FUNCTIONAL CHARACTERIZATION OF EXTRACELLULAR PROTEASE INHIBITORS OF PHYTOPHTHORA INFESTANS

DISSERTATION

Presented in Partial Fulfillment of the Requirements for

the Degree Doctor of Philosophy in the Graduate

School of The Ohio State University

By

Miaoying Tian, M.S.

* * * * *

The Ohio State University 2005

Dissertation Committee:

Dr. Sophien Kamoun, Adviser

Dr. Terrence L. Graham Approved by

Dr. Saskia A. Hogenhout

Dr. Margaret G. Redinbaugh Adviser Dr. Guo-Liang Wang Graduate Program in Plant Pathology

ABSTRACT

The oomycetes form one of several lineages within the eukaryotes that

independently evolved a parasitic lifestyle and are thought to have developed unique

mechanisms of pathogenicity. The devastating oomycete plant pathogen Phytophthora

infestans causes late blight, a ravaging disease of potato and tomato. Little is known

about processes associated with P. infestans pathogenesis, particularly the suppression of host defense responses. We used data mining of P. infestans sequence databases to identify 18 extracellular protease inhibitors belonging to two major structural classes: (i)

Kazal-like serine protease inhibitors (EPI1 to EPI14) and (ii) cystatin-like cysteine protease inhibitors (EPIC1 to EPIC4). A variety of molecular, biochemical and bioinformatic approaches were employed to functionally characterize these genes and investigate their roles in pathogen virulence. The 14 EPI proteins form a diverse family and appear to have evolved by domain shuffling, gene duplication, and diversifying selection to target a diverse array of serine proteases. Recombinant EPI1 and EPI10

proteins inhibited subtilisin A among major serine proteases, and inhibited and interacted

with tomato P69B subtilase, a pathogenesis-related protein belonging to PR7 class. The

recombinant cystatin-like cysteine protease inhibitor EPIC2B interacted with a novel

tomato papain-like extracellular cysteine protease PIP1 with an implicated role in plant

defense. PIP1 is closely related to Rcr3, an apoplastic cysteine protease required for

ii tomato Cf-2 and Cladosporium fulvm Avr2-dependent defense response. Both EPIC1 and

EPIC2B interacted with Rcr3. Interactions with plant defense-related proteases suggest a counterdefense role of these extracellular protease inhibitors. Interestingly, EPIC1 and

EPIC2B were degraded by tomato pathogenesis-related P69B subtilase and EPI1 protected both proteins from degradation, indicating that EPI1 contributes to virulence by protecting pathogen proteins from degradation by defense-related proteases. In addition, our overall results suggest that complex cascades of inhibition of host proteases by diverse extracellular protease inhibitors of P. infestans might occur in the plant apoplast during infection, thus leading to multifaceted suppression of plant defense responses.

Both Kazal-like and cystatin-like inhibitors are widespread in the oomycetes, but have not been reported in other microbial plant pathogens. Inhibition of host proteases by P. infestans protease inhibitors is proposed to be a novel mechanism of pathogen suppression of plant defense.

iii

Dedicated to my parents and husband

iv ACKNOWLEDGMENTS

When I started writing this section, my brain started to gather memories during

my Ph. D study. I felt that I had improved a lot in many aspects, including experimental

skills, oral presentations, writing and personal confidence in my future career. All of

these are not possible without my adviser Dr. Sophien Kamoun’s great contributions. He

guided me with his great intelligence, enthusiasm, patience, encouragement and support.

I would like to express my special appreciation and respect to him.

I am also greatly thankful to my other Student Advisory Committee members: Dr.

Terrence Graham, Dr. Margaret Redinbaugh, Dr. Guoliang Wang and Dr. Saskia

Hogenhout for their stimulating discussions and constructive advices.

I would like to thank all the previous and current Kamoun lab members, who I have worked together, especially Diane Kinney, Shujing Dong, Joe Win, Edgar Huitema,

Trudy Torto-Alalibo, Luis da Cunha, Zhenyu Liu, Jorunn Bos, Nicolas Champouret, Jing

Song, Thirumala-devi Kanneganti and Cahid Cakir for all kinds of help and discussion.

