signaling are considered key factors, ligands is 1-2 orders of magnitude higher than the indispensable for the cell, in order to adopt affinity exhibited by the receptor. IGFBPs usually proliferative/oncogenic pathways. display inhibitory types of activities however, under Anti-IGF1R strategies (e.g., humanized IGF1R certain circumstances, IGFBPs may also stimulate antibodies, low molecular weight tyrosine kinase IGF1 action. inhibitors, etc.) are currently being developed in order to target the IGF1R as a clinically relevant therapeutic Mutations target. Note IGF1R mutations are very rare, suggesting that References homozygous mutations are a lethal condition. Recently, Baker J, Liu JP, Robertson EJ, Efstratiadis A. Role of insulin- IGF1R mutations were described in two cohorts of like growth factors in embryonic and postnatal growth. Cell. children. The first cohort consisted of children with 1993 Oct 8;75(1):73-82 unexplained intrauterine growth restriction and Rubini M, Werner H, Gandini E, Roberts CT Jr, LeRoith D, subsequent short stature, and the second group included Baserga R. Platelet-derived growth factor increases the activity of the promoter of the insulin-like growth factor-1 (IGF-1) children with short stature and high circulating IGF1 receptor gene. Exp Cell Res. 1994 Apr;211(2):374-9 levels. A compound heterozygote for point mutations in IGF1R exon 2 was identified in a girl from the first Peoples R, Milatovich A, Francke U. Hemizygosity at the insulin-like growth factor I receptor (IGF1R) locus and growth group. Fibroblasts cultured from the patient had failure in the ring chromosome 15 syndrome. Cytogenet Cell decreased IGF1R binding and IGF1-stimulated Genet. 1995;70(3-4):228-34 phosphorylation. In the second cohort a boy was Werner H, LeRoith D. The role of the insulin-like growth factor identified with a nonsense mutation, leading to reduced system in human cancer. Adv Cancer Res. 1996;68:183-223 IGF1R expression. Clarke RB, Howell A, Anderson E. Type I insulin-like growth In a family harboring a ring chromosome 15, hemizygotes for the IGF1R locus showed severe factor receptor gene expression in normal human breast tissue treated with oestrogen and progesterone. Br J Cancer. growth failure, while a patient possessing two copies of 1997;75(2):251-7 the gene had borderline stature. On the other hand, a patient with three IGF1R gene copies due to a partial Hernández-Sánchez C, Werner H, Roberts CT Jr, Woo EJ, Hum DW, Rosenthal SM, LeRoith D. Differential regulation of duplication of the long arm of chromosome 15, insulin-like growth factor-I (IGF-I) receptor gene expression by

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 560 IGF1R (insulin-like growth factor 1 receptor) Bentov Y, Werner H

IGF-I and basic fibroblastic growth factor. J Biol Chem. 1997 Bentov I, Werner H. IGF, IGF receptor and overgrowth Feb 21;272(8):4663-70 syndromes. Pediatr Endocrinol Rev. 2004 Jun;1(4):352-60 Abuzzahab MJ, Schneider A, Goddard A, Grigorescu F, Lautier Werner H, Maor S. The insulin-like growth factor-I receptor C, Keller E, Kiess W, Klammt J, Kratzsch J, Osgood D, Pfäffle gene: a downstream target for oncogene and tumor R, Raile K, Seidel B, Smith RJ, Chernausek SD. IGF-I receptor suppressor action. Trends Endocrinol Metab. 2006 mutations resulting in intrauterine and postnatal growth Aug;17(6):236-42 retardation. N Engl J Med. 2003 Dec 4;349(23):2211-22 Klammt J, Pfäffle R, Werner H, Kiess W. IGF signaling defects Okubo Y, Siddle K, Firth H, O'Rahilly S, Wilson LC, Willatt L, as causes of growth failure and IUGR. Trends Endocrinol Fukushima T, Takahashi S, Petry CJ, Saukkonen T, Stanhope Metab. 2008 Aug;19(6):197-205 R, Dunger DB. Cell proliferation activities on skin fibroblasts from a short child with absence of one copy of the type 1 This article should be referenced as such: insulin-like growth factor receptor (IGF1R) gene and a tall child with three copies of the IGF1R gene. J Clin Endocrinol Metab. Bentov Y, Werner H. IGF1R (insulin-like growth factor 1 2003 Dec;88(12):5981-8 receptor). Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8):559-561.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 561

Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Review

MIR221 (microRNA 221) Shiva Akhavan Tabasi, Ayse Elif Erson Department of Biology, Middle East Technical University, Ankara, Turkey (SAT, AEE) Published in Atlas Database: September 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIRN221ID44277chXp11.html DOI: 10.4267/2042/44534 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

LOC100128442 (Xp11.3): hypothetical Identity LOC100128442 Other names: MIRN221 (microRNA 221); hsa-mir- LOC100130359 (Xp11.3): hypothetical 221; miR-221 LOC100130359. HGNC (Hugo): MIR221 DNA/RNA Location: Xp11.3 Local order: Based on Mapviewer (Master Map: Description Genes on sequence), genes flanking miR-221 and miR- miR-221 and 222 are located in an intergenic region. 222 oriented from centromere to telomere on Xp11.3 miR-221 and miR-222 are clustered genes, containing are: identical seed sequences and both map to the X KRT8P14 (Xp11.3) : keratin 8 pseudogene 14 chromosome separated by 727 bases. The positions of LOC392452 (Xp11.3): hypothetical LOC392452 these cluster microRNAs are: MIRN221 (Xp11.3): microRNA 221 hsa-mir-222 X: 45491365-45491474 MIRN222 (Xp11.3): microRNA 222 has-mir-221 X: 45490529-45490638.

Figure1: A: Stem-loop structure of miR-221. B: Genomic localization of miR-221 (MIRN221) and miR-221(MIRN222) on chromosomal band Xp11.3.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 562 MIR221 (microRNA 221) Tabasi SA, Erson AE

Transcription miRNA expression was not found for miR-222 in these cells. Together, these results suggest a need for further In general, the microRNA genes are transcribed by investigation to clarify this difference. RNA polymerase II, whereas RNA polymerase III is Also in kit positive TF-1 erythroleukemic cell line also responsible for transcription of some other which expresses high amounts of kit protein and low microRNAs. It is not known which RNA polymerase levels of miR-221/miR-222, transfection of these transcribes miR 221/miR-222. miR-221 and miR-222 microRNAs blocked proliferation of these cells. were shown to be expressed as a single pri-microRNA transcript in c-kit positive HUVEC cells. Angiogenesis, proliferation and cell Pre-microRNA 221 (precursor microRNA) migration Accession: MI0000298. Length: 110 bp. Note Sequence: miR-222 and miR-221 were found to be highly 5'-UGAACAUCCAGGUCUGGGGCAUGAACCU expressed in human cord blood derived CD34 - GGCAUACAAUGUAGAUUUCUGUGUUCGUUAG Hematopoietic Progenitor Cells (HPCs) and Human GCAACAGCUACAUUGUCUGCUGGGUUUCAGG Umbilical Vein Endothelial cells (HUVECs). HUVECs CUACCUGGAAACAUGUUCUC -3'. were used as an in vitro model for angiogenesis as they Mature miR-221 can form capillary like tubes when exposed to Accession: MIMAT0000278. appropriate stimulation. miR-221/miR-222 were shown Length: 23 nucleotides. to be transcribed in a common pri-microRNA in c-kit- Sequence: 65 - agcuacauugucugcuggguuuc - 87. positive HUVECs, suggesting a coordinated transcriptional regulation. Another group examined the Pseudogene effect of miR-221/miR-222 expression on the c-kit No pseudogenes were reported for mir-221 and 222. transcript and protein and they found that the level of c- kit protein was reduced in HUVECs transfected with Protein miR-221/miR-222, without a change of mRNA levels, which indicated the posttranslational down-regulation Note effect of these microRNAs on c-kit protein. In addition MicroRNAs are not translated into amino acids. miR-221/miR-222 transfected cells were not able to do wound healing and tube formation. In another study, Implicated in down-regulation of eNOS (an angiogenesis regulator) Differentiation and erythropoiesis protein by miR-221/miR-222 was claimed and because no target sites for these microRNAs in 3'-UTR of Note eNOS were present, it was suggested that the regulation Induction of 12-O-tetradecanoylphorbol-13-acetate could be indirect via gene expression, translational (TPA), a differentiation stimulator of HL-60 cells, efficiency or post-translational pathways. Interestingly, caused growth arrest and the adherent phenotype in over-expression of miR-221/miR-222 in endothelial 60% of HL-60 cells. MicroRNA expression was cells reduced angiogenesis and cell proliferation analyzed in these TPA treated differentiating HL-60 whereas conversely in cancer cells, up-regulation of cells. According to the results of microarray analysis, miR-221/miR-222 increased cell proliferation by miR-221 and miR-222 were up-regulated about 3-folds targeting cell cycle inhibitor p27, possibly indicating in TPA induced HL-60 cells. On the other hand, the that the modulation of proliferation depends on the cell expression of c-kit receptor was down- regulated in type. these cells, which suggested that c-kit, as was previously reported, the target of miR-221/222. Glioblastoma miR-221 and miR-222 were shown to be down- Note regulated in erythropoietic culture of cord blood CD34- Glioblastoma tissues and cell lines were investigated positive progenitor cells and it was suggested that this for differentially expressed microRNAs compared to reduction could cause erythropoiesis, as the expression normal brain tissue. Microarray and Northern blot of targeted key mRNAs were not blocked. However in results showed a strong up- regulation of miR-221 in another study, the expression of miR-221 (but not miR- glioblastomas. 222) was shown to be increased during erythropoietic cultures of human CD34 cord blood cells. Further Prostate cancer studies also indicated up-regulation of miR-221. Note Differentially expressed miRNAs during erythropoiesis In a study, PC3 cells (aggressive prostate were detected in cord blood-derived CD34 cells and carcinoma) and LNCaP and 22Rv1 cell line (slowly expression of miR-221 temporarily increased from day growing carcinomas) were tested and a reverse 0 to day 2, while its expression returned to the basal correlation between the expression of miR-221/miR- level (same as day 0) from day 2 to day 12 of 222 and p27 tumor suppressor was observed. In erythropoiesis. However such a fluctuation in the

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 563 MIR221 (microRNA 221) Tabasi SA, Erson AE

addition, over-expression of miR-221/miR-222 altered and is involved in binding, migration and the growth rate of these cells, by triggering a shift from differentiation of cells and promoting bone formation G1 to S phase of the cell cycle. from osteoblasts. To understand the mechanism of Ovarian cancer action of P-15, the expression of microRNAs in osteoblast-like cell line (MG-63) cultured with P-15 Note was investigated and miR-221 was among the up- A microRNA microarray study was performed to detect regulated ones according to a microRNA microarray the microRNA expression level in ovarian cancer, study. using 34 ovarian cancer tissues and 10 ovarian cancer cell lines. The results showed that miR-221 was the Lung cancer most highly expressed microRNA in both ovarian Note cancer tissues and cell lines compared to non- A microRNA expression investigation was performed transformed human ovarian surface epithelium cell in NSCLC (Non-Small Cell Lung Cancer) cells either line. resistant or sensitive to TRAIL (TNF-related apoptosis- Bladder cancer inducing ligand) to reveal roles of microRNAs in TRAIL resistance. The microarray and real-time PCR Note analysis showed that miR-221 and miR-222 were Based on a microarray study, it was shown that human remarkably up-regulated in TRAIL-resistant and down- miR-221 was among the remarkably up-regulated regulated in TRAIL-sensitive NSCLC cells. Also miR- microRNAs in bladder cancers when compared to 222 over-expression in CALU-1 cells (TRAIL- normal bladder mucosa. In this study, a microchip resistant) was confirmed by Northern blotting. In containing 368 probes in triplicate designed for 245 addition, transfecting CALU-1 cells (TRAIL-resistant microRNA genes were used for 27 bladder specimens lung cells) with anti- miR-221/miR-222, caused TRAIL (25 urothelial carcinomas and 2 normal mucosa sensitivity. Consistently over-expression of these samples). microRNAs produced TRAIL-resistant NSCLC cells. Papillary thyroid carcinoma Moreover, p27 tumor suppressor and proto-oncogene kit receptor, which are the known targets of miR- Note 221/miR-222, were shown to be up-regulated in When comparing the expression level of 23 TRAIL-sensitive and down-regulated in TRAIL- microRNAs in 15 Papillary Thyroid Cancer (PTC) resistant NSCLC. These microRNAs were also tumors with normal thyroid tissue, a group of suggested to modulate the expression of Mcl-1 researchers found that miR-221/ miR-222 were among (Myeloid cell leukemia sequence 1) and FADD (Fas- the five over-expressed microRNAs in PTC tumors by Associated protein with Death Domain) indirectly. performing microarray analysis (the results were also Giving these, miR-221 and miR-222 were shown to be confirmed with RT-PCR and Northern blot). responsible for sensitivity to TRAIL in NSCLC cells Interestingly, quantitative real-time PCR results and could be considered as important targets for revealed that miR-221 was over-expressed in normal diagnostic and therapeutic purposes in NSCLC. thyroid tissues of PTC patients when compared to normal thyroid tissues of individuals without clinical Neuroblastoma thyroid disease, indicating the possible importance of Note this microRNA in early stages of PTC carcinogenesis. MYCN amplification is commonly found in Hepatocellular carcinoma neuroblastomas. MYCN acts as transcription factor and regulates the expression of a number of genes. For Note finding the microRNA genes that are possibly regulated As it has been shown in many cancers, miR-221 was with MYCN, microarray and q-RT-PCR studies were also found to be up-regulated in human hepatocellular performed in primary neuroblastoma with MYCN carcinoma (HCC). Over-expression of miR-221 was amplification. miR-221 was one of the 7 up-regulated shown to cause down- regulation of CDKN1B/p27 and microRNAs in these cells. CDKN1C/p57 in hepatocellular carcinoma, indicating a reverse relation between their expressions in HCC. Pancreatic cancer miR-221 was shown to target 3' UTRs of Note CDKN1B/p27 and CDKN1C/p57. Up-regulation of For the purpose of finding a microRNA signature in miR-221 caused cell proliferation in HCC cells by pancreatic cancers, the expression of over 200 increasing the number of cells which were in S1 phase microRNA precursors was investigated by real-time of the cell cycle. PCR in benign tissue, normal pancreas, chronic Osteogenesis pancreatitis and pancreatic cancer cell lines. The results showed that a number of microRNAs were over- Note expressed in the tumors, when compared to normal P-15 is an analog of cell-binding domain of collagen

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 564 MIR221 (microRNA 221) Tabasi SA, Erson AE

pancreas. miR-221 was among the microRNAs that Croce CM, Baffa R. Micro-RNA profiling in kidney and bladder were over-expressed in adenocarcinomas and endocrine cancers. Urol Oncol. 2007 Sep-Oct;25(5):387-92 pancreas cancers. Based on PCR results, over- Lee EJ, Gusev Y, Jiang J, Nuovo GJ, Lerner MR, Frankel WL, expression of mature miR-222 was also suggested Morgan DL, Postier RG, Brackett DJ, Schmittgen TD. Expression profiling identifies microRNA signature in (similar to miR-221) in pancreas cancer. pancreatic cancer. Int J Cancer. 2007 Mar 1;120(5):1046-54 Masaki S, Ohtsuka R, Abe Y, Muta K, Umemura T. Expression References patterns of microRNAs 155 and 451 during normal human Ciafrè SA, Galardi S, Mangiola A, Ferracin M, Liu CG, erythropoiesis. Biochem Biophys Res Commun. 2007 Dec Sabatino G, Negrini M, Maira G, Croce CM, Farace MG. 21;364(3):509-14 Extensive modulation of a set of microRNAs in primary Suárez Y, Fernández-Hernando C, Pober JS, Sessa WC. glioblastoma. Biochem Biophys Res Commun. 2005 Sep Dicer dependent microRNAs regulate gene expression and 9;334(4):1351-8 functions in human endothelial cells. Circ Res. 2007 Apr Felli N, Fontana L, Pelosi E, Botta R, Bonci D, Facchiano F, 27;100(8):1164-73 Liuzzi F, Lulli V, Morsilli O, Santoro S, Valtieri M, Calin GA, Liu Dahiya N, Sherman-Baust CA, Wang TL, Davidson B, Shih CG, Sorrentino A, Croce CM, Peschle C. MicroRNAs 221 and IeM, Zhang Y, Wood W 3rd, Becker KG, Morin PJ. MicroRNA 222 inhibit normal erythropoiesis and erythroleukemic cell expression and identification of putative miRNA targets in growth via kit receptor down-modulation. Proc Natl Acad Sci U ovarian cancer. PLoS One. 2008 Jun 18;3(6):e2436 S A. 2005 Dec 13;102(50):18081-6 Fornari F, Gramantieri L, Ferracin M, Veronese A, Sabbioni S, He H, Jazdzewski K, Li W, Liyanarachchi S, Nagy R, Volinia S, Calin GA, Grazi GL, Giovannini C, Croce CM, Bolondi L, Calin GA, Liu CG, Franssila K, Suster S, Kloos RT, Croce CM, Negrini M. MiR-221 controls CDKN1C/p57 and CDKN1B/p27 de la Chapelle A. The role of microRNA genes in papillary expression in human hepatocellular carcinoma. Oncogene. thyroid carcinoma. Proc Natl Acad Sci U S A. 2005 Dec 2008 Sep 25;27(43):5651-61 27;102(52):19075-80 Garofalo M, Quintavalle C, Di Leva G, Zanca C, Romano G, Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Taccioli C, Liu CG, Croce CM, Condorelli G. MicroRNA Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA, Downing signatures of TRAIL resistance in human non-small cell lung JR, Jacks T, Horvitz HR, Golub TR. MicroRNA expression cancer. Oncogene. 2008 Jun 19;27(27):3845-55 profiles classify human cancers. Nature. 2005 Jun 9;435(7043):834-8 Kuehbacher A, Urbich C, Dimmeler S. Targeting microRNA expression to regulate angiogenesis. Trends Pharmacol Sci. Poliseno L, Tuccoli A, Mariani L, Evangelista M, Citti L, Woods 2008 Jan;29(1):12-5 K, Mercatanti A, Hammond S, Rainaldi G. MicroRNAs modulate the angiogenic properties of HUVECs. Blood. 2006 Palmieri A, Pezzetti F, Brunelli G, Martinelli M, Lo Muzio L, Nov 1;108(9):3068-71 Scarano A, Degidi M, Piattelli A, Carinci F. Peptide-15 changes miRNA expression in osteoblast-like cells. Implant Dent. 2008 Choong ML, Yang HH, McNiece I. MicroRNA expression Mar;17(1):100-8 profiling during human cord blood-derived CD34 cell erythropoiesis. Exp Hematol. 2007 Apr;35(4):551-64 Schulte JH, Horn S, Otto T, Samans B, Heukamp LC, Eilers UC, Krause M, Astrahantseff K, Klein-Hitpass L, Buettner R, Galardi S, Mercatelli N, Giorda E, Massalini S, Frajese GV, Schramm A, Christiansen H, Eilers M, Eggert A, Berwanger B. Ciafrè SA, Farace MG. miR-221 and miR-222 expression MYCN regulates oncogenic MicroRNAs in neuroblastoma. Int J affects the proliferation potential of human prostate carcinoma Cancer. 2008 Feb 1;122(3):699-704 cell lines by targeting p27Kip1. J Biol Chem. 2007 Aug 10;282(32):23716-24 This article should be referenced as such: Gottardo F, Liu CG, Ferracin M, Calin GA, Fassan M, Bassi P, Tabasi SA, Erson AE. MIR221 (microRNA 221). Atlas Genet Sevignani C, Byrne D, Negrini M, Pagano F, Gomella LG, Cytogenet Oncol Haematol. 2009; 13(8):562-565.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 565 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Mini Review

MIR222 (microRNA 222) Shiva Akhavan Tabasi, Ayse Elif Erson Department of Biology, Middle East Technical University, Ankara, Turkey (SAT, AEE)

Published in Atlas Database: September 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIRN222ID44278chXp11.html DOI: 10.4267/2042/44535 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

LOC100128442 (Xp11.3): hypothetical Identity LOC100128442, Other names: MIRN222 (microRNA 222); hsa-mir- LOC100130359 (Xp11.3): hypothetical 222; miR-222 LOC100130359. HGNC (Hugo): MIR222 DNA/RNA Location: Xp11.3 Local order: Based on Mapviewer (Master Map: Description Genes on sequence), genes flanking miR-221 and miR- miR-221 and 222 are located in an intergenic region. 222 oriented from centromere to telomere on Xp11.3 miR-221 and miR-222 are clustered genes, containing are: identical seed sequences and both map to the X KRT8P14 (Xp11.3): keratin 8 pseudogene 14, chromosome separated by 727 bases. The positions of LOC392452 (Xp11.3): hypothetical LOC392452, these cluster microRNAs are: MIRN221 (Xp11.3) : microRNA 221, hsa-mir-222 X: 45491365-45491474 MIRN222 (Xp11.3) : microRNA 222, has-mir-221 X: 45490529-45490638.

A: Stem-loop structure of miR-222. B: Genomic localization of miR-221 (MIRN221) and miR-221(MIRN222) on chromosomal band Xp11.3.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 566 MIR222 (microRNA 222) Tabasi SA, Erson AE

Transcription expression, however, was not found for miR-222 in these cells. Together, these results suggest a need for In general, the microRNA genes are transcribed by further investigation to clarify this difference. Also in RNA polymerase II, whereas RNA polymerase III is kit positive TF-1 erythroleukemic cell line which also responsible for transcription of some other expresses high amounts of kit protein and low levels of microRNAs. It is not known which RNA polymerase miR-221/miR-222, transfection of these microRNAs transcribes miR-221/miR-222. miR-221 and miR-222 blocked proliferation of these cells. were shown to be expressed as a single pri-microRNA transcript in c-kit positive HUVEC cells. Angiogenesis, proliferation and cell Pre-microRNA 222 (precursor microRNA) migration Accession: MI0000299. Note Length:110 bp. miR-222 and miR-221 were found to be highly Sequence: expressed in human cord blood derived CD34 - 5'-GCUGCUGGAAGGUGUAGGUACCCUCAAU Hematopoietic Progenitor Cells (HPCs) and Human GGCUCAGUAGCCAGUGUAGAUCCUGUCUUUC Umbilical Vein Endothelial cells (HUVECs). HUVECs GUAAUCAGCAGCUACAUCUGGCUACUGGGUC were used as an in vitro model for angiogenesis as they UCUGAUGGCAUCUUCUA GCU-3'. can form capillary like tubes when exposed to Mature miR-222 appropriate stimulation. miR-221/miR-222 were shown Accession: MIMAT0000279. to be transcribed in a common pri-microRNA in c-kit- Length: 21 nucleotides. positive HUVECs, suggesting a coordinated Sequence: 69 - agcuacaucuggcuacugggu – 89. transcriptional regulation. Another group examined the Pseudogene effect of miR-221/miR-222 expression on the c-kit No pseudogenes were reported for mir-221 and 222. transcript and protein and they found that the level of c- kit protein was reduced in HUVECs transfected with Protein miR-221/ miR-222, without a change of mRNA levels, which indicated the posttranslational down-regulation Note effect of these microRNAs on c-kit protein. In addition MicroRNAs are not translated into amino acids. miR-221/miR-222 transfected cells were not able to do wound healing and tube formation. In another study, Implicated in down-regulation of eNOS (an angiogenesis regulator) protein by miR-221/miR-222 was claimed and because Differentiation and erythropoiesis no target sites for these microRNAs in 3'-UTR of Note eNOS were present, it was suggested that the regulation Induction of 12-O-tetradecanoylphorbol-13-acetate could be indirect via gene expression, translational (TPA), a differentiation stimulator of HL-60 cells, efficiency or post-translational pathways. Interestingly, caused growth arrest and the adherent phenotype in over-expression of miR-221/miR-222 in endothelial 60% of HL-60 cells. MicroRNA expression was cells reduced angiogenesis and cell proliferation analyzed in these TPA treated differentiating HL-60 whereas conversely in cancer cells, up-regulation of cells. According to the results of microarray analysis, miR-221/miR-222 increased cell proliferation by miR-221 and miR-222 were up-regulated about 3-folds targeting cell cycle inhibitor p27, possibly indicating in TPA induced HL-60 cells. On the other hand, the that the modulation of proliferation depends on the cell expression of c-kit receptor was down- regulated in type. these cells, which suggested that c-kit, as was previously reported, the target of miR-221/222. Prostate cancer miR-221 and miR-222 were shown to be down- Note regulated in erythropoietic culture of cord blood CD34- In a study, PC3 cells (aggressive prostate carcinoma) positive progenitor cells and it was suggested that this and LNCaP and 22Rv1 cell line (slowly growing reduction could cause erythropoiesis, as the expression carcinomas) were tested and a reverse correlation of targeted key mRNAs were not blocked. However, in between the expression of miR-221/miR-222 and p27 another study, the expression of miR-221 (but not miR- tumor suppressor was observed. In addition, over- 222) was shown to be increased during erythropoietic expression of miR-221/miR-222 altered the growth rate cultures of human CD34 cord blood cells. Further of these cells, by triggering a shift from G1 to S phase studies also indicated up-regulation of miR-221. of the cell cycle. Differentially expressed miRNAs during erythropoiesis Papillary thyroid carcinoma were detected in cord blood-derived CD34 cells and expression of miR-221 temporarily increased from day Note 0 to day 2, while its expression returned to the basal When comparing the expression level of 23 level (same as day 0) from day 2 to day 12 of microRNAs in 15 Papillary Thyroid Cancer (PTC) erythropoiesis. Such a fluctuation in the miRNA tumors with normal thyroid tissue, a group of

