Chromosome 18 Gene Dosage Map 2.0

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Human Genetics (2018) 137:961–970 https://doi.org/10.1007/s00439-018-1960-6 ORIGINAL INVESTIGATION Chromosome 18 gene dosage map 2.0 Jannine D. Cody1,2 · Patricia Heard1 · David Rupert1 · Minire Hasi‑Zogaj1 · Annice Hill1 · Courtney Sebold1 · Daniel E. Hale1,3 Received: 9 August 2018 / Accepted: 14 November 2018 / Published online: 17 November 2018 © Springer-Verlag GmbH Germany, part of Springer Nature 2018 Abstract In 2009, we described the first generation of the chromosome 18 gene dosage maps. This tool included the annotation of each gene as well as each phenotype associated region. The goal of these annotated genetic maps is to provide clinicians with a tool to appreciate the potential clinical impact of a chromosome 18 deletion or duplication. These maps are continually updated with the most recent and relevant data regarding chromosome 18. Over the course of the past decade, there have also been advances in our understanding of the molecular mechanisms underpinning genetic disease. Therefore, we have updated the maps to more accurately reflect this knowledge. Our Gene Dosage Map 2.0 has expanded from the gene and phenotype maps to also include a pair of maps specific to hemizygosity and suprazygosity. Moreover, we have revamped our classification from mechanistic definitions (e.g., haplosufficient, haploinsufficient) to clinically oriented classifications (e.g., risk factor, conditional, low penetrance, causal). This creates a map with gradient of classifications that more accurately represents the spectrum between the two poles of pathogenic and benign. While the data included in this manuscript are specific to chro- mosome 18, they may serve as a clinically relevant model that can be applied to the rest of the genome. Introduction possible consequences, the genetics community has gener- ally attempted to classify genomic imbalances on a gradient The rapidly increasing use of molecular diagnostics is identi- between benign and pathogenic using a scale based on the fying a growing number of people with both small and large strength of the evidence for pathogenicity (Richards et al. genomic copy number changes. However, data regarding 2015). The implication is that once all evidence is “very the clinical implications of these imbalances lag far behind. strong” all genomic copy number variations (CNVs) will Without linking genotype to phenotype, the utility of molec- be either pathogenic or benign. Such a dichotomous clas- ular diagnostics is limited. While some genomic imbalances sification fails to capture the full breadth of the biology. For may have no clinical implications, others may have a serious example, the data could be very strong that hemizygosity of impact. In between these two extremes lies a wide spectrum gene A is benign; however, it is causative of disease in the of potential outcomes. However, despite this wide range of presence of a loss-of-function mutation in gene B. Or, gene A hemizygosity is causative of disease only with exposure to a particular drug. In both cases, gene A hemizygosity alone Electronic supplementary material The online version of this is benign yet has clinically actionable implications. Con- article (https ://doi.org/10.1007/s0043 9-018-1960-6) contains veying the potential consequences is particularly important, supplementary material, which is available to authorized users. because the end goal for each genomic change is the knowl- * Jannine D. Cody edge of the biological consequences of that change and the [email protected] potential for rectifying those that are adverse. We are particularly attuned to both genotypic and pheno- 1 Department of Pediatrics, The Chromosome 18 Clinical Research Center, University of Texas Health Science Center typic variation due to the non-recurrent nature of most of the at San Antonio, 7703 Floyd Curl Drive, San Antonio, chromosome 18 conditions. The vast majority of individuals TX 78229, USA with chromosome 18 genomic copy number changes have 2 The Chromosome 18 Registry and Research Society, unique regions of genomic variation. This is not a popula- San Antonio, TX 78229, USA tion of people with recurrent CNVs. For example, no two 3 Department of Pediatrics, Penn State Milton S. Hershey unrelated people with a simple 18q deletion have the same Medical Center, Hershey, PA 17033, USA Vol.:(0123456789)1 3 962 Human Genetics (2018) 137:961–970 region of hemizygosity, and half of those with 18p deletions consequences of abnormal gene dosage has informed the have unique deletions (Heard et al. 2009; Hasi-Zogaj et al. creation of a more nuanced and clinically relevant gene dos- 2015). This means that accurately predicting the clinical age map for chromosome 18 to serve as a model for the rest consequences of an individual’s unique deletion or dupli- of the genome. cation must be based on the genes involved in the imbal- ance and not merely the chromosome arm within which it lies (e.g., 18q- or 18p-). For this reason, we have created a Materials and methods gene dosage map which annotates each of the known 263 genes on chromosome 