I am grateful to MCIC staff and Maize Virology Group at USDA for the convenience they provided for me to use all kinds of equipments.

Finally, I would like to say “ Thank you so much” to my husband Dongliang Wu.

Without his support and understanding, my Ph.D dream wouldn’t come true.

v VITA

1990 - 1994…………………. B.S. Plant Protection, Agricultural University of Hebei, P. R.China

1994 - 1997………………….. M.S., Plant Pathology, The Graduate School of Chinese Academy of Agricultural Sciences, P. R. China

1997 - 2000………………….. Research associate, Institute of Vegetables and Flowers, Chinese Academy of Agricultural Science, P.R. China

2000 - present ……………….. Graduate Research Associate, The Ohio State University

PUBLICATIONS

Research Publication

1. Tian, M., Champouret, N., and Kamoun, S. 2004. Extracellular protease inhibitors of Phytophthora infestans determine a novel counterdefense mechanism. Phytopathology. 94: S136.

2. Tian, M., Huitema, E., da Cunha, L., Torto, T., and Kamoun, S. 2004. A Kazal- like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. Journal of Biological Chemistry. 279(25), 26370- 26377.

3. Huitema, E., Bos, J. I. B., Tian, M., Win, J., Waugh, M. E. and Kamoun, S. 2004. Linking sequence to phenotype in Phytophthora-plant interactions. Trends in Microbiology. 12(4), 193-200.

4. Tian, M., and Feng, L. (2000) Identification of a molecular marker linked with ToMV resistance gene in tomato using Randomly Amplified Polymorphic DNA. Acta Phytopathologica Sinica 30(2):158-161.

vi 5. Tian, M., Wu, M., and Cheng, Z. (1999) Construction of plant expression vector harboring defective replicase gene of Barley Yellow Dwarf Virus and gaining of transgenic wheat plants Scientia Agricultura Sinica 32(5): 49-54.

FIELDS OF STUDY

Major Field: Plant Pathology

Specialty: Molecular Plant-Microbe Interactions

vii TABLE OF CONTENTS

Page Abstract………………………………………………………………………………….. ii Dedication……………………………………………………………………………….. iv Acknowledgments……………………………………………………………………….. v Vita………………………………………………………………………………………. vi List of Tables…………………………………………………………………………….. x List of Figures…………………………………………………………………………… xi

Chapters:

1. Introduction……………………………………………………………………... 1 References………………………………………………………………………. 10

2. A Kazal-like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B………………………… 17

2.1 Abstract……………………………………………………………………... 17 2.2 Introduction…………………………………………………………………. 18 2.3 Materials and Methods……………………………………………………… 20 2.4 Results………………………………………………………………………. 28 2.5 Discussion…………………………………………………………………... 34 2.6 Acknowledgments…………………………………………………………... 37 2.7 References……………………………………………………………………38

3. Evolution of Kazal-like protease inhibitors in Phytophthora was driven by gene duplication, domain shuffling, and diversifying selection……………...51

3.1 Abstract………………………………………………………………………51 3.2 Introduction…………………………………………………………………..52 3.3 Materials and Methods……………………………………………………….56 3.4 Results………………………………………………………………………..58 3.5 Discussion……………………………………………………………………65 3.6 Acknowledgments……………………………………………………………70 3.7 References……………………………………………………………………70

viii 4. A second Kazal-like protease inhibitor from Phytophthora infestans inhibits and interacts with the tomato pathogenesis-related protease P69B……………...87

4.1 Abstract………………………………………………………………………87 4.2 Introduction…………………………………………………………………..88 4.3 Materials and Methods……………………………………………………….91 4.4 Results………………………………………………………………………..96 4.5 Discussion…………………………………………………………………..101 4.6 Acknowledgments…………………………………………………………..105 4.7 References…………………………………………………………………..105

5. An atypical two disulfide bridge Kazal domain from Phytophthora exhibits stable inhibitory activity against serine proteases of the subtilisin family……..117

5.1 Abstract……………………………………………………………………..117 5.2 Introduction…………………………………………………………………118 5.3 Materials and Methods……………………………………………………...123 5.4 Results………………………………………………………………………126 5.5 Discussion…………………………………………………………………..131 5.6 Acknowledgments…………………………………………………………..134 5.7 References…………………………………………………………………..134

