The Regulation and Function of BMPs in Osteoclastogenesis

A Dissertation

SUBMITTED TO THE FACULTY OF THE UNIVERSITY OF MINNESOTA

BY

Raphael Edward Huntley

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

Raj Gopalakrishnan DMD, PhD, Adviser Kim Mansky PhD, Co Adviser

June 2019

Raphael Huntley 2019 ã

Acknowledgements

Thank you to my committee members, Dr. Rajaram Gopalakrishnan, Dr. Kim Mansky, Dr. Paul Jardine, and Dr. Michael O’Connor. Without your input, guidance, and dedication this thesis would not be possible.

Thank you to Dr. Mark Herzberg and Ann Hagen, whose efforts have created and sustained the MinnCReST training program, which provided me financial and developmental support as well as career guidance and training.

i

Dedication

To my parents, who tried their best to raise me like a mensch. It almost worked.

To my loving wife, who may be the only person to read it cover to cover.

To my siblings, who have always referred to me as ‘genius boy, Rafi’.

To my dog; he really is a good boy.

ii

Table of Contents:

Acknowledgements ...... i Dedication ...... ii Table of Contents: ...... iii Table to Figures: ...... vi Chapter 1 ...... 1 Introduction, Statement of Purpose, and Specific Aims ...... 1 1.1 Introduction ...... 2 1.1.1 Clinical use and clinical complications of BMPs ...... 3 1.1.2 Osteoclast Biology...... 3 1.1.3 BMP Structure and Function ...... 6 1.1.4 BMP Ligands expression in osteoclasts ...... 8 1.1.4.1 BMP1 ...... 8 1.1.4.2 BMP2 ...... 8 1.1.4.3 BMP3 ...... 10 1.1.4.4 BMP4 ...... 10 1.1.4.5 BMP5 ...... 11 1.1.4.6 BMP6 ...... 11 1.1.4.7 BMP7 ...... 12 1.1.4.8 BMP8 ...... 12 1.1.4.9 BMP9 ...... 12 1.1.5 BMP Inhibitors ...... 13 1.1.6 BMP Receptors ...... 14 1.1.6.1 BMPR2 ...... 14 1.1.6.2 BMPR1A ...... 14 1.1.6.3 BMPR1B ...... 15 1.1.7 BMP Signaling ...... 15 iii

1.1.7.1 Noncanonical Signaling ...... 15 1.1.7.2 Canonical Signaling ...... 16 1.1.8 Conclusions ...... 18 1.2 Statement of Purpose ...... 18 1.2.1 Significance of Research ...... 18 1.2. Hypothesis ...... 19 1.3 Specific Aims ...... 19 1.3.1 Determine the functional significance of glycosylated amino acids in Twisted Gastrulation regulation of osteoclast differentiation ...... 19 1.3.2 Determine if Twisted gastrulation null osteoclasts are hypersensitive to M-CSF and RANKL signaling ...... 20 1.3.3 Characterize the skeletal phenotype of a mouse model null for Bmp2 in myeloid cells ...... 20 Chapter 2 ...... 22 The Function of Twisted Gastrulation in Regulating Osteoclast Differentiation is Dependent on BMP Binding ...... 22 2.1 Introduction ...... 23 2.2 Material and Methods ...... 25 2.2.1 Mice ...... 25 2.2.2 Harvesting of Bone Marrow and Generation of Osteoclast Cells ...... 25 2.2.3 Osteoclast Transduction ...... 26 2.2.4 RNA Isolation and Quantitative RT-PCR ...... 26 2.2.5 Immunoblotting ...... 27 2.2.6 TRAP Stain ...... 28 2.2.7 Quantitating Nuclei ...... 28 2.2.8 Resorption Assays ...... 28 2.2.9 Statistics ...... 29 2.3 Results ...... 29 2.3.1 Engineering and Expression of TWSG1 constructs in OCLs...... 29 2.3.2 Loss of TWSG1 binding to BMPs results in larger OCLs ...... 30 2.3.3 TWSG1 mutants have increased resorptive activity ...... 32 2.3.4 Effect of W66 and N80Q/N146Q on OCLs is mediated through modulation of BMP signaling ...... 33 2.3.5 TWSG1 mutants have increased expression of key OCL genes ...... 36 2.3.6 TWSG1 mutants do not act in a dominant negative manner ...... 38 2.4 Discussion...... 39 Chapter 3 ...... 42 Twisted Gastrulation1 Null Osteoclasts Are Hypersensitive to RANKL...... 42 3.1 Introduction ...... 43

iv

3.2 Materials and Methods ...... 44 3.2.1 Primary Osteoclasts Cell Culture...... 44 3.2.2 M-CSF and RANKL Hypersensitivity Osteoclast Cell Culture...... 45 3.2.3 Tartrate Resistant Acid Phosphatase (TRAP) Staining...... 45 3.2.4 RNA Isolation and Real-Time PCR ...... 46 3.3 Results ...... 48 3.3.1 Twsg1-/- are not hypersensitive to M-CSF ...... 48 3.3.2 Twsg1-/- osteoclasts are hypersensitive to RANKL ...... 49 3.3.3 Twsg1-/- osteoclasts have increased Rank expression ...... 50 3.3.4 Expression levels of BMP receptors and ligands in Twsg1-/-osteoclasts ...... 51 3.4 Discussion...... 52 Chapter Four ...... 55 Mice with Osteoclasts Lacking BMP2 Expression Are Osteopenic ...... 55 4.1 Introduction ...... 56 4.2 Materials and Methods ...... 57 4.2.1 Breeding of Bmp2fl/fl;LysM-Cre...... 57 4.2.2 Primary Osteoclasts Cell Culture...... 57 4.2.3 Micro Computed Tomography and Bone Morphometric Analysis ...... 58 4.2.4 BMP2 ELISA ...... 59 4.2.5 ELISA of Bone Biomarkers ...... 59 4.2.6 Tartrate Resistant Acid Phosphatase (TRAP) Staining...... 59 4.2.7 RNA Isolation and Real-Time PCR ...... 60 4.2.8 Demineralization Assay...... 61 4.2.9 Western Blot ...... 61 4.2.10 Statistical Analysis ...... 62 4.3 Results ...... 62 4.3.1 BMP2 expression during osteoclast differentiation ...... 62 4.3.2 Bmp2fl/fl;LysM-Cre mice are osteopenic ...... 63 4.3.3 Osteoclasts Null for BMP2 expression are smaller than WT ...... 64 4.3.4 BMP2cKO osteoclasts express increased Nfatc1 ...... 66 4.3.5 BMP2cKO osteoclasts are increased in demineralization ...... 69 4.3.6 Bmp2fl/fl;LysM-Cre mice and bone formation ...... 70 4.3.7 Osteoclasts null for BMP2 express changes in canonical but not noncanonical BMP signaling ...... 72 4.4 Discussion...... 73 Chapter 5 ...... 76 Summary, Conclusions and Future Directions ...... 76 Literature Cited ...... 81

v

Table to Figures:

FIGURE 1. DIAGRAM REPRESENTS THE EVOLUTIONARY DIVERGENCE OF THE BMP FAMILY...... 2 FIGURE 2. OSTEOCLAST DIFFERENTIATION...... 5 FIGURE 3. DIAGRAM OF BMP SIGNALING ...... 7 FIGURE 4. DIAGRAM OF TWSG1 PROTEIN AND EXPRESSION OF TWSG1 MUTANTS ...... 30 FIGURE 5. EXPRESSION OF TWSG1 MUTANTS ENHANCES OSTEOCLAST DIFFERENTIATION AND SIZE ...... 31 FIGURE 6. TWSG1 MUTANT EXPRESSION INCREASES OSTEOCLAST RESORPTIVE ACTIVITY ...... 33 FIGURE 7. INCREASED P-SMAD1/5/8 ACTIVATION IN OSTEOCLASTS EXPRESSING TWSG1 MUTANTS ...... 35 FIGURE 8. TWSG1 MUTANT EXPRESSION INCREASES OSTEOCLAST SPECIFIC GENE EXPRESSION...... 37 FIGURE 9. WT-TWSG1 AND MUTANT CONSTRUCT OVEREXPRESSION IN TWSG1-/- OCL...... 39 FIGURE 10. TWSG1 NULL OSTEOCLASTS ARE NOT ENHANCED IN SIZE WITH INCREASING M-CSF ...... 48 FIGURE 11. TWSG1 NULL OSTEOCLASTS ARE MORE REACTIVE TO RANKL THAN WILD TYPE OSTEOCLASTS ...... 50 FIGURE 12. OSTEOCLASTS FROM TWSG1 NULL MICE HAVE INCREASED RANK EXPRESSION ...... 50 FIGURE 13. BMP RECEPTORS AND LIGANDS ARE UNCHANGED IN TWSG1 NULL OSTEOCLASTS ...... 52 FIGURE 14. MICE NULL FOR BMP2 IN MYELOID CELLS ARE OSTEOPENIC ...... 64 FIGURE 15. OSTEOCLASTS NULL FOR BMP2 EXPRESSION ARE SMALLER BUT MORE NUMEROUS THAN WILD TYPE ...... 65 FIGURE 16. EXPRESSION OF C-FMS AND RANK IN WT AND BMP2CKO OSTEOCLASTS...... 66 FIGURE 17. EXPRESSION OF BMP RECEPTORS BY BMP2CKO AND WT OSTEOCLASTS ...... 67 FIGURE 18. EXPRESSION OF BMP4 AND 6 IN BMP2CKO AND WT OSTEOCLASTS ...... 68 FIGURE 19. BMP2CKO OSTEOCLASTS EXPRESS AN INCREASE IN NFATC1 ...... 69 FIGURE 20. IN VITRO AND IN VIVO RESORPTION ACTIVITY OF BMP2CKO OSTEOCLASTS...... 70 FIGURE 21. BONE FORMATION MARKERS AND MEASUREMENTS ...... 71 FIGURE 22. BMP2CKO HAVE DECREASED PSMAD1/5 SIGNALING ...... 72

vi

Chapter 1

Introduction, Statement of Purpose, and Specific Aims

1

1.1 Introduction In 1889, Senn inadvertently found that bone rudiments initiate bone formation (1).

However, it appears that, Senn had been beaten by about 300 years as the Dutch surgeon, Job van Meekeren recorded the use of dog bone to repair a human cranial defect in 1668 (2). More recently, the work of Urist in 1965 as well as others is largely credited for the discovery that a specific component of bone, which he called BMP or bone morphogenetic protein, could induce ectopic bone formation (3, 4). His work implanting decalcified bone in muscle pouches led him to prove the osteoinductive properties of BMPs, and hence the derivation of the name. It is now known that not all

BMP ligands can induce ectopic bone formation, and various highly homologous BMPs have varying effects on osteogenesis (Fig. 1). Some BMPs, such as BMP 3, inhibit bone formation (5), while others, termed osteogenic BMPs (BMPs 2, 4, 5, 6, 7, and 9), are able to induce ectopic bone (6).

Figure 1. Diagram represents the evolutionary divergence of the BMP family. Sequence homology percentage for Mus musculus based off of NCBI Blast data. Figure adapted from (7) .

2

1.1.1 Clinical use and clinical complications of BMPs In 1988 the first sequences of human BMP ligands were published, with sequences of other BMP ligands following soon after, leading to the first clinical use of recombinant

BMPs (8, 9) . In 2002 both recombinant human BMP-2 (rhBMP2) and recombinant human BMP-7 (rhBMP7) were approved by the FDA for vertebrae fusion in the lower spine (10-12). By 2006 rhBMPs were used in 25 percent of all fusion procedures in the

United States and 40 percent of lumbar fusions (13). Clinically BMPs were used to increase bone fusion at the site of implant, having an additional benefit of reducing the need for an autologous graft thereby reducing morbidity (14-16). However, the use of

BMP is associated with a 50% higher complication rate, and increased length of hospital stay (13). Additionally, studies show that the use of rhBMP2 in spinal fusion using polyetheretherketone (PEEK) cages increases resorption and cage movement (17).

These effects could be due to the stimulation of BMP2 on osteoclast differentiation and activity in addition to their osteogenic effects through osteoblasts. It appears that to date, most of the research has focused on the effect of BMPs on osteoblasts and bone deposition rather than osteoclasts. In this review we focus on some of the in vitro and in vivo results available from our lab and others on the regulation of osteoclasts by BMPs.

1.1.2 Osteoclast Biology The bone is comprised of multiple cell types, including osteoblasts, mesenchymal- derived cells responsible for synthesizing bone and bone degrading osteoclasts, which arise from hematopoietic derived stem cells (18). Bone homeostasis and normal function result from the proper balance of osteoblasts and osteoclasts. To maintain this balance

3

in the adult skeleton, osteoblasts and/or osteocytes produce the cytokines macrophage colony stimulating factor (M-CSF) and receptor activator of NF-κB ligand (RANKL), factors required to promote osteoclast differentiation (19).

Osteoclasts are derived from the monocyte lineage. The transcription factor PU.1 and inducing expression of c-FMS, the receptor for the cytokine M-CSF, is necessary for commitment to the monocyte/macrophage lineage (20). RANKL stimulation induces expression of the master regulator of osteoclast differentiation, NFATc1, through both c-

FOS and NF-kB pathways (21-23). M-CSF stimulation has been shown to promote osteoclast precursor proliferation while RANKL stimulation stimulates osteoclast precursors to exit the cell cycle and terminally differentiate (24).

As part of terminal differentiation, osteoclast precursors undergo fusion to become multinuclear cells. In recent years, proteins necessary for osteoclast differentiation have been identified in mouse models. One such protein is DC-STAMP or the “master fusigen” and the related protein OC-STAMP (25, 26). Recent work by Verma et al. suggests that one role of DC-STAMP in the fusion process is the exposure of phosphatidylserines on the surface of osteoclasts, and this exposure of phosphatidylserines regulates the activity of several proteins including annexins,

S100A4 and syncytin1 (27) . In osteoclasts null for v-ATPaseV0 subunit d2 another protein that has been demonstrated to be necessary for osteoclast fusion, there is also decreased expression of ADAM 8 and 12 (28). ADAMs cleave extracellular regions of transmembrane proteins and are involved in cell-cell and cell-matrix adhesion providing a possible mechanism by which v-ATPaseV0 subunit d2 regulates fusion (28).

4

Multinuclear osteoclasts attach to the bone surface to begin the process of bone resorption. Osteoclasts express the integrin avb3 which recognize the arginine-glycine- aspartic acid (RGD) pepetide expressed in bone matrix proteins (29). Osteoclasts attach tightly to the bone surface by rearrangement of their cytoskeletal proteins to form a sealing zone. Both through integrins and Src, a RANKL activated kinase, the cytoskeleton is rearranged to allow for fusion (18, 29, 30). Into the sealing zone osteoclasts secrete proteases such as cathepsin K as well as H+ and Cl- (31). During bone resorption by the osteoclast, growth factors embedded in the bone matrix are released and help stimulate the differentiation of osteoblasts and a corresponding

increase in

RANKL

production

(32).

Figure 2. Osteoclast Differentiation. Drawing depicts osteoclast differentiation and proteins involved in fusion and activity.

5

1.1.3 BMP Structure and Function BMPs are a large family of growth factors that regulate development, as well as normal physiological maintenance of several organs (33-35). The BMP family resides within the larger TGF-β super-family, which is defined by its ability to bind to serine/threonine cell surface receptors. In other cell types BMPs have been shown to initiate chemotaxis, cell growth, differentiation, and apoptosis; however, in osteoclasts BMPs have been shown to enhance differentiation, activity, and inhibit apoptosis (35-39). BMPs usually function by short-range diffusion, although they can create a gradient by binding to extracellular

BMP binding proteins such as noggin, chordin, gremlin, and twisted gastrulation. The subfamily of BMPs is large with 30 known ligands and counting, and they comprise one third of the known TGF-β superfamily ligands (33, 35, 40).

BMP ligands are produced as precursor proteins that are dimerized in the cytoplasm before being cleaved and secreted in their mature form. They function by binding to BMP receptors, which induces formation of a heterotetrameric receptor unit consisting of two type 1 receptors and two type 2 receptors (35, 41). Both type 1 and type 2 receptors are single pass transmembrane proteins with an extracellular domain and a cytoplasmic domain with serine/threonine kinase function (41). There are three type 1 receptors capable of binding to BMP ligands (BMPR-1A, BMPR-1B, ActR-1A); and three type 2 receptors also with the ability to bind to BMP ligands (BMPR-2, ActR-2A, ActR-2B (41).

BMP ligand-receptor complex affinity vary by both ligand and receptor type (42). BMPs can also bind to a preformed receptor complex; in this case constitutively active BMPR-2 is already linked to BMPR-1 for BMP binding. BMPR-2 phosphorylates BMPR-1 which in turn leads to activation of SMAD 1/5/8 pathway. SMAD 1/5/8 is known as the canonical BMP signaling pathway (reviewed in (41) Figure 3A). A second mechanism

6

for BMP ligands to activate BMP signaling is when BMP receptors are not dimerized but binding of BMP ligand to BMPR-1A recruits BMPR-2 into a complex, which is internalized via caveolae (41). This signaling complex has been shown to initiate non-

SMAD pathways or non-canonical signaling pathways such as MAPK signaling (41),

Figure 3B).

Figure 3. Diagram of BMP Signaling

(A) Image depicts preformed BMP receptor complex that activates canonical

(SMAD1/5/8) signaling upon BMP ligand. (B) Image depicts binding of BMPR2 (black) to and phosphorylation of BMPR1A or 1B upon BMP ligand binding. It has been proposed that this type of complex activates the SMAD independent or noncanonical signaling by BMPs.