18 as well as identifies each region The Chromosome 18 Gene Dosage Maps are visualized of the chromosome linked to specific phenotypes. The first as custom tracks within the University of California Santa edition was published in 2009 (Cody et al. 2009a) and is Cruz Genome Browser. The information used to create and updated annually. The original map included four categories update these maps is derived from multiple sources. We uti- that were mechanistically defined; haplosufficient, haploin- lize the genotype and phenotype data from our cohort of sufficient, conditionally haploinsufficient, and haplolethal. over 650 individuals with chromosome 18 genomic copy However, we now recognize that this classification scheme number changes. This longitudinal study, now in its 27th is as limiting as the dichotomous classifications of benign year, has been approved by the University of Texas Health and pathogenic. In addition, the mechanistic response to a Science Center at San Antonio’s Institutional Review Board. dosage imbalance does not necessarily translate into clinical All study participants are involved in the informed consent relevance. For example, mice with a deletion of the Slc14a1 process which is appropriately documented. The molecu- gene have a urea transport deficiency yet they do not suffer larly defined chromosome 18 copy number changes for each any clinical syndrome, suggesting the existence of compen- participant were determined by high resolution microarray satory mechanisms (Jiang et al. 2017). While hemizygosity as previously described (Heard et al. 2009).The clinical of the SLC14A1 gene may result in haploinsufficiency in consequences and genotype–phenotype correlations have humans at a physiological level the clinical outcome is not been described in numerous publications and were recently significant. reviewed (Hasi-Zogaj et al. 2015; Sebold et al. 2015; Carter The difficulty in determining where to draw the line et al. 2015; O’Donnell et al. 2015; Cody et al. 2015). In addi- between haplosufficient and haploinsufficient; or even tion, we use data derived from scientific publications and between pathogenic and benign became increasingly prob- public databases to inform our classifications. Of particular lematic. Is a gene in hemizygosity that causes an abnormal importance is the Database of Genomic Variation (DGV) phenotype benign when this phenotype is 49% penetrant and (MacDonald et al. 2014) which identifies regions of CNV pathogenic when it is 51% penetrant? Or is it the severity of in control populations thereby eliminating them from high the phenotype itself that defines the terminology? Is a gene penetrance classifications. in hemizygosity that causes short stature benign but another Like the original version, there are two types of data one that causes deafness pathogenic? Or is it the age of onset in this second version of the chromosome 18 gene dosage of the abnormal phenotype that is the determining factor? maps: genes and phenotype regions. Each gene on chromo- For example is a gene in hemizygosity that causes an adult some 18 has been classified into one of the seven classes for onset cancer benign but one that causes congenital cataracts hemizygosity and six for suprazygosity. We use the term pathogenic? These are the questions that prompted us to re- suprazygosity to combine data on individuals with trisomy think and re-categorize the terminology and designations 18 as well as tetrasomy 18p. In addition, phenotypes linked from our original gene dosage maps. to specific regions are classified into five hemizygosity We have modified and expanded the classifications of classes and four suprazygosity classes. Phenotype regions the consequences of abnormal gene dosage to emphasize are those regions of the chromosome linked to a specific penetrance and the probability of an abnormal clinically disease or phenotype but for which the causative gene(s) relevant phenotype. This moves away from the binary clas- has not yet been identified. These regions range from SNPs sification of pathogenic or benign towards a classification to 24 Mb in size. system that more adequately reflects the biologic variability. The classifications for the gene and phenotype regions These changes make the second generation genome dosage and the data sources and rationale for each one are shown map more clinically relevant to patients and their healthcare below. Data from human studies carries more weight than providers. those from animal studies. In particular, data from our own In addition to describing a more nuanced classification studies provides the most definitive data especially with scheme of genomic variants, we will also present several regard to defining phenotype regions. Recognizing that examples of re-evaluation of disease mechanisms in the some conditions have variable expressivity, the presence of context of our own data. The updated information on the any aspect of the associated phenotype is considered to be 1 3 Human Genetics (2018) 137:961–970 963 evidence of the condition in question.
Recommended publications
  • Congenital Cataracts–Facial Dysmorphism–Neuropathy