6. Kazal-like serine protease inhibitor EPI1 from Phytophthora infestans is involved in virulence by initiating cascades of inhibition of plant defense-related proteases…………………………………………………143

6.1 Abstract……………………………………………………………………..143 6.2 Introduction…………………………………………………………………144 6.3 Materials and Methods……………………………………………………...148 6.4 Results………………………………………………………………………154 6.5 Discussion…………………………………………………………………..163 6.6 Acknowledgments…………………………………………………………..170 6.7 References…………………………………………………………………..170

Bibliography……………………………………………………………………………189

ix LIST OF TABLES

Table Page

2.1 Predicted Kazal-like proteins from the oomycete plant pathogens Phytophthora infestans, Phytophthora sojae, Phytophthora ramorum, Phytophthora brassicae, and Plasmopara halstedii…………………………….50

3.1 Primers used for RT-PCR amplifications of epi genes from P. infestans……… 85

3.2 Putative orthologous epi genes in P. infestans, P. sojae and P. ramorum………86

6.1 Primers used in Chapter 6………………………………………………………187

6.2 Predicted cystatin-like extracellular protease inhibitors from the oomycete plant pathogens Phytophthora infestans, Phytophthora sojae and Phytophthora ramorum…………………………………………………………188

x

LIST OF FIGURES

Figure Page

2.1 EPI1 belongs to the Kazal family of serine protease inhibitors…………………43

2.2 rEPI1 inhibits subtilisin A……………………………………………………… 44

2.3 rEPI1 inhibits BTH-induced tomato proteases…………………………………..45

2.4 rEPI1 inhibition of total protease activity from tomato intercellular fluids……..46

2.5 Co-immunoprecipitation of rEPI1 and P69 subtilases using FLAG antisera……47

2.6 Tandem mass spectrometry (MS) identifies P69B as the main target of rEPI1…48

2.7 The epi1 and P69 genes are concurrently expressed during colonization of tomato by Phytophthora infestans…………………………………………….49

3.1 Schematic representation of the structure of Phytophthora infestans EPI1-EPI14 proteins……………………………………………………………..75

3.2 Sequence alignment of 56 Kazal domains of plant pathogenic oomycetes and their corresponding consensus sequence pattern……………………………76

3.3 Distribution of P1 residues among oomycete Kazal domains…………………...77

3.4 Sequence alignment of EPI4, PsojEPI4 and PramEPI4 of Phytophthora infestans, Phytophthora sojae and Phytophthora ramorum, respectively………………….78

3.5 Amino acid identity between Phytophthora infestans EPI proteins and their best matching proteins in Phytophthora sojae and Phytophthora ramorum…….79

3.6 Phylogenetic relationships of 56 oomycete Kazal domains……………………..80

3.7 Phylogenetic analysis of 31 Kazal domains from apicomplexan Kazal-like proteins……………………………………………………………….81

xi 3.8 Pairwise comparison of nonsynonymous substitution rates (dN) and synonymous substitution rates (dS) among 21 EPI domain sequences from Phytophthora infestans……………………………………………………82

3.9 Pairwise comparison of nonsynonymous (dN) and synonymous (dS) substitution rates within putative contact residues and noncontact residues among 21 EPI domains from Phytophthora infestans………………………….83

3.10 Reverse Transcription Polymerase Chain Reaction (RT-PCR) analysis of epi1-14 in mycelium and during a time course of colonization of tomato by Phytophthora infestans………………………………………………………….84

4.1 RT-PCR analysis of epi10 in mycelium and during a time course of colonization of tomato by P. infestans………………………………………….110

4.2 EPI10 belongs to the Kazal family of serine protease inhibitors……………….111

4.3 Affinity purified rEPI10 visualized on SDS-PAGE stained with silver nitrate...112

4.4 rEPI10 inhibits subtilisin A……………………………………………………..113

4.5 Coimmunoprecipitation of rEPI10 and P69 subtilases using FLAG antisera…..114

4.6 Transient expression of P69B subtilase in Nicotiana benthamiana……………115

4.7 EPI10 inhibits P69B subtilase………………………………………………….116

5.1 Primary structure alignment of two Kazal domains of EPI1 and the predicted inhibition constants against subtilisin A………………………………………..138