7

1.1.4 BMP Ligands expression in osteoclasts As referenced in the preceding paragraphs, the history of BMPs in osteoblast biology is long and rich; however, it has become evident in more recent years that BMPs have direct effects on osteoclast differentiation. Further elucidation on the mechanisms by which different ligands induce different responses is necessary to fully understanding the role of BMPs in the skeleton. With the increasing use of BMPs in the clinic for osteogenic purposes, clinicians should possess a solid understanding of the effects of

BMPs on osteoclasts which may negate the desired effect. Our lab as well as others have confirmed that osteoclasts express BMP ligands 2, 4, 6 and 7 (37, 43-45). In the following sections, we will discuss what is known about individual BMP ligands, and their effects on osteoclast differentiation and activity.

1.1.4.1 BMP1 BMP1, which was initially categorized as a BMP because of its ability to induce chondrocyte formation in-vivo, is not related to the TGF-β family (46). Also called procollagen C proteinase (PCP), BMP1 is a secreted metalloprotease that cleaves procollagen to mature structural form (47). Anderson et al. demonstrated that rat and human osteoclasts express BMP1 in their cytoplasm (48); however, the function of

BMP1 in osteoclasts is unknown at this time.

1.1.4.2 BMP2 Our group as well as others have demonstrated that osteoclasts express BMP2 in both early lineage cells (bone marrow macrophages) and mature osteoclasts (37, 49). In early hematopoietic stem cells, BMP2 can increase or decrease cell proliferation,

8

depending on concentration, but BMP stimulation does not affect lineage commitment

(50). This differential response to BMP2 may be a method of regulating maintenance or cell expansion of early lineage cells. In lineage committed osteoclasts, BMP2 acts to enhance survival and proliferation, and its phenotypic effect can be potentiated by IL-1A, prostaglandin, vitamin D3, and PTH (49, 51, 52).

Due to its effects on multiple tissues during development, BMP2 knockout mice are embryonically lethal prior to initiation of skeletal development (53). Clinically, haploinsufficiency of BMP2 can lead to cleft lip and palate (54). However, BMP2 is not necessary for proper bone development, as mice that lack BMP2 in mesenchymal lineage cells specific to limb development display a normal bone phenotype (55). Loss of

BMP2 did however lead to an increase in spontaneous fractures, and a complete loss of fracture repair, indicating its necessity to induce the normal bone healing sequence (55).

In addition to aberrant fracture healing these mice also have decreased bone graft healing (56). We found that loss of BMP2 in OCL lineage cells resulted in improper bone formation. While the mice are normal in length, they are osteopenic due to decreased trabecular bone volume to total volume. Interestingly, osteoclasts that are null for BMP2 expression are smaller but more numerous than in than wild type littermates (Mansky/Gopalakrishnan, unpublished results). This data supports our studies and the studies of others that BMP2 enhance osteoclast size but is not necessary for osteoclast differentiation.

9

1.1.4.3 BMP3 BMP3, also known as osteogenin, or a “non-canonical” BMP, is the most abundant BMP in the bone matrix, embedded by osteoblasts and osteocytes (>65% of BMP stored in bone) (57). It acts a negative regulator of bone density by inhibiting osteoblast differentiation (57). Mice that lack BMP3 have increased bone mass and have twice the trabecular bone volume; while mice that overexpress BMP3 have thinner cortical bones

(57, 58). BMP3 can bind and block ActR-2B, inhibiting other BMP ligand-receptor complexes from forming (59). BMP3 is important in regulating osteogenic BMPs and can bind to and inhibit BMP2 and BMP4 (59). This regulation is important for proper perichondrium development in regulating chondrocyte proliferation and proper ossification (60). However, BMP3 expression has not yet been reported in osteoclasts and cartilage and is thought to be expressed primarily by mature osteoblasts (5).

1.1.4.4 BMP4 BMP4 is closely related to BMP2, and both share common osteogenic functions (Fig. 1).

Global knockouts for BMP4 mice are embryonically lethal before the onset of skeletogenesis (61). Both BMP2 and 4 are highly expressed by osteoclasts at fracture sites (62). Overexpression of BMP4 in bone (Col1a1-Bmp4) leads to osteopenia due to increased osteoclast number (44). However, these mice die shortly after birth making it difficult to study skeletal development (44). BMP4 also regulates other aspects of skeletal development, such as limb development, as heterozygous BMP4 mice have a wide variety of abnormalities including increased risk for preaxial polydactyly, and craniofacial malformation (63). Much like BMP2, several mutations in BMP4 have been 10

linked to craniofacial defects such as nonsyndromic cleft lip and palate (64).

Interestingly, although BMP2 plays a large role in proper chondrocyte development and maturation, BMP4 does not (65).

1.1.4.5 BMP5 Due to their interesting phenotype BMP5 knockout mice have been studied for almost

100 years, although at the time, and for about 75 years after, researchers did not know that the mice were BMP5 deficient (66). Later BMP5 studies were able to clarify its role in bone homeostasis. BMP5 is able to stimulate OCL formation in a biphasic mode, although stimulation requires higher doses than BMP2 (67). Combinations of BMP2, 5 and 6 stimulate osteoblastogenesis but had no additive effect of osteoclast differentiation

(67). Lastly, giant cell tumors have been shown to express BMP5 as well as other BMP ligands (68).

1.1.4.6 BMP6 Although most closely related to BMP5, BMP6 acts in an opposing manner to BMP5 in osteoclasts. In co-cultures with osteoclasts and osteoblasts BMP6 inhibits osteoclastogenesis (69). This effect was shown to be indirect, working through osteoblasts. BMP6 expression increases during osteoclast differentiation (70).

Conditioned media from mature osteoclasts stimulated mesenchymal cell nodule formation and was attenuated by a BMP6 neutralizing antibody (70). However, BMP6

11

KO mice are largely unremarkable, with the exception of a delayed ossification of the sternum (71).

1.1.4.7 BMP7 BMP7, also called OP1, was discovered in 1990 (72) . Mice deficient in BMP7 have retarded ossification of bone and axial skeletal defects (73). Due to its ability to induce bone formation, although less potently than BMP2/6/9, BMP7 has FDA approval for use in long bones non-unions. Clinically, similar to BMP2, OP-1 results in enhanced resorption at fracture site (74). In human osteoclast cultures, BMP7 inhibited CD14+ monocytes differentiation into osteoclasts (75). c-Fos and Nfatc1 were upregulated but were not stable in the presence of BMP7, and MafB, an inhibitor of osteoclast differentiation, was not downregulated in the presence of BMP7 (75).

1.1.4.8 BMP8 BMP8 is expressed developing skeletal tissues but does not seem to play an important role in osteoclastogenesis. Recombinant BMP8 can induce ectopic bone formation in in vitro cultures (76). There is no research to date to suggest that BMP8 regulates osteoclast differentiation or activity.

1.1.4.9 BMP9 For several years BMP9 has been known to be a strong inducer of osteoblast differentiation and can induce heterotopic ossification when injected (4, 77). Conversely

BMP9 also increase osteoclast resorption and increase survival by activation of the canonical pathway (39). Recently BMP9 has been shown to enhance osteoclast 12

differentiation by upregulating ALK1 receptor and inhibiting activation of the ERK1/2 signaling pathway (78).

1.1.5 BMP Inhibitors BMP signaling is tightly regulated by multiple extracellular binding proteins, which modulate the diffusion from a source and control BMP signaling. Multiple extracellular

BMP regulators exist and can both regulate the function of BMPs but can also regulate each other. Mice with a global knockout of the BMP inhibitor Twisted gastrulation

(Twsg1) demonstrated increased numbers, size and activity of osteoclasts but no detectable change in osteoblast activity (38). Osteoclasts from the Twsg1 knockout mice have increased phosphorylated SMAD1/5/8 expression (38). Osteoclast differentiation was inhibited by overexpression of Twsg1 (79). Mice overexpressing

Noggin, another extracellular BMP modulator, showed increased bone volume due to decreased bone formation and resorption (44). Co-culture experiments with osteoblasts from noggin overexpressing mice demonstrated that NOGGIN inhibits osteoclast formation by attenuating BMP activities in osteoclasts as osteoclast differentiation could be rescued by addition of BMP2 (44, 51). Jensen et al. demonstrated that addition of recombinant NOGGIN to osteoclast cultures before day 3 inhibited osteoclast fusion and differentiation while NOGGIN addition after day 3 resulted in no significant change in osteoclast differentiation (37). Lastly, osteoclasts express sclerostin which can inhibit

BMP6 and BMP7 but not BMP2 or BMP4 (80). Sclerostin is secreted only by bone resorbing osteoclasts and therefore may be a mechanism by which bone apposition is inhibited in the vicinity of bone resorption (80).

13

1.1.6 BMP Receptors Our studies along with other studies have demonstrated that osteoclasts express BMP receptors BMPR1A, BMPR1B and BMPR2 (36, 37, 43, 45, 81-83).

1.1.6.1 BMPR2 Our group deleted Bmpr2 from all cells in the myeloid lineage including osteoclasts, the conditional knockout mice were osteopetrotic due to decreased osteoclast differentiation

(36). Bmpr2 conditional knockout mice had changes in the noncanonical signaling pathway (MAPK) and no changes in the canonical (SMAD1/5/8) signaling in knockout compared to wild type mice (36). Data from other studies suggest that in the Bmpr2 conditional mouse model the amino-terminus of the BMPR2 receptor may still be expressed and able to continue to activate the SMAD signaling pathway (84). Due to the defective osteoclast differentiation, these mice are osteoperotic, displaying increased bone volume and increased trabeculae (36). Interestingly, in this animal model, it was not the osteoclast number on the bone surface that was altered, but the resorption of these osteoclasts in-vivo (36).

1.1.6.2 BMPR1A Mice expressing a conditional deletion of Bmpr1a in mature osteoclasts (Bmpr1afl/fl;Ctsk-

Cre) demonstrated increased bone resorption suggesting activation of BMPR1A in the late stages of osteoclast differentiation negatively regulates osteoclast activity (81).

Additionally, mice with a deletion of Bmpr1a in osteoclasts measured increase bone formation suggesting that BMPR1A signaling in osteoclasts regulates osteoclast and osteoblast coupling (81). Recently, Bmpr1a was conditionally deleted from osteoclasts

14

with LysM-Cre which would decrease BMPR1A expression in all myeloid cells. The osteoclasts from these mice were decreased in their ability to form multinuclear TRAP positive cells with decreased expression of SMAD1/5/8; however, while mRNA for Mitf and Pu.1 were increased, Nfatc1 and other late osteoclast genes were decreased (85) .

1.1.6.3 BMPR1B Global knockouts of Bmpr1b have an osteopenic phenotype (82). In vivo analysis of bone activity markers indicates that neither bone formation nor resorption are changed in the global Bmpr1b mice (82). In vitro cultures of osteoclasts from BMPR1B null mice revealed increased proliferation of osteoclast precursors, more osteoclast differentiation, reduced apoptosis but surprisingly also reduced resorption (82).

1.1.7 BMP Signaling As stated earlier, BMPs can signal through both a noncanonical signaling pathway, or

SMAD-independent signaling pathway, and canonical signaling pathway, which is the

SMAD-dependent signaling pathway.

1.1.7.1 Noncanonical Signaling While not known in osteoclasts, BMP signaling has been shown to activate PI3K/Akt,

P/kC and Rho-GTPases (reviewed in (86). All of these kinases have been shown to regulate osteoclast differentiation and activation (as reviewed in (87). It has been shown that mitogen activated protein kinases or MAPKs are activated by BMP signaling in osteoclasts. Mice null for TAK1 expression, a MAPKKK, in mature osteoclasts led to a decrease in SMAD1/5/8 signaling in osteoclasts (88) . BMP2 stimulation has been 15

shown to activate MAPKs, ERK1/2, JNK and p38 in osteoclasts (36). Itoh et al. demonstrated that BMP2 cannot activate NF-kB in osteoclasts but rather BMP2 inhibits

NF-kB activation by RANKL (49). In osteoclasts BMP9 stimulation has been shown to activate both SMAD1/5/8 and ERK1/2 (39). BMP9 was shown to activate ERK1/2 through BMPR2 as loss of BMPR2 expression led to loss of ERK1/2 but not SMAD activation (39).

1.1.7.2 Canonical Signaling The R-Smads are phosphorylated and associate with a common Smad4. The R-

Smad/Smad4 complex translocate to the nucleus to regulate gene expression (35). Our group as well as others have demonstrated that osteoclasts express phosphorylated R-

SMADs as well as SMAD4 and SMADs translocate to the nucleus upon BMP stimulation

(37, 89, 90).

1.1.7.2.1 SMAD1/5/8 In our initial study of the necessity of Smad1/5/8 expression during osteoclast differentiation, we first established by RT-qPCR that osteoclasts express only detectable levels of Smad1 and 5 but not Smad8 (89). Osteoclast precursors isolated from the femurs of Smad1/5fl/fl mice infected with an adenovirus expressing CRE were inhibited in their ability to differentiate and resorb a calcium phosphate substrate (89). We detected no change in c-Fos and Nfatc1 expression but did measure a decrease in Dc-stamp and

Ctsk expression (89). To further characterize the role of SMAD1/5 during osteoclast differentiation, we created Smad1/5 conditional knockouts in osteoclasts

(Mansky/Gopalakrishnan, unpublished results). Loss of Smad1/5 expression in the

16

myeloid lineage had no significant effect on the skeleton; however, loss of Smad1/5 expression in macrophage/osteoclasts and mature osteoclasts enhanced osteoclast differentiation (Mansky/Gopalakrishnan, unpublished results). Surprisingly, we measured increased cortical thickness and an increase in osteoblast activity by P1NP

ELISA (Mansky/Gopalakrishnan, unpublished results). Lastly conditioned media from

SMAD1/5 null osteoclasts increased mineralization of MC3T3 cells compared to wild type conditioned media and expression of known osteoclast/osteoblast coupling factors were increased in SMAD1/5 null osteoclasts (Mansky/Gopalakrishnan, unpublished results).

1.1.7.2.2 SMAD4 In vitro cultures of Smad4fl/fl infected with CRE expressing adenovirus demonstrated that loss of SMAD4 expression during the early stages of osteoclast differentiation results in the loss of osteoclast differentiation (89). We measured less expression of Nfatc1, Dc- stamp and Ctsk as well as decrease in pSMAD2/3 expression (89). However, conditional deletion of Smad4 in mature osteoclasts (Smad4fl/fl;Ctsk-Cre) results in ostepenia due to increased osteoclast differentiation (90). The changes in osteoclast differentiation were not due to changes in BMP signaling but due to changes in the sensitivity to TGF-β signaling (90). Morita et al. demonstrated that TGF-β1 signaling blocks expression of Prdm1, a repressor of osteoclast differentiation (90). Loss of

Prdm1 expression upregulates expression of Bcl-6 and Irf8, both of which are repressors of osteoclast differentiation (90).

17

1.1.8 Conclusions

BMP plays a critical and complex role in bone development and homeostasis. The ability to culture osteoclasts without supporting cells in-vitro has allowed us and others to determine the direct effects of individual BMP ligands in regulating osteoclast differentiation. Additionally, the ability to create knockout mice in cells of the osteoclast lineage has and will provide insight into the necessity for BMP ligands and receptors in regulating osteoclast differentiation and activity. These fundamental studies are necessary to understand the function of BMPs in bone and understand their physiological effects, from signaling process, and cell-cell interaction that BMPs activate when used in the clinical setting.

1.2 Statement of Purpose

1.2.1 Significance of Research The skeleton is a dynamic structure that is constantly being remodeled due to metabolic and mechanical demands. In many diseases such as osteoporosis, periodontal disease, bone metastasis and rheumatoid arthritis, bone resorption outpaces bone formation.

The cells that are primarily responsible for bone resorption are osteoclasts (OCLs), specialized cells derived from hematopoietic stem cells of the monocyte/macrophage lineage. BMPs have been shown by numerous research groups to regulate bone

18

formation but what is not as well understood is the role that BMPs play in regulating osteoclast differentiation.

The data presented in this thesis will help us better understand the mechanisms by which a BMP antagonist, Twisted gastrulation, regulates osteoclast differentiation.

Second, the data presented in this thesis will be the first experimental data demonstrating the significance of BMP2 expressed by osteoclasts. By better understanding the mechanisms by which BMPs regulate osteoclast differentiation and activity, we will better understand how BMPs can be used as therapies in regulating the bone remodeling process.

1.2. Hypothesis I hypothesize that Twisted gastrulation interacts with BMPs through glycosylated amino acids and that increased BMP signaling through loss of an inhibitor such as Twisted gastrulation or decreased BMP signaling through loss of a ligand such as BMP2 will affect the ability of osteoclasts to differentiate.

1.3 Specific Aims

1.3.1 Determine the functional significance of glycosylated amino acids in Twisted Gastrulation regulation of osteoclast differentiation Previously it was shown that glycosylated amino acids N80/N146 within Twisted gastrulation are necessary for Twisted gastrulation to bind to BMP (91). In Chapter 2, I test whether glycosylation of amino acid residue N80/N146 are necessary for Twisted gastrulation’s ability to inhibit osteoclast differentiation and pSMAD1/5/8 activation.

19

1.3.2 Determine if Twisted gastrulation null osteoclasts are hypersensitive to M-CSF and RANKL signaling My lab has previously demonstrated that Twsg1-/- osteoclasts are enhanced in size compared to wild type osteoclasts (38). To determine if Twsg1-/- osteoclasts are more sensitive to M-CSF or RANKL stimulation compared to wild type osteoclasts, I will test increasing concentrations of M-CSF or RANKL during osteoclast differentiation, determine expression levels of c-Fms, Rank, BMP receptors and ligands in Twsg1-/- osteoclasts.

1.3.3 Characterize the skeletal phenotype of a mouse model null for Bmp2 in myeloid cells To test the functional significance of BMP2 expression by osteoclasts, I will characterize a mouse model whose myeloid cells, which includes osteoclasts, are null for BMP2 expression.