    Congenital Cataracts–Facial Dysmorphism–Neuropathy

    Orphanet Journal of Rare Diseases BioMed Central Review Open Access Congenital Cataracts – Facial Dysmorphism – Neuropathy Luba Kalaydjieva* Address: Western Australian Institute for Medical Research and Centre for Medical Research, The University of Western Australia, Hospital Avenue, WA 6009 Nedlands, Australia Email: Luba Kalaydjieva* - [email protected] * Corresponding author Published: 29 August 2006 Received: 11 July 2006 Accepted: 29 August 2006 Orphanet Journal of Rare Diseases 2006, 1:32 doi:10.1186/1750-1172-1-32 This article is available from: http://www.OJRD.com/content/1/1/32 © 2006 Kalaydjieva; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Congenital Cataracts Facial Dysmorphism Neuropathy (CCFDN) syndrome is a complex developmental disorder of autosomal recessive inheritance. To date, CCFDN has been found to occur exclusively in patients of Roma (Gypsy) ethnicity; over 100 patients have been diagnosed. Developmental abnormalities include congenital cataracts and microcorneae, primary hypomyelination of the peripheral nervous system, impaired physical growth, delayed early motor and intellectual development, mild facial dysmorphism and hypogonadism. Para-infectious rhabdomyolysis is a serious complication reported in an increasing number of patients. During general anaesthesia, patients with CCFDN require careful monitoring as they have an elevated risk of complications. CCFDN is a genetically homogeneous condition in which all patients are homozygous for the same ancestral mutation in the CTDP1 gene. Diagnosis is clinical and is supported by electrophysiological and brain imaging studies.
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis

    Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis

    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
  • Itcs) in the Mouse Amygdala of Tshz1 Mutants Correlates with Fear, Depression, and Social Interaction Phenotypes

    Itcs) in the Mouse Amygdala of Tshz1 Mutants Correlates with Fear, Depression, and Social Interaction Phenotypes