5.2 Heterologous expression of two Kazal domains of EPI1………………………138

5.3 The atypical Kazal domain EPI1a inhibits subtilisin A………………………...139

5.4 The atypical Kazal domain rEPI1a inhibits P69B subtilase……………………140

5.5 Coimmunoprecipitation of the recombinant Kazal domains and P69 subtilases using FLAG antisera……………………………………………………………141

5.6 The atypical Kazal domain rEPI1a exhibits stable inhibitory activity against subtilisin A……………………………………………………………………...142

6.1 A family of cystatin-like extracellular protease inhibitors from Phytophthora spp……………………………………………………………….176

xii 6.2 RT-PCR analysis of expression of epiC genes during a time course of colonization of tomato by P. infestans………………………………………….177

6.3 rEPIC1 and rEPIC2B are unstable in BTH-induced tomato intercellular fluids.178

6.4 Tomato P69B subtilase degrades EPIC1 and EPIC2B…………………………179

6.5 P. infestans EPI1 protects EPIC1 and EPIC2B from degradation……………...180

6.6 EPIC1 protein is abundantly secreted in tomato apoplast during infection…….181

6.7 EPIC2B interacts with a tomato cysteine protease of papain family…………...182

6.8 PIP1 is closely related to tomato defense-related cysteine protease Rcr3……...183

6.9 The expression of PIP1 is induced by BTH and P. infestans…………………..184

6.10 EPIC1 and EPIC2B interact with the tomato papain-like cysteine protease Rcr3………………………………………………………….185

6.11 Model of cascades of inhibition of tomato defense-related proteases mediated by extracellular protease inhibitors of P. infestans……………………………..186

xiii CHAPTER 1

INTRODUCTION

Phytophthora infestans, the causal agent of late light on potato and tomato, was

responsible for the Irish potato famine in the nineteenth century and remains a

devastating pathogen causing billions of dollars of losses in potato and tomato production

worldwide (Fry and Goodwin 1997; Birch and Whisson 2001; Smart and Fry 2001;

Ristaino 2002; Shattock 2002). In countries such as Russia, where potato is a major

component of the diet, recurrent epidemics could be catastrophic (Garelik 2002). P.

infestans is thus a severe threat to global food security (Duncan 1999). Despite its great

economic importance, the pathogenicity mechanisms of P. infestans remain largely

unknown.

P. infestans belongs to oomycetes, a group of fungus-like organisms that are

distantly related to fungi but closely related to brown algae in the Stramenopiles (or

heterokonts), one of several major eukaryotic kingdoms (Sogin 1998; Baldauf et al. 2000;

Margulis and Schwartz 2000; Kamoun 2003). Oomycetes include many economically

important plant pathogens, such as Phytophthora, downy mildews and Pythium (Kamoun et al. 1999). The distant taxonomic affinity of oomycetes to other plant pathogens

1 suggests that plant pathogenic oomycetes have evolved unique molecular processes for

infecting their hosts (Kamoun 2003).

Infection of host plants by P. infestans typically starts when sporangia land on the

plant surface and release swimming zoospores, which encyst after a motile period and

germinate to produce germ tubes (Judelson 1996). The tip of the germ tube differentiates

into an appressorium that penetrates the plant epidermal cell (Judelson 1996). A limited

number of genes involved in the development of infection structures, as well as pathogen

adhesion and penetration have been described as possible virulence factors. Pigpa1, a

gene encoding a G-protein α subunit was found to be crucial for zoospore motility and

pathogenicity (Latijnhouwers et al. 2004). Silencing of this gene results in abnormal

zoospores and severely decreases infection efficiencies (Latijnhouwers et al. 2004). Three

Car (cyst-germination-specific acidic repeat) genes encode extracellular mucin-like proteins and may serve as a mucous cover protecting the germling from adverse conditions and assisting in adhesion to the leaf surface (Gornhardt et al. 2000). Several genes encoding degradative enzymes have been described, including a β-

glucosidase/xylosidase (Brunner et al. 2002), exo-1, 3-β-glucanase (McLeod et al. 2002), endo-1, 3-β-glucanase (McLeod et al. 2002), endo-1, 3;1,4-β-glucanase (McLeod et al.