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 567 MIR222 (microRNA 222) Tabasi SA, Erson AE

researchers found that miR-221/ miR-222 were among glioblastoma. Biochem Biophys Res Commun. 2005 Sep the five over-expressed microRNAs in PTC tumors by 9;334(4):1351-8 performing microarray analysis (the results were also Felli N, Fontana L, Pelosi E, Botta R, Bonci D, Facchiano F, confirmed with RT-PCR and Northern blot). Liuzzi F, Lulli V, Morsilli O, Santoro S, Valtieri M, Calin GA, Liu CG, Sorrentino A, Croce CM, Peschle C. MicroRNAs 221 and Interestingly, quantitative real-time PCR results 222 inhibit normal erythropoiesis and erythroleukemic cell revealed that miR-221 was over-expressed in normal growth via kit receptor down-modulation. Proc Natl Acad Sci U thyroid tissues of PTC patients when compared to S A. 2005 Dec 13;102(50):18081-6 normal thyroid tissues of individuals without clinical He H, Jazdzewski K, Li W, Liyanarachchi S, Nagy R, Volinia S, thyroid disease, indicating the possible importance of Calin GA, Liu CG, Franssila K, Suster S, Kloos RT, Croce CM, this microRNA in early stages of PTC carcinogenesis. de la Chapelle A. The role of microRNA genes in papillary thyroid carcinoma. Proc Natl Acad Sci U S A. 2005 Dec Lung cancer 27;102(52):19075-80 Note Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, A microRNA expression investigation was performed Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA, Downing in NSCLC (non-small cell lung cancer) cells either JR, Jacks T, Horvitz HR, Golub TR. MicroRNA expression profiles classify human cancers. Nature. 2005 Jun resistant or sensitive to TRAIL (TNF-related apoptosis- 9;435(7043):834-8 inducing ligand) to reveal roles of microRNAs in Poliseno L, Tuccoli A, Mariani L, Evangelista M, Citti L, Woods TRAIL resistance. The microarray and real-time PCR K, Mercatanti A, Hammond S, Rainaldi G. MicroRNAs analysis showed that miR-221 and miR-222 were modulate the angiogenic properties of HUVECs. Blood. 2006 remarkably up-regulated in TRAIL-resistant and down- Nov 1;108(9):3068-71 regulated in TRAIL-sensitive NSCLC cells. Also miR- Choong ML, Yang HH, McNiece I. MicroRNA expression 222 over-expression in CALU-1 cells (TRAIL- profiling during human cord blood-derived CD34 cell resistant) was confirmed by Northern blotting. In erythropoiesis. Exp Hematol. 2007 Apr;35(4):551-64 addition, transfecting CALU-1 cells (TRAIL-resistant Galardi S, Mercatelli N, Giorda E, Massalini S, Frajese GV, lung cells) with anti- miR-221/miR-222, caused TRAIL Ciafrè SA, Farace MG. miR-221 and miR-222 expression sensitivity. Consistently over-expression of these affects the proliferation potential of human prostate carcinoma cell lines by targeting p27Kip1. J Biol Chem. 2007 Aug microRNAs produced TRAIL-resistant NSCLC cells. 10;282(32):23716-24 Moreover, p27 tumor suppressor and proto-oncogene kit receptor, which are the known targets of miR- Gottardo F, Liu CG, Ferracin M, Calin GA, Fassan M, Bassi P, Sevignani C, Byrne D, Negrini M, Pagano F, Gomella LG, 221/miR-222, were shown to be up-regulated in Croce CM, Baffa R. Micro-RNA profiling in kidney and bladder TRAIL-sensitive and down-regulated in TRAIL- cancers. Urol Oncol. 2007 Sep-Oct;25(5):387-92 resistant NSCLC. These microRNAs were also Lee EJ, Gusev Y, Jiang J, Nuovo GJ, Lerner MR, Frankel WL, suggested to modulate the expression of Mcl-1 Morgan DL, Postier RG, Brackett DJ, Schmittgen TD. (myeloid cell leukemia sequence 1) and FADD (Fas- Expression profiling identifies microRNA signature in associated protein with death domain) indirectly. pancreatic cancer. Int J Cancer. 2007 Mar 1;120(5):1046-54 Giving these, miR-221 and miR-222 were shown to be Masaki S, Ohtsuka R, Abe Y, Muta K, Umemura T. Expression responsible for sensitivity to TRAIL in NSCLC cells patterns of microRNAs 155 and 451 during normal human and could be considered as important targets for erythropoiesis. Biochem Biophys Res Commun. 2007 Dec diagnostic and therapeutic purposes in NSCLC. 21;364(3):509-14 Suárez Y, Fernández-Hernando C, Pober JS, Sessa WC. Pancreatic cancer Dicer dependent microRNAs regulate gene expression and Note functions in human endothelial cells. Circ Res. 2007 Apr 27;100(8):1164-73 For the purpose of finding a microRNA signature in pancreatic cancers, the expression of over 200 Dahiya N, Sherman-Baust CA, Wang TL, Davidson B, Shih IeM, Zhang Y, Wood W 3rd, Becker KG, Morin PJ. MicroRNA microRNA precursors was investigated by real-time expression and identification of putative miRNA targets in PCR in benign tissue, normal pancreas, chronic ovarian cancer. PLoS One. 2008 Jun 18;3(6):e2436 pancreatitis and pancreatic cancer cell lines. The results Fornari F, Gramantieri L, Ferracin M, Veronese A, Sabbioni S, showed that a number of microRNAs were over- Calin GA, Grazi GL, Giovannini C, Croce CM, Bolondi L, expressed in the tumors, when compared to normal Negrini M. MiR-221 controls CDKN1C/p57 and CDKN1B/p27 pancreas. miR-221 was among the microRNAs that expression in human hepatocellular carcinoma. Oncogene. were over-expressed in adenocarcinomas and endocrine 2008 Sep 25;27(43):5651-61 pancreas cancers. Based on PCR results, over- Garofalo M, Quintavalle C, Di Leva G, Zanca C, Romano G, expression of mature miR-222 was also suggested Taccioli C, Liu CG, Croce CM, Condorelli G. MicroRNA (similar to miR-221) in pancreas cancer. signatures of TRAIL resistance in human non-small cell lung cancer. Oncogene. 2008 Jun 19;27(27):3845-55 References Kuehbacher A, Urbich C, Dimmeler S. Targeting microRNA expression to regulate angiogenesis. Trends Pharmacol Sci. Ciafrè SA, Galardi S, Mangiola A, Ferracin M, Liu CG, 2008 Jan;29(1):12-5 Sabatino G, Negrini M, Maira G, Croce CM, Farace MG. Palmieri A, Pezzetti F, Brunelli G, Martinelli M, Lo Muzio L, Extensive modulation of a set of microRNAs in primary Scarano A, Degidi M, Piattelli A, Carinci F. Peptide-15 changes

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 568 MIR222 (microRNA 222) Tabasi SA, Erson AE

miRNA expression in osteoblast-like cells. Implant Dent. 2008 This article should be referenced as such: Mar;17(1):100-8 Tabasi SA, Erson AE. MIR222 (microRNA 222). Atlas Genet Schulte JH, Horn S, Otto T, Samans B, Heukamp LC, Eilers Cytogenet Oncol Haematol. 2009; 13(8):566-569. UC, Krause M, Astrahantseff K, Klein-Hitpass L, Buettner R, Schramm A, Christiansen H, Eilers M, Eggert A, Berwanger B. MYCN regulates oncogenic MicroRNAs in neuroblastoma. Int J Cancer. 2008 Feb 1;122(3):699-704

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 569

Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Mini Review

PAF1 (Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)) Shonali Deb, Moorthy P Ponnusamy, Surinder K Batra Department of Biochemistry and Molecular Biology University of Nebraska Medical Center 985870 Nebraska Medical Center Durham Research center 7005 Omaha, NE 68198-5870, USA (SD, MPP, SKB)

Published in Atlas Database: September 2008 Online updated version: http://AtlasGeneticsOncology.org/Genes/PAF1ID44202ch19q13.html DOI: 10.4267/2042/44536 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

sequences that code for a domain rich in serine and Identity aspartic acid residues and the 30-untranslated region. Other names: F23149_1; FLJ11123; hPAF1; PD2 Introns range in size from 78 to 1539 bp. The HGNC (Hugo): PAF1 sequences at the exon/intron boundaries are highly conserved with respect to canonical acceptor/donor site Location: 19q13.1 (AG/GT). The sequence of this gene is defined by 540 Note: Paf1 is a member of the hPAF complex and is GenBank accessions from 506 cDNA clones, some dysregulated in cancer. The RNA polymerase II- from pancreas (seen 68 times), brain (51), ductal associated factor (PAF) complex was initially reported carcinoma, cell line (32), testis (23), lung (22), in yeast (yPAF), and comprises five subunits in epithelioid carcinoma (20), placenta (20) and 151 other humans, Paf1, Ctr9, Leo1, Cdc73 and Ski8. yPAF is tissues. associated with both the promoter and coding regions of transcriptionally active genes and plays a role in Transcription transcription elongation. The complete PD2 cDNA sequence is present in the GenBankt/EBI Data Bank under the accession number, DNA/RNA AJ401156. This sequence contains a 50-untranslated region of 156 bp upstream of the ATG translation Description initiation codon, and is flanked by a Kozak consensus The Paf1 gene is located on chromosome 19 in the sequence and a 30-untranslated region of 138 bp. The q13.2 (loc126275) region, oriented from centromere to noncoding 30 region contains the polyadenylation telomere, between the IgG binding protein gene signal, AATAAA. An open reading frame, from bp 157 (FcGBP) and the zinc-finger protein 36 gene (ZFP36). to 1752, yields a predicted translation product of 59.9 The Paf1 gene is 5178-bp long and contains 14 exons kDa. Paf1 is overexpressed in the poorly differentiated of sizes ranging from 30 to 551 bp. The first exon pancreatic cancer cell line, Panc1. This gene is contains the 50-untranslated region, the translation start expressed at a very high level, 4.7 times the average site, and the first 16 amino-acid residues. The last exon gene in this release. contains

Shows the genomic organization of Paf1 gene.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 570 PAF1 (Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)) Deb S, et al.

Schematic representation of protein structure and its organization. RRM, RNA recognition motif; RCC, regulator of chromosome condensation.

BC010317), Drosophila melanogaster (AY070561.1, Protein AC008139, and AE003605), Caenorhabditis elegans Description (NP-505925, NM-073524 and CAB02869.1), Schizosaccharomyces pombe (CAB65804), and There is a high degree of similarity between PD2 and Saccharomyces cerevisiae (P38351). The human Paf1 the functional domains of DNA- and RNA-binding shows 98% and 50% similarity to its rodent and proteins. Paf1 protein possesses four myc-type helix- Drosophila counterparts, respectively. The S. cerevisiae loop-helix, a leucine zipper, a DEAD-box subfamily homologue corresponds to the widely investigated Paf1 ATP-dependent helicase domain, one eukaryotic RNA protein, which shows 22% identity with the human recognition motif (RRM) RNP-1 region signature, and sequence, and 44% similarity for a segment of 333 a regulator of chromosome condensation (RCC1) amino-acid residues that excluded the carboxyl signature. Two specific domains were also positioned terminus. Altogether, 22 amino acids are totally toward the carboxyl-terminus: a glutamic acid rich conserved among human, rodent, Drosophila, and S. domain, from amino acid 358 to 452, and a cerevisiae, including two tyrosine residues. The least serine/aspartic acid-rich domain, from amino acid 402 conserved domain is found in the carboxyl-terminal to 531. region. This domain is very rich in serine and aspartic Expression acid residues. Paf1 is expressed at high levels in head, neck, liver, ovary and testis and at a low level in several other Implicated in tissues including kidney. Various cancers Localisation Disease Paf1 is localized in the nucleus. The hPaf1 overexpression is associated with various cancers as given below in the section of Oncogenesis. Function Although there is no direct association of Paf1 with any It has been determined that hPaf1 is a subunit of the other disease, parafibromin, which is part of the hPAF human PAF protein complex which was first identified complex, is encoded by the HRPT2 gene and is during characterization of proteins associated with implicated in suppression of the hyperparathyroidism- parafibromin. The hPAF complex interacts with the jaw tumor (HPT-JT) syndrome. The HRPT2 gene is non-phosphorylated and Ser2- and Ser5-phosphorylated mutated in the germ line of HPT-JT patients. forms of the RNAP II large subunit, indicating its Oncogenesis involvement in both transcription initiation and The oncogenic property of hPaf1 has been reported. elongation. It has been shown that the establishment of Overexpression of hPaf1 in NIH3T3 cells results in H2B monoubiquitination is dependent on hPAF, the enhanced growth rates in vitro and tumor formation in histone chaperone FACT and transcription. Further, the vivo. Further, hPaf1 overexpression is associated with RNF20 / RNF40 UBCH6-PAF complex is required for different cancers, including leukemia, lung, myeloma transcription of the HOX genes in the following and fallopian tube and testicular carcinoma. In cell cascade: PAF - histone H2B ubiquitination - histone lines, hPaf1 is overexpressed due to gene amplification H3-K4 and H3-K79 methylation - HOX gene in the poorly differentiated pancreatic cancer cell line, expression. Immunoprecipitation analysis has Panc1. demonstrated that, found that RNA polymerase II associates with PAF1. Overexpression of hPaf1 in NIH3T3 cells results in enhanced growth rates in vitro References and tumor formation in vivo. Belotserkovskaya R, Reinberg D. Facts about FACT and transcript elongation through chromatin. Curr Opin Genet Dev. Homology 2004 Apr;14(2):139-46 There is a high degree of similarity between Paf1 and Rosonina E, Manley JL. From transcription to mRNA: PAF sequences from mouse (AK017762, AB041615, provides a new path. Mol Cell. 2005 Oct 28;20(2):167-8

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 571 PAF1 (Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)) Deb S, et al.

Rozenblatt-Rosen O, Hughes CM, Nannepaga SJ, Moniaux N, Nemos C, Schmied BM, Chauhan SC, Deb S, Shanmugam KS, Copeland TD, Guszczynski T, Resau JH, Morikane K, Choudhury A, Vanlith M, Sutherlin M, Sikela JM, Meyerson M. The parafibromin tumor suppressor protein is Hollingsworth MA, Batra SK. The human homologue of the part of a human Paf1 complex. Mol Cell Biol. 2005 RNA polymerase II-associated factor 1 (hPaf1), localized on Jan;25(2):612-20 the 19q13 amplicon, is associated with tumorigenesis. Oncogene. 2006 Jun 1;25(23):3247-57 Yart A, Gstaiger M, Wirbelauer C, Pecnik M, Anastasiou D, Hess D, Krek W. The HRPT2 tumor suppressor gene product Chaudhary K, Deb S, Moniaux N, Ponnusamy MP, Batra SK. parafibromin associates with human PAF1 and RNA Human RNA polymerase II-associated factor complex: polymerase II. Mol Cell Biol. 2005 Jun;25(12):5052-60 dysregulation in cancer. Oncogene. 2007 Nov 29;26(54):7499- 507 Zhu B, Mandal SS, Pham AD, Zheng Y, Erdjument-Bromage H, Batra SK, Tempst P, Reinberg D. The human PAF complex Deb S, Ponnusamy MP, Senapati S, Dey P, Batra SK.. Human coordinates transcription with events downstream of RNA PAF Complexes in Endocrine Tumors and Pancreatic Cancer. synthesis. Genes Dev. 2005 Jul 15;19(14):1668-73 Expert Rev Endocrinol Metab. 2008 Sep 3(5), 557-565.

Zhu B, Zheng Y, Pham AD, Mandal SS, Erdjument-Bromage This article should be referenced as such: H, Tempst P, Reinberg D. Monoubiquitination of human histone H2B: the factors involved and their roles in HOX gene Deb S, Ponnusamy MP, Batra SK. PAF1 (Paf1, RNA regulation. Mol Cell. 2005 Nov 23;20(4):601-11 polymerase II associated factor, homolog (S. cerevisiae)). Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8):570-572.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 572

Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Mini Review

PTPN13 (Protein tyrosine phosphatase, non- receptor type 13) Alessandro Beghini University of Milan, Medical Faculty, Department of Biology and Genetics for Medical Sciences, via Viotti 5, 20133-Milan, Italy (AB)

Published in Atlas Database: September 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/PTPN13ID41912ch4q21.html DOI: 10.4267/2042/44537 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Protein Other names: DKFZp686J1497; FAP-1; PNP1; PTP- Description BAS; PTP-BL; PTP-E1; PTP1E; PTPL1; PTPLE The protein encoded by this gene is a member of the HGNC (Hugo): PTPN13 protein tyrosine phosphatase (PTP) family. PTPs are Location: 4q21.3 known to be signaling molecules that regulate a variety Note: Genomic context: PTPN13 lies in a head-to-head of cellular processes including cell growth, conformation with MAPK10/JNK3 and they share a differentiation, mitotic cycle, and oncogenic 633 bp bi-directional promoter which is a typical CpG transformation. This PTP is a large protein that island. possesses a PTP domain at C-terminus, and multiple noncatalytic domains, which include a domain with DNA/RNA similarity to band 4.1 superfamily of cytoskeletal- associated proteins, a region consisting of five PDZ Description domains, and a leucine zipper motif. This PTP was The gene covers 220.87 kb (from 87734485 to found to interact with, and dephosphorylate Fas 87955350-NCBI) and contains 48 exons and 51 receptor, as well as IkappaBalpha through the PDZ different introns (49 gt-ag, 2 gc-ag), initiates domains, which suggested its role in Fas mediated transcription within exon 2 and terminates in exon 48. programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may Transcription function as a regulator of Rho signaling pathway. Eight Transcription produces 13 different mRNAs, 9 spliced and the unspliced mRNAs putatively encode alternatively spliced variants and 4 unspliced forms. good proteins. RefSeq annotates 4 representative transcripts, but Expression Homo sapiens cDNA sequences in GenBank support at In all human normal tissues, including lymph node and least 9 spliced variants. peripheral blood mononuclear cells samples, PTPN13 is ubiquitously expressed.

Genomic view.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 573 PTPN13 (Protein tyrosine phosphatase, non-receptor type 13) Beghini A

Schematic representation of PTPN13 structure and boxes represent functional domains. The KIND domain has been identified in silico by sequence homology.

Localisation samples analyzed), predicted to result in missense or non-sense mutations. Some of these mutant proteins led The FERM domain binds to phosphatidylinositol 4,5- to reduce phosphatase activity. biphosphate leading to the enrichment of PTPN13 at a juxtamembrane localization.However, the PTPN13 protein is also detected throughout the cytoplasm. In Implicated in HeLa cells, PTPN13 localizes to the centrosomes Colorectal cancers during metaphase. Disease Function A large-scale study that looked at the mutations in the Functionally, the gene has been tested for association to tyrosine phosphatome from colorectal cancers diseases (bone neoplasms; carcinoma; colorectal identified PTPN13. The authors identified 19 neoplasms; liver neoplasms; lymphoma; sarcoma, mutations, non-sense and missense, seven of which Ewing's), proposed to participate in a pathway (FAS were in the PTP domain. signaling pathway (CD95)) and a process (protein Lymphomas (Hodgkin and non- amino acid dephosphorylation). Proteins are expected to have molecular functions (non-membrane spanning Hodgkin), gastric and hepatocellular protein tyrosine phosphatase activity, hydrolase tumors activity, protein binding, structural molecule activity) Disease and to localize in various compartments (nucleus, Hypermethylation of the PTPN13 promoter or allelic cytoplasm, cytoskeleton). loss was observed leading to downregulation of Mutations PTPN13 mRNA. Note To be noted Different somatic mutations was identified in colorectal Note tumors (19% of the colorectal cancer Several evidences suggest that PTPN13 may act

Distribution of mutations in PTPN13, black arrows indicate location of missense mutations, red arrows indicate location of nonsense mutations or frameshifts.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 574 PTPN13 (Protein tyrosine phosphatase, non-receptor type 13) Beghini A

differently as a tumor promoting gene depending upon Yoshida S, Harada H, Nagai H, Fukino K, Teramoto A, Emi M. the disease context. The modulation of Fas-mediated Head-to-head juxtaposition of Fas-associated phosphatase-1 (FAP-1) and c-Jun NH2-terminal kinase 3 (JNK3) genes: cell death by PTPN13 could enhance tumor growth by genomic structure and seven polymorphisms of the FAP-1 blocking death signaling. gene. J Hum Genet. 2002;47(11):614-9 Wang Z, Shen D, Parsons DW, Bardelli A, Sager J, Szabo S, References Ptak J, Silliman N, Peters BA, van der Heijden MS, Parmigiani G, Yan H, Wang TL, Riggins G, Powell SM, Willson JK, Banville D, Ahmad S, Stocco R, Shen SH. A novel protein- Markowitz S, Kinzler KW, Vogelstein B, Velculescu VE. tyrosine phosphatase with homology to both the cytoskeletal Mutational analysis of the tyrosine phosphatome in colorectal proteins of the band 4.1 family and junction-associated cancers. Science. 2004 May 21;304(5674):1164-6 guanylate kinases. J Biol Chem. 1994 Sep 2;269(35):22320-7 Yeh SH, Wu DC, Tsai CY, Kuo TJ, Yu WC, Chang YS, Chen Maekawa K, Imagawa N, Nagamatsu M, Harada S. Molecular CL, Chang CF, Chen DS, Chen PJ. Genetic characterization of cloning of a novel protein-tyrosine phosphatase containing a fas-associated phosphatase-1 as a putative tumor suppressor membrane-binding domain and GLGF repeats. FEBS Lett. gene on chromosome 4q21.3 in hepatocellular carcinoma. Clin 1994 Jan 10;337(2):200-6 Cancer Res. 2006 Feb 15;12(4):1097-108 Saras J, Claesson-Welsh L, Heldin CH, Gonez LJ. Cloning and Ying J, Li H, Cui Y, Wong AH, Langford C, Tao Q. Epigenetic characterization of PTPL1, a protein tyrosine phosphatase with disruption of two proapoptotic genes MAPK10/JNK3 and similarities to cytoskeletal-associated proteins. J Biol Chem. PTPN13/FAP-1 in multiple lymphomas and carcinomas 1994 Sep 30;269(39):24082-9 through hypermethylation of a common bidirectional promoter. Inazawa J, Ariyama T, Abe T, Druck T, Ohta M, Huebner K, Leukemia. 2006 Jun;20(6):1173-5 Yanagisawa J, Reed JC, Sato T. PTPN13, a fas-associated Abaan OD, Toretsky JA. PTPL1: a large phosphatase with a protein tyrosine phosphatase, is located on the long arm of split personality. Cancer Metastasis Rev. 2008 Jun;27(2):205- chromosome 4 at band q21.3. Genomics. 1996 Jan 14 15;31(2):240-2 van den Maagdenberg AM, Olde Weghuis D, Rijss J, Merkx This article should be referenced as such: GF, Wieringa B, Geurts van Kessel A, Hendriks WJ. The gene Beghini A. PTPN13 (Protein tyrosine phosphatase, non- (PTPN13) encoding the protein tyrosine phosphatase PTP- receptor type 13). Atlas Genet Cytogenet Oncol Haematol. BL/PTP-BAS is located in mouse chromosome region 5E/F 2009; 13(8):573-575. and human chromosome region 4q21. Cytogenet Cell Genet. 1996;74(1-2):153-5

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 575 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Mini Review

USP7 (ubiquitin specific peptidase 7 (herpes virus- associated)) Kwang-Hyun Baek, Suresh Ramakrishna Laboratory of Molecular Signal Transduction, Graduate School of Life Science and Biotechnology, Cell and Gene Therapy Research Institute, Pochon CHA university, CHA General Hospital, Seoul, Korea (KHB, SR)

Published in Atlas Database: September 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/USP7ID42773ch16p13.html DOI: 10.4267/2042/44538 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Protein Other names: EC 3.1.2.15; HAUSP; TEF1 Description HGNC (Hugo): USP7 HAUSP encodes for 1102 amino acids and its Location: 16p13.3 molecular weight is approximately 135 kDa. MALDI- Local order: Gene is located on Chromosome 16 at 8, TOF/MS analysis has revealed four structural domains 894, 851-8, 964, 842. which are mainly involved in protein-protein interaction and deubiquitination activity. Note: Identified by its binding ability with Herpes N-terminal MATH (TRAF-like) domain (62-205 aa) simplex virus type 1 immediate-early protein Vmw 110 represented in brown colour is responsible for and Epstein-Barr nuclear antigen-1. interaction with p53, MDM2 and EBNA1. N-terminal domain of USP7 complexed with Mdm2 at peptide DNA/RNA 147-150 and with p53 at position 359-362 and 364-367 Description respectively. Ubiquitin processing protease domain represented in Consists of 31 exons with a total transcription length of yellow colour is a large family of cysteine proteases 4,013 bps. responsible for the cleavage of ubiquitin conjugates. Transcription Catalytic domain consists of approximately 350 amino The coding region of the gene starts from exon 1 to acids, comprising three conserved domain architectures exon 31 (200 th bps to 3508 th bps). The length of the Finger, Palm, and Thumb. It has highly conserved Cys, transcript is 3308 bps. Asp(I), His, and Asn/Asp(II) domains, which are responsible for deubiquitination activities. Pseudogene None.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 576 USP7 (ubiquitin specific peptidase 7 (herpes virus-associated)) Baek KH, Ramakrishna S

ICP0 binding domain represented in green colour is apoptosis and EBV-mediated immortalization. located in the C-terminal region at position 599-801 amino acids. N-terminal polyglutamine (poly Q) region Homology at position 4-10 amino acids which is conserved among Human HAUSP shows 98.6% amino acid homology mouse, rat and human. with both rat HAUSP and mouse HAUSP. Expression Implicated in HAUSP is expressed in wide variety of cell types including brain, liver, placenta, lung, ovary and Leukemia melanocytes. Disease Localisation Several studies implicated that ubiquitin proteasome HAUSP primarily localized in nucleus. pathway plays a critical role in thymocyte apoptosis (Beyette et al., 1998). Upon induction of apoptosis in Function murine thymocytes, USP7 specifically processes Herpesvirus-associated ubiquitin-specific protease was dexamethasone and gamma irradiation induced cell identified as a novel p53-interacting protein. HAUSP death (Vugmeyster et al., 2002). High expression was binds and stabilizes p53 through deubiquitination. It found in thymus, spleen and brain, organs which rely also strongly interacts with MDM2, hence playing an on apoptosis for development. A similar observation important role in the p53-MDM2 pathway resulting in was not observed in caspase 3-deficient thymocytes or p53-dependent cell growth repression and apoptosis. thymocytes treated with general caspase inhibitors The tumor suppressor p53 protein is a transcription indicating caspase involvement in the process of factor that responds to many cellular stress signals and apoptosis. is regulated primarily through ubiquitination and subsequent degradation. HAUSP contains an N- Herpes simplex terminal TRAF-like domain in which p53 and MDM2 Disease binds at the same site implied that HAUSP may Herpes simplex virus type 1 immediate-early protein function as a tumor suppressor by stabilizing p53. Vmw110 is a non-specific activator of gene expression HAUSP also interacts with the Epstein-Barr nuclear and it is involved in the initiation of the viral lytic antigen 1 (EBNA1) protein of the Epstein-Barr virus cycle. It has been demonstrated that USP7 interacts (EBV), which is responsible for EBV latent infection with Vmw 110 and its expression level is high during and cellular transformation. Interaction of EBNA1 with early infection (Everett et al., 1997). USP7 stabilizes USP7 occurs at same N-terminal TRAF-like domain at herpes simplex virus type 1 regulatory protein ICP0 by which p53 also binds to USP7. Through interactions its interaction during productive HSV-1 infection with p53, MDM2 and EBNA1, HAUSP plays a role in (Boutell et al., 2005). cell proliferation,

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 577 USP7 (ubiquitin specific peptidase 7 (herpes virus-associated)) Baek KH, Ramakrishna S

A regulatory model controlling the stability of p53 and Mdm2 by HAUSP. Note: HAUSP can deubiquitinate p53, Mdm2, and Mdmx. The selfubiquitination activity of Mdm2 is important to regulate both Mdm2 and p53 at opposite levels. Mdmx stabilizes Mdm2 by inhibiting self-ubiquitination. HAUSP plays a crucial role for regulating the levels of p53, Mdm2, and Mdmx.