    1160 • The Journal of Neuroscience, January 31, 2018 • 38(5):1160–1177 Development/Plasticity/Repair Loss of Intercalated Cells (ITCs) in the Mouse Amygdala of Tshz1 Mutants Correlates with Fear, Depression, and Social Interaction Phenotypes X Jeffrey Kuerbitz,1 Melinda Arnett,5 Sarah Ehrman,1 XMichael T. Williams,3 XCharles V. Vorhees,3 X Simon E. Fisher,6,7 Alistair N. Garratt,8 XLouis J. Muglia,5 Ronald R. Waclaw,1,4 and XKenneth Campbell1,2 Divisions of 1Developmental Biology, 2Neurosurgery, 3Neurology, 4Experimental Hematology and Cancer Biology, 5Center for Prevention of Preterm Birth, Perinatal Institute, Cincinnati Children’s Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, OH 45229, 6Language and Genetics Department, Max Planck Institute for Psycholinguistics, 6500 AH Nijmegen, The Netherlands, 7Donders Institute for Brain, Cognition and Behaviour, Radboud University, Nijmegen, The Netherlands, and 8Institute of Cell Biology and Neurobiology, Center for Anatomy, Charite´ University Hospital Berlin, 10117 Berlin, Germany The intercalated cells (ITCs) of the amygdala have been shown to be critical regulatory components of amygdalar circuits, which control appropriate fear responses. Despite this, the molecular processes guiding ITC development remain poorly understood. Here we establish the zinc finger transcription factor Tshz1 as a marker of ITCs during their migration from the dorsal lateral ganglionic eminence through maturity. Using germline and conditional knock-out (cKO) mouse models, we show that Tshz1 is required for the proper migration and differentiation of ITCs. In the absence of Tshz1, migrating ITC precursors fail to settle in their stereotypical locations encapsulating the lateral amygdala and BLA. Furthermore, they display reductions in the ITC marker Foxp2 and ectopic persistence of the dorsal lateral ganglionic eminence marker Sp8.
  • NEDD4L Regulates the Proliferation and Metastasis of Non-Small-Cell Lung Cancer by Mediating CPNE1 Ubiquitination

    NEDD4L Regulates the Proliferation and Metastasis of Non-Small-Cell Lung Cancer by Mediating CPNE1 Ubiquitination

    NEDD4L Regulates the Proliferation and Metastasis of Non-small-cell Lung Cancer by Mediating CPNE1 Ubiquitination Ruochen Zhang Institute of Resporatory Diseases, soochow University Yuanyuan Zeng Institute of Respiratory Diseases, Soochow University. Weijie Zhang Soochow University Yue Li Soochow University Jieqi Zhou Soochow University Yang Zhang Soochow University Anqi Wang Soochow University Yantian Lv Soochow University Jianjie Zhu First Aliated Hospital of Soochow University Zeyi Liu ( [email protected] ) First Aliated Hospital of Soochow University https://orcid.org/0000-0003-2528-6909 Jian-an Huang First Aliated Hospital of Soochow University Research Keywords: NSCLC, CPNE1, NEDD4L, ubiquitination, degradation Posted Date: February 26th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-250598/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/18 Abstract High expression of CPNE1 is positively correlated with the occurrence, TNM stage, lymph node metastasis, and distant metastasis of non-small-cell lung cancer (NSCLC), suggesting that CPNE1 may be an effective target for the treatment of NSCLC. No direct role of post-translational modication of CPNE1 in NSCLC has been reported. This study conrms that CPNE1 is degraded by two pathways: the ubiquitin-proteasome pathway and the autophagy- lysosome pathway. CPNE1 binds with the ubiquitin molecule via its K157 residue. Moreover, we determine that the ubiquitin ligase NEDD4L can mediate the ubiquitination of CPNE1 and promote its degradation. In addition, we nd that NEDD4L knockout promotes the proliferation and metastasis of NSCLC cells by regulating CPNE1. This study aims to further investigate the mechanism of CPNE1 ubiquitination in the occurrence and development of NSCLC and provide a new potential target for NSCLC treatment.
  • Identification and Characterization of TPRKB Dependency in TP53 Deficient Cancers

    Identification and Characterization of TPRKB Dependency in TP53 Deficient Cancers