2002), and endopolygalacturonases (Torto et al. 2002). These hydrolytic enzymes are believed to facilitate penetration of the plant cuticle and cell wall. However, their actual role in P. infestans pathogenesis has not been determined (Brunner et al. 2002; McLeod et al. 2002; Torto et al. 2002).

Plants have evolved immune systems to prevent pathogen infections by mounting defense responses (Dangl and Jones 2001). Successful pathogens, especially biotrophic 2 pathogens, depend, at least in part, on their capability to avoid or actively suppress plant defense responses (Bushnell and Rowell 1981; Panstruga 2003; Abramovitch and Martin

2004). P. infestans is a hemibiotrophic plant pathogen (Coffey and Wilson 1983;

Judelson 1997; Kamoun et al. 1999). During the early stages of infection, P. infestans requires living host cells but later causes extensive necrosis of host tissue. As with other biotrophic plant pathogens, P. infestans pathogenesis is thought to include the suppression of host defense responses, but remains poorly understood (Heath 2000;

Bouarab et al. 2002; Kamoun 2003). Only a few plant defense suppressors have been characterized from P. infestans. Water-soluble glucans were reported to suppress defenses by affecting the accumulation of pathogenesis-related proteins and phytoalexins in a race-specific manner (Sanchez et al. 1992; Yoshioka et al. 1995; Andreu et al. 1998).

Glucanase inhibitor proteins (GIPs) might represent another type of host defense suppressors of P. infestans since GIPs of Phytophthora sojae are thought to play a counterdefensive role by inhibiting soybean endo-β-1, 3-glucanase to block the degradation of glucans in the pathogen cell wall and/ or the release of defense-eliciting oligosaccharides (Rose et al. 2002). Glucanase inhibitor proteins are also present in P. infestans and were shown to interact with tomato endo-β-1, 3-glucanases (Damasceno et al. 2004).

Our current understanding of P. infestans pathogenesis does not enable the design of effective strategies to manage this devastating plant pathogen. During the last decade, the Phytophthora research community has made great progress in the search for effector proteins, molecules that promote infection (virulence factors) or trigger defense responses

(avirulence factors) (Kamoun 2003; Huitema et al. 2004). One of the most remarkable 3 initiatives is to sequence the genome and transcriptome of P. infestans. Current genomic resources include 74,789 high-quality ESTs from a variety of developmental and infection stages, one-fold coverage of whole genome shotgun and other types of genomic sequences (Kamoun 2003; Huitema et al. 2004; Randall et al. 2004). P. infestans sequences are available from GenBankTM nonredundant, est, htgs, and TraceDB databases, SPC (a proprietary database of Syngenta Inc.), and PFGD

(http://www.pfgd.org), a Phytophthora functional genomics database which combines genomic sequences and annotation (Kamoun 2003; Randall et al. 2004).

Plant pathogens have evolved the remarkable ability to manipulate biochemical, physiological, and morphological processes in their host plants through a diverse array of extracellular effector proteins (Knogge 1996; Lauge and De Wit 1998; Torto et al. 2003).

Many secreted proteins from plant pathogenic oomycetes have been identified to be effector proteins, such as elicitins from all examined Phytophthora species (Tyler 2002),

Nep1-like necrosis-inducing proteins from P. parasitica and P. sojae (Fellbrich et al.

2002; Qutob et al. 2002), CRN1 and CRN2 from P. infestans (Torto et al. 2003), and the

avirulence protein Avr1b from P. sojae (Shan et al. 2004). P. infestans extracellular

proteins are likely to be involved in interactions with the host plants since P. infestans

colonizes the intercellular space during infection. Exploring the available P. infestans

genomic sequences for extracellular proteins would allow the discovery of candidate

effector proteins that can be used in further functional characterization (Torto et al.

2003). Torto et al. (2003) developed algorithm called PexFinder for automated

identification of extracellular proteins from large scale EST data sets. Candidate effector

proteins can be selected from these extracellular proteins based on specific criteria.