Cervical carcinoma protease expression. Therefore, the HAUSP gene might play an important role in carcinogenesis. Disease A chemistry-based functional proteomics approach to Disease identify individual USPs in human papillomavirus Quantitative reverse-transcription polymerase chain (HPV) carrying cervical carcinoma and adjacent reaction (RT-PCR) and immunohistochemistry were normal tissue by biopsies showed high expression of performed to evaluate the protein expression of USP7. Upregulation of USP7 in cervical carcinoma HAUSP in several patients with non-small cell lung suggests its role in growth transformation (Rolen et al., cancer (NSCLC) (Masuya et al., 2006). Fifty-nine 2006). carcinomas (45.0%) showed reduced expression of HAUSP and HAUSP mRNA expression was Tumor significantly lower in adenocarcinomas and squamous Disease cell carcinomas. In total, 93 carcinomas (71.0%) USP7 was upregulated by mitogen activation or virus showed either mutant p53 or reduced HAUSP infection in normal T and B lymphocytes. USP7 expression. The down-regulation of USP7 affects the expression was revealed by chemistry based functional p53 protein expression which in turn leads to tumors. proteomics approach in virus infected and tumor These data show the importance of USP7 expression in derived human cells (Ovaa et al., 2004). Holowaty and NSCLC carcinogenesis, especially in adenocarcinomas. colleagues (2003) showed that USP7 interacts with Epstein-Barr nuclear antigen-1 (EBNA1) and involved References in the regulation of EBNA1 replication activity. This Everett RD, Meredith M, Orr A, Cross A, Kathoria M, Parkinson findings suggests that USP7 has a critical role in EBV J. A novel ubiquitin-specific protease is dynamically associated induced immortalization and tumorigenesis. with the PML nuclear domain and binds to a herpesvirus Non-small cell lung cancers and regulatory protein. EMBO J. 1997 Feb 3;16(3):566-77 Robinson PA, Lomonte P, Leek, Markham AF, Everett RD. adenocarcinomas Assignment1 of herpesvirus-associated ubiquitin-specific Note protease gene HAUSP to human chromosome band 16p13.3 Most non-small cell lung cancers (NSCLCs) show a by in situ hybridization. Cytogenet Cell Genet. 1998;83(1- 2):100 reduced herpesvirus-associated ubiquitin-specific

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 578 USP7 (ubiquitin specific peptidase 7 (herpes virus-associated)) Baek KH, Ramakrishna S

Hong S, Kim SJ, Ka S, Choi I, Kang S. USP7, a ubiquitin- Saridakis V, Sheng Y, Sarkari F, Holowaty MN, Shire K, specific protease, interacts with ataxin-1, the SCA1 gene Nguyen T, Zhang RG, Liao J, Lee W, Edwards AM, Arrowsmith product. Mol Cell Neurosci. 2002 Jun;20(2):298-306 CH, Frappier L. Structure of the p53 binding domain of HAUSP/USP7 bound to Epstein-Barr nuclear antigen 1 Hu M, Li P, Li M, Li W, Yao T, Wu JW, Gu W, Cohen RE, Shi implications for EBV-mediated immortalization. Mol Cell. 2005 Y. Crystal structure of a UBP-family deubiquitinating enzyme in Apr 1;18(1):25-36 isolation and in complex with ubiquitin aldehyde. Cell. 2002 Dec 27;111(7):1041-54 Yoo KJ, Lee HJ, Lee H, Lee KY, Lee SH, Chung HM, Baek KH. Expression and functional analyses of mHAUSP regulating Li M, Chen D, Shiloh A, Luo J, Nikolaev AY, Qin J, Gu W. apoptosis of cervical adenocarcinoma cells. Int J Oncol. 2005 Deubiquitination of p53 by HAUSP is an important pathway for Jul;27(1):97-104 p53 stabilization. Nature. 2002 Apr 11;416(6881):648-53 Cheon KW, Baek KH. HAUSP as a therapeutic target for Vugmeyster Y, Borodovsky A, Maurice MM, Maehr R, Furman hematopoietic tumors (review). Int J Oncol. 2006 MH, Ploegh HL. The ubiquitin-proteasome pathway in May;28(5):1209-15 thymocyte apoptosis: caspase-dependent processing of the deubiquitinating enzyme USP7 (HAUSP). Mol Immunol. 2002 Hu M, Gu L, Li M, Jeffrey PD, Gu W, Shi Y. Structural basis of Nov;39(7-8):431-41 competitive recognition of p53 and MDM2 by HAUSP/USP7: implications for the regulation of the p53-MDM2 pathway. Holowaty MN, Sheng Y, Nguyen T, Arrowsmith C, Frappier L. PLoS Biol. 2006 Feb;4(2):e27 Protein interaction domains of the ubiquitin-specific protease, USP7/HAUSP. J Biol Chem. 2003 Nov 28;278(48):47753-61 Masuya D, Huang C, Liu D, Nakashima T, Yokomise H, Ueno M, Nakashima N, Sumitomo S. The HAUSP gene plays an Holowaty MN, Zeghouf M, Wu H, Tellam J, Athanasopoulos V, important role in non-small cell lung carcinogenesis through Greenblatt J, Frappier L. Protein profiling with Epstein-Barr p53-dependent pathways. J Pathol. 2006 Apr;208(5):724-32 nuclear antigen-1 reveals an interaction with the herpesvirus- associated ubiquitin-specific protease HAUSP/USP7. J Biol Rolén U, Kobzeva V, Gasparjan N, Ovaa H, Winberg G, Chem. 2003 Aug 8;278(32):29987-94 Kisseljov F, Masucci MG. Activity profiling of deubiquitinating enzymes in cervical carcinoma biopsies and cell lines. Mol Canning M, Boutell C, Parkinson J, Everett RD. A RING finger Carcinog. 2006 Apr;45(4):260-9 ubiquitin ligase is protected from autocatalyzed ubiquitination and degradation by binding to ubiquitin-specific protease Sheng Y, Saridakis V, Sarkari F, Duan S, Wu T, Arrowsmith USP7. J Biol Chem. 2004 Sep 10;279(37):38160-8 CH, Frappier L. Molecular recognition of p53 and MDM2 by USP7/HAUSP. Nat Struct Mol Biol. 2006 Mar;13(3):285-91 Holowaty MN, Frappier L. HAUSP/USP7 as an Epstein-Barr virus target. Biochem Soc Trans. 2004 Nov;32(Pt 5):731-2 Fernández-Montalván A, Bouwmeester T, Joberty G, Mader R, Mahnke M, Pierrat B, Schlaeppi JM, Worpenberg S, Gerhartz Li M, Brooks CL, Kon N, Gu W. A dynamic role of HAUSP in B. Biochemical characterization of USP7 reveals post- the p53-Mdm2 pathway. Mol Cell. 2004 Mar 26;13(6):879-86 translational modification sites and structural requirements for Ovaa H, Kessler BM, Rolén U, Galardy PJ, Ploegh HL, substrate processing and subcellular localization. FEBS J. Masucci MG. Activity-based ubiquitin-specific protease (USP) 2007 Aug;274(16):4256-70 profiling of virus-infected and malignant human cells. Proc Natl Kessler BM, Fortunati E, Melis M, Pals CE, Clevers H, Maurice Acad Sci U S A. 2004 Feb 24;101(8):2253-8 MM. Proteome changes induced by knock-down of the Boutell C, Canning M, Orr A, Everett RD. Reciprocal activities deubiquitylating enzyme HAUSP/USP7. J Proteome Res. 2007 between herpes simplex virus type 1 regulatory protein ICP0, a Nov;6(11):4163-72 ubiquitin E3 ligase, and ubiquitin-specific protease USP7. J Virol. 2005 Oct;79(19):12342-54 This article should be referenced as such: Meulmeester E, Maurice MM, Boutell C, Teunisse AF, Ovaa H, Baek KH, Ramakrishna S. USP7 (ubiquitin specific peptidase 7 Abraham TE, Dirks RW, Jochemsen AG. Loss of HAUSP- (herpes virus-associated)). Atlas Genet Cytogenet Oncol mediated deubiquitination contributes to DNA damage-induced Haematol. 2009; 13(8):576-579. destabilization of Hdmx and Hdm2. Mol Cell. 2005 May 27;18(5):565-76

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 579 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Leukaemia Section Review

Chronic myelogenous leukaemia (CML) Ali G Turhan Pole de Biologie-Sante - 40 avenue du Recteur Pineau - 86022 Poitiers Cedex, France (AGT)

Published in Atlas Database: August 2008 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/CML.html DOI: 10.4267/2042/44539 This article is an update of : Turhan AG. Chronic myelogenous leukaemia (CML). Atlas Genet Cytogenet Oncol Haematol 2000;4(4):200-202 Huret JL. Chronic myelogenous leukaemia (CML). Atlas Genet Cytogenet Oncol Haematol 1997;1(2):89-91

splenomegaly might be present. Bone marrow aspirate Clinics and pathology with cytogenetic analysis is required, as well as Disease molecular evaluation for the detection of BCR-ABL oncogene which is quantified by calculating BCR-ABL CML is a malignant chronic myeloproliferative / ABL ratio. The disease is classified most commonly disorder (MPD) of the hematopoietic stem cell. using Sokal or Hasford scores. The natural history of Phenotype/cell stem origin the disease including classically three phases (chronic Evidence exists for the involvement of the most phase, accelerated phase and blast crisis) has been primitive and quiescent hematopoietic stem cell profoundly modified by the current therapy regimens compartiment (CD34+/CD38-, Thy1+): t(9;22) is found using tyrosine kinase inhibitors. For instance, recent in myeloid progenitor and in B-lymphocytes update of the IRIS study demonstrates the progressive progenitors, but, involvement of the T-cell lineage is reduction of secondary events over time with no blast extremely rare. The existence of a highly quiescent crisis occurring after 6 years. Most patients now seen in stem cell population has been demonstrated in patients accelerated phase or in blastic phase are those who with CML. More recently, the presence of Ph relapse after IM and/or dasatinib/Nilotinib therapies. chromosome has been demonstrated in vascular The major problems in CML are the resistance endothelium of CML patients at diagnosis. Ph+ stem encountered as first line therapy as well as intolerance cells with stem markers of endothelial cells have been to TKI therapy leading to discontinuation of the drugs. shown to be present at the level of single stem cells. In the IRIS trial, approximately 30% of patients These findings have suggested that a putative discontinue imatinib for reasons of resistance (15%) or "hemangioblast" giving rise to both hematopoietic and intolerance. Finally, it is clear that currently available endothelial cells could be present on adult marrow and TKI therapies do not eradicate the most primitive stem be a target of t(9;22) translocation. cells, explaining relapses occurring after discontinuation of treatment (see below). Epidemiology Cytology Annual incidence: 10/10 6 (from 1/10 6 in childhood to 30/10 6 after 60 years); Hyperplastic bone marrow; myeloid proliferation with median age: 30-60 years; maturation; some myelodysplastic features can be seen sex ratio: 1.2M/1F. on Imatinib therapy after disappearance of the Ph clone. The significance of these abnormalities is not Clinics known but very rare patients evolve into The disease is currently discovered after a routine myelodysplastic or leukemic phase. The typical AL blood count revealing hyperleucocytosis and cytology can be seen when patients evolve into circulating immature white blood cells. A accelerated or blast phase (see: t(9;22)(q34;q11) in ALL, t(9;22)(q34;q11) in ANLL).

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 580 Chronic myelogenous leukaemia (CML) Turhan AG

Treatment indolent disease, the estimated median survival with the available therapies is 25 years. The treatment of CML has been revolutionized by the introduction of targeted therapies to the clinical practice. The first of these drugs was imatinib mesylate Cytogenetics (IM) targeting the tyrosine kinase activity of BCR- Cytogenetics morphological ABL. In a large international multi-center trial, the use of IM as a first line therapy has been compared to all CML patients have a t(9;22), at least at the standard IFN-ARA-C regimen (IRIS trial). This trial molecular level (see below); but not all t(9;22) are has clealy shown the advantages of IM in terms of found in CML: this translocation may also be seen in complete haematological response, (CHR) complete ALL, and in ANLL (see: t(9;22)(q34;q11) in ALL, cytogenetic response (CCR) and molecular response t(9;22)(q34;q11) in ANLL), t(9;22) is also the hallmark (MR) as compared to IFN-ARA-C regimen. of chronic neutrophilic leukemia which presents Interestingly, the outcome on IM therapy has been clinically with absence of circulating immature myeloid shown to be correlated with the Sokal score at cells. In this translocation BCR breakpoint occurs in diagnosis. The most recent update of this trial has the micro-BCR region, with the e19-a2 junction at the shown for the first time, a reduction of secondary DNA level and a large protein (BCR-ABL p230) with events (accelerated phase, blast crisis) over time, with increased TK activity. It should be noted that the no patients progressing towards blast crisis after 6 years product of the reciprocal translocation ABL-BCR can of therapy. However, several questions remain to be also be detected in CML cells, the signification of solved before demonstration of a "cure" under IM which is unclear. therapy: 1-The attempts to interrupt IM therapy has Cytogenetics molecular been followed in most cases by a cytogenetic and haematological relapse; 2-The most primitive stem Is a useful tool for diagnostic ascertainment in the case cells seem to be resistant to IM therapy at least in vitro of a 'masked Philadelphia' chromosome, where ; 3-The resistance to IM-therapy has been found to be chromosomes 9 and 22 all appear to be normal, but associated, especially in patients who received it as where cryptic insertion of 3' ABL within a second line treatment, with the occurrence of mutations chromosome 22 can be demonstrated. in the ABL-kinase domain, impeding the binding of the Additional anomalies drug to its target. Some of these mutations, occurring in the P-loop or in the ATP binding pocket ("gatekeeper" 1- May be present at diagnosis (in 10%, possibly with mutation T315I) lead to a total resistance to IM; unfavourable significance), or may appear during requiring the interruption of the drug. If the mutations course of the disease, they do not indicate the reside outside these regions (C-lobe of the SH1 kinase imminence of a blast crisis, although these additional domain), the increase of IM dose could lead to anomalies also emerge frequently at the time of acute molecular responses. Detection of ABL-kinase transformation; mutations has therefore become a clinically useful 2- these are: +der(22), +8, i(17q), +19, most often, but molecular test. The majority of ABL-kinase mutations also: +21, -Y, -7, -17, +17; acute transformation can other than T315I have been shown to be targetable by also be accompanied with t(3;21) (q26;q22) (1% of second generation of TK inhibitors, essentially cases); near haploidy can occur; of note, although rare, Dasatinib (Sprycell) and Nilotinib (Tasigna). Dasatinib is the occurrence of chromosome anomalies which are is a combined SRC and ABL-inhibitor which is typical of a given BC phenotype (e.g. t(15;17) in a indicated as a second line therapy in CML patients promyelocytic transformation, dic(9;12) in a CD10+ failing on IM therapy or intolerant to IM-therapy. lymphoblastic BC ...); +8, +19, +21, and i(17q) occur Nilotinib is a TK inhibitor with high affinity for ABL- more often in myeloid - rather than lymphoid- blast tyrosine kinase. Novel therapies to eliminate the stem crises and apparent t(V;22) or t(9;V), where V is a cells with T315I mutation remain a major futur variable. challenge. Deletion of the derivative chromosome 9: detected at diagnosis (n 10% of patients), probably indicating a Prognosis genetic instability phenotype, this finding has been TKI therapies have changed the prognosis of CML as associated to the more aggressive behavior of the well as the natural history of the disease. Results from disease, a poor prognostic factor potentially reversed by the IRIS trial suggest that the majority of patients with the use of imatinib mesylate. CML at first chronic phase will attain complete Since the introduction of imatinib mesylate to the cytogenetic and major molecular responses with clinical practice, chromosomal abnormalities have been however persistence of minimal residual leukemic stem detected in Ph-negative metaphases in patients in CCR. cells. Although it is difficult to qualify CML as an

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 581 Chronic myelogenous leukaemia (CML) Turhan AG

t(9;22)(q34;q11) G- banding (left) - Courtesy Jean-Luc Lai and Alain Vanderhaegen (3 top) and Diane H. Norback, Eric B. Johnson, and Sara Morrison-Delap, UW Cytogenetic Services (2 bottom); R-banding (right) top: Editor; 2 others Courtesy Jean-Luc Lai and Alain Vanderhaegen); diagram and breakpoints (Editor).

The most frequent abnormalities are +7, +8 and in very (tyrosine kinase) - DNA binding motif - actin binding rare cases they are associated to the development of domain C-term; widely expressed; localisation is MDS or AML. The direct role of TKI therapies in these mainly nuclear; inhibits cell growth. abnormalities is difficult to assess in vivo. However, in BCR vitro, it has been demonstrated that imatinib induces centrosome and chromosome aberrations in normal Location human dermal fibroblasts. 22q11 Variants DNA/RNA Various splicings. Chromosome, are found in 5-10% of cases; however, 9q34-3'ABL always joins 22q11-5'BCR in true CML; Protein the third chromosome and breakpoint is, at times, not Main form: 160 kDa; N-term Serine-Treonine kinase random. In a way, masked Philadelphia chromosomes domain, SH2 binding, and C-term domain which (see above) are also variants. functions as a GTPase activating protein for p21rac; widely expressed; cytoplasmic localisation; protein Genes involved and proteins kinase; probable role in signal transduction. ABL Result of the chromosomal Location anomaly 9q34 DNA/RNA Hybrid gene Alternate splicing (1a and 1b) in 5'. Description Protein 1. The crucial event lies on der(22), id est 5' BCR/3' Giving rise to 2 proteins of 145 kDa; contains SH (SRC ABL hybrid gene is pathogenic, while ABL/BCR may homology) domains; N-term SH3 and SH2 - SH1 or may not be expressed;

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 582 Chronic myelogenous leukaemia (CML) Turhan AG

2. breakpoint in ABL is variable over a region of 200 More recently, activation of STAT (Signal transducers kb, often between the two alternative exons 1b and 1a, and activators of transcription) molecules has been sometimes 5' of 1b, or 3' of 1a, but always 5' of exon 2; described as a major molecular signaling event induced 3. breakpoint in BCR is in a narrow region, therefore by BCR-ABL, with activation of essentially STAT5, called M-bcr (for major breakpoint cluster region), a STAT1, and STAT6. cluster of 5.8 kb, between exons 12 and 16, also called Activation of the molecules of the focal adhesion b1 to b5 of M-bcr; most breakpoints being either complex (PAXILLIN, FAK) by BCR-ABL requires the between b2 and b3, or between b3 and b4. role of the adaptor molecule CRK-L. Transcript BCR-ABL activates negative regulatory molecules 8.5 kb mRNA, resulting in a 210 kDa chimeric protein such as PTP1B and Abi-1 and their inactivation could with increased tyrosine kinase activity. be associated with progression into blast crisis. B- Correlations between molecular pathways and Detection leukemic phenotype observed in primary CML cells or RT-PCR for minimal residual disease detection. in BCR-ABL-transduced cells are currently limited. Current detection methods of BCR-ABL make use of BCR-ABL has anti-apoptotic activity quantitative PCR analyses, using essentially TaqMan or (PI63K/Akt/STAT5). SybR green technologies. The amount of BCR-ABL is BCR/ABL induces cell adhesive and migratory compared to an endogenous gene, most of laboratories abnormalities in vitro in the presence of fibronection or using ABL or BCR. The ratio of BCR-ABL / ABL at in transwell assays (abnormal integrin diagnosis is then followed during the treatment which signaling/FAK/CRK-L/abnormal response to induces a reduction of this ratio which is expressed by chemokine SDF-1). The involvement of CXCR-4 and two different manners: 1-An absolute number resulting SDF-1 axis has also recently been shown: BCR-ABL from the BCR-ABL/ABL ratio is quantified, and the down-regulates CXCR-4 expression with a dose- reduction of this ratio by 3-log under therapy represents dependent effect. This could explain the inability of "major molecular response" or MMR. Or 2- The BCR- BCR-Abl-expressing leukemic cells and progenitors to ABL /ABL ratio is quantified at diagnosis, representing the marrow niches where SDF-1 (the ligand of CXCR- 100% of BCR-ABL amount detected for a given patient 4) is present. Under the IM-therapy, the up-regulation using the RQ-PCR technology used in the laboratory. of CXCR-4 expression could induce the migration of This ratio expressed as a percentage is calculated at some stem cells which escape from the effect of IM- each timepoint during the follow-up on therapy, a therapy, to the bone marrow niches where these cells percentage of 0.1% (3-logreduction from the diagnosis) become quiescent. Other adhesion receptors such as signifies MMR. The introduction of this international CD44 have been shown to be altered in CML and in a scale allows the comparison of results from different murine CML model generated in CD44 K/O mice, the laboratories. leukemogenic ability of the BCR-ABL-expressing stem Fusion protein cells is impaired. BCR-ABL induces a dose-effect relationship in CML Description cells with increased BCR-ABL mRNA during P210 with the first 902 or 927 amino acids from BCR; progression into blast crisis, with induction of genetic BCR/ABL has a cytoplasmic localization, in contrast instability. During recent years molecular pathways with ABL, mostly nuclear. The shuttling of ABL involved in the genetic instability phenotype have been between the nucleus and cytoplasm is accomplished by extensively studied. BCR-ABL has been shown to the presence of import and export signal sequences in contribute directly to the generation of a "mutator" the COOH-terminal region of ABL. Interestingly, these phenotype as well as to the overexpression of DNA- sequences are conserved in BCR-ABL. It has been polymerase-beta which is prone to copying errors shown that the inhibition of BCR-ABL export from the during DNA replication. BCR-ABL is directly nucleus has been shown to induce apoptosis in BCR- responsible of the down-regulation of the major DNA ABL-expressing cells. This inhibition is accomplished repair protein DNA-PKcs and that of BRCA1, both of by the use of export inhibitors such as leptomycin. these events taking place at the post-transcriptional Oncogenesis level. Conversely, BCR-ABL increases expression of A- Major molecular pathways activated by BCR-ABL. RAD51, through a STAT5-induced mechanism, and BCR/ABL activates RAS signaling through the GRB2 might contribute to drug resistance. Recent data suggest adaptor molecule which interacts specifically with the that BCR-ABL not only interferes with DNA repair Y177 of BCR. pathways but also contributes to DNA damage by PI3-K (phosphatidyl inositol 3' kinase) pathway is increasing the production of reactive oxygen species also activated with secondary activation of the (ROS). There is evidence suggesting that ROS activity AKT/PKB pathway. induced by BCR-ABL could contribute to the Integrity of transcription machinery induced by MYC occurrence of ABL-kinase mutations. Leukemic cell is necessary for the transforming action of BCR-ABL. populations expressing high levels of BCR-ABL TK

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 583 Chronic myelogenous leukaemia (CML) Turhan AG

activity (such as stem cells) might be predisposed to the suggested by the foowing facts: 1- in blast crisis cells occurrence of these mutations. Thus, BCR-ABL SET activity is high with low PP2A levels; 2- generates conditions of genetic damage in the presence inhibition of SET by forskolin or an shRNA approach, of inappropriate DNA repair capacity. Beside DNA - lead to restoration of PP2A levels and inhibition of PKcs and Rad 51, DNA repair pathways have been several signalling pathways controlled by BCR-ABL, shown to be altered by BCR-ABL activity including including AKT, Jak2, STAT and Myc. The global Bloom protein, WRN helicase, ATM and BRCA1. result in different models leads to the reversion of BC Molecular events associated with blast crisis: BCR- phenotype (reduced proliferation, increased ABL expression increases during progression of CML, differentiation) even in imatinib resistant (including from CP to blastic phase. This increased expression T315I) leukemic cells. A clinical grade PP2A activator, plays potentially a role, in the downstream signalling fingolimod is currently in clinical trials. events as this has been shown in in vitro models. Target cell for blast crisis: there is recent data Several molecular events have now been explored in suggesting that blast crisis could occur not at the level the last decade such as P53 mutation (30% of patients) of hematopoietic stem cell but at the level of a CFU- methylation of internal ABL promoter, telomere GM. The data in favour of this hypothesis have been shortening, Abi-1 inactivation. Some molecular events obtained by analyzing the levels of beta-catenin are detected more frequently in lymphoid blast crisis activation (target of WNT signalling) in CFU-C ((p16/ARF mutations, Rb mutations, Ikaros deletions). obtained from patients in blast crisis. However, stem In a minority of patients, there are additional cell characteristics of these populations have been translocations detected such as t(3;21)(q26;q22) tested only by in vitro replating assays. translated into a AML1 / EVI1 fusion protein. It should be noted however that in the TKI therapy era, the most To be noted common genetic abnormality detected is the occurrence of ABL-kinase mutations. Note Interaction of BCR-ABL with RNA binding proteins. 1. Most CML patients are nowadays diagnosed in an Recently, there has been progress in the understanding early stage but blast crisis could still be seen at the first of the mechanisms of impaired differentiation. BCR- onset of CML, and those cases may be ABL has been shown to downregulate the expression of undistinguishable from true ALL or ANLL with t(9;22) CCAAT enhancer-binding protein alpha (CEBP-alpha) and P210 BCR/ABL hybrid; at the protein level by acting on hnRNPE2, which 2. JCML (juvenile chronic myelogenous leukaemia) is belongs to a family of RNA binding proteins. CEBP- not the juvenile form of chronic myelogenous alpha expression is required for normal granulocytic leukaemia: there is no t(9;22) nor BCR/ABL hybrid in differentiation via induction of G-CSF-R gene JCML, and clinical features (including a worse expression. BCR-ABL has been shown to increase the prognosis) are not similar to those found in CML; expression of several classes of RNA binding proteins 3. So called BCR/ABL negative CML should not be either at the transcriptional level (hnRNPA2/B1, called so! hnRNPK, hnRNPD1) or by stablizing the protein 4. P53 is altered in 1/3 of BC-CML cases (hnRNPA1, hnRNPE2). These RNA binding proteins 5. Recent data suggest that Rac pathway could be a interact with RNA molecules exported from the therapeutic target. nucleus and change the fate of the proteins by inhibition or stimulating the translation, or by References stabilizing the protein levels by inhibition of the Nowell PC, Hungerford DA.. A minute chromosome in human proteasome-induced degradation. Some RNA binding chronic granulocytic leukemia. Science 1960; 132: 1497. proteins regulated by BCR-ABL lead to enhanced Sokal JE, Gomez GA, Baccarani M, Tura S, Clarkson BD, proliferation and survival of CML cells, possibly Cervantes F, Rozman C, Carbonell F, Anger B, Heimpel H. contributing the occurrence of blast crisis. Among Prognostic significance of additional cytogenetic abnormalities those, increased levels of la/SSB, lead to an increased at diagnosis of Philadelphia chromosome-positive chronic translation of MDM with low p53 levels and inhibition granulocytic leukemia. Blood. 1988 Jul;72(1):294-8 of apoptosis. Via hnRNPA1, BCR-ABL has been Huret JL. Complex translocations, simple variant translocations shown to increase the nuclear oncogene SET (TAF-1B) and Ph-negative cases in chronic myelogenous leukaemia. Hum Genet. 1990 Oct;85(6):565-8 which is an inhibitor of PP2A, a serine threonine phosphatase which is a negative regulator of RAS / Kurzrock R, Talpaz M. The molecular pathology of chronic MAPK and PI-3K pathways. PP2A plays also a major myelogenous leukaemia. Br J Haematol. 1991 Oct;79 Suppl 1:34-7 role in controlling cell cycle and DNA replication. PP2A is thought to be a tumor suppressor protein Guilhot F, Chastang C, Michallet M, Guerci A, Harousseau JL, Maloisel F, Bouabdallah R, Guyotat D, Cheron N, Nicolini F, whose expression is reduced in tumors. By stimulating Abgrall JF, Tanzer J. Interferon alfa-2b combined with the PP2A inhibitor SET, BCR-ABL lead to reduced cytarabine versus interferon alone in chronic myelogenous levels of PP2A which could contribute to blast crisis as leukemia. French Chronic Myeloid Leukemia Study Group. N Engl J Med. 1997 Jul 24;337(4):223-9