20

21

Chapter 2

The Function of Twisted Gastrulation in Regulating Osteoclast Differentiation is Dependent on BMP Binding

22

2.1 Introduction The skeleton is a dynamic structure that is under persistent anabolic, catabolic and metabolic demands. The fragile balance of bone homeostasis requires constant bone remodeling to maintain a structure that is durable, yet from which calcium ions can be quickly drawn. In many diseases such as osteoporosis, bone resorption outpaces bone formation and bone mineral deposition leading to a net loss in bone mineral density and bone structure. The cells that are primarily responsible for bone resorption are osteoclasts (OCLs), specialized cells derived from hematopoietic stem cells of the monocyte/macrophage lineage. OCLs differentiate in a stepwise fashion to first form mononuclear pre-osteoclast cells (pre-OCLs). Pre-OCLs fuse and spread to form mature multinucleated osteoclasts largely under the regulation of two cytokines: receptor activator of nuclear factor kappa-B ligand (RANKL) and macrophage colony-stimulating factor (M-CSF (24).

Bone morphogenetic proteins (BMPs) have been well studied as stimulators of osteoblast differentiation and bone formation (92). However, we recently showed that

BMPs are also critical for OCL formation as mice deficient in bone morphogenetic receptor II (BMPRII) in OCLs showed reduced ability to form OCLs (36). Further, in support of these in vivo findings, bone marrow derived cultures treated with recombinant

BMP2 showed increased RANKL-mediated osteoclastogenesis (37). These results suggest that BMPs, acting on OCLs, play a larger role than previously perceived in regulating osteoclast differentiation and potentially in the bone remodeling process.

BMP signaling can be modulated through several extracellular and intracellular mechanisms. In the extracellular space, a major regulatory mechanism is through 23

binding of secreted BMP ligands to BMP binding proteins such as Noggin, Chordin and

Twisted gastrulation (TWSG1) (93). Our lab has demonstrated that mice deficient for

TWSG1 have enhanced osteoclastogenesis without a defect in bone formation, due to increased BMP signaling (38). Furthermore, TWSG1 overexpression in pre-OCLs reduces TRAP positive multinucleated OCL formation by suppressing BMP signaling

(79). We propose that the biochemical basis for the skeletal phenotype in Twsg1-/- mice is solely due to lack of TWSG1 binding to BMP ligands and enhanced BMP signaling in

OCLs (38).

The goal of the current project was to investigate whether TWSG1 binding to BMPs is required for its inhibitory effects on OCLs. Towards this end, we investigated the significance of two previously proposed BMP binding sites in TWSG1 (two glycosylation sites within exon 4 and a conserved cysteine rich site in the N-terminus) for inhibition of

BMP signaling during osteoclastogenesis. Mutations of these sites on TWSG1 protein, referred to as N80Q/N146Q for glycosylation site mutant (91) and W66A for the N- terminal cysteine site mutant (94) have been shown to have decreased BMP ligand binding ability, but were still able to bind to other extracellular cysteine rich proteins (91,

94). Biological effects of these mutations were previously studied in the context of craniofacial development in mice and embryonic patterning in amphibians. Our work aims to understand the impact of these mutations on osteoclast function. These TWSG1 mutant constructs, along with WT-TWSG1, were overexpressed in pre-OCL. As we have previously shown, WT-TWSG1 expression in pre-OCLs decreased formation and activity of mature OCLs. On the other hand, neither the W66A nor the N80Q/N146Q mutants inhibited osteoclastogenesis, indicating that BMP binding is essential for decreasing OCL differentiation. In fact, cells overexpressing either mutant construct

24

showed increased osteoclastogenesis as well as increased BMP signaling, suggesting loss of TWSG1 binding to BMPs may in fact lead to a possible pro-BMP effect, resulting in enhanced osteoclastogenesis. Our results confirm that BMP binding is required for

TWSG1-mediated inhibition of OCL formation.

2.2 Material and Methods

2.2.1 Mice Generation and genotyping of Twsg1-/- mice was previously described (95). The use and care of the mice in this study was approved by the University of Minnesota

Institutional Animal Care and Use Committee.

2.2.2 Harvesting of Bone Marrow and Generation of Osteoclast Cells

Primary bone marrow macrophages were harvested from the femurs and tibiae of 4- week-old WT C57Bl/6 or Twsg1-/- mice. The femurs and tibiae were dissected and adherent tissue was removed. The ends of the bones were cut and the marrow was flushed from the inner compartments. The red blood cells (RBC) were lysed from the flushed bone marrow tissue with RBC lysis buffer (150 mM NH4Cl, 10 mM KHCO3, 0.1 mM EDTA, pH7.4) and the remaining cells were plated on 100 mm plates and cultured overnight in OCL media (phenol red-free Alpha-MEM (Gibco) with 5% fetal bovine serum

(Hyclone), 25 units/mL penicillin/streptomycin (Invitrogen), 400 mM L-Glutamine

(Invitrogen), and supplemented with 1% CMG 14-12 culture supernatant containing M-

CSF). The non-adherent cell population, including OCL precursor cells, was then carefully separated, counted and plated at approximately 1.7x104 cells/cm2 in OCL

25

media supplemented with 1% CMG 14-12 culture supernatant. After 48 hours in OCL media supplemented with 1% CMG 14-12 culture supernatant, cells were treated with

1% CMG 14-12 culture supernatant and 30 ng/mL RANKL (R&D Systems) for approximately 5 days, driving differentiation to mature OCLs.

2.2.3 Osteoclast Transduction Bone marrow macrophages were isolated as described above. Prior to stimulation with

RANKL, the cells were incubated with 100 MOI of adenovirus (control, TWSG1,

N80Q/N146Q or W66A) for 3h at 37°C in the presence of 1% CMG 14-12 culture supernatant as previously published (79). Titering of the adenoviruses was performed using an optical based density measurement (vp/mL). This method was used to determine viral particle density and MOI (79). After 3 hours, media-containing adenovirus was removed and cells were fed with 1% CMG 14-12 culture supernatant and RANKL (30 ng/ml). After five days, RNA was extracted for use in qRT-PCR, protein was extracted for western blotting, or cells were stained for TRAP.

2.2.4 RNA Isolation and Quantitative RT-PCR Quantitative real-time PCR was performed using the MyiQ Single Color Real-Time PCR

Detection System (Biorad). RNA was harvested from cells using Trizol Reagent

(Ambion, Life Technologies) and quantified using UV spectroscopy. cDNA was prepared from 1 μg RNA using the iScript cDNA Synthesis Kit (Biorad) as per the manufacturer’s protocol. The 2▵▵Ct method was used to analyze expression; in accordance with this method we have previously experimentally determined that our primer sets amplify with similar efficiencies. Experimental genes were normalized to GAPDH as indicated in

26

figure legends. NFATc1 (Forward) 5’ -TCA TCC TGT CCA ACA CCAAA; (Reverse) 5’ -

TCA CCC TGG TGT TCT TCC TC; CTSK (Forward) 5’-AGG GAA GCA AGC ACT GGA

TA; (Reverse) 5’-GCT GGC TGG AAT CAC ATC TT; DC-STAMP (Forward) 5’-GGG

CAC CAG TAT TTT CCT GA; (Reverse) 5’ -TGG CAG GAT CCA GTA AAA GG.

2.2.5 Immunoblotting Cell protein lysates were harvested from OCLs in modified RIPA buffer (50mM Tris pH

7.4, 150mM NaCl, 1% IGEPAL, 0.25% sodium deoxycholate, 1mM EDTA) supplemented with Halt Protease & Phosphatase Inhibitor Cocktail (Thermo Scientific).

Lysates were cleared by centrifugation at 12,000Xg at 4°C. Proteins were resolved by

SDS-PAGE and transferred to a PVDF membrane (Millipore). Anti-FLAG (DYKDDDDK) antibody was obtained from Cell Signaling. Smad1/5/8 was obtained from Santa Cruz, and phospho-Smad1/5/8 (p-Smad1/5/8) antibody was obtained from Cell Signaling

Technology. HRP-conjugated anti-rabbit or anti-mouse were incubated with membranes, washed, and incubated with Amersham ECL Prime Western Blotting Detection Reagent

(GE Healthcare). Typically, the membranes were blotted with p-Smad 1/5/8 before being reblotted with total Smad1/5/8 antibody. Blots were stripped with western blot membrane stripping buffer (100 mM glycine, pH 2.5, 200 mM NaCl, 0.1% Tween 20,

0.1% β-mercaptoethanol) for 5 minutes at 50°C. Densitometry analysis was performed on NIH Image J. Individual activation levels were determined by comparing each p-

Smad 1/5/8 band to its total Smad 1/5/8 band, and relative expression was determined by comparing individual activation levels to control infected cell culture levels.

27

2.2.6 TRAP Stain Primary OCLs were fixed with 4% paraformaldehyde (PFA) and washed with PBS. The cells were then stained for tartrate resistant acid phosphatase (TRAP) expression with tartrate 5 mg, Naphthol AS-MX phosphate, 0.5 mL M, M-Dimethyl formamide, 50 mL acetic acid buffer (1 mL acetic acid, 6.8 g sodium acetate trihydrate, 11.5 g sodium tartrate in 1 L water) and 25 mg Fast Violet LB salt. Cells were then observed and captured with light microscopy and NIH Image J was used to measure and analyze cell area. Cells with three nuclei or more were counted.

2.2.7 Quantitating Nuclei TRAP stained multinuclear osteoclasts were stained with DAPI to visualize nuclei.

Images of cells were captured with light microscopy and total nuclei were quantitated with NIH Image J. To calculate number of nuclei per cell, DAPI images were overlaid with TRAP stained images to calculate number of nuclei per cell in TRAP positive cells containing 3 or more nuclei.

2.2.8 Resorption Assays Osteoclast precursors were plated on Osteo Assay Surface plates (Corning) at a concentration of 100,000 cells per well. Cells were allowed to fully differentiate. On day

5, the media was completely removed and 100μL/well of 10% bleach was added to each well and incubated at room temperature for 5 minutes. The bleach solution was then aspirated off and the wells were washed twice with 150μL of dH2O. The plate was then allowed to air dry completely at room temperature for 3-5 hours. The wells were observed at 10x magnification for the formation of resorption pits and images were

28

captured with light microscopy. Images were measured and analyzed using NIH Image

J.

2.2.9 Statistics All experiments were performed at least three times in either duplicate or triplicate as indicated in figure legends. The data shown are representative of the mean + SD of all experiments. Student’s t-test or 1-way ANOVA analysis followed by a Tukey’s multiple comparison test were used to compare data; p<0.05 indicates significance. Statistical analysis was performed using Prism 5 software for Mac OSX.

2.3 Results

2.3.1 Engineering and Expression of TWSG1 constructs in OCLs TWSG1 is a highly conserved 222 amino acid glycoprotein with a secretory signal and a single BMP binding region. The previously published TWSG1 W66A mutant lacks a critical tryptophan in its BMP binding region, rendering it unable to bind BMPs (Figure 1A

(94). The N80Q/N146Q mutant has two point mutations in critical N-glycosylation sites in the exon 4 that result in loss of BMP binding (Figure 4A (91). In order to assess the function of TWSG1 binding to BMPs on osteoclastogenesis, adenovirus constructs for

WT-TWSG1 and TWSG1 mutants were generated as previously described (79).

TWSG1expression was regulated by the CMV promoter, and mononuclear pre-OCL cells were treated at 100 MOI after 48 hours of M-CSF stimulation. Protein expression of all the TWSG1 expressing constructs was at similar levels as measured by western blot

(Figure 4B).

29

Figure 4. Diagram of TWSG1 protein and expression of TWSG1 mutants

(A) Schematic of TWSG1 showing location of single BMP binding domain, a secretory signal peptide (SP), and cysteine rich region (CR). Location of point mutations,

N80Q/N146Q and W66A, are indicated. (B) Western blot against FLAG epitope of wild type (WT) and mutant (QQ and W66) TWSG1 adenoviruses in 293T cells.

2.3.2 Loss of TWSG1 binding to BMPs results in larger OCLs Our lab has previously shown that OCLs null for TWSG1 are larger than OCLs from WT mice (38). In addition, we have demonstrated that overexpression of TWSG1 in pre-

OCLs inhibited OCL differentiation, resulting in smaller OCLs (79). To determine if BMP binding is necessary for the ability of TWSG1 to regulate OCL differentiation, we transduced OCLs from WT mice with either a control adenovirus or an adenovirus overexpressing WT-TWSG1 or mutant TWSG1 and stimulated differentiation with M-

CSF and RANKL. As we have previously reported, TWSG1 overexpression drastically reduced OCL differentiation by reducing the size and number of multinucleated mature

OCLs as compared to control viral vector (Figure 5A). Because of the drastic phenotypic range observed, cell sizes were quantified in groups of three nuclei or more, or ten

30

nuclei or more. The size of multinucleated cells with three or more nuclei was doubled in cell cultures overexpressing TWSG1-mutant constructs relative to control-virus transduced cultures (mean values of control: 0.0162, N80Q/N146Q: 0.0317; W66A:

0.0293; TWSG1: 0.0075 mm2, Figure 5B). In OCLs overexpressing TWSG1 there were no cells with 10 nuclei or more (Figure 5C). In contrast, overexpression of either the

N80Q/N146Q or W66A mutant did not show this repressive effect. On the contrary,

N80Q/N146Q and W66A mutants showed a 1.5 fold increase (N80Q/N146Q: 0.2391±

0.0985; W66A: 0.2211 ± 0.0131 mm2) in the size of multinucleated TRAP positive OCLs compared to control transduced cultures (control: 0.1528 ± 0.0174 mm2, Figure 5C).

Figure 5. Expression of TWSG1 mutants enhances osteoclast differentiation and size

31

(A) Images of TRAP positive mature OCLs. Cell area quantification of either control, WT-

TWSG1 or mutant TWSG1 adenovirus for cells with three or more nuclei (B) or ten or more nuclei (C). Values represent average of at least three experiments run in triplicate.

* indicates statistically significant, with a p value <0.05, compared to WT-TWSG1 transduced cells. Error bars represent standard deviation. Scale bar represents 0.25mm in length.

2.3.3 TWSG1 mutants have increased resorptive activity We next examined if the enhanced OCL formation observed in cells overexpressing mutant TWSG1 correlated with increased cell activity. We cultured BMMs on calcium phosphate coated plates, transduced with TWSG1 constructs as described above, and then cells were given M-CSF and RANKL to stimulate osteoclast differentiation. Figure

6A shows photomicrographs of synthetic hydroxyapatite mineral surfaces. As we have previously shown, resorption was reduced in TWSG1 expressing cells compared with control adenovirus transduced cultures, although in this case the reduction did not reach statistical significance (Figure 6B, (79). On the other hand, both mutant constructs led to a multiple fold increase in resorption (N80Q/N146Q: 11.26% area; W66A: 43.78% area), as compared to both control and TWSG1 overexpression (WT-TWSG1: 0.15% area,

Figure 6B). Collectively, these data suggest that loss of BMP binding of TWSG1 results in enhanced OCL formation, causing increased bone resorption.

32

Figure 6. TWSG1 mutant expression increases osteoclast resorptive activity

(A) Binary image of calcium phosphate coated wells. (B) Quantification of percent area resorbed transduced with control, WT-TWSG1 or mutant TWSG1 adenoviruses. Values reflect average of at least three experiments run in duplicate. ** indicates statistically significant compared with a p value <0.005, *** indicates a p value <0.0005, compared to

WT-TWSG1 transduced cells. Error bars represent standard deviation. Scale bar represents 0.25mm in length.

2.3.4 Effect of W66 and N80Q/N146Q on OCLs is mediated through modulation of BMP signaling TWSG1 has been shown to antagonize BMP signaling in OCLs (79). To determine the status of BMP signaling in TWSG1 mutant overexpressing cells, we transduced mononuclear pre-OCLs as previously described (79). At day three of OCL differentiation, after 72 hours of RANKL stimulation, cell lysates were collected and

33

western blot analysis was performed to analyze levels of BMP canonical signaling. We have previously shown that BMPs signal through the canonical SMAD pathway in OCLs

(36, 37). In addition to demonstrating that TWSG1 overexpression led to a reduced OCL size, we showed that TWSG1 reduced p-Smad1/5/8 levels (79). Here we show that in contrast to control transduced cell cultures, TWSG1 mutant overexpressing OCLs have increased p-Smad1/5/8 levels, suggesting an increase in BMP signaling (Figure 7A, top panel). Densitometry quantification of the bands shows that N80Q/N146Q and W66A mutant cultures have markedly increased p-Smad1/5/8 activation (23.88 and 33.95 times higher, respectively). Blots were then stripped and reprobed to demonstrate that there were no detectable changes in total Smad1/5/8 (Figure 7A, bottom panel). These data suggest that the cellular defects observed with W66A and N80Q/N146Q overexpression are likely caused by a loss of TWSG1 suppressive activity on canonical BMP signaling.

To determine if the source of the BMP in these cultures was from the OCL themselves or from the FBS used in culturing the osteoclasts, C2C12 cells, which are highly responsive to BMP signaling, were cultured in serum free media for three hours then stimulated with the osteoclast culture media (containing FBS) for thirty minutes. Our data show that the

OCL culture media stimulated only a slight increase in p-Smad1/5/8 signaling in these cultures, suggesting that the main source of BMP ligands in the OCL cultures comes from the osteoclasts themselves and not the FBS that is used to culture the osteoclasts

(Figure 7B).