4 Degradative enzymes might be putative virulence factors involved in host tissue

penetration and degradation (Kamoun et al. 2002). Inhibitor proteins of hydrolytic

enzymes might be involved in counterdefense by inhibiting plant defensive enzymes

(Rose et al. 2002). There is indirect evidence showing that secreted effectors from plant

pathogenic fungi and oomycetes might function inside the plant cell (Jia et al. 2000;

Tyler 2002). Therefore, extracellular proteins that are also predicted to be localized intracellularly might be candidate effector proteins. In addition, proteins exhibiting significant sequence variation within populations of the pathogen might represent effectors that coevolved with host targets, especially if the encoding genes are undergoing diversifying selection (Stahl and Bishop 2000; Bos et al. 2003; Allen et al.

2004; Liu et al. 2004).

In this thesis research, we mined currently available P. infestans sequence

databases for genes encoding secreted proteins with predicted virulence function. Among

a set of 1294 predicted secreted proteins, 18 extracellular protease inhibitors were

identified. They belong to 2 major structural classes: (i) Kazal-like serine protease

inhibitors (EPI1 to EPI14, InterPro domain IPR002350, MEROPES family I1) and (ii)

cystatin-like cysteine protease inhibitors (EPIC1 to EPIC4, InterPro IPR000010 and/or

IPR003243, MEROPS family I25). These proteins fit one of our criteria for candidate

effector proteins since they are predicted to be inhibitors of proteases, a type of enzymes

that hydrolyze peptide bonds of proteins. Moreover, they could represent an important

virulence mechanism applied by P. infestans to suppress plant defense.

There is emerging evidence that the plant proteases play important roles in plant

defense. For example, several apoplastic proteases have been linked to defense. Rcr3, a

5 secreted cysteine protease from tomato, is required for Cf-2-mediated resistance against the fungus Cladosporium fulvum carrying the Avr2 avirulence gene (Kruger et al. 2002).

An apoplastic aspartic protease CDR1 from Arabidopsis activates defense signaling by generating an unknown mobile endogenous peptide elicitor (Xia et al. 2004). The roles of proteases in plant defense are also reflected in their involvement in the hypersensitive response (HR), a form of programmed cell death (PCD) that is associated with resistance to pathogens (D'Silva et al. 1998; Solomon et al. 1999; Mosolov et al. 2001; Chichkova et al. 2004). Proteasome involved in ubiquitin-mediated protein degradation pathway has been implicated in PCD and disease resistance (Suty et al. 2003; TÖR et al. 2003; Zeng et al. 2004). PCD inhibition using caspase inhibitors pointed to a role of plant proteases with caspase-like activity (cleavage after Asp residues) in the HR (D'Silva et al. 1998;

Solomon et al. 1999; Chichkova et al. 2004; van der Hoorn and Jones 2004). Plant vacuolar processing enzymes (VPEs) were recently identified to be cysteine proteases with caspase-like activity that are essential for virus-induced HR and virus resistance

(Hatsugai et al. 2004; Rojo et al. 2004). Interestingly, VPEs not only contribute to resistance to avirulent pathogens (incompatible interactions), but also to basic defense to pathogens during susceptible interactions (compatible interactions) (Hatsugai et al. 2004;

Rojo et al. 2004). Knockout of VPEγ from Arabidopsis results in increased susceptibility to Botrytis cinerea and turnip mosaic virus (Rojo et al. 2004). A variety of proteases from various plants are up-regulated during infection by plant pathogens suggesting a potential role in plant defense (Tornero et al. 1997; Avrova et al. 1999; Liu et al. 2001; Guevara et al. 2002; Zhao et al. 2003; Avrova et al. 2004; Tian et al. 2004). For example, the pathogenesis related protein P69B of tomato is an apoplastic subtilisin-like serine

6 protease that accumulate upon infection by multiple plant pathogens (Tornero et al. 1997;

Zhao et al. 2003; Tian et al. 2004).