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 584 Chronic myelogenous leukaemia (CML) Turhan AG

Dai Z, Quackenbush RC, Courtney KD, Grove M, Cortez D, Geay JF, Buet D, Zhang Y, Foudi A, Jarrier P, Berthebaud M, Reuther GW, Pendergast AM. Oncogenic Abl and Src tyrosine Turhan AG, Vainchenker W, Louache F. p210BCR-ABL kinases elicit the ubiquitin-dependent degradation of target inhibits SDF-1 chemotactic response via alteration of CXCR4 proteins through a Ras-independent pathway. Genes Dev. signaling and down-regulation of CXCR4 expression. Cancer 1998 May 15;12(10):1415-24 Res. 2005 Apr 1;65(7):2676-83 LaMontagne KR Jr, Flint AJ, Franza BR Jr, Pandergast AM, Neviani P, Santhanam R, Trotta R, Notari M, Blaser BW, Liu S, Tonks NK. Protein tyrosine phosphatase 1B antagonizes Mao H, Chang JS, Galietta A, Uttam A, Roy DC, Valtieri M, signalling by oncoprotein tyrosine kinase p210 bcr-abl in vivo. Bruner-Klisovic R, Caligiuri MA, Bloomfield CD, Marcucci G, Mol Cell Biol. 1998 May;18(5):2965-75 Perrotti D. The tumor suppressor PP2A is functionally inactivated in blast crisis CML through the inhibitory activity of Deutsch E, Dugray A, AbdulKarim B, Marangoni E, Maggiorella the BCR/ABL-regulated SET protein. Cancer Cell. 2005 L, Vaganay S, M'Kacher R, Rasy SD, Eschwege F, Nov;8(5):355-68 Vainchenker W, Turhan AG, Bourhis J. BCR-ABL downregulates the DNA repair protein DNA-PKcs. Blood. 2001 Apr Baccarani M, Saglio G, Goldman J, Hochhaus A, Simonsson 1;97(7):2084-90 B, Appelbaum F, Apperley J, Cervantes F, Cortes J, Deininger M, Gratwohl A, Guilhot F, Horowitz M, Hughes T, Kantarjian H, Slupianek A, Schmutte C, Tombline G, Nieborowska-Skorska Larson R, Niederwieser D, Silver R, Hehlmann R. Evolving M, Hoser G, Nowicki MO, Pierce AJ, Fishel R, Skorski T. concepts in the management of chronic myeloid leukemia: BCR/ABL regulates mammalian RecA homologs, resulting in recommendations from an expert panel on behalf of the drug resistance. Mol Cell. 2001 Oct;8(4):795-806 European LeukemiaNet. Blood. 2006 Sep 15;108(6):1809-20 Graham SM, Jørgensen HG, Allan E, Pearson C, Alcorn MJ, Druker BJ, Guilhot F, O'Brien SG, Gathmann I, Kantarjian H, Richmond L, Holyoake TL. Primitive, quiescent, Philadelphia- Gattermann N, Deininger MW, Silver RT, Goldman JM, Stone positive stem cells from patients with chronic myeloid leukemia RM, Cervantes F, Hochhaus A, Powell BL, Gabrilove JL, are insensitive to STI571 in vitro. Blood. 2002 Jan 1;99(1):319- Rousselot P, Reiffers J, Cornelissen JJ, Hughes T, Agis H, 25 Fischer T, Verhoef G, Shepherd J, Saglio G, Gratwohl A, Perrotti D, Cesi V, Trotta R, Guerzoni C, Santilli G, Campbell Nielsen JL, Radich JP, Simonsson B, Taylor K, Baccarani M, K, Iervolino A, Condorelli F, Gambacorti-Passerini C, Caligiuri So C, Letvak L, Larson RA. Five-year follow-up of patients MA, Calabretta B. BCR-ABL suppresses C/EBPalpha receiving imatinib for chronic myeloid leukemia. N Engl J Med. expression through inhibitory action of hnRNP E2. Nat Genet. 2006 Dec 7;355(23):2408-17 2002 Jan;30(1):48-58 Koptyra M, Falinski R, Nowicki MO, Stoklosa T, Majsterek I, Canitrot Y, Falinski R, Louat T, Laurent G, Cazaux C, Nieborowska-Skorska M, Blasiak J, Skorski T. BCR/ABL Hoffmann JS, Lautier D, Skorski T. p210 BCR/ABL kinase kinase induces self-mutagenesis via reactive oxygen species regulates nucleotide excision repair (NER) and resistance to to encode imatinib resistance. Blood. 2006 Jul 1;108(1):319-27 UV radiation. Blood. 2003 Oct 1;102(7):2632-7 Kovitz C, Kantarjian H, Garcia-Manero G, Abruzzo LV, Cortes Deutsch E, Jarrousse S, Buet D, Dugray A, Bonnet ML, J. Myelodysplastic syndromes and acute leukemia developing Vozenin-Brotons MC, Guilhot F, Turhan AG, Feunteun J, after imatinib mesylate therapy for chronic myeloid leukemia. Bourhis J. Down-regulation of BRCA1 in BCR-ABL-expressing Blood. 2006 Oct 15;108(8):2811-3 hematopoietic cells. Blood. 2003 Jun 1;101(11):4583-8 Krause DS, Lazarides K, von Andrian UH, Van Etten RA. O'Brien SG, Guilhot F, Larson RA, Gathmann I, Baccarani M, Requirement for CD44 in homing and engraftment of BCR- Cervantes F, Cornelissen JJ, Fischer T, Hochhaus A, Hughes ABL-expressing leukemic stem cells. Nat Med. 2006 T, Lechner K, Nielsen JL, Rousselot P, Reiffers J, Saglio G, Oct;12(10):1175-80 Shepherd J, Simonsson B, Gratwohl A, Goldman JM, Hehlmann R, Hochhaus A, Baccarani M. Chronic myeloid Kantarjian H, Taylor K, Verhoef G, Bolton AE, Capdeville R, leukaemia. Lancet. 2007 Jul 28;370(9584):342-50 Druker BJ. Imatinib compared with interferon and low-dose cytarabine for newly diagnosed chronic-phase chronic myeloid Jiang X, Zhao Y, Smith C, Gasparetto M, Turhan A, Eaves A, leukemia. N Engl J Med. 2003 Mar 13;348(11):994-1004 Eaves C. Chronic myeloid leukemia stem cells possess multiple unique features of resistance to BCR-ABL targeted Jamieson CH, Ailles LE, Dylla SJ, Muijtjens M, Jones C, therapies. Leukemia. 2007 May;21(5):926-35 Zehnder JL, Gotlib J, Li K, Manz MG, Keating A, Sawyers CL, Weissman IL. Granulocyte-macrophage progenitors as Neviani P, Santhanam R, Oaks JJ, Eiring AM, Notari M, Blaser candidate leukemic stem cells in blast-crisis CML. N Engl J BW, Liu S, Trotta R, Muthusamy N, Gambacorti-Passerini C, Med. 2004 Aug 12;351(7):657-67 Druker BJ, Cortes J, Marcucci G, Chen CS, Verrills NM, Roy DC, Caligiuri MA, Bloomfield CD, Byrd JC, Perrotti D. FTY720, Perrotti D, Calabretta B. Translational regulation by the p210 a new alternative for treating blast crisis chronic myelogenous BCR/ABL oncoprotein. Oncogene. 2004 Apr 19;23(18):3222-9 leukemia and Philadelphia chromosome-positive acute Fabarius A, Giehl M, Frank O, Duesberg P, Hochhaus A, lymphocytic leukemia. J Clin Invest. 2007 Sep;117(9):2408-21 Hehlmann R, Seifarth W. Induction of centrosome and Perrotti D, Neviani P. From mRNA metabolism to cancer chromosome aberrations by imatinib in vitro. Leukemia. 2005 therapy: chronic myelogenous leukemia shows the way. Clin Sep;19(9):1573-8 Cancer Res. 2007 Mar 15;13(6):1638-42 Flamant S, Kortulewski T, Dugray A, Bonnet ML, Guillier M, Thomas EK, Cancelas JA, Chae HD, Cox AD, Keller PJ, Guilhot F, Bourhis JH, Vainchenker W, Tronik-Le Roux D, Perrotti D, Neviani P, Druker BJ, Setchell KD, Zheng Y, Harris Turhan AG. Osteopontin is upregulated by BCR-ABL. Biochem CE, Williams DA. Rac guanosine triphosphatases represent Biophys Res Commun. 2005 Aug 12;333(4):1378-84 integrating molecular therapeutic targets for BCR-ABL-induced Flamant S, Turhan AG. Occurrence of de novo ABL kinase myeloproliferative disease. Cancer Cell. 2007 Nov;12(5):467- domain mutations in primary bone marrow cells after BCR-ABL 78 gene transfer and Imatinib mesylate selection. Leukemia. 2005 Jul;19(7):1265-7

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 585 Chronic myelogenous leukaemia (CML) Turhan AG

Savona M, Talpaz M. Getting to the stem of chronic myeloid This article should be referenced as such: leukaemia. Nat Rev Cancer. 2008 May;8(5):341-50 Turhan AG. Chronic myelogenous leukaemia (CML). Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8):580-586.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 586

Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Leukaemia Section Short Communication t(3;21)(p12;q22) Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: August 2008 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0321p12q22ID1524.html DOI: 10.4267/2042/44540 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Clinics and pathology 21q22 Protein Disease Contains a Runt domain and, in the C-term, a M7-AML (megakaryoblastic acute myeloid leukemia) transactivation domain; forms heterodimers; widely with t(9;22); the t(3;21) may be therapy related. expressed; nuclear localisation; transcription factor (activator) for various hematopoietic-specific genes. Epidemiology Only one case to date, a male patient aged 60 years References (Jeandidier et al., 2006). Jeandidier E, Dastugue N, Mugneret F, Lafage-Pochitaloff M, Mozziconacci MJ, Herens C, Michaux L, Verellen-Dumoulin C, Cytogenetics Talmant P, Cornillet-Lefebvre P, Luquet I, Charrin C, Barin C, Collonge-Rame MA, Pérot C, Van den Akker J, Grégoire MJ, Additional anomalies Jonveaux P, Baranger L, Eclache-Saudreau V, Pagès MP, Cabrol C, Terré C, Berger R. Abnormalities of the long arm of t(9;22)(q34;q11). chromosome 21 in 107 patients with hematopoietic disorders: a collaborative retrospective study of the Groupe Français de Genes involved and proteins Cytogénétique Hématologique. Cancer Genet Cytogenet. 2006 Apr 1;166(1):1-11 Note The partner of RUNX1 is unknown. This article should be referenced as such: Huret JL. t(3;21)(p12;q22). Atlas Genet Cytogenet Oncol RUNX1 Haematol. 2009; 13(8):587. Location

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 587

Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Leukaemia Section Short Communication

t(8;17)(p12;q25) Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: August 2008 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0817p12q25ID1202.html DOI: 10.4267/2042/44541 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Clinics and pathology FGFR1 Location Disease 8p12 Chronic myelogenous leukemia-like (CML-like) Protein disease without BCR-ABL1 rearrangement Receptor tyrosine kinase; contains an extracellular Epidemiology ligand-binding domain with Ig-like structures, a Only one case to date, a 29 year old female patient transmembrane domain, and a cytosolic tyrosine kinase (Lewis et al., 1987; Sohal et al., 2001). (TK) domain. Involved in signal transduction. Clinics References The patient presented with a CML-like disease with Lewis JP, Welborn JL, Meyers FJ, Levy NB, Roschak T. Mast systemic mastocytosis, in transformation to an cell disease followed by leukemia with clonal evolution. Leuk aggressive disease. Res. 1987;11(9):769-73 Sohal J, Chase A, Mould S, Corcoran M, Oscier D, Iqbal S, Cytogenetics Parker S, Welborn J, Harris RI, Martinelli G, Montefusco V, Sinclair P, Wilkins BS, van den Berg H, Vanstraelen D, Additional anomalies Goldman JM, Cross NC. Identification of four new translocations involving FGFR1 in myeloid disorders. Genes The t(8;17) was the sole anomaly. Chromosomes Cancer. 2001 Oct;32(2):155-63 Genes involved and proteins This article should be referenced as such: Huret JL. t(8;17)(p12;q25). Atlas Genet Cytogenet Oncol Note Haematol. 2009; 13(8):588. FGFR1 was found involved; the partner is unknown.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 588

Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Leukaemia Section Short Communication

t(X;21)(p11;q22) Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: August 2008 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0X21p11q22ID1523.html DOI: 10.4267/2042/44542 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

t(X;21)(p11.2;q22) G- banding and FISH - Courtesy Aurelia M. Meloni-Ehrig

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 589 t(X;21)(p11;q22) Huret JL

Clinics and pathology RUNX1 Location Disease 21q22 Chronic myelogenous leukemia (CML) in blast crisis; Protein the t(X;21) may be therapy related. Contains a Runt domain and, in the C-term, a Epidemiology transactivation domain; forms heterodimers; widely Only one case to date, a female patient aged 23 years expressed; nuclear localisation; transcription factor (Jeandidier et al., 2006). (activator) for various hematopoietic-specific genes. Cytogenetics References Jeandidier E, Dastugue N, Mugneret F, Lafage-Pochitaloff M, Additional anomalies et al. Abnormalities of the long arm of chromosome 21 in 107 patients with hematopoietic disorders: a collaborative t(9;22)(q34;q11), +8, i(17q). retrospective study of the Groupe Français de Cytogénétique Hématologique. Cancer Genet Cytogenet. 2006 Apr Genes involved and proteins 1;166(1):1-11 Note This article should be referenced as such: The partner of RUNX1 is unknown. Huret JL. t(X;21)(p11;q22). Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8):589-590.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 590 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Solid Tumour Section Review

Nervous System: Glioma: an overview Ivana Magnani Dipartimento Di Medicina, Chirurgia E Odontoiatria, Polo Universitario San Paolo, Genetica Medica, Via di Rudini, 8, 20142 Milano, Italy (IM)

Published in Atlas Database: August 2008 Online updated version : http://AtlasGeneticsOncology.org/Tumors/GliomaOverviewID5763.html DOI: 10.4267/2042/44543 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Classification Epidemiology Descriptive epidemiology largely depends on Note population-based cancer registries, which record cases Primary CNS tumors constitute a spectrum of according to the International Classification of Diseases pathological entities each with a distinct natural history for Oncology (ICD-O). The Central Brain tumor that reflects the sequential accumulation of genetic Registry of the United States is available at lesions and the deregulation of growth-factor signalling http://www.CBTRUS.org. pathways during neoplastic transformation. For No underlying cause has been identified for the simplicity, CNS tumors may be classified as majority of malignant gliomas. Epidemiologic factors GLIOMAS or NONGLIOMAS (see Table 1 which including specific occupational exposures, provides a summary of 2007 World Health environmental carcinogens, foods containing N-nitroso Organization (WHO) classification). Relevant features compounds, electromagnetic fields, etc. have been in the present section will concern GLIOMAS, tumors associated to only a small proportion of gliomas. that are thought to be of glial cell origin. The only two firmly established factors of primary brain tumors are the exposure to high doses of ionizing Clinics and pathology radiation and inherited mutations of highly penetrant genes associated with rare syndromes (Table 3). Etiology In addition, preliminary evidence points to a lower Gliomas account for >70% of all primary brain tumors. glioma risk among people with allergic conditions and The most common (65%) and most malignant type is high levels of serum IgE. glioblastoma. With the exception of pilocytic Polymorphisms of genes that affect detoxification, astrocytomas, the prognosis of glioma patients is still DNA repair, and cell-cycle regulation have also been poor. Less than 3% of glioblastoma patients are still implicated in the development of gliomas. alive at 5 years after diagnosis, higher age being the Recently, two international Brain Tumor consortia have most significant predictor of poor outcome. Table 2 been formed: the Brain Tumor Epidemiology reports the population-based data of incidence rates Consortium (BTEC) (per 100,000 person per year) in 1992-1997 in United (http://epi.grants.cancer.gov/btec/) to identify potential States adjusted to 2000 US population and the genetic and environmental risk factors and the incidence rates in Zurich, Switzerland in 1980-1994 GLIOGENE to study the genetic basis of familial adjusted to 2000 US population. gliomas.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 591 Nervous System: Glioma: an overview Magnani I

GLIOMAS NONGLIOMAS

grade I II III IV

Astrocytic tumors Choroid plexus tumors Pilocytic astrocytoma * Pituicytoma (**) * Neuronal and mixed neuronal-glial tumor Pilomyxoid astrocytoma (**) * Subependymal giant cell * Tumors of the pineal region astrocytoma

Pleomorphic xanthoastrocytoma *

Diffuse astrocytoma * Embryonal tumors, including Medulloblastoma Fibrillary astrocytoma * Gemistocytic astrocytoma * Meningeal tumors Protoplasmic astrocytoma * Anaplastic astrocytoma * Primary CNS Lymphomas Glioblastoma * - Giant cell glioblastoma * Germ cell tumors - Gliosarcoma * Gliomatosis cerebri nd Pituitary adenomas

Oligodendroglial tumors

Oligodendroglioma * Tumors of cranial and paraspinal nerves Anaplastic oligodendroglioma *

Oligoastrocytic tumors Tumors of the sellar region

Oligoastrocytoma * Anaplastic oligoastrocytoma * Metastatic tumors

Ependymal tumors

Subependymom * Myxopapillary ependymoma * Ependymoma * - Cellular - Papillary - Clear Cell - Tanycytic Anaplastic ependymoma * nd = not defined

Table 1 WHO classification of Central Nervous System Tumors

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 592 Nervous System: Glioma: an overview Magnani I

Table 2 Population-based data of incidence rates, age and sex, and survival of patients with gliomas. From: Ohgaki H and Kleihues P. Epidemiology and etiology of gliomas. Acta Neuropathol 2005, 109: 93-108.

Table 3 Inherited mutations in members of families at increased risk of glioma. From Epidemiology and molecular pathology of glioma. Schwartzbaum JA, Fisher JL, Aldape KD and Wrensch M. Nat Clinical Practice Neurology 2006, 9:494-503.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 593 Nervous System: Glioma: an overview Magnani I

Table 4 Data are from Sathornsumetee et al.(3), Furnari et al.(18), Chi and Wen (20) and Sathornsumetee et al.(21). PCV denotes procarbazine, lomustine (CCNU), and vincristine, and TMZ temozolomide. † Radiotherapy is administered at a dose of 60 Gy given in 30 fractions over a period of 6 weeks. Concomitant TMZ is administered at a dose of 75 mg per square meter of body-surface area per day for 42 days with radiotherapy. Beginning 4 weeks after radiotherapy, adjuvant TMZ is administered at a dose of 150 mg per square meter per day on days 1 to 5 of the first 28-day cycle, followed by 200 mg per square meter per day on days 1 to 5 of each subsequent 28-day cycle, if the first cycle was well tolerated. ‡ PCV therapy consists of lomustine (CCNU), 110 mg per square meter, on day 1; procarbazine, 60 mg per square meter, on days 8 to 21; and vincristine, 1.5 mg per square meter (maximum dose, 2 mg), on days 8 and 29.

Treatment deletions have significantly better outcomes, regardless of treatment. Management of Gliomas: Anaplastic Astrocytomas Pilocytic Astrocytomas Anaplastic astrocytomas comprise 10-15% of all glial Pilocytic astrocytoma, when totally resected, has a neoplasms. Currently, the only factors that have been favourable outcome compared to other astrocytomas. shown to influence prognosis in patients with AA are However, when residual tumor remains, the prognosis age and Karnofsky performance status. The most is less satisfactory. It has been reported that radiation important predictor of response to therapy and survival treatment after surgery suppresses residual tumor. in AA tumors is the presence or absence of the 1p19q Tumor location reveals a cerebellar predominance in co-deletion, a molecular feature that defines a subset of both children and adults. oligodendroglial tumors, and anaplastic Low-grade Astrocytomas oligodendrogliomas in particular. A further likely Favorable prognostic features include younger age at prognostic biomarker is the methylation status of O(6)- diagnosis, tumor size < 5cm and, possibly, greater methylguanine-DNA-methyltranferase gene (the extent of tumor resection. Late recurrences are predominant DNA repair enzyme following alkylator- relatively common, and patients should be followed up based chemotherapy-induced injury). Evidence-based for at least 15 years. Despite their relatively indolent management of patients with AA recommends course, most astrocytomas eventually evolve into more maximum safe resection followed by involved-field anaplastic lesions and cannot be cured by surgery and radiotherapy for newly diagnosed patients, and radiation therapy. temozolomide (TMZ) for recurrent disease. Low-grade Oligodendrogliomas/Oligoastrocytomas Glioblastoma Multiforme (GBM) Approximately half of oligodendrogliomas are Glioblastomas are among the most devasting characterized by loss of heterozygosity of neoplasms claiming the lives of patients within a chromosomes 1p and 19q, a pathognomonic diagnostic median of 1 year after diagnosis. Although feature. For recurrent low-grade oligodendroglial glioblastoma can occur at all ages, including childhood, tumors, surgery, radiation, and chemotherapy may each the average age at which it is diagnosed is 55 years. play an important role. Poor prognostic clinical variables include increasing Anaplastic Oligodendroglioma/Oligoastrocytoma age, poor performance status, increased severity of Although uncommon, these tumors are recognized by neurologic deficits ad diagnosis and the inability to their unique molecular, histologic and clinical features. achieve substantial tumor resection. Treatments include Radiation therapy is the most commonly prescribed surgery, radiotherapy, chemotherapy and so on. The post-surgical therapy. The role and timing of adjuvant extremely infiltrative nature of this tumors makes chemotherapy are less clear. Patients with 1p and 19q

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 594 Nervous System: Glioma: an overview Magnani I

complete surgical removal impossible. Concurrent the progression of this tumor. The numerical radiotherapy and the oral alkylating agent TMZ abnormalities are similar to the lower-grade tumors, followed by adjuvant TMZ has become the standard of involving the gain of chromosomes 7 and 20 and the care for patients with newly diagnosed GBM, although loss of chromosomes 10 and 22 and sex chromosomes. the methylation status of the promoter region of the In general, numerical changes appear to include more MGMT gene in the tumor specimen is associated with loss than gain of chromosomes, and this is reflected in superior survival, regardless of received treatment. the frequent loss of 9p and chromosomes 13 and 14. Low-grade and anaplastic ependymomas Monosomy of chromosome 22 is the most frequent Ependymomas may occur anywhere in the spinal axis. alteration observed in ependymomas, in addition to In children, they are more commonly found in the deletions or translocations involving 22q. posterior fossa and spinal cord. Both the low-grade and In addition to alterations in chromosome number, most anaplastic lesions may disseminate along the solid tumors are also characterized by centrosome leptomeningeal surfaces. Low-grade lesions in the amplification. Centrosome nucleates and organizes the spine are usually treated with surgery alone. Anaplastic cytoplasmic and mitotic spindle microtubules (MTs) in or incompletely resected low-grade tumors are usually interphase and mitotic cells, respectively. Because the treated with postoperative radiation therapy. The role of centrosome is actively involved in proper chromosome chemotherapy is uncertain and in general should be segregation during mitosis, it has been hypothesized reserved patients having previously failed surgery and that centrosome amplification drives tumor aneuploidy radiotherapy (see Table 4). by increasing the frequency of abnormal mitosis that There is growing evidence that glioma stem cells lead to chromosome missegregation. In a recent work may contribute to the resistance of malignant on primary diffuse astrocytic gliomas Katsetos et al. gliomas to standard treatments. Radioresistance in reported the overexpression of gamma-tubulin, the key stem cells generally results from the preferential structural component of centrosome, associated with activation of DNA-damage-response pathways, supernumerary centrosomes .Interphase and - whereas chemoresistance results partly from the metaphase amplified centrosomes in glioma cell lines overexpression of O 6-methylguanine-DNA are visible in Figure 1, a and b respectively (personal methyltransferase (MGMT), the up-regulation of observations). multidrug resistance genes, and the inhibition of Chromosomal imbalances of glioma in childhood apoptosis. Therapeutic strategies that effectively target and adolescence stem cells sparing normal cells and overcome their Pilocytic astrocytomas account for 23.5% of pediatric resistance to treatment will be necessary if malignant brain tumors. The most common aberration consisted gliomas are to be completely eradicated. Another of 6q, followed by 7q gain, and loss of 9q. The determined obstacle to effective therapy is the imbalance +7q is observed in other gliomas such as invasive nature of glioma cells into the surrounding pleomorphic xanthoastrocytomas and ependymomas, brain. whereas -9q is the most frequent alteration in pleomorphic xanthoastrocytomas and is also present in Cytogenetics anaplastic astrocytomas. Anaplastic astrocytomas account for 7.2% of childhood Note brain tumors. Among the investigated tumors the most Cytogenetic markers of glioma in adults common chromosomal alterations were gains of 5q and The gain of chromosome 7 is the most frequent 1q and losses of 22q, 9q and 12q. numerical aberration observed in astrocytomas (WHO Glioblastomas account for 7.2% of pediatric brain grade I) and anaplastic astrocytomas (WHO grade II). tumors. The most frequent reported chromosomal In AA other chromosomes showing a tendency toward imbalances were losses of 17p and 13q whereas gains gain are chromosomes 19 and 20. Chromosomes most included 1q, 2q, 3q and 17q .Compared with adult often lost include 10 and 22 and a single sex cases, gains of 1p, 2q and 21q as well as losses of 6q, chromosome. Among the oligodendroglioma 11q and 16q were more frequently observed among karyotypes the majority have normal or nonclonal pediatric malignant astrocytomas, supporting chromosomal pattern often associated with isolated sex differences between childhood and adult chromosomal chromosomes. The genetic instability of glioblastoma abnormalities and different genetic pathways. results in numerous subpopulations and isolated cell Oligodendroglial tumors are rare in the pediatric types: nonetheless several non-random chromosome population and only isolated cases have been changes, in particular aneuploidies, are associated with investigated.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 595 Nervous System: Glioma: an overview Magnani I

Figure 1 . Interphase and -metaphase amplified centrosomes in glioma cell lines.