34

Figure 7. Increased p-Smad1/5/8 activation in osteoclasts expressing TWSG1 mutants

(A) Western blot of osteoclast transduced with control or mutant TWSG1 adenoviruses constructs. Cells were treated with M-CSF and RANKL for 3 days. Cell lysate was analyzed for the presence of p-Smad1/5/8 (Cell Signaling). Blots were striped and reblotted for Smad1/5/8 (Santa Cruz). (B) C2C12 cells starved for three hours then treated with serum free media, OCL differentiation media, or serum free media with 50 ng BMP2. Western blot of cell lysates analyzed for the expression of p-Smad1/5/8 (Cell

Signaling), Smad1/5/8 (Santa Cruz).

35

2.3.5 TWSG1 mutants have increased expression of key OCL genes To determine how TWSG1 and TWSG1 mutants function to alter OCL-specific gene expression during differentiation, real time RT-PCR was performed with RNA obtained from OCL cultures following transduction with WT-TWSG1 or mutant TWSG1 adenoviral vectors. We observed an inhibition of NFATc1 (a key OCL specific transcription factor),

DC-STAMP (a critical OCL fusion gene) and CTSK (an important OCL specific marker required for resorption) expression in WT-TWSG1 compared to control transduced cells

(TWSG1 NFATc1: 5.41, TWSG1 DC-STAMP: 1.84, TWSG1 CTSK: 155.63; Control

NFATc1: 9.54, Control DC-STAMP: 3.58, Control CTSK: 336.62, Figure 5). In agreement with increased OCL formation, cells overexpressing W66A and N80/146Q mutant showed increased OCL gene expression (Figure 8). This increase was most noted in W66A mutant overexpressing cells, with a 3- to 14-fold increase in expression compared to cells transduced with WT-TWSG1 (N80/146Q NFATc1: 5.93 (is this fold change?), N80/146Q DC-STAMP: 8.45, N80/146Q CTSK: 1217.83; W66A NFATc1:

16.81, W66A DC-STAMP: 16.61, W66A CTSK: 2243.69).

36

Figure 8. TWSG1 mutant expression increases osteoclast specific gene expression

Real time RT-PCR comparing osteoclast gene expression of Nfatc1, Dc-stamp and cathepsin K (Ctsk) in OCL cultures transduced with control, WT-TWSG1 or mutant

TWSG1 adenoviruses. Values were normalized to GAPDH. Values represent the average of at least three experiments run in duplicate. * indicates statistically significant, with a p value <0.05, compared to WT-TWSG1 transduced cells. A one-way ANOVA was used to determine significance. Error bars represent standard deviation.

37

2.3.6 TWSG1 mutants do not act in a dominant negative manner TWSG1 is expressed in OCLs, and protein levels increase throughout differentiation

(79). This raises the possibility that the W66A and N80Q/N146Q mutants could compete with endogenous TWSG1 and block normal protein function. This mechanism could account for the increased BMP signaling and possibly increased osteoclastogenesis in

OCLs overexpressing mutant TWSG1. To determine if the TWSG1 mutants act in a dominant negative manner, control, WT-TWSG1, W66A or N80Q/N146Q adenoviruses were transduced into Twsg1-/- pre-OCLs as has been described in previous experiments for WT pre-OCLs, and then cells were stimulated with RANKL and M-CSF to promote

OCL differentiation. Cells were fixed and TRAP positive cells containing three nuclei or more were quantitated. As shown in Figure 9, overexpression of W66A and

N80Q/N146Q mutants in Twsg1-/- derived bone marrow cultures resulted in larger multinucleated OCLs, similar to those in Figure 5. These results indicate that the effects of W66A and N80Q/N146Q TWSG1 mutants do not depend on the presence of an intact endogenous TWSG1 protein, and hence the mutants do not appear to act in a dominant negative manner.

38

Figure 9. WT-TWSG1 and mutant construct overexpression in Twsg1-/- OCL

Quantification of osteoclasts from Twsg1-/- mice transduced with control, WT-TWSG1 or mutant TWSG1 adenoviruses. Values represent average of at least three experiments run in duplicate. * indicates statistically significant, with a p value <0.05, compared to

WT-TWSG1 transduced cells. Error bars represent standard deviation.

2.4 Discussion BMPs play a large role in stimulating OCL differentiation, fusion, and activity (37), and

TWSG1 is able to decrease BMP signaling in OCLs (37). In an effort to understand if

TWSG1 regulates osteoclastogenesis by BMP binding alone, we overexpressed wild type TWSG1 and mutant constructs in early mononuclear pre-OCLs. Here we demonstrate that, consistent with our previous findings, WT-TWSG1 overexpression reduced OCL size and function. These phenotypic effects were reversed in OCLs overexpressing BMP binding mutants, which showed enhanced osteoclastogenesis, increased resorptive activity, and elevated Smad1/5/8 phosphorylation. These data suggest that that the suppressive effects of TWSG1 is mediated by binding of the protein to BMPs, because loss of functional BMP binding domains on TWSG1 promotes osteoclast differentiation, gene expression and activity.

Previously, we showed that because of loss of its extracellular inhibitor TWSG1, Twsg1-/- mice have increase in BMP signaling and enhanced osteoclastogenesis. These mice are osteopenic compared to WT littermates (38). Therefore, it was of interest to study the effect of TWSG1 on OCLs in isolation to gain further mechanistic insight into

TWSG1-mediated regulation of osteoclastogenesis through its interaction with BMP.

39

Previously designed TWSG1 mutants that do not bind to BMP were used in this study along with WT-TWSG1. Our results further establish WT-TWSG1 as a negative regulator of BMP signaling in osteoclasts. In our studies, OCLs overexpressing TWSG1 had reduced osteoclastic gene expression compared to control OCLs. Phenotypically these mature TWSG1 overexpressing OCLs were smaller and had decreased resorption activity, highlighting the impact of TWSG1 on OCL differentiation.

Maintenance of optimal BMP signaling plays a major role in multiple tissue types such as nephrons during development, embryonic mandibular arch, normal postnatal bone homeostasis, and other systems (91, 95, 96). In murine osteoclasts (as shown here) and mandibular explants (91), exogenous TWSG1 acts as a BMP antagonist. In other biological contexts and species, TWSG1 can also have a pro-BMP function depending on its complex interactions with other BMP binding partners. Oelgeschlager et al. demonstrated a pro-BMP effect in Xenopus with the xTSGW67G mutant (a W66 homologue) due to a direct binding between the mutant TWSG1 and Chordin, which stimulated Chordin cleavage by Tolloid zinc metalloproteinase (94). In that study,

TWSG1 formed a trimolecular complex with Chordin and Tolloid, but not BMP. This interaction between TWSG1 and Chordin does not pertain to mature OCLs because they do not express Chordin (38).

Our results complement previous studies on the role of TWSG1 in regulating BMP signaling in other model systems and also validate the critical functional regions within the TWSG1 protein for these interactions. Oelgeschlager et al. found that xTSGW67G, the homologous mutant to W66A, had a strong ventralizing effect in Xenopus, a phenotype commonly associated with overactive BMP signaling (94). Furthermore, we have

40

previously demonstrated the requirement for N-glycosylation of TWSG1 for BMP binding using a mandible explant model (91). In agreement with these data, our studies show that the N-glycosylation compound mutant, N80Q/N146Q, could not inhibit BMP canonical signaling, which underscores the importance of glycosylation sites. Although loss of glycosylation and misfolding can lead to protein degradation, the increase in signaling and activity above that of control transduced cells led us to believe that the

W66A and N80Q/N146Q mutants are not being degraded, and still retain a secondary pro-BMP function.

The results presented here suggest a dual function for TWSG1 in OCLs, with the ability to promote or inhibit BMP signaling. WT-TWSG1 serves to inhibit BMP signaling, while

N-terminal TWSG1 mutants have increased BMP signaling above that of control transduced cells. These studies support the notion that TWSG1 limits BMP signaling by direct binding to BMPs through its N-terminus. However, we cannot exclude the possibility that TWSG1’s conserved C-terminus, which is retained in our mutant constructs, also contributes to the enhancement of BMP signaling, perhaps acting in conjunction with other extracellular proteins that are also involved in BMP gradient maintenance, for example cysteine-rich proteins such as crossveinless-2 (CV2), Noggin, or members of the DAN family of BMP binding proteins. Further research is necessary to elucidate the multiple and complex interactions of TWSG1.

41

Chapter 3

Twisted Gastrulation1 Null Osteoclasts Are Hypersensitive to RANKL

42

3.1 Introduction The skeleton is not a static structure as it is constantly being remodeled to maintain homeostasis (97). Diseases such as osteoporosis and osteopetrosis are a result of a disruption in this balance between bone formation by osteoblasts and bone resorption by osteoclasts. Osteoclasts are a highly specialized multinucleated cell derived from the hematopoietic stem cell lineage. Differentiation into these multinucleated cells requires a stepwise process involving pre-osteoclasts cells forming from the monocyte/macrophage lineage. These pre-osteoclasts then fuse and form multinucleated mature osteoclasts that are able to resorb bone mineral matrix (18, 98). Osteoclast differentiation requires the presence of two cytokines: macrophage colony-stimulating factor (M-CSF) and receptor activator of nuclear factor kappa-B ligand (RANKL) which are supplied by osteoblasts or osteocytes (19, 24, 99).

Bone morphogenetic proteins (BMPs) are regulators of both osteoblast (as reviewed in

(100) and osteoclast differentiation (36-39, 43, 44) and regulation of BMPs in osteoclasts is modulated by both extracellular and intracellular mechanisms (38, 79, 101). One extracellular mechanism that regulates BMP activation is the binding of BMP ligands to 43

BMP binding proteins like Chordin, Noggin and Twisted Gastrulation (93). The highly conserved 222 amino acid glycoprotein Twisted Gastrulation (TWSG1) is a negative modulator of BMP signaling in osteoclasts (38, 79, 101). Our lab has previously shown that osteoclasts null for TWSG1 are significantly larger than osteoclasts from wild type mice. These mice have shown increased SMAD 1/5/9 activation and are osteopenic compared to their wild type littermates (38). We have also demonstrated that overexpressing TWSG1 in pre-osteoclasts inhibits differentiation with this inhibition being rescued with increasing concentrations of BMP2 (79).

The goal of this current study was to determine if TWSG1 null osteoclasts were hypersensitive to increasing concentrations of osteoclast stimulating factors M-CSF and

RANKL when compared to wild type osteoclasts. At low concentrations of M-CSF,

TWSG1 null cells created larger TRAP positive multinucleated cells in culture when compared to wild type cells. Similarly, at various concentrations of RANKL, TWSG1 null osteoclasts exhibited larger osteoclasts as well as more TRAP positive cells compared to wild type cells.

3.2 Materials and Methods

3.2.1 Primary Osteoclasts Cell Culture Femora and tibiae were dissected from wild-type or Twsg1-/- littermates and adherent tissue was removed. Primary bone marrow macrophages from the mice were then isolated from the femora and tibiae. The ends of the femora and tibiae were cut and the bone marrow was flushed out. Using red cell lysis buffer (150 mM NH4Cl, 10 mM KHCO3

, 0.1 mM EDTA, ph 7.4), red blood cells were lysed from the flushed marrow. The resulting cells were then plated and cultured overnight in 10 cm tissue culture dishes

44

(Midsci) in osteoclast media (phenol red-free alpha-MEM (Gibco) with 5% heat inactivated fetal bone serum (Hyclone), 25 units/mL penicillin/streptomycin (Invitrogen),

400 mM L-Glutamine (Invitrogen), and supplemented with 0.1% CMG 14-12 culture supernatant containing M-CSF). Cell populations that were non-adherent, including osteoclast precursor cells, were then removed and replated in 12-well cell culturing plates (Midsci) at a concentration of 2 x 105 cells/well in osteoclast media supplemented with 0.1% CMG culture supernatant. Subsequently, every two days, cells were refed with

0.1% CMG plus 10 ng/mL of RANKL (R&D Systems) to initiate osteoclastogenesis.

3.2.2 M-CSF and RANKL Hypersensitivity Osteoclast Cell Culture After the initial plating of the osteoclast precursor cells, cells were refed with either 2.5 ng/mL, 5.0 ng/mL or 10 ng/mL of M-CSF plus 10 ng/mL of RANKL or increasing 5.0 ng/mL, 15.0 ng/mL or 30 ng/mL of RANKL plus 0.1% CMG culture supernatant. Every two days, cells were refed with their respective concentrations until the cells were fully differentiated into multinuclear cells.

3.2.3 Tartrate Resistant Acid Phosphatase (TRAP) Staining After culturing the primary osteoclasts as described above, the cells were rinsed using

1X DPBS (Gibco),and fixed with 4% paraformaldehyde for 20 minutes. Primary osteoclasts were stained using the Naphthol AS-MX phosphate and Fast Violet LB salt protocol (BD Biosciences Technical Bulletin #445). Cells were imaged and photographed using light microscopy. The pictures were analyzed using NIH ImageJ to measure the size and number of TRAP positive multinuclear cells.

45

3.2.4 RNA Isolation and Real-Time PCR RNA was harvested from primary osteoclasts plated in duplicate using TRIZOL Reagent

(Ambion, Life Technologies) and quantified using UV spectroscopy. cDNA was then prepared from 1 ug of purified RNA using iScript cDNA Synthesis Kit (Bio-Rad) as per manufacturer’s protocol. Quantitative real-time PCR was performed in duplicate using

CFX Connect Real-Time PCR system (Bio-Rad). Each reaction contained 10 ul iTaq

Universal Sybr Green Supermix, 8.8 ul DEPC water, 500 nM forward and reverse primers, and 1 ul cDNA for a total of 20 ul per reaction. The PCR conditions were as follows: 95°C for 3 minute, and 40 cycles of 94°C for 15 seconds, 58°C for 30 seconds, and 72°C for 30 seconds, followed by melting curve analysis (95°C for 5 seconds, 65°C for 5 seconds, and then 65°C to 95°C with 0.5°C increase for 5 seconds). Experimental gene were normalized relative to Hprt. Primer sequences are listed in Table 1.

Table 1: Sequence of primers used for qRT-PCR

Oligo Sequence

C-fms Forward: 5’-TGCTAAAGTCCACGGCTCAT-3’

Reverse: 5’-TCGGAGAAAGTTGAGATGGTGT-3’

Rank Forward: 5’-CCAGGACAGGGCTGATGAGAA-3’

Reverse: 5’-TGGCTGACATACACCACGATGA-3’

Bmp2 Forward: 5’-AGGGTTTCAGGTCAGTTTCCG-3’

Reverse: 5’-TCCGAAGGTAAGTGTGCTTGG-3’

46

Bmp4 Forward: 5’-AGCCGGTAAAGATCCCTCAT-3’

Reverse: 5’-CCTGGTAACCGAATGCTGAT-3’

Bmp6 Forward: 5’-CACAGTCCTCTTCTTCGGGC-3’

Reverse: 5’-CTTTTGCATCTCCCGCTTCT-3’

Bmpr-Ia Forward: 5’-GCTCATCGAGACCTGAAGAG-3’

Reverse: 5’-GTCTGGAGGCTGGATTATGG-3’

Bmpr-Ib Forward: 5’-AGCACAGATGGGTACTGCTTC-3’

Reverse: 5’-TCTAGTCCTAGACATCCAGAGGTG-3’

Bmpr-II Forward: 5’-TGGCAGTGAGGTCACTCAAG-3’

Reverse: 5’-TTGCGTTCATTCTGCATAGC-3’

Twsg1 Forward: 5’-TCCCAGCAACAATGTCCACG-3’

Reverse: 5’-ACCTGACGGCTAACACAGATGC-3’

Hprt Forward: 5’-GAGGAGTCCTGTTGATGTTGCCAG-3’

Reverse: 5’-GGCTGGCCTATAGGCTCATAGTGC-3’

3.2.5 Statistical Analysis

Each experiment was run in triplicate and performed at least three times. All results are expressed as mean ± standard deviation. Student’s t-test or one-way ANOVA analysis followed by a Tukey’s multiple comparison test were used to compare data using Graph-

Pad Prism version 7.

47

3.3 Results

3.3.1 Twsg1-/- are not hypersensitive to M-CSF TWSG1 null mice present phenotypically with osteopenia due to an increase in their osteoclast size and number, with no difference in the osteoblast number or function (38).

To determine if the increased osteoclast size in the TWSG1 null animal was due to

Twsg1-/- osteoclasts being more hypersensitive to M-CSF and RANKL, we assessed the reaction of TWSG1 null cells to varying concentrations of M-CSF. We did not observe any significant variation with wild type or Twsg1-/- osteoclasts in size or number with decreasing concentrations of M-CSF tested (Fig. 10). However, due to the large variation in size among our cultures the difference between different concentrations of

M-CSF was not statistically significant.

Figure 10. TWSG1 null osteoclasts are not enhanced in size with increasing M-CSF 48

Wild type and TWSG1 null osteoclast cultures were cultured with increasing concentrations of M-CSF. (A) Representative images depicting TRAP stained osteoclast cultures. Quantification of TRAP stained multinucleated osteoclasts by average cell size

(B) and number of osteoclasts (C).

3.3.2 Twsg1-/- osteoclasts are hypersensitive to RANKL Next we assessed the reaction of TWSG1 null cells to varying concentrations of RANKL.

We observed that TWSG1 null osteoclasts were still able to form larger TRAP positive multinuclear cells at the lowest concentration of RANKL tested compared to wild type osteoclasts (Fig. 11); however, the difference in size and number of TRAP positive multinuclear was only significant at the highest concentration of RANKL tested.