    Identification and Characterization of TPRKB Dependency in TP53 Deficient Cancers. by Kelly Kennaley A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Molecular and Cellular Pathology) in the University of Michigan 2019 Doctoral Committee: Associate Professor Zaneta Nikolovska-Coleska, Co-Chair Adjunct Associate Professor Scott A. Tomlins, Co-Chair Associate Professor Eric R. Fearon Associate Professor Alexey I. Nesvizhskii Kelly R. Kennaley [email protected] ORCID iD: 0000-0003-2439-9020 © Kelly R. Kennaley 2019 Acknowledgements I have immeasurable gratitude for the unwavering support and guidance I received throughout my dissertation. First and foremost, I would like to thank my thesis advisor and mentor Dr. Scott Tomlins for entrusting me with a challenging, interesting, and impactful project. He taught me how to drive a project forward through set-backs, ask the important questions, and always consider the impact of my work. I’m truly appreciative for his commitment to ensuring that I would get the most from my graduate education. I am also grateful to the many members of the Tomlins lab that made it the supportive, collaborative, and educational environment that it was. I would like to give special thanks to those I’ve worked closely with on this project, particularly Dr. Moloy Goswami for his mentorship, Lei Lucy Wang, Dr. Sumin Han, and undergraduate students Bhavneet Singh, Travis Weiss, and Myles Barlow. I am also grateful for the support of my thesis committee, Dr. Eric Fearon, Dr. Alexey Nesvizhskii, and my co-mentor Dr. Zaneta Nikolovska-Coleska, who have offered guidance and critical evaluation since project inception.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • NEDD4 2 (NEDD4L) (NM 001144964) Human Tagged ORF Clone Product Data

    NEDD4 2 (NEDD4L) (NM 001144964) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC227866 NEDD4 2 (NEDD4L) (NM_001144964) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: NEDD4 2 (NEDD4L) (NM_001144964) Human Tagged ORF Clone Tag: Myc-DDK Symbol: NEDD4L Synonyms: hNEDD4-2; NEDD4-2; NEDD4.2; PVNH7; RSP5 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 NEDD4 2 (NEDD4L) (NM_001144964) Human Tagged ORF Clone – RC227866 ORF Nucleotide >RC227866 representing NM_001144964 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCGACCCTATACATTTAAGGACTTTCTCCTCAGACCAAGAAGTCATAAGTCTCGAGTTAAGGGAT TTTTGCGATTGAAAATGGCCTATATGCCAAAAAATGGAGGTCAAGATGAAGAAAACAGTGACCAGAGGGA TGACATGGAGCATGGATGGGAAGTTGTTGACTCAAATGACTCGGCTTCTCAGCACCAAGAGGAACTTCCT CCTCCTCCTCTGCCTCCCGGGTGGGAAGAAAAAGTGGACAATTTAGGCCGAACTTACTATGTCAACCACA ACAACCGGACCACTCAGTGGCACAGACCAAGCCTGATGGACGTGTCCTCGGAGTCGGACAATAACATCAG ACAGATCAACCAGGAGGCAGCACACCGGCGCTTCCGCTCCCGCAGGCACATCAGCGAAGACTTGGAGCCC GAGCCCTCGGAGGGCGGGGATGTCCCCGAGCCTTGGGAGACCATTTCAGAGGAAGTGAATATCGCTGGAG ACTCTCTCGGTCTGGCTCTGCCCCCACCACCGGCCTCCCCAGGATCTCGGACCAGCCCTCAGGAGCTGTC
  • The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid

    The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid

    The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid Leukemia Cells Supported Only by Exogenous Cytokines Is Associated with a Patient Subset with Adverse Outcome Annette K. Brenner, Elise Aasebø, Maria Hernandez-Valladares, Frode Selheim, Frode Berven, Ida-Sofie Grønningsæter, Sushma Bartaula-Brevik and Øystein Bruserud Supplementary Material S2 of S31 Table S1. Detailed information about the 68 AML patients included in the study. # of blasts Viability Proliferation Cytokine Viable cells Change in ID Gender Age Etiology FAB Cytogenetics Mutations CD34 Colonies (109/L) (%) 48 h (cpm) secretion (106) 5 weeks phenotype 1 M 42 de novo 241 M2 normal Flt3 pos 31.0 3848 low 0.24 7 yes 2 M 82 MF 12.4 M2 t(9;22) wt pos 81.6 74,686 low 1.43 969 yes 3 F 49 CML/relapse 149 M2 complex n.d. pos 26.2 3472 low 0.08 n.d. no 4 M 33 de novo 62.0 M2 normal wt pos 67.5 6206 low 0.08 6.5 no 5 M 71 relapse 91.0 M4 normal NPM1 pos 63.5 21,331 low 0.17 n.d. yes 6 M 83 de novo 109 M1 n.d. wt pos 19.1 8764 low 1.65 693 no 7 F 77 MDS 26.4 M1 normal wt pos 89.4 53,799 high 3.43 2746 no 8 M 46 de novo 26.9 M1 normal NPM1 n.d. n.d. 3472 low 1.56 n.d. no 9 M 68 MF 50.8 M4 normal D835 pos 69.4 1640 low 0.08 n.d.
  • Prediction of Meiosis-Essential Genes Based Upon the Dynamic Proteomes Responsive to Spermatogenesis