A number of plant proteases have been implicated in defense responses against P.

infestans. These include tomato P69B subtilase (Tian et al. 2004), an extracellular

aspartic protease (AP), as well as two cysteine proteases CYP and StCathB from potato

(Avrova et al. 1999; Guevara et al. 2002; Avrova et al. 2004). All of them are highly

induced upon infection by P. infestans and some were shown to be differentially induced in plants with different levels of resistance (Avrova et al. 1999; Guevara et al. 2002;

Avrova et al. 2004; Tian et al. 2004). For instance, StCathB is rapidly induced during R gene-mediated resistance but its expression level is gradually increased in a potato cultivar with partial resistance (Avrova et al. 2004). The induction of AP expression is higher and faster in a resistant potato cultivar than in a susceptible one (Guevara et al.

2002). Differential induction in plants with different resistance suggests a role of these proteases in plant defense.

Plants and plant pathogens have co-evolved diverse attack and counter-attack strategies in their arms race for survival (Stahl and Bishop 2000). These antagonistic

systems include enzymes from pathogens/plants and the corresponding inhibitors from

plants/pathogens. Pathogens secrete cell-wall-degrading enzymes, such as polygalacturonases, to facilitate invasion of plants (Stotz et al. 2000; De Lorenzo et al.

2001). In turn, plants produce polygalacturonase-inhibiting proteins (PIGPs) to defend against invading microbes (De Lorenzo et al. 2001). On the other hand, plants use hydrolytic enzymes such as β-1, 3-endoglucanases to attack the pathogen cell wall (Rose et al. 2002). The oomycete pathogen Phytophthora sojae has evolved a counter-attack

7 mechanism by secreting glucanase inhibitor proteins (GIPs) that suppress the activity of a

soybean β-1, 3-endoglucanase (Rose et al. 2002). An analogous plant enzyme-pathogen

inhibitor co-evolution might involve plant proteases and pathogen protease inhibitors.

Despite the variety of examples showing that plant proteases are involved in plant defenses, no protease inhibitor has been reported from plant pathogens prior to the work described in this thesis. Kazal-like serine protease inhibitors and cystatin-like cysteine protease inhibitors are ubiquitous in oomycetes. A total of 35 putative Kazal-like inhibitors were identified from five plant pathogenic oomycete species, P. infestans, P. sojae, P. ramorum, P. brassicae, and the downy mildew Plasmopara halstedii. Cystatin- like protease inhibitors are also common in these oomycete plant pathogens. However, these two structural classes of protease inhibitors have not been found in any other microbial plant pathogens based on MEROPS database (a peptidase and inhibitor database available at http://merops.sanger.ac.uk/) and our own data mining of the

GenBank database. Therefore, the characterization of these extracellular protease inhibitors from P. infestans may reveal a novel and unique counterdefense mechanism.

Serine protease inhibitors from mammalian parasites have been shown to play a role in parasite survival and pathogenesis. These include Kazal-like inhibitors from apicomplexans Toxoplasma gondii and Neospora caninum, and Kunitz type serine protease inhibitor from the hookworm Ancylostoma ceylanicum (Milstone et al. 2000;

Pszenny et al. 2000; Pszenny et al. 2002; Bruno et al. 2004; Morris et al. 2004). These

parasites live in protease-rich digestive tracts and the protease inhibitors may protect

them from attack by host proteases. P. infestans also colonizes a protease-rich

8 environment, the plant apoplast, and it may have evolved a similar host protease- inhibiting virulence strategy.

The objective of this thesis was to functionally characterize the two families of

extracellular protease inhibitors of P. infestans, including characterization of their biochemical functions and their biological roles in pathogen virulence. The main findings of this thesis are described in Chapters 2-6 and are briefly summarized below.

In Chapter 2, we describe the 14 EPI proteins of P. infestans together with 21 additional Kazal-like extracellular protease inhibitors from four other plant pathogenic oomycetes. Among these proteins, the two-domain protein EPI1 was found to be a strong inhibitor of subtilisin A and inhibited and interacted with tomato pathogenesis-related subtilase P69B, suggesting a novel counterdefense mechanism for P. infestans.