49

Figure 11. TWSG1 null osteoclasts are more reactive to RANKL than wild type osteoclasts

Wild type and TWSG1 null osteoclast cultures were cultured with increasing concentrations of RANKL. (A) Representative images depicting TRAP stained osteoclast cultures. Quantification of TRAP stained multinucleated osteoclasts by average cell size

(B) and number of osteoclasts (C). * p<0.05 and *** p<0.001 compared to wild type cultures at 30 ng/mL

3.3.3 Twsg1-/- osteoclasts have increased Rank expression To determine the mechanism by which osteoclasts from TWSG1 null osteoclasts are enhanced to RANKL, we initially measured expression of c-Fms and Rank by q-RT PCR during osteoclast differentiation. Interestingly we measured a significant increase in

Rank expression in the Twsg1-/- osteoclasts at day 5 of osteoclast differentiation (Fig.

12B). We also measured a trend towards an increase in c-Fms expression at day 5 though not significant (Fig. 12A).

Figure 12. Osteoclasts from TWSG1 null mice have increased Rank expression

BMMs from WT and TWSG1 null mice were cultured in M-CSF (Day 0) and M-CSF and

RANKL (Day 1-5) to stimulate osteoclast differentiation. (A) c-Fms and (B) Rank RNA expression were measured by RT-qPCR. * p<0.05 compared to wild type day 5 50

3.3.4 Expression levels of BMP receptors and ligands in Twsg1-/- osteoclasts As we have previously demonstrated that BMP signaling enhances osteoclast differentiation, we also measured expression of BMP receptors and ligands in Twsg1-/- osteoclasts during osteoclast differentiation. While we did not measure a significant change in any of the BMP receptors, there was a trend for increased expression in

Bmpr1a and Bmpr1b (Fig. 13A-B). There was no difference in expression of BmprII between wild type and Twsg1-/- osteoclasts (Fig. 13C). There were also increases in expression of Bmp4 and Bmp6 in Twsg1-/- however the increases were not significant

(Fig. 13E-F).

51

Figure 13. BMP receptors and ligands are unchanged in TWSG1 null osteoclasts

BMMs from WT and TWSG1 null mice were cultured in M-CSF (Day 0) and M-CSF and

RANKL (Day 1-5) to stimulate osteoclast differentiation. (A) Bmpr1a, (B) Bmpr1b, (C)

BmprII, (D) Bmp2, (E) Bmp4 and (F) Bmp6 RNA expression were measured by RT- qPCR.

3.4 Discussion Twisted gastrulation (TWSG1) has been previously shown to alter BMP signaling (38).

Mice globally deficient TWSG1 are osteopenic due to enhanced osteoclastogenesis with both larger and increased number of osteoclasts mediated through increased BMP signaling, with no changes in osteoblast number or function (38). In this current study, we characterized the mechanism by which TWSG1 null osteoclasts are hypersensitive to

RANKL and M-CSF.

We demonstrated that size of WT or TWSG1 null osteoclasts did not vary significantly in number with increasing concentrations of M-CSF; however, we did measure a significant change in size with increasing concentrations of RANKL. We have shown that the loss of TWSG1 in these cells leads to increased BMP signaling and so we hypothesize that the mechanism by which TWSG1 deficient osteoclasts are more sensitive to RANKL is not due to TWSG1 directly antagonizing RANKL as TWSG1’s only function is with BMP signaling.

We demonstrated that there was increased expression in expression of Rank and c-

Fms, receptors for RANKL and M-CSF, respectively in the TWSG1 deficient mature

52

osteoclasts. The transcription factors MITF and PU.1 have been shown to regulate the expression of Rank and c-Fms during the early phases of osteoclast differentiation (as reviewed in (87) but it not clear if MITF and PU.1 are also responsible for regulating

Rank and c-Fms in mature osteoclasts. It was curious that we only detect increase in

Rank and c-Fms at day 5, and not at early time points during osteoclast differentiation.

It is not clear from our results if the trend towards increase in Bmpr1a and Bmpr1b expression in TWSG1KO cells is responsible at all for the increase in sensitivity towards

RANKL that we measure in TWSG1KO osteoclasts. Both BMP and TAK1 have been shown to signal through the MAPKKK, TAK1. Osteoclasts null for TAK1 expression have decreased pSMAD1/5/8 signaling after three days of M-CSF and RANKL stimulation (88). Another hypothesis that we have to explore if increased both RANKL and BMP signaling via TAK1 activation leads to the increase sensitivity to RANKL that we detect in our TWSG1KO osteoclasts. Additionally, we detect no change in Bmp2 but

Bmp4 and Bmp6 also trend towards higher expression. Again, it is not clear if this is contributing to the phenotype of the TWSG1KO osteoclasts or even creating an environment in which osteoclasts are more sensitive to RANKL activation. Osteoclast secretion of BMPs into the bone marrow microenvironment is an area of research that has not explored. In Chapter 4 of my thesis, I will describe the phenotype of mice that are BMP2 null in myeloid cells and the effects on osteoblasts and osteoclasts.

It has been well described that BMP signaling in osteoblasts regulates RANKL expression and therefore indirectly regulates osteoclast differentiation. However, our study suggests that BMP signaling in osteoclasts may also regulate sensitivity of

53

osteoclasts to RANKL signaling either by increasing expression of Rank or by some other unknown mechanism.

54

Chapter Four

Mice with Osteoclasts Lacking BMP2 Expression Are Osteopenic

55

4.1 Introduction Bone is comprised of multiple cell types including osteoblasts, cells which are responsible for forming bone, and osteoclasts, which are responsible for resorbing bone

(102). Maintenance of the skeleton requires coordinated action of bone resorption and bone formation (103, 104). Osteoblasts have been shown to regulate osteoclast differentiation through the expression of two cytokines, macrophage colony stimulation factor (M-CSF) and receptor activator of NF-kappa B ligand (RANKL) which are necessary and sufficient to stimulate osteoclast differentiation (19). Just as important osteoclasts express signals that stimulate osteoblast activity. Shi et al. demonstrated that GJA is a downstream target of BMP signaling regulating crosstalk between osteoblasts and osteoclasts (83). Bmpr1a;Ctsk-Cre demonstrates that loss of BMPR1A expression in mature osteoclasts increases bone formation (81). Our data as well as others suggest that BMP signaling in osteoclasts may mediated osteoclast-osteoblast coupling during bone remodeling.

Bone morphogenetic proteins (BMPs) are a large family of growth factors that belong to the TGF-B super family. The role of BMP2 in the mesenchymal cell lineage including osteoblasts has been well studied (105), the importance of BMPs expressed by osteoclasts is less understood. Osteoclasts have been shown to express BMP ligands and receptors (37, 43, 45). Our group has previously shown that mice that are null for a

BMP antagonist, Twisted gastrulation, were osteopenic due to enhanced osteoclastogenesis (38). In another study, we demonstrated that mice null for Bmpr2 were osteopetrotic due to decreased osteoclast differentiation and activity (36).

56

The goal of our current study was to determine the significance in the skeleton of BMP2 expressed by osteoclasts. We determined that osteoclasts 3 days after RANKL stimulation secrete detectable levels of BMP2 in the culture supernatant. Mice null for

Bmp2 in cells of the myeloid lineage including osteoclasts are osteopenic at three months of age. In in vitro osteoclast cultures from BMP2cKO mice the osteoclasts are more numerous but smaller compared to wild type cultures. We detected an increase in in vitro osteoclast activity but there was no significant change in CTX-1 a measure of in vivo osteoclast activity. Lastly while not significant we did measure decreases in osteoblast activity by both P1NP and MAR.

4.2 Materials and Methods

4.2.1 Breeding of Bmp2fl/fl;LysM-Cre Bmp2fl/fl mice were obtained from Dr. Stephen Harris, University of Texas-San Antonio

(106). These mice were crossed with B6.129-Lyzstm1(cre)Ifo/J mice (LysM-Cre) which expresses CRE recombinase in cells of the myeloid lineage (Jackson Labs (107). The use and care of these mice was reviewed and approved by the University of Minnesota

Institutional Animal Care and Use Committee, IACUC protocol number 1505-32588A.

4.2.2 Primary Osteoclasts Cell Culture Femora and tibiae were dissected from wild-type or Bmp2fl/fl;LysM-Cre littermates and adherent tissue was removed. Primary bone marrow macrophages from the mice were then isolated from the femora and tibiae. The ends of the femora and tibiae were cut and the bone marrow was flushed out. Using Red Blood Cell lysis buffer (150 mM NH4Cl, 10

57

mM KHCO3 , 0.1 mM EDTA, ph 7.4), red blood cells were lysed from the flushed marrow.

The resulting cells were then plated and cultured overnight in 10 cm tissue culture dishes (TPP, MidSci) in osteoclast media (phenol red-free alpha-MEM (Gibco) with 5% heat inactivated fetal bone serum (Hyclone), 25 units/mL penicillin/streptomycin

(Invitrogen), 400 mM L-Glutamine (Invitrogen), and supplemented with 1% CMG 14-12

(culture supernatant containing M-CSF). Cell populations that were non-adherent, including osteoclast precursor cells, were then removed and replated in 12-well cell culturing plates (TPP, MidSci) at a concentration of 2 x 105 cells/well in osteoclast media supplemented with 1% CMG culture supernatant. Subsequently, every two days, cells were refed with 1% CMG plus 10 ng/mL of RANKL (R&D Systems) to initiate osteoclastogenesis.

4.2.3 Micro Computed Tomography and Bone Morphometric Analysis Samples were scanned in air using the XT H 225 micro-CT machine (Nikon Metrology

Inc., Brighton, MI, USA) at an isotropic voxel size of 6.7 µm. The scan settings were 90 kV, 90 µA, 720 projections, 2 frames per projection, and an integration time of 708 ms.

3D reconstructions were done using the software CT Pro 3D (Nikon metrology, Inc.,

Brighton, MI, USA). BMP datasets for each scan were made using VGStudio MAX 2.1

(Volume Graphics GmbH, Heidelberg, Germany). Morphometric analysis was completed with the SkyScan CT-Analyser (CTAn) software (Bruker micro-CT, Belgium) according to Bruker micro-CT’s Method Note 2. Method Note 8 was used to select cortical and trabecular regions of interest in an automated manner. All 3D models were created with the CT-Volume (CTVol) software (Bruker micro-CT, Belgium).

58

4.2.4 BMP2 ELISA Cell lysates and supernatants were collected from mature WT and BMP2cKO osteoclasts that had been stimulated with M-CSF and RANKL for 5 days. ELISA to measure BMP2 protein was performed per manufacturer’s instructions (R and D

Systems).

4.2.5 ELISA of Bone Biomarkers Serum was harvested at time of euthanasia from animals at 3 months of age and subjected to ELISA as per manufacturer’s protocol. Bone resorption was quantitated with CTX (RatLaps EIA IDS)), bone formation was quantitated with P1NP (Rat/Mouse

P1NP EIA kit, IDS), and osteoclast number was quantitated with TRAP (Mouse TRAP

ELISA, IDS) ELISA.

4.2.6 Tartrate Resistant Acid Phosphatase (TRAP) Staining After culturing the primary osteoclasts as described above, the cells were rinsed using

1X DPBS (Gibco) and fixed with 4% paraformaldehyde for 20 minutes. Primary osteoclasts expressing TRAP were stained using the Naphthol AS-MX phosphate and

Fast Violet LB salt protocol (BD Biosciences Technical Bulletin #445). Cells that were stained were imaged and photographed using light microscopy. The pictures were analyzed using NIH ImageJ to measure the size and number of the TRAP positive osteoclasts.

59

4.2.7 RNA Isolation and Real-Time PCR RNA was harvested from primary osteoclasts plated in duplicate using TRIZOL Reagent

(Ambion, Life Technologies) and quantified using UV spectroscopy. cDNA was then prepared from 1 ug of purified RNA using iScript cDNA Synthesis Kit (Bio-Rad) as per manufacturer’s protocol. Quantitative real-time PCR was performed in duplicate using

CFX Connect Real-Time PCR system (Bio-Rad). Each reaction contained 10 µl iTaq

Universal Sybr Green Supermix, 8.8 µl DEPC water, 500 nM forward and reverse primers, and 1 µl cDNA for a total of 20 µl per reaction. The PCR conditions were as follows: 95°C for 3 minute, and 40 cycles of 94°C for 15 seconds, 58°C for 30 seconds, and 72°C for 30 seconds, followed by melting curve analysis (95°C for 5 seconds, 65°C for 5 seconds, and then 65°C to 95°C with 0.5°C increase for 5 seconds). c-Fos (Forward) 5’-CCA AGC GGA

GAC AGA TCA ACT T (Reverse) 5’-TCCAGTTTTTCC TTCTCTTTCAGCAGA; Nfatc1

(Forward) 5’-TCATCCTGTCCAACACCAAA;(Reverse) 5’ -

TCACCCTGGTGTTCTTCCTC; Cathepsin K (Forward) 5’-

AGGGAAGCAAGCACTGGATA; (Reverse) 5’-GCTGGCTGGAATCACATCTT; Dc-stamp

(Forward) 5’-GGGCACCAGTAT TTTCCTGA; (Reverse) 5’ –

TGGCAGGATCCAGTAAAAGG; Bmpr1a (Forward) 5’–GCTCATCGAGACCTGAAGAG and (Reverse) 5’-GTCTGGAGGCTGGATTATGG); Bmpr1b (Forward) 5’–

AGCACAGATGGGTACTGCTTC and (Reverse) 5’–

TCTAGTCCTAGACATCCAGAGGTG; BmprII (Forward) 5’–

TGGCAGTGAGGTCACTCAAG and (Reverse) 5’–TTGCGTTCATTCTGCATAGC; Bmp4

(Forward) 5’–CCTGGTAACCGAATGCTGAT and (Reverse) 5’–

AGCCGGTAAAGATCCCTCAT; Bmp6 (Forward) 5’–CACAGTCCTCTTCTTCGGGC and

(Reverse) 5’–CTTTTGCATCTCCCGCTTCT; c-Fms (Forward) 5’–

TGCTAAAGTCCACGGCTCAT and (Reverse) 5’–TCGGAGAAAGTTGAGATGGTGT;

60

and Rank (Forward) 5’–CCAGGACAGGGCTGATGAGAA and (Reverse) 5 –

TGGCTGACATACACCACGATGA. Experimental genes were normalized to Hprt

(Forward) 5’–GAGGAGTCCTGTTGATGTTGCCAG and (Reverse) 5’–

GGCTGGCCTATAGGCTCATAGTGC.

4.2.8 Demineralization Assay Primary osteoclasts were plated on Corning Osteo Assay surface plates at a density of

100,000 cells per well. Cells were allowed to fully differentiate. The media was completely removed on day 5 and 100μL/ well of 10% bleach was added and allowed to incubate at room temperature for 5 minutes. The bleach solution was then aspirated and the wells were washed twice with 150μL of dH2O. The plate was then allowed to air dry completely at room temperature for 3-5 hours. The wells were observed at 4x magnification for the formation of resorption pits and images were captured with light microscopy. Images were measured and analyzed using NIH ImageJ.

4.2.9 Western Blot Cell protein lysates were harvested from osteoclasts in modified RIPA buffer (50mM Tris pH 7.4, 150mM NaCl, 1% IGEPAL, 0.25% sodium deoxycholate, 1mM EDTA) supplemented with Halt Protease & Phosphatase Inhibitor Cocktail (Thermo Scientific).

Lysates were cleared by centrifugation at 12,000Xg at 4°C. Proteins were resolved by

SDS-PAGE and transferred to PVDF membrane (Millipore). pSMAD1/5/8 (13820), p- p38 (9211), p38 (9212) and alpha-tubulin (2144) antibodies were obtained from Cell

Signaling. HRP-conjugated anti-rabbit was incubated with membranes, washed, and incubated with Advansta-Western Bright Sirius detection agent.

61

4.2.10 Statistical Analysis Each experiment was run in triplicate and performed three times. All results are expressed as mean ± standard deviation. Student’s unpaired t-test or one-way ANOVA analysis followed by a Tukey’s multiple comparison test were used to compare data using Graph-Pad Prism version 7.

4.3 Results

4.3.1 BMP2 expression during osteoclast differentiation Our lab as well as others had demonstrated that osteoclasts express Bmp2 by RT- qPCR, but it had not been shown that osteoclasts express and/or secrete BMP2 protein

(37, 45). In agreement with previous RT-qPCR data, we found that BMP2 protein could be measured in osteoclast lysates by ELISA starting after 2 days of RANKL stimulation and peaking at 3 days. However, BMP2 was only measured in the osteoclast supernatant at day three (Table 1).

Mean BMP2 Standard Mean Standard concentration Deviation BMP2 Deviation (pg/mL) concentr ation (pg/mL)

WT BMM Lysate WT BMM Supernatant

D0 0 0 D0 0 0

D1 0 0 D1 0 0

62

D2 366.25 321.73 D2 0 0

D3 51.25 261.63 D3 58.75 63.63

D4 151.875 175.89 D4 0 0

Table 1. Expression Levels of BMP2 During Osteoclast Differentiation.

Quantification of BMP2 expressed by bone marrow macrophages (BMMs) either treated with M-CSF (Day0) or M-CSF and RANKL (Day1 through Day4).

4.3.2 Bmp2fl/fl;LysM-Cre mice are osteopenic We have previously demonstrated that addition of recombinant BMP2 to RANKL stimulated osteoclast cultures or loss of BMP antagonist leads to enhanced osteoclast size (37, 38). To determine the skeletal phenotype of mice that are null for BMP2 expression in osteoclasts, conditional BMP2 knockout mice, Bmp2fl/fl obtained from Dr.

Stephen Harris (106) and a LysM-Cre mice from Jackson Labs were bred. Bmp2fl/fl and

Bmp2fl/fl;LysM-Cre mice herein referred to as WT and BMP2cKO respectively.