    Prediction of Meiosis-Essential Genes Based Upon the Dynamic Proteomes Responsive to Spermatogenesis

    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.05.936435; this version posted February 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Prediction of meiosis-essential genes based upon the dynamic proteomes responsive to spermatogenesis Kailun Fang1,2,3,8, Qidan Li3,4,5,8, Yu Wei2,3,8, Jiaqi Shen6,8, Wenhui Guo3,4,5,7,8, Changyang Zhou2,3,8, Ruoxi Wu1, Wenqin Ying2, Lu Yu1,2, Jin Zi5, Yuxing Zhang3,4,5, Hui Yang2,3,9*, Siqi Liu3,4,5,9*, Charlie Degui Chen1,3,9* 1. State Key Laboratory of Molecular Biology, Shanghai Key Laboratory of Molecular Andrology, CAS Center for Excellence in Molecular Cell Science, Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, Shanghai 200031, China. 2. State Key Laboratory of Neuroscience, Key Laboratory of Primate Neurobiology, CAS Center for Excellence in Brain Science and Intelligence Technology, Shanghai Research Center for Brain Science and Brain-Inspired Intelligence, Institute of Neuroscience, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China. 3. University of the Chinese Academy of Sciences, Beijing 100049, China. 4. CAS Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101, China. 5. BGI Genomics, BGI-Shenzhen, Shenzhen 518083, China. 6. United World College Changshu China, Jiangsu 215500, China. 7. Malvern College Qingdao, Shandong, 266109, China 8.
  • A Flexible Microfluidic System for Single-Cell Transcriptome Profiling

    A Flexible Microfluidic System for Single-Cell Transcriptome Profiling

    www.nature.com/scientificreports OPEN A fexible microfuidic system for single‑cell transcriptome profling elucidates phased transcriptional regulators of cell cycle Karen Davey1,7, Daniel Wong2,7, Filip Konopacki2, Eugene Kwa1, Tony Ly3, Heike Fiegler2 & Christopher R. Sibley 1,4,5,6* Single cell transcriptome profling has emerged as a breakthrough technology for the high‑resolution understanding of complex cellular systems. Here we report a fexible, cost‑efective and user‑ friendly droplet‑based microfuidics system, called the Nadia Instrument, that can allow 3′ mRNA capture of ~ 50,000 single cells or individual nuclei in a single run. The precise pressure‑based system demonstrates highly reproducible droplet size, low doublet rates and high mRNA capture efciencies that compare favorably in the feld. Moreover, when combined with the Nadia Innovate, the system can be transformed into an adaptable setup that enables use of diferent bufers and barcoded bead confgurations to facilitate diverse applications. Finally, by 3′ mRNA profling asynchronous human and mouse cells at diferent phases of the cell cycle, we demonstrate the system’s ability to readily distinguish distinct cell populations and infer underlying transcriptional regulatory networks. Notably this provided supportive evidence for multiple transcription factors that had little or no known link to the cell cycle (e.g. DRAP1, ZKSCAN1 and CEBPZ). In summary, the Nadia platform represents a promising and fexible technology for future transcriptomic studies, and other related applications, at cell resolution. Single cell transcriptome profling has recently emerged as a breakthrough technology for understanding how cellular heterogeneity contributes to complex biological systems. Indeed, cultured cells, microorganisms, biopsies, blood and other tissues can be rapidly profled for quantifcation of gene expression at cell resolution.
  • CD29 Identifies IFN-Γ–Producing Human CD8+ T Cells With