Ependymomas comprise 10.1% of pediatric brain 1p/19q loss tumors. Among the tumor group investigated classic Deletions of 1p and 19q are associated with tumors and anaplastic ependymomas are characterized by +1q, with oligodendroglial components. Combined whereas all 3 entities (including the myxopapillary alterations have been observed in up to 70% of variant) frequently show +9. Other imbalances oligodendrogliomas and 50% of mixed observed were +7q as well as -22q. oligoastrocytomas. Besides being a relevant diagnostic Cytogenetics Molecular marker, 1p/19q loss has been recently validated for its prognostic relevance by prospective data suggesting Molecular pathology of glioma that 1p /19q deletion is predictive of radio- Different studies applying cytogenetic, comparative chemosensitivity in anaplastic oligodendroglial tumors genomic hybridization (CGH), array-CGH and loss of and mixed oligoastrocytomas. Based on the observation heterozygosity (LOH) methods demonstrated non- that the majority of 1p and 19q deletions seem to random genomic aberrations in gliomas. The involve the entire 1p and 19q arms, in a recent paper characterization of genomic abnormalities enhanced to Jenkins RB et al showed that an unbalanced identify specific genes involved in tumor initiation and t(1;19)(q10;q10) underlies the formation of the progression. combined 1p and 19q deletion in gliomas and in Table 5 summarizes the most common detectable addition it predicts a better prognosis of patients with chromosome changes in glioma. oligodendroglioma.

Table 5 From Epidemiology and molecular pathology of glioma. Schwartzbaum JA, Fisher JL, Aldape KD and Wrensch M. Nat Clinical Practice Neurology 2006, 9:494-503.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 596 Nervous System: Glioma: an overview Magnani I

Figure 2: Genetic pathways associated with glioblastoma formation. A (astrocytomas), O (oligodendroglioma), GBMO (glioblastoma with oligodendroglial component). The amplified genes are indicated by "+". The chromosomes deleted and the genes inactivated are indicated by "-".

mTOR leading to cell proliferation and enhanced cell Genes involved and proteins survival by blocking apoptosis. PTEN downregulates Genetic pathways to Glioblastoma the PIP3 signal, thereby inhibiting cell proliferation. The PTEN gene is mutated in up to 40% of Note glioblastomas and almost exclusively in primary Genotype/phenotype correlation studies of gliomas glioblastomas (Fig.1). elucidate the genetic pathways that lead to GBM. They ARF include: TP53/MDM2/p14 pathway - two main early alterations such as p53 inactivation Note (associated with astrocytomas) and the loss of The TP53 is involved in several cellular processes, chromosomes 1p and 19q (more specific to including the cell cycle, response of cells to DNA oligodendrogliomas), both mutually exclusive. damage, cell death, cell differentiation, and - The P16/CDKN2A deletion on 9p21, neovascularisation. After DNA damage, TP53 is mutation/amplification of EGFR and inactivation of activated and induces transcription of genes such as PTEN, two genes acting in a key signalling pathway in p21. MDM2 binds to mutant and wild-type TP53 the development of primary GBM. proteins, thereby inhibiting the ability of wild-type - The TP53 pathway playing a crucial role in the TP53 to activate the transcription. Conversely, development of secondary GBM. transcription of the MDM2 gene is induced by wild- The p16/RB1 pathway seems to be important in type TP53. Whereas TP53 activity and MDM2 pathways to both primary and secondary GBM. The expression in normal cells are regulated by the above RB1 inactivation on 13q and CDK4 amplification, also autoregulatory feedback loop and by the p14 ARF gene mutually exclusive, are more frequent in anaplastic product that inhibits MDM2-p53 degradation, in human gliomas. PTEN inactivation on chromosome 10q and cancer cell lines p14 ARF expression inversely correlates epidermal growth factor receptor (EGFR) amplification with TP53. and/or rearrangement are more frequent in This means that loss of TP53 function may result from glioblastomas. abnormal expression of any of the TP53, MDM2, or The scheme in Figure 2 depicts the genetic pathways to p14 ARF genes. glioblastoma. The major signalling pathways involved in the P16/RB1 pathway pathogenesis of glioblastomas are depicted in Figure Note 3 and then shortly commented. The RB1 protein controls the progression through G1 EGFR/PTEN/Akt/mTOR pathway to S phase of the cell cycle. The CDK4/cyclin D1 complex phosphorylates the RB1 protein, determining Note the release of the E2F transcription factor that activates EGFR is activated upon the binding of growth factors genes involved in the G1 -S transition. P16 INK4a binds to its extracellular domain, resulting in recruitment of to CDK4, inhibits the CDK4/cyclin D1 complex and in P13K to the cell membrane. P13K in turn turn blocks the G1 -S transition. Consequently, the loss phosphorylates phosphatidynositol-4,5-biphosphate to of normal RB1 function may depend on the altered the 3-phosphate(PIP3), which activates downstream expression of any of the RB1, P16 INK4a , or CDk4 genes. effector molecules such as AKT (protein kinase B) and

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 597 Nervous System: Glioma: an overview Magnani I

Figure 3: From Genetic Pathways to primary and secondary glioblastoma. Hiroko Ohgaki and Paul Kleihues The Am J Pathol 2007 May;170(5):1445-53 review.

Burkhard C, Di Patre PL, Schüler D, Schüler G, Ya şargil MG, References Yonekawa Y, Lütolf UM, Kleihues P, Ohgaki H. A population- based study of the incidence and survival rates in patients with Magnani I, Guerneri S, Pollo B, Cirenei N, Colombo BM, pilocytic astrocytoma. J Neurosurg. 2003 Jun;98(6):1170-4 Broggi G, Galli C, Bugiani O, DiDonato S, Finocchiaro G. Increasing complexity of the karyotype in 50 human gliomas. Chamberlain MC. Ependymomas. Curr Neurol Neurosci Rep. Progressive evolution and de novo occurrence of cytogenetic 2003 May;3(3):193-9 alterations. Cancer Genet Cytogenet. 1994 Jul 15;75(2):77-89 Lamszus K, Kunkel P, Westphal M. Invasion as limitation to Brem S, Rozental JM, Moskal JR. What is the etiology of anti-angiogenic glioma therapy. Acta Neurochir Suppl. human brain tumors? A report on the first Lebow conference. 2003;88:169-77 Cancer. 1995 Aug 15;76(4):709-13 Okamoto Y, Di Patre PL, Burkhard C, Horstmann S, Jourde B, Pihan GA, Purohit A, Wallace J, Knecht H, Woda B, Fahey M, Schüler D, Probst-Hensch NM, Yasargil MG, Quesenberry P, Doxsey SJ. Centrosome defects and genetic Yonekawa Y, Lütolf UM, Kleihues P, Ohgaki H. Population- instability in malignant tumors. Cancer Res. 1998 Sep based study on incidence, survival rates, and genetic 1;58(17):3974-85 alterations of low-grade diffuse astrocytomas and oligodendrogliomas. Acta Neuropathol. 2004 Jul;108(1):49-56 Magnani I, Chiariello E, Conti AM, Finocchiaro G. A recurrent 19q11-12 breakpoint suggested by cytogenetic and Rickert CH, Paulus W. Comparative genomic hybridization in fluorescence in situ hybridization analysis of three glioblastoma central and peripheral nervous system tumors of childhood and cell lines. Cancer Genet Cytogenet. 1999 Apr 15;110(2):82-6 adolescence. J Neuropathol Exp Neurol. 2004 May;63(5):399- 417 Rickert CH, Sträter R, Kaatsch P, Wassmann H, Jürgens H, Dockhorn-Dworniczak B, Paulus W. Pediatric high-grade Sanson M, Thillet J, Hoang-Xuan K. Molecular changes in astrocytomas show chromosomal imbalances distinct from gliomas. Curr Opin Oncol. 2004 Nov;16(6):607-13 adult cases. Am J Pathol. 2001 Apr;158(4):1525-32 Dean M, Fojo T, Bates S. Tumour stem cells and drug Shapiro JR. Genetic alterations associated with adult diffuse resistance. Nat Rev Cancer. 2005 Apr;5(4):275-84 astrocytic tumors. Am J Med Genet. 2002 Oct 30;115(3):194- 201

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 598 Nervous System: Glioma: an overview Magnani I

Ohgaki H, Kleihues P. Epidemiology and etiology of gliomas. Buckner JC, Brown PD, O'Neill BP, Meyer FB, Wetmore CJ, Acta Neuropathol. 2005 Jan;109(1):93-108 Uhm JH. Central nervous system tumors. Mayo Clin Proc. 2007 Oct;82(10):1271-86 Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, Hjelmeland AB, Dewhirst MW, Bigner DD, Rich JN. Glioma stem cells promote Fisher JL, Schwartzbaum JA, Wrensch M, Wiemels JL. radioresistance by preferential activation of the DNA damage Epidemiology of brain tumors. Neurol Clin. 2007 response. Nature. 2006 Dec 7;444(7120):756-60 Nov;25(4):867-90, vii Jenkins RB, Blair H, Ballman KV, Giannini C, Arusell RM, Law Karipidis KK, Benke G, Sim MR, Yost M, Giles G. Occupational M, Flynn H, Passe S, Felten S, Brown PD, Shaw EG, Buckner exposure to low frequency magnetic fields and the risk of low JC. A t(1;19)(q10;p10) mediates the combined deletions of 1p grade and high grade glioma. Cancer Causes Control. 2007 and 19q and predicts a better prognosis of patients with Apr;18(3):305-13 oligodendroglioma. Cancer Res. 2006 Oct 15;66(20):9852-61 Louis DN, Ohgaki H, Wiestler OD, Cavenee WK, Burger PC, Katsetos CD, Reddy G, Dráberová E, Smejkalová B, Del Valle Jouvet A, Scheithauer BW, Kleihues P. The 2007 WHO L, Ashraf Q, Tadevosyan A, Yelin K, Maraziotis T, Mishra OP, classification of tumours of the central nervous system. Acta Mörk S, Legido A, Nissanov J, Baas PW, de Chadarévian JP, Neuropathol. 2007 Aug;114(2):97-109 Dráber P. Altered cellular distribution and subcellular sorting of gamma-tubulin in diffuse astrocytic gliomas and human Malmer B, Adatto P, Armstrong G, Barnholtz-Sloan J, glioblastoma cell lines. J Neuropathol Exp Neurol. 2006 Bernstein JL, Claus E, Davis F, Houlston R, Il'yasova D, May;65(5):465-77 Jenkins R, Johansen C, Lai R, Lau C, McCarthy B, Nielsen H, Olson SH, Sadetzki S, Shete S, Wiklund F, Wrensch M, Yang Louis DN. Molecular pathology of malignant gliomas. Annu P, Bondy M. GLIOGENE an International Consortium to Rev Pathol. 2006;1:97-117 Understand Familial Glioma. Cancer Epidemiol Biomarkers Prev. 2007 Sep;16(9):1730-4 Neglia JP, Robison LL, Stovall M, Liu Y, Packer RJ, Hammond S, Yasui Y, Kasper CE, Mertens AC, Donaldson SS, Meadows Ohgaki H, Kleihues P. Genetic pathways to primary and AT, Inskip PD. New primary neoplasms of the central nervous secondary glioblastoma. Am J Pathol. 2007 May;170(5):1445- system in survivors of childhood cancer: a report from the 53 Childhood Cancer Survivor Study. J Natl Cancer Inst. 2006 Nov 1;98(21):1528-37 Wiemels JL, Wiencke JK, Kelsey KT, Moghadassi M, Rice T, Urayama KY, Miike R, Wrensch M. Allergy-related Roversi G, Pfundt R, Moroni RF, Magnani I, van Reijmersdal polymorphisms influence glioma status and serum IgE levels. S, Pollo B, Straatman H, Larizza L, Schoenmakers EF. Cancer Epidemiol Biomarkers Prev. 2007 Jun;16(6):1229-35 Identification of novel genomic markers related to progression to glioblastoma through genomic profiling of 25 primary glioma Wigertz A, Lönn S, Schwartzbaum J, Hall P, Auvinen A, cell lines. Oncogene. 2006 Mar 9;25(10):1571-83 Christensen HC, Johansen C, Klaeboe L, Salminen T, Schoemaker MJ, Swerdlow AJ, Tynes T, Feychting M. Allergic Schwartzbaum JA, Fisher JL, Aldape KD, Wrensch M. conditions and brain tumor risk. Am J Epidemiol. 2007 Oct Epidemiology and molecular pathology of glioma. Nat Clin 15;166(8):941-50 Pract Neurol. 2006 Sep;2(9):494-503; quiz 1 p following 516 Blakeley J, Grossman S. Anaplastic oligodendroglioma. Curr Aoki T, Hashimoto N, Matsutani M. Management of Treat Options Neurol. 2008 Jul;10(4):295-307 glioblastoma. Expert Opin Pharmacother. 2007 Dec;8(18):3133-46 Samanic CM, De Roos AJ, Stewart PA, Rajaraman P, Waters MA, Inskip PD. Occupational exposure to pesticides and risk of Arslantas A, Artan S, Oner U, Müslümanoglu MH, Ozdemir M, adult brain tumors. Am J Epidemiol. 2008 Apr 15;167(8):976- Durmaz R, Arslantas D, Vural M, Cosan E, Atasoy MA. 85 Genomic alterations in low-grade, anaplastic astrocytomas and glioblastomas. Pathol Oncol Res. 2007;13(1):39-46 Wen PY, Kesari S. Malignant gliomas in adults. N Engl J Med. 2008 Jul 31;359(5):492-507 Broniscer A, Baker SJ, West AN, Fraser MM, Proko E, Kocak M, Dalton J, Zambetti GP, Ellison DW, Kun LE, Gajjar A, This article should be referenced as such: Gilbertson RJ, Fuller CE. Clinical and molecular characteristics of malignant transformation of low-grade glioma in children. J Magnani I. Nervous System: Glioma: an overview. Atlas Genet Clin Oncol. 2007 Feb 20;25(6):682-9 Cytogenet Oncol Haematol. 2009; 13(8):591-599.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 599 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Solid Tumour Section Mini Review

Soft tissue tumors: Dermatofibrosarcoma protuberans Kayuri Patel, Dolores Lopez-Terrada Department of Pathology at Texas Children's Hospital and Baylor College of Medicine, Houston, TX 77030, USA (KP, DLT)

Published in Atlas Database: August 2008 Online updated version : http://AtlasGeneticsOncology.org/Tumors/DermFibroSarcProtID5059.html DOI: 10.4267/2042/44544 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

growth. Dermatofibrosarcoma Protuberans (DFSP) is Identity primarily associated with the trunk, limbs, head, neck Alias and vulva. Dermatofibrosarcoma Protuberans Epidemiology Darier Ferrand tumor Darier-Hoffmann tumor Rare soft tissue tumor, accounts for up to 1% of all soft tissue sarcomas. Note t(17;22)(q22;q13) is found in most if not all Clinics Dermatofibrosarcoma Protuberans cases. Typically diagnosed in young to middle-aged adults and affects either sex and all races, however numerous Clinics and pathology pediatric and congential cases have been reported. The Disease duration of the lesions prior to diagnosis is commonly more than 5 years, and decades in some cases. Neoplasm of the deep dermis with extension to the subcutis, characterized by locally aggressive

Typical dermatofibrosarcoma protuberans (H&E, 40x)

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 600 Soft tissue tumors: Dermatofibrosarcoma protuberans Patel K, Lopez-Terrada D

From top to bottom: a), b) Strong CD34 immunoreactivity (CD34, 40x).

Pathology Monotonous storiform pattern of uniform, cytologically bland spindle cells, with a characteristic honeycomb pattern of infiltration into the subcutaneous fat. Immunohistochemical staining demonstrates strong positivity for vimentin and CD34 and negativity for factor XIIIa staining. Apolipoprotein has also been described as a marker for DFSP. Treatment Preferred treatment for DFSP is wide surgical excision with pathologically negative margins. Recently Imatinib mesylate therapy has been documented to induce extensive regression of primary and metastatic lesions. Prognosis Despite the local invasiveness, DFSP rarely metastasizes. The risk for development of metastatic FISH of a DFSP case using a break-apart probe to the PDGFB disease is only 5%. The extent of surgical excision locus shows tumor cells with one yellow signal indicating an determines the prognosis of the patient. To reduce the intact PDGFB locus, and two or more green signals, representing additional copies of an unbalanced rearranged local recurrence rate, a wide surgical excision with PDGFB locus (x100). adequate margins is used. Genes involved and proteins Cytogenetics COL1A1 Cytogenetics Morphological Location Cytogenetically, DFSP is characterized by the presence 17q21.31-q22 of the recurrent t(17;22)(q22;q13) translocation or, more commonly, supernumerary ring chromosomes Note containing material from chromosomal regions 17q22 Molecular location: from base pairs 45,616,456 to and 22q13 accompanied by simple chromosome 45,633,999. trisomies. The translocation results in the fusion of the DNA / RNA alpha chain type 1 of collagen (COL1A1) gene with the COL1A1 is transcribed from centromere to telomere at platelet-derived growth factor Beta (PDGFbeta) gene. 17q21.31-q22. The mRNA sequence contains 5927 bp, Cytogenetics Molecular comprising 52 exons and spans approximately 18 kb. Exons 5 to 49 encode the alpha helical domain. Fluorescence in situ hybridization based approaches can be used to demonstrate the t(17;22), using gene Protein specific probes to demonstrate PDGFbeta gene The COL1A1 gene produces a component of type I rearrangements as well as genetic gains and losses. collagen called the pro-a1(I) chain. The Alpha1 (I)

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 601 Soft tissue tumors: Dermatofibrosarcoma protuberans Patel K, Lopez-Terrada D

chains of the type I collagen are synthesized as is the transcriptional up-regulation of the PDGFB gene. procollagen molecules containing amino and carboxy- The associated COL1A1-PDGFbeta fusion protein is terminal propeptides, which are removed by site- posttranslationally processed to a functional PDGFbeta specific endopeptidase synthesizing the 1464 amino and results in PDGFbeta-mediated autocrine and/or acid protein. paracrine activation of platelet-derived growth factor PDGFbeta receptor-beta (PDGFBB). Location References 22q12.3-q13.1 Naeem R, Lux ML, Huang SF, Naber SP, Corson JM, Fletcher Note JA. Ring chromosomes in dermatofibrosarcoma protuberans Molecular location: from base pairs 37,949,665 to are composed of interspersed sequences from chromosomes 37,970,936. 17 and 22. Am J Pathol. 1995 Dec;147(6):1553-8 DNA / RNA Simon MP, Maire G, and Pedeutour F.. COL1A1 (collagen, type I, alpha 1). Atlas Genet Cytogenet Oncol Haematol. The PDGFbeta mRNA sequence contains 3373 bp, February 2001. comprising 7 exons and spans approximately 22 kb. Exon 7 and most part of the exon 1 are non-coding Simon MP, Maire G, and Pedeutour F.. PDGFB. Atlas Genet Cytogenet Oncol Haematol. February 2001. sequences. West RB, Harvell J, Linn SC, Liu CL, Prapong W, Hernandez- Protein Boussard T, Montgomery K, Nielsen TO, Rubin BP, Patel R, The PDGFbeta chains are synthesized as 240 amino Goldblum JR, Brown PO, van de Rijn M. Apo D in soft tissue acids precursors molecules containing amino and tumors: a novel marker for dermatofibrosarcoma protuberans. carboxy-terminal propeptides, which are removed by Am J Surg Pathol. 2004 Aug;28(8):1063-9 site-specific endopeptidases. Two PDGFbeta precursor McArthur GA, Demetri GD, van Oosterom A, Heinrich MC, chains associate in dimers to form the mature PDGFBB Debiec-Rychter M, Corless CL, Nikolova Z, Dimitrijevic S, Fletcher JA. Molecular and clinical analysis of locally advanced after proteolysis. dermatofibrosarcoma protuberans treated with imatinib: Imatinib Target Exploration Consortium Study B2225. J Clin Result of the chromosomal Oncol. 2005 Feb 1;23(4):866-73 Fletcher C,. Mesenchymal Tumors Diagnostic Histopathology anomaly of Tumors. 2007; Churchill Livingstone 3rd Ed.; vol 2: 1489- Fusion Protein 1491. Patel KU, Szabo SS, Hernandez VS, Prieto VG, Abruzzo LV, Note Lazar AJ, López-Terrada D. Dermatofibrosarcoma protuberans COL1A1 and PDGFbeta both encoded as pro-peptides COL1A1-PDGFB fusion is identified in virtually all are processed by proteolytic cleavage at N and C- dermatofibrosarcoma protuberans cases when investigated by newly developed multiplex reverse transcription polymerase terminus to give mature proteins. Sequences analyses chain reaction and fluorescence in situ hybridization assays. of the chimerical COL1A1/PDGFbeta fusion Hum Pathol. 2008 Feb;39(2):184-93 transcripts has shown that the COL1A1/PDGFbeta putative proteins exhibit a pro-peptide structure, with a This article should be referenced as such: preserved N-terminus COL1A1 pro-peptide containing Patel K, Lopez-Terrada D. Soft tissue tumors: the signal peptide and the N and C-terminus PDGFbeta Dermatofibrosarcoma protuberans. Atlas Genet Cytogenet maturation cleavage sites. The result of this Oncol Haematol. 2009; 13(8):600-602. characteristic rearrangement of COL1A1and PDGFbeta

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 602 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Cancer Prone Disease Section Mini Review

Maffucci syndrome Twinkal C Pansuriya, Judith VMG Bovée Dept of Pathology, Leiden University Medical Center, P.O. Box 9600, 2300 RC Leiden, The Netherlands (TCP, JVMGB)

Published in Atlas Database: July 2008 Online updated version : http://AtlasGeneticsOncology.org/Kprones/MaffucciID10153.html DOI: 10.4267/2042/44545 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

The enchondromas bear the risk of secondary fractures Identity in metaphyses and diaphyses. Alias Phenotype and clinics Dyschondrodysplasia with haemangiomas Maffucci syndrome is characterized by enchondromas, Enchondromatosis with multiple cavernous resulting in bone deformities, and soft tissue haemangiomas haemangiomas. The disease appears to develop around Multiple angiomas and endochondromas the age of 4 to 5 years in 25% of cases. In 45% of cases Kast syndrome symptoms start before the age of 6 and in 78% of cases Haemangiomatosis chondrodystrophica symptoms developed before puberty. The bone and Note vascular lesions may be progressive. No association It is a rare, developmental disorder characterized by the with mental or psychiatric abnormalities but in few presence of multiple enchondromas exceptional cases, it is associated with ovarian tumor (enchondromatosis), multiple haemangiomas or, less and nervous system abnormalities. A review of ninety- commonly, lymphangiomas. eight cases showed that hand, foot, femur, tibia and Inheritance fibula were the most frequently affected sites. The It is a non hereditary disease. diagnosis is made based on a combination of clinical, radiological and histological grounds. Enchondromas Clinics can be radiolucent or mineralized and can be intramedullary or periosteal in location. Phleboliths Note (associated with soft tissue calcification) in Maffucci syndrome was first described in 1881 by haemangiomas can be visualized in radiographs. Angelo Maffucci. In the 2002 World Health Histologically, haemangiomas can be divided into two Organization classification Maffucci syndrome is groups; capillary haemangiomas (narrow, thin-walled considered as a subclass of enchondromatosis. It is capillaries, thin epithelium separated by connective characterized by the occurrence of multiple tissue) and cavernous haemangiomas (sharply defined enchondromas of the bones combined with and having deeper structures more often than capillary haemangiomas of the soft tissue. Both of which may subtype). Another specific subtype called spindle cell undergo malignant change. Males and females are haemangioma (features like cavernous haemangioma equally affected. Haemangiomas often protrude as soft combined with Kaposi sarcoma-like features) can be nodules usually presenting on the distal extremities, but seen. Distinction between enchondroma and low-grade they can appear anywhere in the body such as in the chondrosarcoma in Maffucci syndrome is complicated leptomeninges, in the eyes, in the pharynx, in the as compared to solitary tumors and usually it is based tongue, in the intestines and in the trachea. Multiple on clinical and radiological grounds (cortical enchondromas are benign cartilaginous tumours destruction, soft growing in the medulla of bones, predominantly in long tissue extension) or the presence of mitosis. bones.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 603 Maffucci syndrome Pansuriya TC, Bovée JVMG