BMP2cKO mice were viable and developed similar to their WT littermates. To determine the skeletal phenotype 3-month old male mice were analyzed by micro-CT. As shown in

Figure 14, BMP2cKO measured a significant decrease in bone volume fraction per total volume (BV/TV) in comparison to WT femoral BV/TV. The decrease in BV/TV was accompanied by a significant decrease trabecular number and a trend towards an increase in trabecular spacing (p=0.09). These results demonstrate that loss of BMP2 expression in osteoclasts leads to osteopenia effecting the trabecular bone space.

63

Figure 14. Mice null for BMP2 in myeloid cells are osteopenic

Three month old male Bmp2fl/fl ;LysM-Cre mice were analyzed by micro-CT. (A)

Representative micro-CT scans of the distal femur from WT and BMP2cKO mice at three months of age. (B) Comparison of bone volume/ total volume (C), trabecular number (D) and trabecular spacing and (E) trabecular thickness. Data represent the mean values of 5 WT, 7 KO. Samples were compared using T-test ** p<0.001 vs. WT.

4.3.3 Osteoclasts Null for BMP2 expression are smaller than WT Mice that are null for BMP2 expression in myeloid cells, BMP2cKO, are osteopenic.

Since we created mice that are null for BMP2 in myeloid cells including osteoclasts, we 64

determined the phenotype of the osteoclasts from the BMP2cKO mice. We analyzed osteoclast size and number after 2, 3 or 4 days of RANKL stimulation (Figure 16). We confirmed that osteoclasts from BMP2cKO had a significant decrease in Bmp2 RNA

(Figure 15A). After 3 or 4 days of RANKL stimulation, BMP2cKO osteoclasts measured smaller in comparison to WT; however, at day 4, the number of osteoclasts (number of

TRAP positive cells) was increased in BMP2cKO compared to osteoclasts cultured from

WT mice (Figure 15D). This data supports our published data suggesting that BMP2 is not required for osteoclast differentiation, but instead enhances the size of osteoclasts.

Figure 15.

Figure 15. Osteoclasts null for BMP2 expression are smaller but more numerous than wild type 65

Bone marrow macrophages (BMMs) were flushed from WT or BMP2cKO mice. BMMs were stimulated with M-CSF and RANKL for indicated days. (A) qRT-PCR was used to measure Bmp2 gene expression following 2 days of RANKL stimulation. TRAP stained images and quantification of BMMs differentiated with M-CSF and RANKL for 2 days (B),

3 days (C) or 4 days (D). Samples were compared using unpaired student’s T-test* p<0.05 vs. WT, ** p<0.01 vs. WT, *** p<0.001 vs. WT, **** p<0.0001 vs. WT

4.3.4 BMP2cKO osteoclasts express increased Nfatc1 To determine if changes in gene expression were responsible for the decrease in size in the osteoclasts from the BMP2cKO mice, we first measured gene expression for c-Fms,

Rank as well as BMP receptors and ligands. While both c-Fms and Rank were increased in expression in the osteoclasts from the BMP2cKO mice, the differences were not significant (Figure 16).

Figure 16. Expression of c-Fms and Rank in WT and BMP2cKO osteoclasts

qRT-PCR comparing expression of osteoclast genes from WT and Bmp2;LysM-Cre mice.

(A) c-Fms, and (B) Rank. Data shown are the mean + SD of three independent experiments in which gene expression was measured from three wells of each genotype, with each PCR reaction performed in duplicate. Expression of each gene is graphed relative to Hprt. Samples were compared using unpaired student T-test.

66

Additionally, there were no significant differences in expression of Bmpr2, Bmpr1a,

Bmpr1b, Bmp4 or Bmp6 (Figures 17 and 18).

Figure 17. Expression of BMP receptors by BMP2cKO and WT osteoclasts qRT-PCR comparing expression of osteoclast genes from WT and Bmp2;LysM-Cre mice.

(A) Bmpr1a (B) Bmpr1b and (C) Bmpr2. Data shown are the mean + SD of three independent experiments in which gene expression was measured from three wells of each genotype, with each PCR reaction performed in duplicate. Expression of each gene is graphed relative to Hprt. Samples were compared using unpaired student T-test.

67

Figure 18. Expression of Bmp4 and 6 in BMP2cKO and WT osteoclasts

qRT-PCR comparing expression of osteoclast genes from WT and Bmp2;LysM-Cre mice.

(A) Bmp4 and (B) Bmp6. Data shown are the mean+SD of three independent experiments in which gene expression was measured from three wells of each genotype, with each

PCR reaction performed in duplicate. Expression of each gene is graphed relative to Hprt.

Samples were compared using unpaired student T-test.

Lastly, we examined expression of c-Fos, Nfatc1, Dc-stamp and cathepsin K (Ctsk) after

2 days stimulation with RANKL. As shown in Figure 19, we detected a significant increase in Nfatc1 expression in BMP2cKO compared to WT osteoclasts (Figure 19B).

The other three osteoclast differentiation markers measured no significant change in expression. The increase in Nfatc1 expression may explain why we measure an increase in the number of TRAP positive multinuclear cells in the BMP2cKO osteoclasts as Nfatc1 is the master regulator of osteoclast differentiation.

68

Figure 19. BMP2cKO osteoclasts express an increase in Nfatc1 qRT-PCR comparing expression of osteoclast genes from WT and BMP2cKO mice after

2 days of RANKL treatment. (A) c-Fos, (B) Nfatc1, (C) Dcstamp, and (D) Ctsk. Data shown are the mean + SD of three independent experiments in which gene expression was measured from three wells of each genotype, with each PCR reaction performed in duplicate. Expression of each gene is graphed relative to Hprt. Samples were compared using T-test * p<0.05 vs. WT.

4.3.5 BMP2cKO osteoclasts are increased in demineralization Because we measured an increase in the number of TRAP positive multinuclear cells in osteoclast cultures from BMP2cKO mice, we plated cells on calcium phosphate coated wells to measure the ability of osteoclasts to demineralize a calcium phosphate surface.

As shown in Figure 20, we measured a 2-fold increase in the ability of BMP2cKO

69

osteoclasts to demineralize calcium phosphate surface (Figure 20A). Although both the in-vitro OCL measured increased resorption and the in-vivo data showed that the mice were osteopenic, we did not measure a significant change in CTX-1, an in-vivo serum marker for bone resorption in the BMP2cKO mice compared to WT mice (Figure 20B).

Figure 20. In vitro and in vivo resorption activity of BMP2cKO osteoclasts

BMMs from WT and BMP2cKO were cultured on calcium phosphate coated wells. (A)

Representative images of demineralization by WT or BMP2cKO osteoclasts. (B)

Quantification of total percent demineralized by WT and BMP2cKO osteoclasts. (C)

Quantification of in vivo osteoclast activity in WT and BMP2cKO mice as measured by

CTX-1 ELISA.

4.3.6 Bmp2fl/fl;LysM-Cre mice and bone formation Because the BMP2cKO mice are osteopenic and we did not measure a change in in vivo bone resorption, we used both P1NP ELISA to determine the bone deposition globally in

70

BMP2cKO mice and dynamic bone histomorphometry to determine deposition rate on the surface of the cortical bone (Figure 21A-B). Both by P1NP ELISA (Figure 21A, p=0.0506) and dynamic bone histomorphometry (Figure 21B, p=0.07), we measured a trend towards a decrease in bone formation in the BMP2cKO. Our sample size was small with only 3WT and 3 BMP2cKO mice being measured. Interestingly, the cortical thickness in the femoral shafts of these animals were equivalent (Figure 21C-D). Our

P1NP ELISA and dynamic histomorphometric data suggest that the osteopenia we measure in the BMP2cKO may be due to a decrease in bone formation. Together these data suggest that BMP2cKO mice have decreased bone formation.

Figure 21. Bone formation markers and measurements

Three month old WT and BMP2cKO male mice were analyzed for cortical bone parameters by micro-CT. (A) ELISA analysis of P1NP as a marker of bone formation (B) 71

mineral apposition rate (C) representative µCT scans of cortical bone of femurs from WT and BMP2cKO male mice at 3 months of age. (D) cortical thickness. Data represent the mean values of 5 WT, 7 KO for cortical thickness measurements. Samples were compared using T-test.

4.3.7 Osteoclasts null for BMP2 express changes in canonical but not noncanonical BMP signaling BMPs have been shown to signal through both SMAD independent (noncanonical) and

SMAD dependent (canonical) signaling pathways (108). To evaluate which BMP signaling pathway are changed in osteoclasts from BMP2cKO, we harvested cell lysates from bone marrow macrophages that had been stimulated with RANKL for 3 days

(Figure 22). Osteoclasts from BMP2cKO mice expressed a decrease in p-SMAD1/5/8, with a modest increase in p-p38. These data suggest that loss of BMP2 in early osteoclastogenesis results in a substantial decrease in the canonical p-SMAD pathway which does not inhibit the ability of osteoclasts to differentiate but does decrease the size of the osteoclasts.

Figure 22. BMP2cKO have decreased pSMAD1/5 signaling

72

Western blot of osteoclast extracts that were cultured in the presence of M-CSF and

RANKL for 3 days. pSMAD1/5, pp38 and total p38 levels were analyzed by Western blot.

4.4 Discussion Accumulating evidence from our lab and others established the significance of BMP signaling in osteoclast differentiation (36-38, 83). We have previously shown that global knockout of a BMP antagonist, Twisted gastrulation, lead to enhanced osteoclastogenesis and osteopenia while loss of BMP receptor type 2 in osteoclasts results in decreased osteoclast differentiation and osteopetrosis (38). However, the significance of BMP2 expression during osteoclast differentiation had not been previously explored. In this present study we demonstrate that osteoclasts express

BMP2 protein and BMP2 protein can be detected in the supernatant of osteoclast cultures on day 3 after RANKL treatment. We determined that the skeleton of mice null for BMP2 in osteoclasts is osteopenic. We found that loss of BMP2 in osteoclasts resulted in a substantial decrease in osteoclast size, but not number or function. This increase in osteoclast number may be due to the increase in Nfatc1, the ‘master transcription factor’ of osteoclastogenesis (109). Nfatc1 expression was the only osteoclast marker gene that was significantly changed by qRT-PCR. While it is not clear at this time in the discrepancy between our in vitro and in vivo resorption results, it may be due to differences in substrate. Similar to our results, Bmpr1a;Ctsk-Cre mice had increased number of multinuclear TRAP positive cells (81). These data indicate that the

73

signaling mechanism for bone mineral resorption and cellular differentiation may be uncoupled in this animal model.

Our BMPcKO animal model was osteopenic, showing a significant decrease in the percent of bone volume to total volume of the trabecular space, with only minor changes of the cortical space. Bone measurements for this animal model were obtained from 3 month old male mice, which are skeletally mature. Larger differences may be observable in older mice. This may be due to the slower turnover time of the cortical bone. While trabecular bone has a higher surface volume, and is more easily accessible to pre-osteoclastic cells, the cortical bone has osteocytes which may play a factor in regulate its resorption and negate the effect of the osteoclasts.

Mice that have osteoclasts that are null for SMAD1/5 expression are also osteopenic similar to the BMP2cKO mice (110). In both mouse models, the osteoclasts are smaller but more numerous compared to the WT osteoclasts; however, unlike the BMP2cKO the

SMAD1/5cKO osteoclasts initially fuse sooner than the WT osteoclasts (110). This difference may be due to other signaling changes not just loss of SMAD1/5 activation that we have not yet identified in the BMP2cKO osteoclasts.

Our own work as well as the work of others suggests that BMP signaling in osteoclasts regulates the coupling between osteoblasts and osteoclasts (70, 83, 110). Mice that are null for Bmpr1a in mature osteoclasts have increased osteoblast mineralization in vitro

(83). In our SMAD1/5cKO mouse model, we measured increased cortical bone and osteoblast activity by P1NP ELISA (110). While we did not measure any significant differences in cortical bone between the BMP2cKO and the WT mice, we did see a trend by both P1NP and MAR of decreased osteoblast activity. These measurements may have been significant if we had more mice included in our analysis.

74

The signaling pathways by which BMP2 regulates osteoclast differentiation is not entiriely clear. Our lab has developed several models with aberrant signaling the

BMP/SMAD pathways (36, 38, 110). Previous data from our lab has shown that mice with osteoclasts expressing modified expression of BMPR2 are smaller; however,

BMPR2cKO osteoclasts have decreased p38 signaling but wild type levels of SMAD1/5 signaling (36). The BMP2cKO osteoclasts have nondetectable levels of pSMAD1/5 but wild type levels of phosphorylated p38 kinase. This is an interesting result since both mouse models modify BMP signaling in cells of the myeloid lineage, suggesting that another ligand other than BMP2 may activate BMPR2 and SMAD-independent signaling during the early stages of osteoclast differentiation.

We conclude that osteoclast derived BMP2 plays a large role in not only osteoclastogenesis but in bone mineral homeostasis resulting in osteopenia and a substantial decrease in the trabecular bone fraction. These effects are not isolated, and osteoblast function may be altered in these mice. The mechanism for this effect, and why it is seen to a lesser effect in the cortical bone as well, is an area that our lab will continue to explore.

75

Chapter 5

Summary, Conclusions and Future Directions

76

This thesis address osteoclastogenesis through the lens of bone morphogenetic proteins and taken together our data sheds light on the tight regulation of bone homeostasis as regulated by BMPs. Maintenance of optimal BMP signaling levels is critical, and BMPs play a major role in multiple tissue types from embryological development to postnatal bone homeostasis. BMPs are highly conserved, existing in one of the simplest forms as

DPP in Drosophila. The replication and variation the various BMP ligands has added to the evolutionary complexity of the system as we view it today. Our understanding of the

BMPs and their regulation is incomplete. This is due to the added layers of complexity that exist in the biological system. For example, when considering bone homeostasis it

77

is apparent multiple BMP ligands and receptors are expressed as well as various intracellular signaling pathways can be activated. These proteins can function in a bipolar manner depending on the presence of other regulators. Therefore untangling the complexity of BMPs on bone homeostasis and osteoclastogesis remains an unsolved problem.

Understanding the function of various BMPs plays a critical role in the clinical utility and of these ligands. As noted in the introduction the concept of using bone or bone rudiments in clinical practice has been around since the mid 1600s. Urist’s work in 1965 demonstrated a single component could allow for the formation of bone and collagen.

Multiple labs have focused their research on understanding how BMPs stimulate osteoblasts and bone formation; however, BMPs can also stimulate osteoclasts. Our data as well as the data of others has demonstrated that BMPs regulation of osteoclast differentiation and activity is just an interesting question. Also recent research has suggested that BMPs may regulate osteoclast and osteoblast coupling. Coupling of bone formation and resorption is an interesting question since future therapies for skeletal disorders will more than likely depend on a better understanding of the coupling process.

Extracellular regulation of BMPs plays a critical role in bone homeostasis and mineralization. One such regulator is Twisted gastrulation, an extracellular BMP binding protein which plays a unique role during osteoclastogenesis. Osteoclasts deficient in

Twisted gastrulation have enhanced osteoclastogenesis with no apparent effect on osteoblast activity. To understand whether the effect of Twisted gastrulation is via regulation of BMP signaling, we created multiple protein mutants which were unable to

78

bind the BMPs. Overexpression of wild type Twisted gastrulation suppresses osteoclastogenesis by decreasing BMP signaling. Conversely, we found that over expression of Twisted gastrulation mutants led to an increase in osteoclastogenesis, with increased BMP signaling. These cells had an increase in both their canonical and non-canonical signaling pathways. Interestingly, osteoclasts over expressing Twisted gastrulation mutants are larger and resorb more mineral matrix then their control counterparts. We hypothesize that this increase in activity is due to the interaction of

Twisted gastrulation with other extracellular proteins. This interaction allows the complex to either be an antagonist or an agonist of BMP signaling. Our results suggest to us that there may be a dual function of Twisted gastrulation and osteoclasts; their ability to act as both an antagonist or an agonist depending on other protein binding. We hypothesiae that other cysteine rich proteins, such as crossveiless-2, may play critical role in conjunction with Twisted gastrulation to maintain a BMP gradient and signaling.

The function of Twisted gastrulation on osteoclastogenesis is profound, and phenotypically leads to osteopenia due to increased osteoclast number and function with no effect on osteoblast function. To determine if the phenotypic effect was due to hypersensitivity to growth factor signaling, we compared the difference in differentiation to different concentrations of M-CSF or RANKL, the two cytokines necessary for osteoclast differentiation. We found that TWSG1-KO osteoclast were hypersensitive to

RANKL and responded by increasing in size. We also measured an increase in Rank expression suggesting that one possible mechanism for the enhanced osteoclast differentiation is the increase in Rank expression. Therefore, we presume the effect of the loss of TWSG1 is due to the increased sensitivity of osteoclasts which results in hyper-osteoclast differentiation and increased bone resorption.

79

The importance of BMPs on the growth and development of osteoclasts is still an unexplored are of research. In order to understand which BMPs, and in what amount, were being produced by osteoclasts, we measured BMP2 expression throughout differentiation. In order to assess the function of BMP2 from osteoclasts in regulating osteoclast differentiation, we created a Cre/Lox mouse model deficient in BMP2 in myeloid lineage cells including osteoclasts. We found that these mice were osteopenic, having decreased bone volume fraction in their trabecular bone, with no difference in their cortical bone. An in-vitro analysis of BMP2-cKO osteoclasts revealed that these cells were smaller than their WT counterparts. Interestingly, these BMP2 deficient osteoclasts resorb more mineral matrix in vitro. This may be due to the significant increase in Nfatc1, the ‘master regulator’ transcription factor in osteoclasts. While the cells were smaller, they still resorbed bone mineral matrix. We found that BMP2-cKO osteoclasts predominantly retain their non-canonical p-P38 signaling pathway, while there canonical SMAD pathway is greatly diminished. These data, along with our labs previous data, indicate that these pathways play two distinct roles in osteoclastogenesis, and that loss of the p-SMAD pathway results in a substantial decrease in fusion, but no decrease on the resorption capabilities of these cells.