    CD29 Identifies IFN-Γ–Producing Human CD8+ T Cells With

    + CD29 identifies IFN-γ–producing human CD8 T cells with an increased cytotoxic potential Benoît P. Nicoleta,b, Aurélie Guislaina,b, Floris P. J. van Alphenc, Raquel Gomez-Eerlandd, Ton N. M. Schumacherd, Maartje van den Biggelaarc,e, and Monika C. Wolkersa,b,1 aDepartment of Hematopoiesis, Sanquin Research, 1066 CX Amsterdam, The Netherlands; bLandsteiner Laboratory, Oncode Institute, Amsterdam University Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; cDepartment of Research Facilities, Sanquin Research, 1066 CX Amsterdam, The Netherlands; dDivision of Molecular Oncology and Immunology, Oncode Institute, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands; and eDepartment of Molecular and Cellular Haemostasis, Sanquin Research, 1066 CX Amsterdam, The Netherlands Edited by Anjana Rao, La Jolla Institute for Allergy and Immunology, La Jolla, CA, and approved February 12, 2020 (received for review August 12, 2019) Cytotoxic CD8+ T cells can effectively kill target cells by producing therefore developed a protocol that allowed for efficient iso- cytokines, chemokines, and granzymes. Expression of these effector lation of RNA and protein from fluorescence-activated cell molecules is however highly divergent, and tools that identify and sorting (FACS)-sorted fixed T cells after intracellular cytokine + preselect CD8 T cells with a cytotoxic expression profile are lacking. staining. With this top-down approach, we performed an un- + Human CD8 T cells can be divided into IFN-γ– and IL-2–producing biased RNA-sequencing (RNA-seq) and mass spectrometry cells. Unbiased transcriptomics and proteomics analysis on cytokine- γ– – + + (MS) analyses on IFN- and IL-2 producing primary human producing fixed CD8 T cells revealed that IL-2 cells produce helper + + + CD8 Tcells.
  • Gene Expression Profiling of Corpus Luteum Reveals the Importance Of

    Gene Expression Profiling of Corpus Luteum Reveals the Importance Of

    bioRxiv preprint doi: https://doi.org/10.1101/673558; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Gene expression profiling of corpus luteum reveals the 2 importance of immune system during early pregnancy in 3 domestic sheep. 4 Kisun Pokharel1, Jaana Peippo2 Melak Weldenegodguad1, Mervi Honkatukia2, Meng-Hua Li3*, Juha 5 Kantanen1* 6 1 Natural Resources Institute Finland (Luke), Jokioinen, Finland 7 2 Nordgen – The Nordic Genetic Resources Center, Ås, Norway 8 3 College of Animal Science and Technology, China Agriculture University, Beijing, China 9 * Correspondence: MHL, [email protected]; JK, [email protected] 10 Abstract: The majority of pregnancy loss in ruminants occurs during the preimplantation stage, which is thus 11 the most critical period determining reproductive success. While ovulation rate is the major determinant of 12 litter size in sheep, interactions among the conceptus, corpus luteum and endometrium are essential for 13 pregnancy success. Here, we performed a comparative transcriptome study by sequencing total mRNA from 14 corpus luteum (CL) collected during the preimplantation stage of pregnancy in Finnsheep, Texel and F1 15 crosses, and mapping the RNA-Seq reads to the latest Rambouillet reference genome. A total of 21,287 genes 16 were expressed in our dataset. Highly expressed autosomal genes in the CL were associated with biological 17 processes such as progesterone formation (STAR, CYP11A1, and HSD3B1) and embryo implantation (eg.