Neoplastic risk Dec 4;7(4):215-9 There is a high risk of development of malignant Matsumoto N, Fukushima T, Tomonaga M, Imamura M. [Maffucci's syndrome with intracranial manifestation and tumors in Maffucci patients, with an overall incidence chromosome abnormalities--a case report]. No Shinkei Geka. of 23-100%. The majority is of mesenchymal origin 1986 Mar;14(3 Suppl):403-10 and includes secondary central chondrosarcoma and Schwartz HS, Zimmerman NB, Simon MA, Wroble RR, Millar angiosarcoma. Moreover, benign tumors such as EA, Bonfiglio M. The malignant potential of enchondromatosis. pituitary chromophobe adenoma, uterine polyp, uterine J Bone Joint Surg Am. 1987 Feb;69(2):269-74 fibroid, adrenal cortical adenoma and ovarian thecoma Mulder JD, Schutte HE, Kroon HM, Takonis WK.. Radiological are described, as well as fibrosarcoma, glioma, Atlas of Bone tumors. 1993, Amsterdam: Elsevier. mesenchymal ovarian tumour and carcinoma of the Nakayama Y, Takeno Y, Tsugu H, Tomonaga M. Maffucci's pancreas. syndrome associated with intracranial chordoma: case report. Treatment Neurosurgery. 1994 May;34(5):907-9; discussion 909 Individuals having Maffucci syndrome need to have Albregts AE, Rapini RP. Malignancy in Maffucci's syndrome. Dermatol Clin. 1995 Jan;13(1):73-8 regular physical examinations in order to evaluate changes in the skin and bone lesions that may suggest Tibbs RE, Bowles AP, Raila FA. Maffucci's Syndrome and malignancy. Haemangiomas could be treated with Intracranial Chondrosarcoma. Skull Base Surg. 1997;7(1):49- 55 sclerotherapy, surgery or with laser treatment to reduce the size of the lesions. Biopsy can be done in case of Tibbs RE Jr, Bowles AP Jr. Maffucci's syndrome associated with a cranial base chondrosarcoma: case report and literature symptomatic enchondromas. Surgery can be done in review. Neurosurgery. 1998 Aug;43(2):397 case of borderline or low grade chondrosarcoma. Jermann M, Eid K, Pfammatter T, Stahel R. Maffucci's Prognosis syndrome. Circulation. 2001 Oct 2;104(14):1693 It depends upon severity of the disease but there is an Zwenneke Flach H, Ginai AZ, Wolter Oosterhuis J. Best cases increased risk for malignancy. from the AFIP. Maffucci syndrome: radiologic and pathologic findings. Armed Forces Institutes of Pathology. Radiographics. Cytogenetics 2001 Sep-Oct;21(5):1311-6 Fletcher CDM, Unni K, Mertens F, (Ed).. World Health Note Organization Classification of Tumors. Pathology and genetics. The molecular defect underlying Maffucci syndrome is Tumors of Soft Tissue and Bone. Lyon: IARC Press; 2002:427. still unknown. There was one case reported with Noël G, Feuvret L, Calugaru V, Hadadi K, Baillet F, Mazeron inversion of p11 and q21 of chromosome 1 in a patient JJ, Habrand JL. Chondrosarcomas of the base of the skull in Ollier's disease or Maffucci's syndrome--three case reports and with Maffucci syndrome. review of the literature. Acta Oncol. 2004;43(8):705-10 Chan YC, Giam YC. Guidelines of care for cutaneous References haemangiomas. Ann Acad Med Singapore. 2005 Rozeman LB,Schrage YM, Bovee JVMG, Hogendoorn PCW.. Jan;34(1):117-23 Maffucci Syndrome. In press,Neurocutaneous Disorders. Veth R, Schreuder B, van Beem H, Pruszczynski M, de Rooy Phakomatoses and Hamartoneoplastic Syndromes.Ruggieri, J. Cryosurgery in aggressive, benign, and low-grade malignant Martino; Pascual Castroviejo, Ignacio; Di Rocco, Concezio bone tumours. Lancet Oncol. 2005 Jan;6(1):25-34 (Eds.) Lewis RJ, Ketcham AS. Maffucci's syndrome: functional and This article should be referenced as such: neoplastic significance. Case report and review of the Pansuriya TC, Bovée JVMG. Maffucci syndrome. Atlas Genet literature. J Bone Joint Surg Am. 1973 Oct;55(7):1465-79 Cytogenet Oncol Haematol. 2009; 13(8):603-604. Spranger J, Kemperdieck H, Bakowski H, Opitz JM. Two peculiar types of enchondromatosis. Pediatr Radiol. 1978

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 604 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Cancer Prone Disease Section Mini Review

Multiple osteochondromas (MO) Christianne MA Reijnders, Judith VMG Bovée Dept of Pathology, Leiden University Medical Center, P.O. Box 9600, 2300 RC Leiden, The Netherlands (CMAR, JVMGB) Published in Atlas Database: July 2008 Online updated version: http://AtlasGeneticsOncology.org/Kprones/HeredMultExostosID10061.html DOI: 10.4267/2042/44546 This article is an update of : Bovée JVMG. Hereditary multiple exostoses (HME). Atlas Genet Cytogenet Oncol Haematol 2002;6(3):236-238 Bovée JVMG. Hereditary multiple exostoses (HME). Atlas Genet Cytogenet Oncol Haematol 2000;4(1):46-48

extremities. Patients with a 1 mutation have a more Identity severe phenotype than patients with an 2 mutation. Alias Neoplastic risk Hereditary multiple exostosis (HME) Multiple hereditary exostoses (MHE) Malignant transformation is low in solitary Diaphyseal aclasis osteochondromas (<1%) but is estimated to occur in Multiple hereditary osteochondromatosis 0.5-5% of cases of multiple osteochondromas (MO). Multiple cartlaginous exostoses Treatment Inheritance Osteochondromas can be surgically removed for Autosomal dominant disorder, genetically cosmetic or functional reasons. heterogeneous. Males are more often affected, possibly partly due to an incomplete penetrance in females. Cytogenetics Approximately 62% of the patients have a positive Cytogenetics of cancer family history. Clonal karyotypic abnormalities in the cartilaginous Clinics cap of osteochondroma involving 8q22-24.1 were found in ten out of 30 sporadic and in 1 out of 13 Phenotype and clinics multiple osteochondromas, supporting a neoplastic MO is characterized by the presence of multiple origin. This was confirmed since aneuploidy was found osteochondromas (osteocartilaginous exostosis), i.e. in 4 out of 10 osteochondromas and LOH was almost bony protrusions covered by a cartilaginous cap on the exclusively found at the 1 locus in 5 out of 14 outer surface of bone. This results in a variety of osteochondromas. Aberrations of chromosome 1p orthopaedic deformities such as disproportionate short (1p13-p22) were found in five of seven stature and bowing of the forearm. Osteochondromas osteochondromas. are the most common benign bone tumours, representing approximately 50% of all primary benign Genes involved and proteins tumours of bone. They gradually develop and increase Note in size in the first decade of life. The stratified zones of MO is a genetically heterogeneous disorder for which chondrocytes that are normally found in the growth at present, two genes, 1 and 2 located respectively on plate can still be recognised on the interface of cartilage 8q24 and 11p11-p12, have been isolated. The EXT1 and bone in osteochondroma. Consequently, gene was reported to show linkage in 44%-66% of the osteochondromas cease growing as the growth plates MO families, whereas EXT2 would be involved in close during puberty. The majority of osteochondromas 27%. is asymptomatic and is located in bones that developed Additional linkage to chromosome 19p has been found, from cartilage, especially the long bones in the suggesting the existence of an 3 -gene, although loss of heterozygosity studies could not confirm this and the

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 605 Multiple osteochondromas (MO) Reijnders CMA, Bovée JVMG

gene has not been identified so far. Two patients with mutations were described to induce cytoskeletal MO demonstrated a germline mutation in 1 combined abnormalities (altered actin distribution) in with loss of the remaining wild type allele in three osteochondroma chondrocytes. osteochondromas, confirming the tumour suppressor Mutations function of the EXT genes and indicating that in Germinal: Germline mutations of 1 and 2 in MO cartilaginous cells of the growth plate inactivation of patients have been studied extensively in Caucasian as both copies of the EXT1-gene is required for well as Asian populations. osteochondroma formation in hereditary cases. Somatic: One sporadic osteochondroma was described Homozygous deletions of EXT1 identified in seven out to harbour a deletion of one 1 gene combined with an of eight non-hereditary osteochondromas further inactivating mutation in the other 1 gene. No somatic support the two hit model. However, loss of the mutations were found in the EXT1 and EXT2 gene in remaining wildtype allele can be demonstrated in only 34 sporadic and hereditary osteochondromas and a subset of osteochondromas in MO patients. secondary peripheral chondrosarcomas tested. EXT1 (exostosin-1) EXT2 (exostosin-2) Location Location 8q24 11p11-p12 DNA/RNA Description: The 1 gene is composed of 11 exons, and References the 2 gene consists of 16 exons. Crandall BF, Field LL, Sparkes RS, Spence MA. Hereditary Protein multiple exostoses. Report of a family. Clin Orthop Relat Res. Expression: Both 1 and 2 mRNA is ubiquitously 1984 Nov;(190):217-9 expressed. A high level of expression of EXT1 and Cook A, Raskind W, Blanton SH, Pauli RM, Gregg RG, EXT2 mRNA has been found in developing limb buds Francomano CA, Puffenberger E, Conrad EU, Schmale G, Schellenberg G. Genetic heterogeneity in families with of mouse embryos and expression was demonstrated to hereditary multiple exostoses. Am J Hum Genet. 1993 be confined to the proliferating and prehypertrophic Jul;53(1):71-9 chondrocytes of the growth plate. Le Merrer M, Legeai-Mallet L, Jeannin PM, Horsthemke B, Function: A tumour suppressor function is suggested Schinzel A, Plauchu H, Toutain A, Achard F, Munnich A, for the genes. The gene products, exostosin-1 (1) and Maroteaux P. A gene for hereditary multiple exostoses maps to exostosin-2 (EXT2) are endoplasmic reticulum chromosome 19p. Hum Mol Genet. 1994 May;3(5):717-22 localized type II transmembrane glycoproteins which Ahn J, Lüdecke HJ, Lindow S, Horton WA, Lee B, Wagner MJ, form a Golgi-localized hetero-oligomeric complex that Horsthemke B, Wells DE. Cloning of the putative tumour catalyzes heparan sulphate (HS) polymerization. suppressor gene for hereditary multiple exostoses (EXT1). Nat Heparan sulphate proteoglycans (HSPG) are large Genet. 1995 Oct;11(2):137-43 macromolecules composed of heparan sulphate Wicklund CL, Pauli RM, Johnston D, Hecht JT. Natural history glycosaminoglycan chains linked to a protein core. study of hereditary multiple exostoses. Am J Med Genet. 1995 Jan 2;55(1):43-6 Four HSPG families are syndecan, glypican, perlecan and isoforms of CD44. HSPGs are required for high- Stickens D, Clines G, Burbee D, Ramos P, Thomas S, Hogue D, Hecht JT, Lovett M, Evans GA. The EXT2 multiple affinity binding of fibroblast growth factor to its exostoses gene defines a family of putative tumour suppressor receptor. Furthermore, studies in Drosophila have genes. Nat Genet. 1996 Sep;14(1):25-32 shown that EXT (tout-velu, Ttv) is required for the Wuyts W, Van Hul W, Wauters J, Nemtsova M, Reyniers E, diffusion of the morphogens: Hedgehog (Hh, human Van Hul EV, De Boulle K, de Vries BB, Hendrickx J, Herrygers homologues Indian Hedgehog (IHh) and Sonic I, Bossuyt P, Balemans W, Fransen E, Vits L, Coucke P, Hedgehog (SHh), decapentaplegic (dpp, human Nowak NJ, Shows TB, Mallet L, van den Ouweland AM, homologues TGF-beta and BMP) and wingless (human McGaughran J, Halley DJ, Willems PJ. Positional cloning of a gene involved in hereditary multiple exostoses. Hum Mol homologue Wnt). It was therefore hypothesized that Genet. 1996 Oct;5(10):1547-57 EXT mutations affect IHh / PTHLH, TGF-beta/BMP and Wnt signaling pathways within the normal growth Hecht JT, Hogue D, Wang Y, Blanton SH, Wagner M, Strong LC, Raskind W, Hansen MF, Wells D. Hereditary multiple plate. Indeed, altered levels of the EXT1 and EXT2 exostoses (EXT): mutational studies of familial EXT1 cases protein and of their putative downstream effectors and EXT-associated malignancies. Am J Hum Genet. 1997 (IHh/PTHrP, TGF-beta/BMP and Wnt signalling Jan;60(1):80-6 pathways) were demonstrated in both sporadic and Legeai-Mallet L, Margaritte-Jeannin P, Lemdani M, Le Merrer hereditary osteochondroma. In addition, due to M, Plauchu H, Maroteaux P, Munnich A, Clerget-Darpoux F. impaired EXT1/EXT2 function the HSPGs appear to be An extension of the admixture test for the study of genetic heterogeneity in hereditary multiple exostoses. Hum Genet. retained in the Golgi apparatus and cytoplasm of the 1997 Mar;99(3):298-302 tumour cell, instead of being transported to the cell surface and/or extra cellular matrix where they Legeai-Mallet L, Munnich A, Maroteaux P, Le Merrer M. Incomplete penetrance and expressivity skewing in hereditary normally exert their function. Moreover, EXT multiple exostoses. Clin Genet. 1997 Jul;52(1):12-6

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 606 Multiple osteochondromas (MO) Reijnders CMA, Bovée JVMG

Philippe C, Porter DE, Emerton ME, Wells DE, Simpson AH, evidence of recurrent 8q24.1 loss in osteochondroma. Cancer Monaco AP. Mutation screening of the EXT1 and EXT2 genes Genet Cytogenet. 2002 Sep;137(2):102-7 in patients with hereditary multiple exostoses. Am J Hum Genet. 1997 Sep;61(3):520-8 Hall CR, Cole WG, Haynes R, Hecht JT. Reevaluation of a genetic model for the development of exostosis in hereditary Bellaiche Y, The I, Perrimon N. Tout-velu is a Drosophila multiple exostosis. Am J Med Genet. 2002 Sep 15;112(1):1-5 homologue of the putative tumour suppressor EXT-1 and is needed for Hh diffusion. Nature. 1998 Jul 2;394(6688):85-8 Khurana J, Mertens F, Bovée JV.. Osteochondroma. In: World Health Organization classification of tumours. Pathology and Raskind WH, Conrad EU 3rd, Matsushita M, Wijsman EM, genetics of tumours of soft tissue and bone, Editors: Fletcher Wells DE, Chapman N, Sandell LJ, Wagner M, Houck J. CD, Unni KK, Mertens F, IARC Press, Lyon, 2002, 234-236. Evaluation of locus heterogeneity and EXT1 mutations in 34 families with hereditary multiple exostoses. Hum Mutat. Sawyer JR, Thomas EL, Lukacs JL, Swanson CM, Ding Y, 1998;11(3):231-9 Parham DM, Thomas JR, Nicholas RW. Recurring breakpoints of 1p13 approximately p22 in osteochondroma. Cancer Genet Wuyts W, Van Hul W, De Boulle K, Hendrickx J, Bakker E, Cytogenet. 2002 Oct 15;138(2):102-6 Vanhoenacker F, Mollica F, Lüdecke HJ, Sayli BS, Pazzaglia UE, Mortier G, Hamel B, Conrad EU, Matsushita M, Raskind Bornemann DJ, Duncan JE, Staatz W, Selleck S, Warrior R. WH, Willems PJ. Mutations in the EXT1 and EXT2 genes in Abrogation of heparan sulfate synthesis in Drosophila disrupts hereditary multiple exostoses. Am J Hum Genet. 1998 the Wingless, Hedgehog and Decapentaplegic signaling Feb;62(2):346-54 pathways. Development. 2004 May;131(9):1927-38 Bovée JV, Cleton-Jansen AM, Wuyts W, Caethoven G, Hameetman L, Bovée JV, Taminiau AH, Kroon, HM, Taminiau AH, Bakker E, Van Hul W, Cornelisse CJ, Hogendoorn PC.. Multiple osteochondromas: Hogendoorn PC. EXT-mutation analysis and loss of clinicopathological and genetic spectrum and suggestions for heterozygosity in sporadic and hereditary osteochondromas clinical management. Hereditary Cancer in Clinical Practice and secondary chondrosarcomas. Am J Hum Genet. 1999 (2004); 2 (4) 161-173. Sep;65(3):689-98 Han C, Belenkaya TY, Khodoun M, Tauchi M, Lin X, Lin X. Park KJ, Shin KH, Ku JL, Cho TJ, Lee SH, Choi IH, Phillipe C, Distinct and collaborative roles of Drosophila EXT family Monaco AP, Porter DE, Park JG. Germline mutations in the proteins in morphogen signalling and gradient formation. EXT1 and EXT2 genes in Korean patients with hereditary Development. 2004 Apr;131(7):1563-75 multiple exostoses. J Hum Genet. 1999;44(4):230-4 Porter DE, Lonie L, Fraser M, Dobson-Stone C, Porter JR, Xu L, Xia J, Jiang H, Zhou J, Li H, Wang D, Pan Q, Long Z, Monaco AP, Simpson AH. Severity of disease and risk of Fan C, Deng HX. Mutation analysis of hereditary multiple malignant change in hereditary multiple exostoses. A exostoses in the Chinese. Hum Genet. 1999 Jul-Aug;105(1- genotype-phenotype study. J Bone Joint Surg Br. 2004 2):45-50 Sep;86(7):1041-6 Bernard MA, Hogue DA, Cole WG, Sanford T, Snuggs MB, Alvarez C, Tredwell S, De Vera M, Hayden M. The genotype- Montufar-Solis D, Duke PJ, Carson DD, Scott A, Van Winkle phenotype correlation of hereditary multiple exostoses. Clin WB, Hecht JT. Cytoskeletal abnormalities in chondrocytes with Genet. 2006 Aug;70(2):122-30 EXT1 and EXT2 mutations. J Bone Miner Res. 2000 Hameetman L, Rozeman LB, Lombaerts M, Oosting J, Mar;15(3):442-50 Taminiau AH, Cleton-Jansen AM, Bovée JV, Hogendoorn PC. Bovée JV, van den Broek LJ, Cleton-Jansen AM, Hogendoorn Peripheral chondrosarcoma progression is accompanied by PC. Up-regulation of PTHrP and Bcl-2 expression decreased Indian Hedgehog signalling. J Pathol. 2006 characterizes the progression of osteochondroma towards Aug;209(4):501-11 peripheral chondrosarcoma and is a late event in central Alvarez CM, De Vera MA, Heslip TR, Casey B. Evaluation of chondrosarcoma. Lab Invest. 2000 Dec;80(12):1925-34 the anatomic burden of patients with hereditary multiple Legeai-Mallet L, Rossi A, Benoist-Lasselin C, Piazza R, exostoses. Clin Orthop Relat Res. 2007 Sep;462:73-9 Mallet JF, Delezoide AL, Munnich A, Bonaventure J, Hameetman L, David G, Yavas A, White SJ, Taminiau AH, Zylberberg L. EXT 1 gene mutation induces chondrocyte Cleton-Jansen AM, Hogendoorn PC, Bovée JV. Decreased cytoskeletal abnormalities and defective collagen expression in EXT expression and intracellular accumulation of heparan the exostoses. J Bone Miner Res. 2000 Aug;15(8):1489-500 sulphate proteoglycan in osteochondromas and peripheral chondrosarcomas. J Pathol. 2007 Mar;211(4):399-409 Porter DE, Emerton ME, Villanueva-Lopez F, Simpson AH. Clinical and radiographic analysis of osteochondromas and Hameetman L, Szuhai K, Yavas A, Knijnenburg J, van Duin M, growth disturbance in hereditary multiple exostoses. J Pediatr van Dekken H, Taminiau AH, Cleton-Jansen AM, Bovée JV, Orthop. 2000 Mar-Apr;20(2):246-50 Hogendoorn PC. The role of EXT1 in nonhereditary osteochondroma: identification of homozygous deletions. J Bernard MA, Hall CE, Hogue DA, Cole WG, Scott A, Snuggs Natl Cancer Inst. 2007 Mar 7;99(5):396-406 MB, Clines GA, Lüdecke HJ, Lovett M, Van Winkle WB, Hecht JT. Diminished levels of the putative tumor suppressor proteins Jäger M, Westhoff B, Portier S, Leube B, Hardt K, Royer- EXT1 and EXT2 in exostosis chondrocytes. Cell Motil Pokora B, Gossheger G, Krauspe R. Clinical outcome and Cytoskeleton. 2001 Feb;48(2):149-62 genotype in patients with hereditary multiple exostoses. J Orthop Res. 2007 Dec;25(12):1541-51 Bovée JV, Hogendoorn PC.. Multiple osteochondromas. In: World Health Organization classification of tumours. Pathology Bovée JV. Multiple osteochondromas. Orphanet J Rare Dis. and genetics of tumours of soft tissue and bone, Editors: 2008 Feb 13;3:3 Fletcher CD, Unni KK, Mertens F, IARC Press, Lyon, 2002, 360-362. This article should be referenced as such: Feely MG, Boehm AK, Bridge RS, Krallman PA, Neff JR, Reijnders CMA, Bovée JVMG. Multiple osteochondromas Nelson M, Bridge JA. Cytogenetic and molecular cytogenetic (MO). Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8):605-607.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 607 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Cancer Prone Disease Section Mini Review

Ollier disease Twinkal C Pansuriya, Judith VMG Bovée Dept of Pathology, Leiden University Medical Center, P.O. Box 9600, 2300 RC Leiden, The Netherlands (TCP, JVMGB)

Published in Atlas Database: July 2008 Online updated version : http://AtlasGeneticsOncology.org/Kprones/OllierID10152.html DOI: 10.4267/2042/44547 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

occurrence within Ollier disease and is often an Identity incidental finding. Enchondromas can occur anywhere Alias in the skeleton, with a predilection for the hands and Multiple enchondromatosis feet as well as long bones of upper and lower Dyschondroplasia extremities. The diagnosis is based on Multiple cartilaginous enchondroses roentgenographic appearance as well as clinical features. Lesions affecting the proximal bones are more Note severe and the region of the knee joint and the lower Ollier disease is a rare skeletal disorder which is end of the radius and ulna are particularly common characterized by the occurrence of multiple sites and are more prone to pathological fractures. cartilaginous tumours particularly in the medulla of the Development of palpable bony masses may cause metaphyses and diaphyses of the short and long tubular angular deformity and asymmetric growth. Surgery bones of the limbs, especially the hands and feet, often could be required in case of limb length inequality. The with a unilateral predominance. only clinical sign of the disease is severe deformities Inheritance and bone shortening which may lead to limitations in Non-hereditary. joint motility. Radiographically, cortical destruction and soft tissue extension are suspicious for malignant Clinics transformation of enchondroma. Histologically, enchondromas from Ollier disease patients show more Note worrisome features such as higher cellularity, Ollier disease was first described by Louis Ollier, a pleomorphism and binucleated cells as compared to French surgeon in early 1800s. The disorder is solitary enchondromas. characterized by the presence of at least three enchondromas. Ollier disease manifests early in Neoplastic risk childhood and affects both sexes equally. Lesions are Patients with solitary enchondromas have very low distributed unilaterally. In Ollier disease, chance (<1%) to develop secondary central enchondromas form in the medulla of mainly long chondrosarcoma whereas Ollier patients have an bones and it is now clear that Ollier disease is a increased life time risk of 15% to 30%. Some patients neoplastic disorder since genetic abnormalities were may develop multiple synchronous or metachronous found in the enchondromas. As a result of the chondrosarcomas. Pathological fractures can occur at enchondromas the outer cortical layer of the bone the site of an enchondroma but does not always becomes thin and more fragile. The disease has a indicate malignant transformation. In case of benign unilateral predominance and may result in limb length tumors, the principle symptom is swelling while pain is discrepancy. The estimated prevalence of Ollier disease uncommon and if present, it is usually due to is 1/100,000. pathological fracture or can be the first sign of Phenotype and clinics Solitary enchondroma is far more common than the

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 608 Ollier disease Pansuriya TC, Bovée JVMG

A) Magnetic resonance image and B) radiograph of left toe representing typical involvement of short tubular bones. malignancy. Increase in tumor size, cortical erosion, transformation from enchondroma towards grade I, II, extension of the tumor into soft tissues and pain are the III chondrosarcoma have a 5 years survival rate of signs for malignant transformation. Chondrosarcoma 90%, 81% and 43% respectively and 10 years survival associated with Ollier disease seems to occur more rate of 83%, 64% and 29% respectively. frequently in female as compared to male patients. Treatment Cytogenetics For enchondromas a wait- and -see policy is justified, Cytogenetics of cancer since these are benign lesions. They can be operated in The exact cause of Ollier disease is not known yet but case of complaints or cosmetic deformity. is believed to be a random spontaneous mutation. Enchondromas in phalanges and metacarpals can be Previously, a mutation (p.R150C) in PTHR1 (3p22- curetted and the cavities can be filled with stored p21.1) was reported in two out of six patients but an cancellous bone or cortical bone graft. In Ollier disease, elaborative study on 31 patients failed to detect any patients have multiple lesions affecting different mutations in PTHR1. Previously, it has been shown regions in the body. Therefore, selection is required for that IHH signalling is very low while PTHLH signaling the operative treatment. Surgery can be done in case of was active in Ollier disease. Recently, in 3 out of 14 complications such as growth defect, pathological Ollier patients three additional heterozygous missense fracture and malignant transformation. Lifelong mutations (p.G121E; p.A122T and p.R255H) were monitoring is required in Ollier patients given the risk identified in PTHR1. Two mutations, p.G121E and of malignant transformation. Leg-length discrepancy in p.A122T were heterozygously present only in Ollier disease can be corrected using fully implantable enchondroma from the Ollier patient while p. R255H lengthening nail. Amputation can be required in case of was present in tumor as well as in leukocyte DNA. severe limb shortening and osteotomy can be done to These mutations were shown to decrease the function correct deformity and to unite the fragments readily. of the PTHR1 receptor. Thus, heterozygous PTHR1 Ilizarov technique can be used also. mutations may contribute to Ollier disease in a small Prognosis subset of patients. PTHR1 is a receptor for parathyroid The risk of malignant transformation is considerable hormone and for parathyroid hormone-related peptide (up to 35%) which can be life threatening. whose activity is mediated by G proteins which activate Most frequently, malignant transformation occurs in adenylyl cyclase and also a phosphatidylinositol- long bones and flat bones while this is less common in calcium second messenger system. the hands and feet. Patients with malignant Genetic studies on high grade chondrosarcoma of the