Therefore, osteoclast derived BMP2 acts as a regulator of osteoclastogenesis increasing its size through the canonical SMAD signaling pathway. A second function of BMP2 from osteoclasts may be in the regulation of osteoblastogenesis, At the present time we are uncertain if this is a direct effect of BMP2 from osteoclasts or some other BMP2 regulated osteoclast derived factor.

80

Literature Cited 1. N S. On the healing of aspectic bone cavities by implantation of antisepctic decalcified bone. Am J Med Sci. 1889;98:219-43.

2. Meekeren Jv. Heel- en Geneeskonstige Aanmerkingen. Commelijn Amsterdam. 1668.

3. Urist MR. Bone: formation by autoinduction. Science. 1965;150(698):893-9.

81

4. Celeste AJ, Iannazzi JA, Taylor RC, Hewick RM, Rosen V, Wang EA, Wozney JM. Identification of transforming growth factor beta family members present in bone- inductive protein purified from bovine bone. Proc Natl Acad Sci U S A. 1990;87(24):9843-7. PubMed PMID: 2263636; PMCID: PMC55270.

5. Kokabu S, Gamer L, Cox K, Lowery J, Tsuji K, Raz R, Economides A, Katagiri T, Rosen V. BMP3 suppresses osteoblast differentiation of bone marrow stromal cells via interaction with Acvr2b. Mol Endocrinol. 2012;26(1):87-94. doi: 10.1210/me.2011-1168. PubMed PMID: 22074949; PMCID: PMC3248326.

6. Luu HH, Song WX, Luo X, Manning D, Luo J, Deng ZL, Sharff KA, Montag AG, Haydon RC, He TC. Distinct roles of bone morphogenetic proteins in osteogenic differentiation of mesenchymal stem cells. J Orthop Res. 2007;25(5):665-77. doi: 10.1002/jor.20359. PubMed PMID: 17290432.

7. Feiner N, Begemann G, Renz AJ, Meyer A, Kuraku S. The origin of bmp16, a novel Bmp2/4 relative, retained in teleost fish genomes. BMC Evol Biol. 2009;9:277. doi: 10.1186/1471-2148-9-277. PubMed PMID: 19951429; PMCID: PMC2801517.

8. Boyne PJ, Marx RE, Nevins M, Triplett G, Lazaro E, Lilly LC, Alder M, Nummikoski P. A feasibility study evaluating rhBMP-2/absorbable collagen sponge for maxillary sinus floor augmentation. Int J Periodontics Restorative Dent. 1997;17(1):11- 25. Epub 1997/02/01. PubMed PMID: 10332250.

9. Howell TH, Fiorellini J, Jones A, Alder M, Nummikoski P, Lazaro M, Lilly L, Cochran D. A feasibility study evaluating rhBMP-2/absorbable collagen sponge device for local alveolar ridge preservation or augmentation. Int J Periodontics Restorative Dent. 1997;17(2):124-39.

10. McKay WF, Peckham SM, Badura JM. A comprehensive clinical review of recombinant human bone morphogenetic protein-2 (INFUSE Bone Graft). Int Orthop. 2007;31(6):729-34. Epub 2007/07/20. doi: 10.1007/s00264-007-0418-6. PubMed PMID: 17639384; PMCID: PMC2266665.

11. White AP, Vaccaro AR, Hall JA, Whang PG, Friel BC, McKee MD. Clinical applications of BMP-7/OP-1 in fractures, nonunions and spinal fusion. Int Orthop. 2007;31(6):735-41. Epub 2007/10/27. doi: 10.1007/s00264-007-0422-x. PubMed PMID: 17962946; PMCID: PMC2266670.

12. Bessa PC, Casal M, Reis RL. Bone morphogenetic proteins in tissue engineering: the road from laboratory to clinic, part II (BMP delivery). J Tissue Eng Regen Med. 2008;2(2-3):81-96. Epub 2008/04/03. doi: 10.1002/term.74. PubMed PMID: 18383454.

13. Cahill KS, Chi JH, Day A, Claus EB. Prevalence, complications, and hospital charges associated with use of bone-morphogenetic proteins in spinal fusion procedures. JAMA. 2009;302(1):58-66. doi: 10.1001/jama.2009.956. PubMed PMID: 19567440.

82

14. Burkus JK, Sandhu HS, Gornet MF, Longley MC. Use of rhBMP-2 in combination with structural cortical allografts: clinical and radiographic outcomes in anterior lumbar spinal surgery. J Bone Joint Surg Am. 2005;87(6):1205-12. doi: 10.2106/JBJS.D.02532. PubMed PMID: 15930528.

15. Dimar JR, Glassman SD, Burkus KJ, Carreon LY. Clinical outcomes and fusion success at 2 years of single-level instrumented posterolateral fusions with recombinant human bone morphogenetic protein-2/compression resistant matrix versus iliac crest bone graft. Spine (Phila Pa 1976). 2006;31(22):2534-9; discussion 40. doi: 10.1097/01.brs.0000240715.78657.81. PubMed PMID: 17047540.

16. Vaccaro AR, Whang PG, Patel T, Phillips FM, Anderson DG, Albert TJ, Hilibrand AS, Brower RS, Kurd MF, Appannagari A, Patel M, Fischgrund JS. The safety and efficacy of OP-1 (rhBMP-7) as a replacement for iliac crest autograft for posterolateral lumbar arthrodesis: minimum 4-year follow-up of a pilot study. Spine J. 2008;8(3):457- 65. doi: 10.1016/j.spinee.2007.03.012. PubMed PMID: 17588821.

17. Vaidya R, Sethi A, Bartol S, Jacobson M, Coe C, Craig JG. Complications in the use of rhBMP-2 in PEEK cages for interbody spinal fusions. J Spinal Disord Tech. 2008;21(8):557-62. doi: 10.1097/BSD.0b013e31815ea897 00024720-200812000-00005 [pii].

18. Teitelbaum SL. Bone resorption by osteoclasts. Science. 2000;289(5484):1504- 8. doi: 8789 [pii].

19. Xiong J, Onal M, Jilka RL, Weinstein RS, Manolagas SC, O'Brien CA. Matrix- embedded cells control osteoclast formation. Nat Med. 2011;17(10):1235-41. doi: 10.1038/nm.2448. PubMed PMID: 21909103; PMCID: PMC3192296.

20. Tondravi MM, McKercher SR, Anderson K, Erdmann JM, Quiroz M, Maki R, Teitelbaum SL. Osteopetrosis in mice lacking haematopoietic transcription factor PU.1. Nature. 1997;386(6620):81-4. doi: 10.1038/386081a0. PubMed PMID: 9052784.

21. Takayanagi H, Kim S, Koga T, Nishina H, Isshiki M, Yoshida H, Saiura A, Isobe M, Yokochi T, Inoue J, Wagner EF, Mak TW, Kodama T, Taniguchi T. Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in terminal differentiation of osteoclasts. Dev Cell. 2002;3(6):889-901. PubMed PMID: 12479813.

22. Grigoriadis AE, Wang ZQ, Cecchini MG, Hofstetter W, Felix R, Fleisch HA, Wagner EF. c-Fos: a key regulator of osteoclast-macrophage lineage determination and bone remodeling. Science. 1994;266(5184):443-8. PubMed PMID: 7939685.

23. Iotsova V, Caamano J, Loy J, Yang Y, Lewin A, Bravo R. Osteopetrosis in mice lacking NF-kappaB1 and NF-kappaB2. Nat Med. 1997;3(11):1285-9. PubMed PMID: 9359707.

24. Ross FP. M-CSF, c-Fms, and signaling in osteoclasts and their precursors. Ann N Y Acad Sci. 2006;1068:110-6. doi: 10.1196/annals.1346.014. PubMed PMID: 16831911. 83

25. Mensah KA, Ritchlin CT, Schwarz EM. RANKL induces heterogeneous DC- STAMP(lo) and DC-STAMP(hi) osteoclast precursors of which the DC-STAMP(lo) precursors are the master fusogens. J Cell Physiol. 2010;223(1):76-83. doi: 10.1002/jcp.22012. PubMed PMID: 20039274; PMCID: PMC2814997.

26. Yagi M, Miyamoto T, Sawatani Y, Iwamoto K, Hosogane N, Fujita N, Morita K, Ninomiya K, Suzuki T, Miyamoto K, Oike Y, Takeya M, Toyama Y, Suda T. DC-STAMP is essential for cell-cell fusion in osteoclasts and foreign body giant cells. J Exp Med. 2005;202(3):345-51. doi: 10.1084/jem.20050645.

27. Verma SK, Leikina E, Melikov K, Gebert C, Kram V, Young MF, Uygur B, Chernomordik LV. Cell-surface phosphatidylserine regulates osteoclast precursor fusion. J Biol Chem. 2018;293(1):254-70. doi: 10.1074/jbc.M117.809681. PubMed PMID: 29101233; PMCID: PMC5766907.

28. Lee SH, Rho J, Jeong D, Sul JY, Kim T, Kim N, Kang JS, Miyamoto T, Suda T, Lee SK, Pignolo RJ, Koczon-Jaremko B, Lorenzo J, Choi Y. v-ATPase V0 subunit d2- deficient mice exhibit impaired osteoclast fusion and increased bone formation. Nat Med. 2006;12(12):1403-9. doi: nm1514 [pii] 10.1038/nm1514.

29. Teitelbaum SL. Osteoclasts and integrins. Ann N Y Acad Sci. 2006;1068:95-9. doi: 10.1196/annals.1346.017. PubMed PMID: 16831909.

30. Boyce BF, Xing L. Functions of RANKL/RANK/OPG in bone modeling and remodeling. Arch Biochem Biophys. 2008;473(2):139-46. doi: 10.1016/j.abb.2008.03.018. PubMed PMID: 18395508; PMCID: PMC2413418.

31. Seeman E. Bone modeling and remodeling. Crit Rev Eukaryot Gene Expr. 2009;19(3):219-33. PubMed PMID: 19883366.

32. Charles JF, Aliprantis AO. Osteoclasts: more than 'bone eaters'. Trends Mol Med. 2014;20(8):449-59. doi: 10.1016/j.molmed.2014.06.001. PubMed PMID: 25008556; PMCID: PMC4119859.

33. Abe E. Function of BMPs and BMP antagonists in adult bone. Ann N Y Acad Sci. 2006;1068:41-53. doi: 10.1196/annals.1346.007. PubMed PMID: 16831904.

34. Carreira AC, Lojudice FH, Halcsik E, Navarro RD, Sogayar MC, Granjeiro JM. Bone morphogenetic proteins: facts, challenges, and future perspectives. Journal of dental research. 2014;93(4):335-45. doi: 10.1177/0022034513518561 [doi].

35. Wang RN, Green J, Wang Z, Deng Y, Qiao M, Peabody M, Zhang Q, Ye J, Yan Z, Denduluri S, Idowu O, Li M, Shen C, Hu A, Haydon RC, Kang R, Mok J, Lee MJ, Luu HL, Shi LL. Bone Morphogenetic Protein (BMP) signaling in development and human diseases. Genes Dis. 2014;1(1):87-105. doi: 10.1016/j.gendis.2014.07.005. PubMed PMID: 25401122; PMCID: PMC4232216.

36. Broege A, Pham L, Jensen ED, Emery A, Huang TH, Stemig M, Beppu H, Petryk A, O'Connor M, Mansky K, Gopalakrishnan R. Bone morphogenetic proteins signal via SMAD and mitogen-activated protein (MAP) kinase pathways at distinct times during 84

osteoclastogenesis. The Journal of biological chemistry. 2013;288(52):37230-40. doi: 10.1074/jbc.M113.496950 [doi].

37. Jensen ED, Pham L, J BC, Jr., Espe K, Carlson AE, Westendorf JJ, Petryk A, Gopalakrishnan R, Mansky KC. Bone Morphogenetic Protein 2 Directly Enhances Differentiation of Murine Osteoclast Precursors. Journal of Cellular Biochemistry. 2010;109(4):672-82.

38. Rodriguez JS, Mansky KC, Jensen ED, Carlson AE, Schwarz T, Pham L, Mackenzie B, Prasad H, Rohrer MD, Petryk A, Gopalakrishnan R. Enhanced Osteoclastogenesis Causes Osteopenia in Twisted Gastrulation-Deficient Mice through Increased BMP Signaling. J Bone Miner Res. 2009;24(11):1917-26. doi: 10.1359/jbmr.090507.

39. Fong D, Bisson M, Laberge G, McManus S, Grenier G, Faucheux N, Roux S. Bone morphogenetic protein-9 activates Smad and ERK pathways and supports human osteoclast function and survival in vitro. Cell Signal. 2013;25(4):717-28. doi: 10.1016/j.cellsig.2012.12.003. Epub 2013 Jan 8. 10.1016/j.cellsig.2012.12.003.

40. Bragdon B, Moseychuk O, Saldanha S, King D, Julian J, Nohe A. Bone morphogenetic proteins: a critical review. Cellular signalling. 2011;23(4):609-20. doi: 10.1016/j.cellsig.2010.10.003 [doi].

41. Miyazono K, Kamiya Y, Morikawa M. Bone morphogenetic protein receptors and signal transduction. J Biochem. 2010;147(1):35-51. doi: 10.1093/jb/mvp148. PubMed PMID: 19762341.

42. Mueller TD, Nickel J. Promiscuity and specificity in BMP receptor activation. FEBS Lett. 2012;586(14):1846-59. Epub 2012/06/20. doi: 10.1016/j.febslet.2012.02.043. PubMed PMID: 22710174.

43. Kaneko H, Arakawa T, Mano H, Kaneda T, Ogasawara A, Nakagawa M, Toyama Y, Yabe Y, Kumegawa M, Hakeda Y. Direct stimulation of osteoclastic bone resorption by bone morphogenetic protein (BMP)-2 and expression of BMP receptors in mature osteoclasts. Bone. 2000;27(4):479-86. doi: S8756-3282(00)00358-6 [pii].

44. Okamoto M, Murai J, Yoshikawa H, Tsumaki N. Bone morphogenetic proteins in bone stimulate osteoclasts and osteoblasts during bone development. J Bone Miner Res. 2006;21(7):1022-33. doi: 10.1359/jbmr.060411.

45. Garimella R, Tague SE, Zhang J, Belibi F, Nahar N, Sun BH, Insogna K, Wang J, Anderson HC. Expression and synthesis of bone morphogenetic proteins by osteoclasts: a possible path to anabolic bone remodeling. J Histochem Cytochem. 2008;56(6):569- 77. doi: 10.1369/jhc.2008.950394. PubMed PMID: 18319273; PMCID: PMC2386763.

46. Sterchi EE, Stocker W, Bond JS. Meprins, membrane-bound and secreted astacin metalloproteinases. Mol Aspects Med. 2008;29(5):309-28. doi: 10.1016/j.mam.2008.08.002. PubMed PMID: 18783725; PMCID: PMC2650038.

85

47. Rattenholl A, Pappano WN, Koch M, Keene DR, Kadler KE, Sasaki T, Timpl R, Burgeson RE, Greenspan DS, Bruckner-Tuderman L. Proteinases of the bone morphogenetic protein-1 family convert procollagen VII to mature anchoring fibril collagen. J Biol Chem. 2002;277(29):26372-8. doi: 10.1074/jbc.M203247200. PubMed PMID: 11986329.

48. Anderson HC, Hodges PT, Aguilera XM, Missana L, Moylan PE. Bone morphogenetic protein (BMP) localization in developing human and rat growth plate, metaphysis, epiphysis, and articular cartilage. J Histochem Cytochem. 2000;48(11):1493-502.

49. Itoh K, Udagawa N, Katagiri T, Iemura S, Ueno N, Yasuda H, Higashio K, Quinn JM, Gillespie MT, Martin TJ, Suda T, Takahashi N. Bone morphogenetic protein 2 stimulates osteoclast differentiation and survival supported by receptor activator of nuclear factor-kappaB ligand. Endocrinology. 2001;142(8):3656-62.

50. Bhatia M, Bonnet D, Wu D, Murdoch B, Wrana J, Gallacher L, Dick JE. Bone morphogenetic proteins regulate the developmental program of human hematopoietic stem cells. The Journal of experimental medicine. 1999;189(7):1139-48.

51. Abe E, Yamamoto M, Taguchi Y, Lecka-Czernik B, O'Brien CA, Economides AN, Stahl N, Jilka RL, Manolagas SC. Essential requirement of BMPs-2/4 for both osteoblast and osteoclast formation in murine bone marrow cultures from adult mice: antagonism by noggin. J Bone Miner Res. 2000;15(4):663-73. doi: 10.1359/jbmr.2000.15.4.663. PubMed PMID: 10780858.

52. Koide M, Murase Y, Yamato K, Noguchi T, Okahashi N, Nishihara T. Bone morphogenetic protein-2 enhances osteoclast formation mediated by interleukin-1alpha through upregulation of osteoclast differentiation factor and cyclooxygenase-2. Biochemical and biophysical research communications. 1999;259(1):97-102. doi: 10.1006/bbrc.1999.0715 [doi].

53. An Z, Wang H, Song P, Zhang M, Geng X, Zou MH. Nicotine-induced activation of AMP-activated protein kinase inhibits fatty acid synthase in 3T3L1 adipocytes: a role for oxidant stress. J Biol Chem. 2007;282(37):26793-801. doi: 10.1074/jbc.M703701200.

54. Williams ES, Uhas KA, Bunke BP, Garber KB, Martin CL. Cleft palate in a multigenerational family with a microdeletion of 20p12.3 involving BMP2. Am J Med Genet A. 2012;158A(10):2616-20. doi: 10.1002/ajmg.a.35594. PubMed PMID: 22965927; PMCID: PMC3448788.

55. Tsuji K, Bandyopadhyay A, Harfe BD, Cox K, Kakar S, Gerstenfeld L, Einhorn T, Tabin CJ, Rosen V. BMP2 activity, although dispensable for bone formation, is required for the initiation of fracture healing. Nat Genet. 2006;38(12):1424-9. doi: 10.1038/ng1916. PubMed PMID: 17099713.

56. Chappuis V, Gamer L, Cox K, Lowery JW, Bosshardt DD, Rosen V. Periosteal BMP2 activity drives bone graft healing. Bone. 2012;51(4):800-9. doi: 10.1016/j.bone.2012.07.017. PubMed PMID: 22846673.

86

57. Daluiski A, Engstrand T, Bahamonde ME, Gamer LW, Agius E, Stevenson SL, Cox K, Rosen V, Lyons KM. Bone morphogenetic protein-3 is a negative regulator of bone density. Nat Genet. 2001;27(1):84-8. doi: 10.1038/83810. PubMed PMID: 11138004.

58. Gamer LW, Cox K, Carlo JM, Rosen V. Overexpression of BMP3 in the developing skeleton alters endochondral bone formation resulting in spontaneous rib fractures. Dev Dyn. 2009;238(9):2374-81. doi: 10.1002/dvdy.22048. PubMed PMID: 19653325; PMCID: PMC3523674.

59. Gamer LW, Nove J, Levin M, Rosen V. BMP-3 is a novel inhibitor of both activin and BMP-4 signaling in Xenopus embryos. Dev Biol. 2005;285(1):156-68. doi: 10.1016/j.ydbio.2005.06.012. PubMed PMID: 16054124.

60. Gamer LW, Ho V, Cox K, Rosen V. Expression and function of BMP3 during chick limb development. Dev Dyn. 2008;237(6):1691-8. doi: 10.1002/dvdy.21561. PubMed PMID: 18489005; PMCID: PMC2862365.

61. Winnier G, Blessing M, Labosky PA, Hogan BL. Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse. Genes Dev. 1995;9(17):2105-16. PubMed PMID: 7657163.

62. Spector JA, Luchs JS, Mehrara BJ, Greenwald JA, Smith LP, Longaker MT. Expression of bone morphogenetic proteins during membranous bone healing. Plast Reconstr Surg. 2001;107(1):124-34.

63. Selever J, Liu W, Lu MF, Behringer RR, Martin JF. Bmp4 in limb bud mesoderm regulates digit pattern by controlling AER development. Dev Biol. 2004;276(2):268-79. doi: 10.1016/j.ydbio.2004.08.024. PubMed PMID: 15581864.

64. Suazo J, Tapia JC, Santos JL, Castro VG, Colombo A, Blanco R. Risk variants in BMP4 promoters for nonsyndromic cleft lip/palate in a Chilean population. BMC Med Genet. 2011;12:163. doi: 10.1186/1471-2350-12-163. PubMed PMID: 22182590; PMCID: PMC3276445.

65. Shu B, Zhang M, Xie R, Wang M, Jin H, Hou W, Tang D, Harris SE, Mishina Y, O'Keefe RJ, Hilton MJ, Wang Y, Chen D. BMP2, but not BMP4, is crucial for chondrocyte proliferation and maturation during endochondral bone development. J Cell Sci. 2011;124(Pt 20):3428-40. doi: 10.1242/jcs.083659. PubMed PMID: 21984813; PMCID: PMC3196857.

66. King JA, Marker PC, Seung KJ, Kingsley DM. BMP5 and the molecular, skeletal, and soft-tissue alterations in short ear mice. Dev Biol. 1994;166(1):112-22. Epub 1994/11/01. doi: 10.1006/dbio.1994.1300. PubMed PMID: 7958439.

67. Wutzl A, Brozek W, Lernbass I, Rauner M, Hofbauer G, Schopper C, Watzinger F, Peterlik M, Pietschmann P. Bone morphogenetic proteins 5 and 6 stimulate osteoclast generation. J Biomed Mater Res A. 2006;77(1):75-83. doi: 10.1002/jbm.a.30615. PubMed PMID: 16355411.

87

68. Kudo N, Ogose A, Ariizumi T, Kawashima H, Hotta T, Hatano H, Morita T, Nagata M, Siki Y, Kawai A, Hotta Y, Hoshino M, Endo N. Expression of bone morphogenetic proteins in giant cell tumor of bone. Anticancer Res. 2009;29(6):2219-25. PubMed PMID: 19528484.

69. Simic P, Culej JB, Orlic I, Grgurevic L, Draca N, Spaventi R, Vukicevic S. Systemically administered bone morphogenetic protein-6 restores bone in aged ovariectomized rats by increasing bone formation and suppressing bone resorption. J Biol Chem. 2006;281(35):25509-21. doi: 10.1074/jbc.M513276200. PubMed PMID: 16798745.

70. Pederson L, Ruan M, Westendorf JJ, Khosla S, Oursler MJ. Regulation of bone formation by osteoclasts involves Wnt/BMP signaling and the chemokine sphingosine-1- phosphate. Proc Natl Acad Sci U S A. 2008;105(52):20764-9. doi: 10.1073/pnas.0805133106. PubMed PMID: 19075223; PMCID: PMC2603259.

71. Meynard D, Kautz L, Darnaud V, Canonne-Hergaux F, Coppin H, Roth MP. Lack of the bone morphogenetic protein BMP6 induces massive iron overload. Nat Genet. 2009;41(4):478-81. doi: 10.1038/ng.320. PubMed PMID: 19252488.

72. Ozkaynak E, Rueger DC, Drier EA, Corbett C, Ridge RJ, Sampath TK, Oppermann H. OP-1 cDNA encodes an osteogenic protein in the TGF-beta family. EMBO J. 1990;9(7):2085-93. PubMed PMID: 2357959; PMCID: PMC551926.

73. Jena N, Martin-Seisdedos C, McCue P, Croce CM. BMP7 null mutation in mice: developmental defects in skeleton, kidney, and eye. Exp Cell Res. 1997;230(1):28-37. PubMed PMID: 9013703.

74. Laursen M, Hoy K, Hansen ES, Gelineck J, Christensen FB, Bunger CE. Recombinant bone morphogenetic protein-7 as an intracorporal bone growth stimulator in unstable thoracolumbar burst fractures in humans: preliminary results. Eur Spine J. 1999;8(6):485-90. PubMed PMID: 10664308; PMCID: PMC3611219.

75. Maurer T, Zimmermann G, Maurer S, Stegmaier S, Wagner C, Hansch GM. Inhibition of osteoclast generation: a novel function of the bone morphogenetic protein 7/osteogenic protein 1. Mediators Inflamm. 2012;2012:171209. doi: 10.1155/2012/171209. PubMed PMID: 23132958; PMCID: PMC3486172.

76. DiLeone RJ, King JA, Storm EE, Copeland NG, Jenkins NA, Kingsley DM. The Bmp8 gene is expressed in developing skeletal tissue and maps near the Achondroplasia locus on mouse chromosome 4. Genomics. 1997;40(1):196-8. doi: 10.1006/geno.1996.4533. PubMed PMID: 9070944.

77. Bergeron E, Senta H, Mailloux A, Park H, Lord E, Faucheux N. Murine preosteoblast differentiation induced by a peptide derived from bone morphogenetic proteins-9. Tissue Eng Part A. 2009;15(11):3341-9. doi: 10.1089/ten.TEA.2009.0189. PubMed PMID: 19388833.

78. Li H, Zhao D, Wang S, Ding J, Zhao L. Bone morphogenetic protein9 promotes the differentiation of mouse spleen macrophages into osteoclasts via the ALK1 receptor 88

and ERK 1/2 pathways in vitro. Mol Med Rep. 2016;14(5):4545-50. doi: 10.3892/mmr.2016.5803. PubMed PMID: 27748860; PMCID: PMC5101994.

79. Pham L, Beyer K, Jensen ED, Rodriguez JS, Davydova J, Yamamoto M, Petryk A, Gopalakrishnan R, Mansky K. Bone Morphogenetic Protein 2 SIgnaling in Osteoclasts is Negatively Regulated by BMP Antagonist, Twisted Gastrulation. Journal of Cellular Biochemistry. 2010;112:793-803.

80. Kusu N, Laurikkala J, Imanishi M, Usui H, Konishi M, Miyake A, Thesleff I, Itoh N. Sclerostin is a novel secreted osteoclast-derived bone morphogenetic protein antagonist with unique ligand specificity. J Biol Chem. 2003;278(26):24113-7. doi: 10.1074/jbc.M301716200. PubMed PMID: 12702725.

81. Okamoto M, Murai J, Imai Y, Ikegami D, Kamiya N, Kato S, Mishina Y, Yoshikawa H, Tsumaki N. Conditional deletion of Bmpr1a in differentiated osteoclasts increases osteoblastic bone formation, increasing volume of remodeling bone in mice. J Bone Miner Res. 2011;26(10):2511-22. doi: 10.1002/jbmr.477. 10.1002/jbmr.477.

82. Shi C, Iura A, Terajima M, Liu F, Lyons K, Pan H, Zhang H, Yamauchi M, Mishina Y, Sun H. Deletion of BMP receptor type IB decreased bone mass in association with compromised osteoblastic differentiation of bone marrow mesenchymal progenitors. Sci Rep. 2016;6:24256. doi: 10.1038/srep24256. PubMed PMID: 27048979; PMCID: PMC4822175.

83. Shi C, Zhang H, Louie K, Mishina Y, Sun H. BMP Signaling Mediated by BMPR1A in Osteoclasts Negatively Regulates Osteoblast Mineralization Through Suppression of Cx43. J Cell Biochem. 2016. doi: 10.1002/jcb.25746. PubMed PMID: 27649478.

84. Yu PB, Beppu H, Kawai N, Li E, Bloch KD. Bone morphogenetic protein (BMP) type II receptor deletion reveals BMP ligand-specific gain of signaling in pulmonary artery smooth muscle cells. J Biol Chem. 2005;280(26):24443-50. doi: M502825200 [pii] 10.1074/jbc.M502825200.

85. Li A, Cong Q, Xia X, Leong WF, Yeh J, Miao D, Mishina Y, Liu H, Li B. Pharmacologic Calcitriol Inhibits Osteoclast Lineage Commitment via the BMP-Smad1 and IkappaB-NF-kappaB Pathways. J Bone Miner Res. 2017;32(7):1406-20. doi: 10.1002/jbmr.3146. PubMed PMID: 28370465; PMCID: PMC5814246.

86. Zhang YE. Non-Smad pathways in TGF-beta signaling. Cell Res. 2009;19(1):128-39. doi: 10.1038/cr.2008.328. PubMed PMID: 19114990; PMCID: PMC2635127.

87. Mellis DJ, Itzstein C, Helfrich MH, Crockett JC. The skeleton: a multi-functional complex organ: the role of key signalling pathways in osteoclast differentiation and in bone resorption. J Endocrinol. 2011;211(2):131-43. doi: 10.1530/JOE-11-0212. PubMed PMID: 21903860.

89

88. Qi B, Cong Q, Li P, Ma G, Guo X, Yeh J, Xie M, Schneider MD, Liu H, Li B. Ablation of Tak1 in osteoclast progenitor leads to defects in skeletal growth and bone remodeling in mice. Scientific reports. 2014;4:7158. doi: 10.1038/srep07158 [doi].

89. Tasca A, Stemig M, Broege A, Huang B, Davydova J, Zwijsen A, Umans L, Jensen ED, Gopalakrishnan R, Mansky KC. Smad1/5 and smad4 expression are important for osteoclast differentiation. Journal of cellular biochemistry. 2015;116(7):1350-60. doi: 10.1002/jcb.25092 [doi].

90. Morita M, Yoshida S, Iwasaki R, Yasui T, Sato Y, Kobayashi T, Watanabe R, Oike T, Miyamoto K, Takami M, Ozato K, Deng CX, Aburatani H, Tanaka S, Yoshimura A, Toyama Y, Matsumoto M, Nakamura M, Kawana H, Nakagawa T, Miyamoto T. Smad4 is required to inhibit osteoclastogenesis and maintain bone mass. Sci Rep. 2016;6:35221. doi: 10.1038/srep35221. PubMed PMID: 27731422; PMCID: PMC5059689.

91. Billington CJ, Jr., Fiebig JE, Forsman CL, Pham L, Burbach N, Sun M, Jaskoll T, Mansky K, Gopalakrishnan R, O'Connor MB, Mueller TD, Petryk A. Glycosylation of Twisted Gastrulation is Required for BMP Binding and Activity during Craniofacial Development. Front Physiol. 2011;2:59. doi: 10.3389/fphys.2011.00059. PubMed PMID: 21941513; PMCID: PMC3170884.

92. Kanatani M, Sugimoto T, Kaji H, Kobayashi T, Nishiyama K, Fukase M, Kumegawa M, Chihara K. Stimulatory effect of bone morphogenetic protein-2 on osteoclast-like cell formation and bone-resorbing activity. J Bone Miner Res. 1995;10(11):1681-90.

93. Walsh DW, Godson C, Brazil DP, Martin F. Extracellular BMP-antagonist regulation in development and disease: tied up in knots. Trends Cell Biol. 2010;20(5):244-56. doi: 10.1016/j.tcb.2010.01.008. PubMed PMID: 20188563.

94. Oelgeschlager M, Reversade B, Larrain J, Little S, Mullins MC, De Robertis EM. The pro-BMP activity of Twisted gastrulation is independent of BMP binding. Development. 2003;130(17):4047-56.

95. Petryk A, Anderson RM, Jarcho MP, Leaf I, Carlson CS, Klingensmith J, Shawlot W, O'Connor MB. The mammalian twisted gastrulation gene functions in foregut and craniofacial development. Dev Biol. 2004;267(2):374-86. doi: 10.1016/j.ydbio.2003.11.015 S0012160603007267 [pii].

96. MacKenzie B, Wolff R, Lowe N, J BC, Jr., Peterson A, Schmidt B, Graf D, Mina M, Gopalakrishnan R, Petryk A. Twisted gastrulation limits apoptosis in the distal region of the mandibular arch in mice. Dev Biol. 2009;328(1):13-23. doi: S0012-1606(09)00022- 0 [pii] 10.1016/j.ydbio.2008.12.041.

97. Boyle WJ, Simonet WS, Lacey DL. Osteoclast differentiation and activation. Nature. 2003;423(6937):337-42. doi: 10.1038/nature01658. PubMed PMID: 12748652.

90

98. Novack DV, Teitelbaum SL. The osteoclast: friend or foe? Annu Rev Pathol. 2008;3:457-84. doi: 10.1146/annurev.pathmechdis.3.121806.151431. PubMed PMID: 18039135.

99. Suda T, Takahashi N, Udagawa N, Jimi E, Gillespie MT, Martin TJ. Modulation of osteoclast differentiation and function by the new members of the tumor necrosis factor receptor and ligand families. Endocr Rev. 1999;20(3):345-57. doi: 10.1210/edrv.20.3.0367. PubMed PMID: 10368775.

100. Wu M, Chen G, Li YP. TGF-beta and BMP signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease. Bone Res. 2016;4:16009. doi: 10.1038/boneres.2016.9. PubMed PMID: 27563484; PMCID: PMC4985055.

101. Huntley R, Davydova J, Petryk A, Billington CJ, Jr., Jensen ED, Mansky KC, Gopalakrishnan R. The Function of Twisted Gastrulation in Regulating Osteoclast Differentiation is Dependent on BMP Binding. J Cell Biochem. 2015;116(10):2239-46. doi: 10.1002/jcb.25174. PubMed PMID: 25808976; PMCID: PMC4853233.

102. Karsenty G, Wagner EF. Reaching a genetic and molecular understanding of skeletal development. Dev Cell. 2002;2(4):389-406. Epub 2002/04/24. PubMed PMID: 11970890.

103. Raggatt LJ, Partridge NC. Cellular and molecular mechanisms of bone remodeling. J Biol Chem. 2010;285(33):25103-8. Epub 2010/05/27. doi: 10.1074/jbc.R109.041087. PubMed PMID: 20501658; PMCID: PMC2919071.

104. Zaidi M. Skeletal remodeling in health and disease. Nat Med. 2007;13(7):791- 801. Epub 2007/07/10. doi: 10.1038/nm1593. PubMed PMID: 17618270.

105. Chen G, Deng C, Li YP. TGF-beta and BMP signaling in osteoblast differentiation and bone formation. Int J Biol Sci. 2012;8(2):272-88. Epub 2012/02/03. doi: 10.7150/ijbs.2929. PubMed PMID: 22298955; PMCID: PMC3269610.

106. Ma L, Martin JF. Generation of a Bmp2 conditional null allele. Genesis. 2005;42(3):203-6. Epub 2005/06/30. doi: 10.1002/gene.20132. PubMed PMID: 15986484.

107. Clausen BE, Burkhardt C, Reith W, Renkawitz R, Forster I. Conditional gene targeting in macrophages and granulocytes using LysMcre mice. Transgenic Res. 1999;8(4):265-77.

108. Bragdon B, Moseychuk O, Saldanha S, King D, Julian J, Nohe A. Bone morphogenetic proteins: a critical review. Cell Signal. 2011;23(4):609-20. doi: 10.1016/j.cellsig.2010.10.003. PubMed PMID: 20959140.

109. Takayanagi H. The role of NFAT in osteoclast formation. Ann N Y Acad Sci. 2007;1116:227-37. doi: 10.1196/annals.1402.071. PubMed PMID: 18083930.

91

110. Tasca A, Astleford K, Blixt N, Jensen ED, Gopalakrishnan R, Mansky K. SMAD1/5 signaling in osteoclasts regulates bone formation via coupling factors. PLoS One. 2018.

92