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 609 Ollier disease Pansuriya TC, Bovée JVMG

tibia from a patient with Ollier disease revealed LOH multiple enchondromatosis (Ollier's disease): an autopsy- (loss of heterozygosity) for chromosomal bands based molecular genetic study. Hum Pathol. 2000 Oct;31(10):1299-303 harbouring the RB1 (13q14) and CDKN2A (9p21) tumor suppressor genes and there was overexpression Bovée JV, Sciot R, Dal Cin P, Debiec-Rychter M, et al. Chromosome 9 alterations and trisomy 22 in central of the TP53 protein. However, these changes were chondrosarcoma: a cytogenetic and DNA flow cytometric absent in femoral enchondroma of the same patient. analysis of chondrosarcoma subtypes. Diagn Mol Pathol. 2001 A del(1)(p11q31.2) has been described in a low grade Dec;10(4):228-35 chondrosarcoma of the scapula in an Ollier patient. Benbouazza K, El Hassani S, Hassikou H, Guedira N, Hajjaj- Results of cDNA microarray showed similar expression Hassouni N. Multiple enchondromatosis: a case report. Joint profiling of Ollier disease related tumors as compared Bone Spine. 2002 Mar;69(2):236-9 to solitary tumors. Array CGH data of four Ollier Fletcher CDM, Unni K, Mertens F, (Ed).. World Health samples (2 phalangeal enchondromas and 2 grade II Organization Classification of Tumors. Pathology and genetics. chondrosarcomas) showed highly variable genetic Tumors of Soft Tissue and Bone. Lyon: IARC Press; 2002: abnormalities. One phalangeal enchondroma revealed 427. no alteration while another sample showed complete Hopyan S, Gokgoz N, Poon R, Gensure RC, Yu C, Cole WG, loss of chromosome 6. The two grade II Bell RS, Jüppner H, Andrulis IL, Wunder JS, Alman BA. A mutant PTH/PTHrP type I receptor in enchondromatosis. Nat chondrosarcoma showed gains and losses of several Genet. 2002 Mar;30(3):306-10 chromosomes. One of the grade II chondrosarcomas showed gain of almost the entire chromosomes Noël G, Feuvret L, Calugaru V, Hadadi K, Baillet F, Mazeron JJ, Habrand JL. Chondrosarcomas of the base of the skull in 2,5,8,15,19,20,21 and 22 and gain of parts of Ollier's disease or Maffucci's syndrome--three case reports and chromosomes 1,5,7,9,16,17 and 18. The other Ollier review of the literature. Acta Oncol. 2004;43(8):705-10 disease related chondrosarcoma grade II revealed losses Rozeman LB, Sangiorgi L, Briaire-de Bruijn IH, Mainil-Varlet P, on chromosomes 1,3,4,6,9,10,13,15,16,22 as well as Bertoni F, Cleton-Jansen AM, Hogendoorn PC, Bovée JV. amplifications on chromosomes 6, 7, 12, 14, 15, 16, 17, Enchondromatosis (Ollier disease, Maffucci syndrome) is not 18, 19. caused by the PTHR1 mutation p.R150C. Hum Mutat. 2004 Dec;24(6):466-73 References Baumgart R, Bürklein D, Hinterwimmer S, Thaller P, Mutschler W. The management of leg-length discrepancy in Ollier's Sanderson GH, Smyth FS.. Chondrodysplasia (Ollier's disease with a fully implantable lengthening nail. J Bone Joint disease): A Report of a case resembling Osteitis Fibrosa Surg Br. 2005 Jul;87(7):1000-4 Cystica. J Bone Joint Surg Am. 1938; 20:61-67. Bovée JV, Cleton-Jansen AM, Taminiau AH, Hogendoorn PC. CLEVELAND M, FIELDING W. Chondrodysplasia (Ollier's Emerging pathways in the development of chondrosarcoma of disease). Report of a case with a thirty-eight year follow-up. J bone and implications for targeted treatment. Lancet Oncol. Bone Joint Surg Am. 1959 Oct;41-A:1341-4 2005 Aug;6(8):599-607 Spranger J, Kemperdieck H, Bakowski H, Opitz JM. Two Bükte Y, Necmioglu S, Nazaroglu H, Kilinc N, Yilmaz F. A case peculiar types of enchondromatosis. Pediatr Radiol. 1978 Dec of multiple chondrosarcomas secondary to severe multiple 4;7(4):215-9 symmetrical enchondromatosis (Ollier's disease) at an early age. Clin Radiol. 2005 Dec;60(12):1306-10 Liu J, Hudkins PG, Swee RG, Unni KK. Bone sarcomas associated with Ollier's disease. Cancer. 1987 Apr Rozeman LB, Hameetman L, van Wezel T, Taminiau AH, 1;59(7):1376-85 Cleton-Jansen AM, Hogendoorn PC, Bovée JV. cDNA expression profiling of chondrosarcomas: Ollier disease Schwartz HS, Zimmerman NB, Simon MA, Wroble RR, Millar resembles solitary tumours and alteration in genes coding for EA, Bonfiglio M. The malignant potential of enchondromatosis. components of energy metabolism occurs with increasing J Bone Joint Surg Am. 1987 Feb;69(2):269-74 grade. J Pathol. 2005 Sep;207(1):61-71 Mulder JD, Schutte HE, Kroon HM, Takonis WK.. Radiological Rozeman LB, Szuhai K, Schrage YM, Rosenberg C, et al. Atlas of Bone tumors. 1993, Amsterdam: Elsevier. Array-comparative genomic hybridization of central Gabos PG, Bowen JR. Epiphyseal-metaphyseal chondrosarcoma: identification of ribosomal protein S6 and enchondromatosis. A new clinical entity. J Bone Joint Surg Am. cyclin-dependent kinase 4 as candidate target genes for 1998 Jun;80(6):782-92 genomic aberrations. Cancer. 2006 Jul 15;107(2):380-8 Ozisik YY, Meloni AM, Spanier SS, Bush CH, Kingsley KL, Sasaki D, Hatori M, Abe Y, Kokubun S. Ollier's disease treated Sandberg AA. Deletion 1p in a low-grade chondrosarcoma in a with grafting using alpha-tricalcium phosphate cement. A case patient with Ollier disease. Cancer Genet Cytogenet. 1998 report. Ups J Med Sci. 2006;111(2):249-56 Sep;105(2):128-33 Watanabe K, Tsuchiya H, Sakurakichi K, Yamashiro T, Schaison F, Anract P, Coste F, De Pinieux G, Forest M, Matsubara H, Tomita K. Treatment of lower limb deformities Tomeno B. [Chondrosarcoma secondary to multiple cartilage and limb-length discrepancies with the external fixator in diseases. Study of 29 clinical cases and review of the Ollier's disease. J Orthop Sci. 2007 Sep;12(5):471-5 literature]. Rev Chir Orthop Reparatrice Appar Mot. 1999 Couvineau A, Wouters V, Bertrand G, Rouyer C, Gérard B, Dec;85(8):834-45 Boon LM, Grandchamp B, Vikkula M, Silve C. PTHR1 Bovée JV, van Roggen JF, Cleton-Jansen AM, Taminiau AH, mutations associated with Ollier disease result in receptor loss van der Woude HJ, Hogendoorn PC. Malignant progression in of function. Hum Mol Genet. 2008 Sep 15;17(18):2766-75

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 610 Ollier disease Pansuriya TC, Bovée JVMG

Pannier S, Legeai-Mallet L. Hereditary multiple exostoses and This article should be referenced as such: enchondromatosis. Best Pract Res Clin Rheumatol. 2008 Mar;22(1):45-54 Pansuriya TC, Bovée JVMG. Ollier disease. Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8):608-611. Van Loon P, Lammens J. Malformation of the humerus in a patient with Ollier disease treated with the Ilizarov technique. J Shoulder Elbow Surg. 2008 Mar-Apr;17(2):e9-11

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 611 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Deep Insight Section

JAK2 mutations in myeloproliferative neoplasms Naseema Gangat, Ayalew Tefferi Division of Hematology, Mayo Clinic, Rochester, MN, United States (NG, AT)

Published in Atlas Database: September 2008 Online updated version : http://AtlasGeneticsOncology.org/Deep/JAK2mutationID20065.html DOI: 10.4267/2042/44548 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Introduction ET and PMF (Tefferi and Gilliland, 2005). In the last 2 years, additional JAK2 mutations have been reported Myeloproliferative neoplasms (MPN) are clonal and have shown to induce PV-(JAK2)-like phenotype disorders of hematopoietic stem cells that clinically in mice (Scott et al., 2007b). manifest as overproduction of cells that contribute to the myeloid lineage. These include the "classical JAK structure and function MPN's" chronic myeloid leukemia (CML), The acronym JAK stands for Just Another Kinase, polycythemia vera (PV), essential thrombocythemia which refers to the discovery of multiple tyrosine (ET) and primary myelofibrosis (PMF) (Vardiman et kinase family members. Janus kinases (JAKs) are al., 2002), as well as "atypical MPN's"; chronic named after the Roman god with two faces because eosinophilic leukemia (James et al., 2005), chronic they contain two symmetrical kinase-like domains; the myelomonocytic leukemia (CMML), and systemic C-terminal JAK homology 1 (JH1) and the mastocytosis (SM) (Tefferi and Gilliland, 2006). immediately adjacent JH2 or pseudokinase domain In 1951, CML, PV, ET and PMF were recognized to (Saharinen and Silvennoinen, 2002; Feener et al., have significant overlap in both clinical and biological 2004). Valine 617 is within the JH2 domain. There are features and were felt to be related diseases four mammalian members of the JAK family of (Dameshek, 1951). In 1960, CML was recognized as a receptor-associated tyrosine kinases: JAK1, JAK2, distinct entity after discovery of the Philadelphia JAK3 and tyrosine kinase 2 (TYK2). They comprise of chromosome (Nowell and Hungerford, 1960). seven homologous JH domains organized into four In the early 1980s, Fialkow analyzed X chromosome regions; kinase (JH1), pseudo-kinase (JH2), FERM (the inactivation patterns in women with PV, ET, PMF or N-terminal JH7, JH6, JH5 and part of JH4) and SH2- CML carrying a polymorphic variant of the gene for like (JH3 and part of JH4) (Schindler et al., 2007). The glucose-6-phosphate dehydrogenase. Based on the carboxy-terminal portion of these molecules includes a observations, they established that all four diseases distinctive kinase domain (JH1) which is catalytically were clonal stem cell disorders (Adamson et al., 1976; active and a catalytically inactive pseudo kinase Fialkow et al., 1977; Fialkow et al., 1981). Recently in domain (JH2) which is felt to regulate the activity of 2005, several independent groups identified a somatic JH1. The amino-terminal JH domains, JH3-JH7, mutation involving a protein tyrosine kinase in patients constitute a FERM (four-point-one, ezrin, radixin, with PV, ET and PMF (Baxter et al., 2005; James et al., moesin) domain and mediate association with receptors 2005; Kralovics et al., 2005; Levine et al., 2005). This (Funakoshi-Tago et al., 2006). was a JAK2 point mutation at codon 617, subsequently In humans, JAK1 is located on chromosome 1p31.3, named JAK2V617F which results from a G -->T JAK2 on 9p24, JAK3 on 19p13.1 and TYK2 on transversion at nucleotide 1849 in exon 14 of the JAK2 19p13.2. Each one of these genes ranges in size from gene, the consequence of which is substitution of valine 120 to 130 kDa containing 20 - 25 exons. Expression is by phenylalanine at codon 617. The mutation is present ubiquitous for JAK1, JAK2 and TYK2 but restricted to in hematopoietic cells from affected individuals, but hematopoietic cells for JAK3. not in the germline, suggesting that this mutation is Typically, JAK kinases function through their acquired as a somatic disease allele in the interaction with cytokine receptors that lack intrinsic hematopoietic compartment. This mutation is observed kinase activity. Ligand binding (e.g. erythropoietin, in 95% of patients with PV, and 50% of patients with

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 612 JAK2 mutations in myeloproliferative neoplasms Gangat N, Tefferi A

thrombopoietin) to the appropriate cytokine receptor The JAK2V617F mutation has been reported in over (type 1 or type 2 cytokine receptors; e.g. EpoR, MPL) 95% of patients with PV, 50% of patients with ET or results in juxtaposition of JAKs followed by JAK PMF, 20% in certain other MPNs including refractory kinase phosphorylation and activation, cytokine anemia with ring sideroblasts and thrombocytosis receptor phosphorylation and creates a docking site for (RARS-T), and less than 5% in AML or MDS the recruitment and activation of signal transducers and (Renneville et al., 2006; Steensma et al., 2006; activators of transcription (STATs) (Mertens and Verstovsek et al., 2006). JAK2V617F is a somatically Darnell, 2007). Following phosphorylation, activated acquired mutation and a subset of patients with PV are STATs dimerize and translocate into the nucleus to homozygous for the JAK2V617F allele as a result of induce target gene transcription. This entire process is mitotic recombination and duplication of the mutant tightly regulated at multiple levels by protein tyrosine allele, known as uniparental disomy. Uniparental phosphatases, suppressors of cytokine signaling disomy of chromosomal locus 9p24, including JAK2, (SOCS) and protein inhibitors of activated STAT (Starr had previously been noted in PV (Kralovics et al., and Hilton, 1999; Sasaki et al., 2000; Stofega et al., 2002), and later the JAK2V617F allele was identified 2000). through analysis of the minimal region of uniparental JAK2 was first identified in 1993 (Harpur et al., 1992) disomy (Kralovics et al., 2005). It has been shown that and was found to be an essential mediator for most patients with PV possess JAK2V617F erythropoietin signaling (Witthuhn et al., 1993). The homozygous mutant erythroid progenitors, while most JAK2 gene is located on chromosome 9p24. Genetic patients with ET possess only heterozygous and wild- deletion of JAK2 results in embryonic death due to lack type erythroid colonies (Scott et al., 2006). These of definitive erythropoiesis, and JAK2- deficient observations suggest that mitotic recombination and hematopoietic progenitors do not respond to JAK2V617F homozygosity is an early genetic event in erythropoietin stimulation, suggesting that JAK2 is the the development of PV, but not ET. only JAK kinase responsible for erythropoietin receptor In humans, JAK2V617F mutation occurs at the stem signaling (Parganas et al., 1998). cell level and is present in hematopoietic stem cell JAK2V617F mutations in PV, ET and progenitors (Baxter et al., 2005; Jamieson et al., 2006). It is believed to be myeloid lineage specific because it PMF is present in erythroid and granulocyte-macrophage In 2005, several independent groups identified a progenitors (Baxter et al., 2005; James et al., 2005). recurrent mutation in the JAK2 tyrosine kinase in most However, some reports have suggested JAK2V617F patients with PV, ET or PMF (Baxter et al., 2005; clonal involvement of B (Ishii et al., 2006), T (Ishii et James et al., 2005; Kralovics et al., 2005; Levine et al., al., 2006), and NK (Bellanne-Chantelot et al., 2006) 2005). Subsequently, the mutation was also described lymphocytes. These observations confirm the stem cell in other myeloid neoplasms (Steensma et al., 2005). nature of JAK2V617F MPN's. JAK2V617F is an exon 14 G to T somatic mutation. In retroviral transplant mouse models JAK2V617F This mutation is a guanine-to-thymidine substitution, induces a PV-like phenotype: erythrocytosis, low which results in a substitution of valine for serum erythropoietin level, splenomegaly due to phenylalanine at codon 617 within the JH2 domain of extramedullary hematopoiesis, leukocytosis, JAK2 (JAK2V617F). The JH2 domain is believed to be megakaryocytic hyperplasia and ultimately evolution to auto-inhibitory (Saharinen and Silvennoinen, 2002), myelofibrosis (Lacout et al., 2006; Wernig et al., 2006). and valine 617 plays an important role in JAK2 kinase It has also been shown that in JAK2V617F transgenic auto-inhibition (Lindauer et al., 2001). Thus, the valine mice, manipulation of mutant gene expression results in to phenylalanine substitution at codon 617 results in either an ET (lower expression compared with wild- constitutive kinase activity resulting in a gain-of- type allele) or PV phenotype with (equal expression) or function mutation (Ihle and Gilliland, 2007). Studies without (higher expression) thrombocytosis (Tiedt et have shown that expression of JAK2V617F results in al., 2008). Based on the above experiments, we observe transformation of Ba/F3 cells to IL-3 independent that mutant allele burden in patients with ET is growth, unlike wild-type JAK2 (James et al., 2005). significantly lower than that seen in patients with either Similarly, coexpression of JAK2V617F and PV or PMF (Kittur et al., 2007; (Tefferi et al., 2007; erythropoietin receptor, thrombopoietin receptor Vannucchi et al., 2007b; Tefferi et al., 2008). In PV, a (MPL), or granulocyte-macrophage colony stimulating higher allele burden is the result of JAK2V617F factor (GM-CSF) receptor (all homodimeric Type 1 homozygosity. cytokine receptors) result in cytokine independent Although JAK2V617F is central to the pathogenesis of growth and activation of signal transduction (Lu et al., PV, ET, PMF, the presence of the same allele in three 2005). In addition, expression of JAK2V617F, results clinically distinct MPN's suggests that there might be in constitutive activation of downstream signaling additional inherited or acquired genetic predisposition. pathways including the JAK-STAT, PI3K/AKT and A familial tendency has been reported in 72 families MAPK/ERK pathways (James et al., 2005; Kralovics et with at least two members with MPN's that were tested al., 2005; Levine et al., 2005). for JAK2V617F (Bellanne-Chantelot et al., 2006). The

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 613 JAK2 mutations in myeloproliferative neoplasms Gangat N, Tefferi A

presence of JAK2V617F in these families ranged from occur in 10% of JAK2V617F negative PMF and in 2% some families in which all members carried the of JAK2V617F negative ET, but not observed in PV or mutation, to some in which none of the members with other myeloid malignancies (Pardanani et al., 2006b). MPN had the JAK2V617F mutation. This pattern is Clinical correlates of JAK2 mutations in consistent with a two-hit hypothesis, with an inherited genetic predisposition to MPN (Pardanani et al., PV, ET and PMF 2006a). The prognostic significance of the JAK2V617F There is further evidence to suggest that other somatic mutation has not been precisely delineated. In ET, the alleles are involved along with JAK2V617F in the presence of JAK2V617F has been associated with development of MPN's. It is noted that in a subset of advanced age, higher hemoglobin level, higher JAK2V617F positive MPN who transform to AML, the leukocyte counts and lower platelet counts (Antonioli leukemic blasts are JAK2V617F mutation negative et al., 2005; Campbell et al., 2005; Wolanskyj et al., (Theocharides et al., 2007). 2005; Kittur et al., 2007). In addition in mutation- Other reported JAK2 exon 14 mutations include D620E positive patients with ET, JAK2V617F allele burden (PV, MPN, unclassifiable), E627E (MPN, has been directly correlated with leukocyte count, unclassifiable), C616Y (PV), V617F from platelet count and the presence of palpable c.1848_1849delinsCT (post-ET MF) and splenomegaly (Kittur et al., 2007; Vannucchi et al., V617F/C618R from c.1849 - 1852GTCT > TTTC (PV) 2007b). Although JAK2V617F mutant and wild- type (Grunebach et al., 2006; Schnittger et al., 2006; Wong patients differ in regards to laboratory parameters and et al., 2007; Zhang et al., 2007). clinical features, there were no differences in overall JAK2 exon 12 mutations survival, or myelofibrotic and leukemic transformations. In PV, JAK2V617F homozygous A small proportion of patients with PV are patients were noted to have a higher hemoglobin level, JAK2V617F negative when tested by sensitive allele- higher leukocyte count, lower platelet count, and an specific assays (Jones et al., 2005). However, in 2007, increased incidence of pruritus but not an increased risk Scott and colleagues identified a set of JAK2 exon 12 of thrombosis (Vannucchi et al., 2007b). A similar set mutations in JAK2V617F-negative patients with PV of correlations were made for higher mutant allele (Scott et al., 2007b). The majority of these cases were burden in PV, measured by quantitative assays (Tefferi found to harbor 1 of 4 exon 12 JAK2 mutant alleles: et al., 2007; Vannucchi et al., 2007a). In PMF, the N542-E543del, F537-K539delinsL, a point mutation presence of JAK2V617F was associated with older age that results in substitution of lysine for leucine at codon at diagnosis, higher leukocyte count and presence of 539 (K539L), and H538QK539L. All four exon 12 pruritus (Tefferi et al., 2005). Furthermore, mutant alleles induced cytokine- JAK2V617F “homozygous” PMF patients displayed independent/hypersensitive proliferation in even higher leukocyte count and spleen size (Barosi et erythropoietin receptor-expressing cell lines and al., 2007). In PMF, the presence of the JAK2V617F constitutive activation of JAK-STAT signalling (Scott mutation is associated with poorer overall survival et al., 2007b). In addition, JAK2K539L induced a PV (Campbell et al., 2006). However, these data suggest phenotype in a murine transplant model. Unlike that JAK2V617F mutational status may have JAK2V617F, JAK2 exon 12 mutations are only prognostic significance in PV, ET and PMF, but observed in JAK2V617F- negative PV (i.e. additional studies of large patient cohorts are needed to approximately 5% of all PV cases) (Scott et al., 2007a; confirm these findings. Butcher et al., 2008), and are specific to patients with The prevalence of JAK2 exon 12 is too low to enable isolated erythrocytosis without concomitant accurate assessment of prognostic impact. leukocytosis or thrombocytosis. Nevertheless, JAK2 exon 12 mutations have been Several other exon 12 mutation variants have been associated with a PV phenotype that is more likely to identified; R541 - E543delinsK, I540 - E543delinsMK, present with isolated erythrocytosis (Scott et al., 2007b; V536-I546dup11, F537-I546dup10 + 547L and E543- Pietra et al., 2008). D544del (Percy et al., 2007; Butcher et al., 2008; Pietra et al., 2008). Conclusion MPL mutations The discovery of the JAK2V617F mutation in 2005 has been pivotal to our understanding of the pathogenesis Approximately 50% of ET and PMF patients are of PV, ET and PMF. The subsequent discovery in 2007 JAK2V617F negative. This led Pikman and colleagues of the JAK2 exon 12 mutations in JAK2V617F (Pikman et al., 2006) to study whether other genes in negative PV suggests that activation of the JAK-STAT the JAK-STAT signaling pathway might be mutated in pathway is important in the pathogenesis of JAK2V617F negative ET and PMF. This led to the JAK2V617F-negative MPN. Understanding the identification of mutations of the thrombopoietin molecular pathogenesis of diseases, such as bcr-abl in receptor (MPL), which substitute either leucine or CML, and now JAK2V617F in PV, ET, and PMF has lysine by tryptophan at codon 515. These mutations

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 614 JAK2 mutations in myeloproliferative neoplasms Gangat N, Tefferi A

led to the development of small molecule inhibitors of Kralovics R, Guan Y, Prchal JT. Acquired uniparental disomy JAK2. of chromosome 9p is a frequent stem cell defect in polycythemia vera. Exp Hematol. 2002 Mar;30(3):229-36 Accordingly, a number of anti-JAK2 small molecule drugs have been tested in preclinical models and some Saharinen P, Silvennoinen O. The pseudokinase domain is required for suppression of basal activity of Jak2 and Jak3 have been introduced into clinical trials (Pardanani et tyrosine kinases and for cytokine-inducible activation of signal al., 2007; Lasho et al., 2008; Pardanani, 2008). transduction. J Biol Chem. 2002 Dec 6;277(49):47954-63 Preliminary results from currently ongoing JAK2 Vardiman JW, Harris NL, Brunning RD. The World Health inhibitor drug trials (INCB018424, XL019) suggest Organization (WHO) classification of the myeloid neoplasms. remarkable activity in alleviating symptomatic Blood. 2002 Oct 1;100(7):2292-302 splenomegaly and constitutional symptoms in patients Feener EP, Rosario F, Dunn SL, Stancheva Z, Myers MG Jr. with primary or post-PV/ET myelofibrosis (Verstovsek, Tyrosine phosphorylation of Jak2 in the JH2 domain inhibits 2007a; Verstovsek, 2007b). Despite the discovery of cytokine signaling. Mol Cell Biol. 2004 Jun;24(11):4968-78 JAK2 and MPL mutations there are several unanswered Antonioli E, Guglielmelli P, Pancrazzi A, Bogani C, Verrucci M, questions regarding the etiology of PV, ET and PMF; Ponziani V, Longo G, Bosi A, Vannucchi AM. Clinical how does a single disease allele contribute to three implications of the JAK2 V617F mutation in essential distinct clinical disorders? Will JAK2 inhibitor therapy thrombocythemia. Leukemia. 2005 Oct;19(10):1847-9 offer clinical benefit to patients with PV, ET and PMF? Baxter EJ, Scott LM, Campbell PJ, East C, Fourouclas N, Swanton S, Vassiliou GS, Bench AJ, Boyd EM, Curtin N, Scott MA, Erber WN, Green AR. Acquired mutation of the tyrosine References kinase JAK2 in human myeloproliferative disorders. Lancet. DAMESHEK W. Some speculations on the myeloproliferative 2005 Mar 19-25;365(9464):1054-61 syndromes. Blood. 1951 Apr;6(4):372-5 Campbell PJ, Scott LM, Buck G, Wheatley K, East CL, NOWELL PC, HUNGERFORD DA. Chromosome studies on Marsden JT, Duffy A, Boyd EM, Bench AJ, Scott MA, Vassiliou normal and leukemic human leukocytes. J Natl Cancer Inst. GS, Milligan DW, Smith SR, Erber WN, Bareford D, Wilkins 1960 Jul;25:85-109 BS, Reilly JT, Harrison CN, Green AR. Definition of subtypes of essential thrombocythaemia and relation to polycythaemia Adamson JW, Fialkow PJ, Murphy S, Prchal JF, Steinmann L. vera based on JAK2 V617F mutation status: a prospective Polycythemia vera: stem-cell and probable clonal origin of the study. Lancet. 2005 Dec 3;366(9501):1945-53 disease. N Engl J Med. 1976 Oct 21;295(17):913-6 James C, Ugo V, Le Couédic JP, Staerk J, Delhommeau F, Fialkow PJ, Jacobson RJ, Papayannopoulou T. Chronic Lacout C, Garçon L, Raslova H, Berger R, Bennaceur-Griscelli myelocytic leukemia: clonal origin in a stem cell common to the A, Villeval JL, Constantinescu SN, Casadevall N, Vainchenker granulocyte, erythrocyte, platelet and monocyte/macrophage. W. A unique clonal JAK2 mutation leading to constitutive Am J Med. 1977 Jul;63(1):125-30 signalling causes polycythaemia vera. Nature. 2005 Apr 28;434(7037):1144-8 Fialkow PJ, Faguet GB, Jacobson RJ, Vaidya K, Murphy S. Evidence that essential thrombocythemia is a clonal disorder Jones AV, Kreil S, Zoi K, Waghorn K, Curtis C, Zhang L, Score with origin in a multipotent stem cell. Blood. 1981 J, Seear R, Chase AJ, Grand FH, White H, Zoi C, Loukopoulos Nov;58(5):916-9 D, Terpos E, Vervessou EC, Schultheis B, Emig M, Ernst T, Lengfelder E, Hehlmann R, Hochhaus A, Oscier D, Silver RT, Harpur AG, Andres AC, Ziemiecki A, Aston RR, Wilks AF. Reiter A, Cross NC. Widespread occurrence of the JAK2 JAK2, a third member of the JAK family of protein tyrosine V617F mutation in chronic myeloproliferative disorders. Blood. kinases. Oncogene. 1992 Jul;7(7):1347-53 2005 Sep 15;106(6):2162-8 Witthuhn BA, Quelle FW, Silvennoinen O, Yi T, Tang B, Miura Kralovics R, Passamonti F, Buser AS, Teo SS, Tiedt R, O, Ihle JN. JAK2 associates with the erythropoietin receptor Passweg JR, Tichelli A, Cazzola M, Skoda RC. A gain-of- and is tyrosine phosphorylated and activated following function mutation of JAK2 in myeloproliferative disorders. N stimulation with erythropoietin. Cell. 1993 Jul 30;74(2):227-36 Engl J Med. 2005 Apr 28;352(17):1779-90 Parganas E, Wang D, Stravopodis D, Topham DJ, Marine JC, Levine RL, Wadleigh M, Cools J, Ebert BL, Wernig G, Huntly Teglund S, Vanin EF, Bodner S, Colamonici OR, van Deursen BJ, Boggon TJ, Wlodarska I, Clark JJ, Moore S, Adelsperger J, JM, Grosveld G, Ihle JN. Jak2 is essential for signaling through Koo S, Lee JC, Gabriel S, Mercher T, D'Andrea A, Fröhling S, a variety of cytokine receptors. Cell. 1998 May 1;93(3):385-95 Döhner K, Marynen P, Vandenberghe P, Mesa RA, Tefferi A, Starr R, Hilton DJ. Negative regulation of the JAK/STAT Griffin JD, Eck MJ, Sellers WR, Meyerson M, Golub TR, Lee pathway. Bioessays. 1999 Jan;21(1):47-52 SJ, Gilliland DG. Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and Sasaki A, Yasukawa H, Shouda T, Kitamura T, Dikic I, myeloid metaplasia with myelofibrosis. Cancer Cell. 2005 Yoshimura A. CIS3/SOCS-3 suppresses erythropoietin (EPO) Apr;7(4):387-97 signaling by binding the EPO receptor and JAK2. J Biol Chem. 2000 Sep 22;275(38):29338-47 Lu X, Levine R, Tong W, Wernig G, Pikman Y, Zarnegar S, Gilliland DG, Lodish H. Expression of a homodimeric type I Stofega MR, Herrington J, Billestrup N, Carter-Su C. Mutation cytokine receptor is required for JAK2V617F-mediated of the SHP-2 binding site in growth hormone (GH) receptor transformation. Proc Natl Acad Sci U S A. 2005 Dec prolongs GH-promoted tyrosyl phosphorylation of GH receptor, 27;102(52):18962-7 JAK2, and STAT5B. Mol Endocrinol. 2000 Sep;14(9):1338-50 Steensma DP, Dewald GW, Lasho TL, Powell HL, McClure Lindauer K, Loerting T, Liedl KR, Kroemer RT. Prediction of RF, Levine RL, Gilliland DG, Tefferi A. The JAK2 V617F the structure of human Janus kinase 2 (JAK2) comprising the activating tyrosine kinase mutation is an infrequent event in two carboxy-terminal domains reveals a mechanism for both "atypical" myeloproliferative disorders and autoregulation. Protein Eng. 2001 Jan;14(1):27-37 myelodysplastic syndromes. Blood. 2005 Aug 15;106(4):1207- 9

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 615 JAK2 mutations in myeloproliferative neoplasms Gangat N, Tefferi A

Tefferi A, Gilliland DG. JAK2 in myeloproliferative disorders is Schnittger S, Bacher U, Kern W, Schröder M, Haferlach T, not just another kinase. Cell Cycle. 2005 Aug;4(8):1053-6 Schoch C. Report on two novel nucleotide exchanges in the JAK2 pseudokinase domain: D620E and E627E. Leukemia. Tefferi A, Lasho TL, Schwager SM, Steensma DP, Mesa RA, 2006 Dec;20(12):2195-7 Li CY, Wadleigh M, Gary Gilliland D. The JAK2(V617F) tyrosine kinase mutation in myelofibrosis with myeloid Scott LM, Scott MA, Campbell PJ, Green AR. Progenitors metaplasia: lineage specificity and clinical correlates. Br J homozygous for the V617F mutation occur in most patients Haematol. 2005 Nov;131(3):320-8 with polycythemia vera, but not essential thrombocythemia. Blood. 2006 Oct 1;108(7):2435-7 Wolanskyj AP, Lasho TL, Schwager SM, McClure RF, Wadleigh M, Lee SJ, Gilliland DG, Tefferi A. JAK2 mutation in Steensma DP, McClure RF, Karp JE, Tefferi A, Lasho TL, essential thrombocythaemia: clinical associations and long- Powell HL, DeWald GW, Kaufmann SH. JAK2 V617F is a rare term prognostic relevance. Br J Haematol. 2005 finding in de novo acute myeloid leukemia, but STAT3 Oct;131(2):208-13 activation is common and remains unexplained. Leukemia. 2006 Jun;20(6):971-8 Bellanné-Chantelot C, Chaumarel I, Labopin M, Bellanger F, Barbu V, De Toma C, Delhommeau F, Casadevall N, Tefferi A, Gilliland G. Classification of chronic myeloid Vainchenker W, Thomas G, Najman A. Genetic and clinical disorders: from Dameshek towards a semi-molecular system. implications of the Val617Phe JAK2 mutation in 72 families Best Pract Res Clin Haematol. 2006;19(3):365-85 with myeloproliferative disorders. Blood. 2006 Jul 1;108(1):346-52 Verstovsek S, Silver RT, Cross NC, Tefferi A. JAK2V617F mutational frequency in polycythemia vera: 100%, >90%, less? Campbell PJ, Griesshammer M, Döhner K, Döhner H, Kusec Leukemia. 2006 Nov;20(11):2067 R, Hasselbalch HC, Larsen TS, Pallisgaard N, Giraudier S, Le Bousse-Kerdilès MC, Desterke C, Guerton B, Dupriez B, Wernig G, Mercher T, Okabe R, Levine RL, Lee BH, Gilliland Bordessoule D, Fenaux P, Kiladjian JJ, Viallard JF, Brière J, DG. Expression of Jak2V617F causes a polycythemia vera-like Harrison CN, Green AR, Reilly JT. V617F mutation in JAK2 is disease with associated myelofibrosis in a murine bone associated with poorer survival in idiopathic myelofibrosis. marrow transplant model. Blood. 2006 Jun 1;107(11):4274-81 Blood. 2006 Mar 1;107(5):2098-100 Barosi G, Bergamaschi G, Marchetti M, Vannucchi AM, Funakoshi-Tago M, Pelletier S, Matsuda T, Parganas E, Ihle Guglielmelli P, Antonioli E, Massa M, Rosti V, Campanelli R, JN. Receptor specific downregulation of cytokine signaling by Villani L, Viarengo G, Gattoni E, Gerli G, Specchia G, Tinelli C, autophosphorylation in the FERM domain of Jak2. EMBO J. Rambaldi A, Barbui T. JAK2 V617F mutational status predicts 2006 Oct 18;25(20):4763-72 progression to large splenomegaly and leukemic transformation in primary myelofibrosis. Blood. 2007 Dec Grünebach F, Bross-Bach U, Kanz L, Brossart P. Detection of 1;110(12):4030-6 a new JAK2 D620E mutation in addition to V617F in a patient with polycythemia vera. Leukemia. 2006 Dec;20(12):2210-1 Ihle JN, Gilliland DG. Jak2: normal function and role in hematopoietic disorders. Curr Opin Genet Dev. 2007 Ishii T, Bruno E, Hoffman R, Xu M. Involvement of various Feb;17(1):8-14 hematopoietic-cell lineages by the JAK2V617F mutation in polycythemia vera. Blood. 2006 Nov 1;108(9):3128-34 Kittur J, Knudson RA, Lasho TL, Finke CM, Gangat N, Wolanskyj AP, Li CY, Wu W, Ketterling RP, Pardanani A, Jamieson CH, Gotlib J, Durocher JA, Chao MP, Mariappan Tefferi A. Clinical correlates of JAK2V617F allele burden in MR, Lay M, Jones C, Zehnder JL, Lilleberg SL, Weissman IL. essential thrombocythemia. Cancer. 2007 Jun 1;109(11):2279- The JAK2 V617F mutation occurs in hematopoietic stem cells 84 in polycythemia vera and predisposes toward erythroid differentiation. Proc Natl Acad Sci U S A. 2006 Apr Mertens C, Darnell JE Jr. SnapShot: JAK-STAT signaling. Cell. 18;103(16):6224-9 2007 Nov 2;131(3):612 Lacout C, Pisani DF, Tulliez M, Gachelin FM, Vainchenker W, Pardanani A, Hood J, Lasho T, Levine RL, Martin MB, Noronha Villeval JL. JAK2V617F expression in murine hematopoietic G, Finke C, Mak CC, Mesa R, Zhu H, Soll R, Gilliland DG, cells leads to MPD mimicking human PV with secondary Tefferi A. TG101209, a small molecule JAK2-selective kinase myelofibrosis. Blood. 2006 Sep 1;108(5):1652-60 inhibitor potently inhibits myeloproliferative disorder-associated JAK2V617F and MPLW515L/K mutations. Leukemia. 2007 Pardanani A, Lasho T, McClure R, Lacy M, Tefferi A. Aug;21(8):1658-68 Discordant distribution of JAK2V617F mutation in siblings with familial myeloproliferative disorders. Blood. 2006 Jun Percy MJ, Scott LM, Erber WN, Harrison CN, Reilly JT, Jones 1;107(11):4572-3 FG, Green AR, McMullin MF. The frequency of JAK2 exon 12 mutations in idiopathic erythrocytosis patients with low serum Pardanani AD, Levine RL, Lasho T, Pikman Y, Mesa RA, erythropoietin levels. Haematologica. 2007 Dec;92(12):1607- Wadleigh M, Steensma DP, Elliott MA, Wolanskyj AP, Hogan 14 WJ, McClure RF, Litzow MR, Gilliland DG, Tefferi A. MPL515 mutations in myeloproliferative and other myeloid disorders: a Schindler C, Levy DE, Decker T. JAK-STAT signaling: from study of 1182 patients. Blood. 2006 Nov 15;108(10):3472-6 interferons to cytokines. J Biol Chem. 2007 Jul 13;282(28):20059-63 Pikman Y, Lee BH, Mercher T, McDowell E, Ebert BL, Gozo M, Cuker A, Wernig G, Moore S, Galinsky I, DeAngelo DJ, Clark Scott LM, Beer PA, Bench AJ, Erber WN, Green AR. JJ, Lee SJ, Golub TR, Wadleigh M, Gilliland DG, Levine RL. Prevalance of JAK2 V617F and exon 12 mutations in MPLW515L is a novel somatic activating mutation in polycythaemia vera. Br J Haematol. 2007 Nov;139(3):511-2 myelofibrosis with myeloid metaplasia. PLoS Med. 2006 Scott LM, Tong W, Levine RL, Scott MA, Beer PA, Stratton Jul;3(7):e270 MR, Futreal PA, Erber WN, McMullin MF, Harrison CN, Warren Renneville A, Quesnel B, Charpentier A, Terriou L, Crinquette AJ, Gilliland DG, Lodish HF, Green AR. JAK2 exon 12 A, Laï JL, Cossement C, Lionne-Huyghe P, Rose C, Bauters F, mutations in polycythemia vera and idiopathic erythrocytosis. N Preudhomme C. High occurrence of JAK2 V617 mutation in Engl J Med. 2007 Feb 1;356(5):459-68 refractory anemia with ringed sideroblasts associated with Tefferi A, Strand JJ, Lasho TL, Knudson RA, Finke CM, marked thrombocytosis. Leukemia. 2006 Nov;20(11):2067-70 Gangat N, Pardanani A, Hanson CA, Ketterling RP. Bone

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 616 JAK2 mutations in myeloproliferative neoplasms Gangat N, Tefferi A

marrow JAK2V617F allele burden and clinical correlates in Butcher CM, Hahn U, To LB, Gecz J, Wilkins EJ, Scott HS, polycythemia vera. Leukemia. 2007 Sep;21(9):2074-5 Bardy PG, D'Andrea RJ. Two novel JAK2 exon 12 mutations in JAK2V617F-negative polycythaemia vera patients. Leukemia. Theocharides A, Boissinot M, Girodon F, Garand R, Teo SS, 2008 Apr;22(4):870-3 Lippert E, Talmant P, Tichelli A, Hermouet S, Skoda RC. Leukemic blasts in transformed JAK2-V617F-positive Lasho TL, Tefferi A, Hood JD, Verstovsek S, Gilliland DG, myeloproliferative disorders are frequently negative for the Pardanani A. TG101348, a JAK2-selective antagonist, inhibits JAK2-V617F mutation. Blood. 2007 Jul 1;110(1):375-9 primary hematopoietic cells derived from myeloproliferative disorder patients with JAK2V617F, MPLW515K or JAK2 exon Vannucchi AM, Antonioli E, Guglielmelli P, Longo G, Pancrazzi 12 mutations as well as mutation negative patients. Leukemia. A, Ponziani V, Bogani C, Ferrini PR, Rambaldi A, Guerini V, 2008 Sep;22(9):1790-2 Bosi A, Barbui T. Prospective identification of high-risk polycythemia vera patients based on JAK2(V617F) allele Pardanani A. JAK2 inhibitor therapy in myeloproliferative burden. Leukemia. 2007 Sep;21(9):1952-9 disorders: rationale, preclinical studies and ongoing clinical trials. Leukemia. 2008 Jan;22(1):23-30 Vannucchi AM, Antonioli E, Guglielmelli P, Rambaldi A, Barosi G, Marchioli R, Marfisi RM, Finazzi G, Guerini V, Fabris F, Pietra D, Li S, Brisci A, Passamonti F, Rumi E, Theocharides Randi ML, De Stefano V, Caberlon S, Tafuri A, Ruggeri M, A, Ferrari M, Gisslinger H, Kralovics R, Cremonesi L, Skoda R, Specchia G, Liso V, Rossi E, Pogliani E, Gugliotta L, Bosi A, Cazzola M. Somatic mutations of JAK2 exon 12 in patients Barbui T. Clinical profile of homozygous JAK2 617V>F with JAK2 (V617F)-negative myeloproliferative disorders. mutation in patients with polycythemia vera or essential Blood. 2008 Feb 1;111(3):1686-9 thrombocythemia. Blood. 2007 Aug 1;110(3):840-6 Tefferi A, Lasho TL, Huang J, Finke C, Mesa RA, Li CY, Wu Verstovsek S, Kantarjian H. Pardanani A.. INCB018424, an W, Hanson CA, Pardanani A. Low JAK2V617F allele burden in oral, selective JAK2 inhibitor, shows significant clinical activity primary myelofibrosis, compared to either a higher allele in a phase I/II study in patients with primary myelofibrosis burden or unmutated status, is associated with inferior overall (PMF) and post polycythemia vera/essential thrombocythemia and leukemia-free survival. Leukemia. 2008 Apr;22(4):756-61 myelofibrosis (Post-PV/ET MF). Blood. 2007a;110(11):558. Tiedt R, Hao-Shen H, Sobas MA, Looser R, Dirnhofer S, Verstovsek S, Pardanani A.D, Shah NP. A phase I study of Schwaller J, Skoda RC. Ratio of mutant JAK2-V617F to wild- XL019, a selective JAK2 inhibitor, in patients with primary type Jak2 determines the MPD phenotypes in transgenic mice. myelofibrosis and post-polycythemia vera/essential Blood. 2008 Apr 15;111(8):3931-40 thrombocythemia myelofibrosis. Blood. 2007b;110(11):553. This article should be referenced as such: Wong CL, Ma ES, Wang CL, Lam HY, Ma SY. JAK2 V617F due to a novel TG --> CT mutation at nucleotides 1848-1849: Gangat N, Tefferi A. JAK2 mutations in myeloproliferative diagnostic implication. Leukemia. 2007 Jun;21(6):1344-6 neoplasms. Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8):612-617. Zhang SJ, Li JY, Li WD, Song JH, Xu W, Qiu HX. The investigation of JAK2 mutation in Chinese myeloproliferative diseases-identification of a novel C616Y point mutation in a PV patient. Int J Lab Hematol. 2007 Feb;29(1):71-2

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 617 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Case Report Section Paper co-edited with the European LeukemiaNet

A Case of Myelodysplastic Syndrome with a Translocation t(1;12)(p36;p13) Ulrike Bacher, Torsten Haferlach, Claudia Haferlach Interdisciplinary Clinic for Stem Cell Transplantation, University of Hamburg, Martinistr. 52, 20246 Germany (UB), MLL, Munich Leukemia Laboratory, Max-Lebsche-Platz 31, 81377 Munich, Germany (TH, CH)

Published in Atlas Database: August 2008 Online updated version : http://AtlasGeneticsOncology.org/Reports/0112BacherID100040.html DOI: 10.4267/2042/44549 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Clinics strategy (peripheral stem cell transplantation; PBSCT) after a dose reduced conditioning regimen (fludarabine, Age and sex amsacrine, cytarabine, busulfane) in combination with 46 years old male patient. thymoglobuline. Previous history Complete remission: no No preleukemia. No previous malignancy. No inborn Treatment related death: yes (transplant associated condition of note. mortality, TRM) (day +15 after allogeneic Organomegaly transplantation). (Cause of death: severe hemolysis No hepatomegaly, no splenomegaly, no enlarged lymph after ABO minor mismatched allo-transplantation; nodes, no central nervous system involvement. suspicion of thrombotic thrombocytopenic purpura (TTP) in association to cyclosporine A for Blood immunosuppression; intestinal bleeding of unclear origin). 9 WBC: 1.9X 10 /l Relapse: not applicable due to early death after HB: 10.4g/dl transplantation. 9 Platelets: 42X 10 /l Status: Dead. Bone marrow: Hypercellular, trilineage dysplasia, Survival: 3 months from diagnosis of MDS. blasts <5% Karyotype Cyto-Pathology Sample: Bone marrow Classification Culture time: 24, 48 hours Diagnosis Banding: Giemsa Myelodysplastic syndrome - subtype refractory anemia Results: 46,XY,t(1;12)(p36;p13) [9]; 46,XY [11] cytopenia with multilineage dysplasia (MDS - RCMD) Other molecular cytogenetics technics: according to the WHO classification. See figure below: Fluorescence in situ hybridization Survival with probes flanking the breakpoints within the ETV6 gene demonstrating an ETV6 rearrangement (left) and Date of diagnosis: 03-2008 in a second hybridization with whole chromosome Treatment: Allogeneic stem cell transplantation from painting probes for chromosome 1 (red) and an HLA-mismatched unrelated donor as first-line chromosome 12 (green) on the same metaphase.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 618 A Case of Myelodysplastic Syndrome with a Translocation t(1;12)(p36;p13) Bacher U, et al.

Other molecular cytogenetics results: transplantation unfortunately followed by severe No evidence of the FLT3-ITD/LM (internal tandem complications with hemolysis and intestinal bleeding duplication/length mutation), NRAS-mutation, or resulting in early transplant-associated mortality. MLL-PTD (partial tandem duplication) by polymerase So far, the prognostic impact of the chain reaction (PCR) analyses. t(1;12)(p36;p13)/ETV6-TEL cannot be determined. As the respective translocation is difficult to detect in chromosome banding analyses, the true frequency might be higher than actually thought. Call for Collaborations PD Dr. med. Claudia Haferlach MLL, Munich Leukemia Laboratory, Max-Lebsche- Platz 31, 81377 Munich, Germany [email protected] References Vassallo J, Altemani AM, Cardinalli IA, Crespo AN, Lima CS, Eid KA, Souza CA. Granulocytic sarcoma of the larynx Comments preceding chronic myeloid leukemia. Pathol Res Pract. 1993 Nov;189(9):1084-6; discussion 1086-9 Two our knowledge so far two cases with a Odero MD, Vizmanos JL, Román JP, Lahortiga I, Panizo C, t(1;12)(p36;p13) were described in the literature. The Calasanz MJ, Zeleznik-Le NJ, Rowley JD, Novo FJ. A novel first reported case suffered from chronic myeloid gene, MDS2, is fused to ETV6/TEL in a t(1;12)(p36.1;p13) in a leukemia (CML) (Vassallo et al., 1993). The second patient with myelodysplastic syndrome. Genes Chromosomes patient, a 66-old female, showed MDS in Cancer. 2002 Sep;35(1):11-9 transformation (RAEB-T) and rapidly proceeded to This article should be referenced as such: secondary acute myeloid leukemia (AML) (Oedro et Bacher U, Haferlach T, Haferlach C. A Case of al., 2002). The here reported case - a 46 year old male - Myelodysplastic Syndrome with a Translocation had MDS in an initial stage (RCMD). Treatment was t(1;12)(p36;p13). Atlas Genet Cytogenet Oncol Haematol. performed by upfront allogeneic stem cell 2009; 13(8):618-619.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 619 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Case Report Section Paper co-edited with the European LeukemiaNet

Translocation t(5;17)(q13;q21) as the sole cytogenetic anomaly in acute myeloid leukemia after chemotherapy and allogeneic bone marrow transplantation for AML-M4: a case report Elvira D Rodrigues Pereira Velloso, Cristina A Ratis, Edi Cabral, Denize Gonsalez, Nydia S Bacal, Cristóvão LP Mangueira Clinical Laboratory, Hospital Israelita Albert Einstein, Sao Paulo, Brazil (EDRPV, CAR, NSB, CLPM); Hospital Santa Cruz, Sao Paulo, Brazil (ED, DG)

Published in Atlas Database: August 2008 Online updated version : http://AtlasGeneticsOncology.org/Reports/0517RodriguesID100039.html DOI: 10.4267/2042/44550 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Clinics Cyto-Pathology Age and sex Classification 40 years old female patient. Previous history Cytology: AML-M4 No preleukemia. Previous malignancy AML in April, Immunophenotype: Blast cells positivity for: CD34, 2005, characterized as AML-M4 (FAB classification), HLA-DR, CD117, cMPO, CD33, CD13, CD4, CD15, BM cytogenetics with no clonal anomaly (46,XX[12]), CD64 and CD71. immunophenotyping of blast cells showed positivity Rearranged Ig Tcr: Not done. for CD34, HLA-DR,CD117, cMPO, CD33, CD13, Pathology: Not done. CD4, CD15, CD64 and CD71. The patient was treated with Idarubicin for 3 days, and Ara-C for 7 days, with Electron microscopy: Not done. complete remission. Consolidation chemotherapy with Diagnosis: AML-M4 in first relapse after allogeneic HDARA-C was done. In September, 2005 a full- BMT. matched related bone marrow transplantation was performed, from her brother. Karyotypes performed in Survival April and September, 2006 and September, 2007 Date of diagnosis: 01-2008 showed a complete chimerism (//46,XY[20]). No inborn condition of note. Treatment: Idarubicin + ARA-C (I3A7) Organomegaly Complete remission: no No hepatomegaly, no splenomegaly, no enlarged lymph Treatment related death: + nodes, no central nervous system involvement. Relapse: - Blood Status: Dead. Last follow up: 02-2008 Survival: 1,5 months. WBC: 312X 10 9/l HB: 8,7g/dl Karyotype 9 Platelets: 27X 10 /l Sample: Bone Marrow Blasts: 98% Bone marrow: 90% myeloid/monocytic blast cells%

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 620 Translocation t(5;17)(q13;q21) as the sole cytogenetic anomaly in acute myeloid leukemia Rodrigues Pereira Velloso ED, et al. after chemotherapy and allogeneic bone marrow transplantation for AML-M4: a case report

Culture time: 24 and 48- hours without stimulating and chromosome 10 monosomy in a disease classified agents. as T-ALL. Immunophenotyping of the blast cells Banding: G- band showed positivity for CD34, lymphoid (TdT, CD2, CD3, CD5, CD7) and myeloid (CD117, CD13, CD33) Results: 46,XX, (5;17)(q13;q21)[20]// antigens. Using the scoring system proposed by the Karyotype at Relapse: Not applied. European Group for the Immunologic classification of Other molecular cytogenetics technics: Not done. Leukemia (EGIL classification) this disease is now classified as biphenotypic leukemia (BAL). Other Molecular Studies The present case was the first that described the t(5;17) as a sole cytogenetic anomaly in AML. Unfortunately Technics: Not done. we could not review the first karyotype to see if there was a small clone with translocation, but the finding of the same phenotype at diagnosis and relapse suggests that this could be a primary event in this leukemia. More than this, this could be a very interesting rearrangement to study, as it was found in T-ALL, BAL and AML. References Bene MC, Castoldi G, Knapp W, Ludwig WD, Matutes E, Orfao A, van't Veer MB. Proposals for the immunological classification of acute leukemias. European Group for the Immunological Characterization of Leukemias (EGIL). Leukemia. 1995 Oct;9(10):1783-6

Schoch C, Rieder H, Stollmann-Gibbels B, Freund M, Tischler t(5;17)(q13;q21) (G- banding). HJ, Silling-Engelhardt G, Fonatsch C. 17p anomalies in lymphoid malignancies: diagnostic and prognostic implications. Comments Leuk Lymphoma. 1995 Apr;17(3-4):271-9 Zamora L, Espinet B, Solé F, Salido M, Rodon N, Florensa L, To our knowledge, this is the third reported case of Woessner S. Translocation (5;17)(q13;q21) in a case with t(5;17)(q13;q21) in acute leukemia and the first precursor T-lymphoblastic lymphoma/leukemia. Cancer Genet described with this translocation as the sole cytogenetic Cytogenet. 2002 Jan 1;132(1):81-2 anomaly. This article should be referenced as such: The first case was described by Schoch in 1995, in a review concerning 17p anomalies in lymphoid Rodrigues Pereira Velloso ED, Ratis CA, Cabral E, Gonsalez malignancies. A complex karyotype including D, Bacal NS, Mangueira CLP. Translocation t(5;17)(q13;q21) as the sole cytogenetic anomaly in acute myeloid leukemia der(5)t(5;17)(q1:3;q21) was observed in a pre T-ALL, after chemotherapy and allogeneic bone marrow emerging from a T-cell NHL. transplantation for AML-M4: a case report. Atlas Genet Zamora et al described in 2002, a case with this t(5;17) Cytogenet Oncol Haematol. 2009; 13(8):620-621.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 621 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Instructions to Authors Manuscripts submitted to the Atlas must be submitted solely to the Atlas. Iconography is most welcome: there is no space restriction. The Atlas publishes "cards", "deep insights", "case reports", and "educational items". Cards are structured review articles. Detailed instructions for these structured reviews can be found at: http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes, http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias, http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours, http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases. According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews" (between), and "short communications" (texts below 400 words). The latter category may not be accepted for indexing by bibliographic databases. Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length restriction. Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in at least 1 case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings, and 4- with iconography of chromosomes. It is mandatory to use the specific "Submission form for Case reports": see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html. Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French, German, Italian, and Spanish are welcome.

Subscription : The Atlas is FREE!

Corporate patronage, sponsorship and advertising Enquiries should be addressed to [email protected].

Rules, Copyright Notice and Disclaimer Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to editors any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members must disclose any potential conflict. Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If complete anonymity is difficult to achieve, informed consent should be obtained. Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may, nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further the content of their papers published in the Atlas, provided that the source is cited. Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general distribution. All rights are reserved. The information presented is protected under international conventions and under national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty, express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose, and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein. See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical Publication - Updated October 2004": http://www.icmje.org.

http://AtlasGeneticsOncology.org

A Case of Myelodysplastic Syndrome with a Translocation t(1;12)(p36;p13) Bacher U, et al.

Atlas Genet Cytogenet Oncol Haematol. 2009; 13(8) 623