In Chapter 3, we describe detailed evolutionary and comparative analyses of the

35 Kazal-like genes from five plant pathogenic oomycetes with an emphasis on the 14 epi

genes of P. infestans. Evolution of Kazal-like protease inhibitors was found to be driven

by gene duplication, domain shuffling, and diversifying selection. These analyses helped

us devise specific hypotheses regarding the function of the Phytophthora inhibitors and

the nature of their target proteases.

In Chapter 4, we describe the functional characterization of a second Kazal-like

extracellular serine protease inhibitor, EPI10, from P. infestans. Similar to EPI1, EPI10

also targets the tomato pathogenesis-related P69B subtilase. This suggests that inhibition

of P69B is complementarily performed by EPI1 and EPI10.

In Chapter 5, we investigated which of the two Kazal domains of EPI1 functions

in inhibiting subtilisins. The atypical two disulfide bridge domain was found to be a

9 stable inhibitor of subtilisin A, and solely responsible for the inhibition and interaction with tomato P69B subtilase. This finding sheds light on the biochemical and biological functions of Kazal inhibitors of plant pathogenic oomycetes, 40% of which contain atypical Kazal domain(s).

In Chapter 6, we describe the four cystatin-like extracellular protease inhibitors

(EPIC1-EPIC4) of P. infestans and cascades of inhibition of host defense-related proteases mediated by EPI1 and EPIC1/EPIC2B. This chapter provides biochemical evidence for the roles of defense-counterdefense mediated by tomato P69B and P. infestans EPI1. In addition, the overall results suggest that complex cascades of inhibition of host defense-related proteases lead to multifaced suppression of plant defense responses.

REFERENCES

Abramovitch, R.B. and Martin, G.B. 2004. Strategies used by bacterial pathogens to suppress plant defenses. Curr. Opin. Plant Biol. 7: 356-364.

Allen, R.L., Bittner-Eddy, P.D., Grenville-Briggs, L.J., Meitz, J.C., Rehmany, A.P., Rose, L.E., and Beynon, J.L. 2004. Host-parasite coevolutionary conflict between Arabidopsis and downy mildew. Science 306: 1957-1960.

Andreu, A., Tonón, C., Van Damme, M., Van Damme, M., Huarte, M., Huarte, M., and Daleo, G. 1998. Effect of glucans from different races of Phytophthora infestans on defense reactions in potato tuber. Eur. J. Plant Pathol. 104: 777-783.

Avrova, A.O., Stewart, H.E., De Jong, W.D., Heilbronn, J., Lyon, G.D., and Birch, P.R. 1999. A cysteine protease gene is expressed early in resistant potato interactions with Phytophthora infestans. Mol. Plant-Microbe Interact. 12: 1114-1119.

Avrova, A.O., Taleb, N., Rokka, V., Heilbronn, J., Campbell, E., Hein, I., Gilroy, E.M., Cardle, L., Bradshaw, J.E., Stewart, H.E., et al. 2004. Potato oxysterol binding protein and cathepsin B are rapidly up-regulated in independent defence pathways that distinguish R gene-mediated and field resistances to Phytophthora infestans. Mol. Plant Pathol. 5: 45-46. 10 Baldauf, S.L., Roger, A.J., Wenk-Siefert, I., and Doolittle, W.F. 2000. A kingdom-level phylogeny of eukaryotes based on combined protein data. Science 290: 972-977.

Birch, P.R.J. and Whisson, S. 2001. Phytophthora infestans enters the genomics era. Mol. Plant Pathol. 2: 257-263.

Bos, J.I.B., Armstrong, M., Whisson, S.C., Torto, T., Ochwo, M., Birch, P.R.J., and Kamoun, S. 2003. Intraspecific comparative genomics to identify avirulence genes from Phytophthora. New Phytol. 159:63-72.

Bouarab, K., Melton, R., Peart, J., Baulcombe, D., and Osbourn, A. 2002. A saponin- detoxifying enzyme mediates suppression of plant defences. Nature 418: 889-892.

Brunner, F., Wirtz, W., Rose, J.K., Darvill, A.G., Govers, F., Scheel, D., and Nurnberger, T. 2002. A beta-glucosidase/xylosidase from the phytopathogenic oomycete Phytophthora infestans. Phytochemistry 59: 689-696.

Bruno, S., Duschak, V.G., Ledesma, B., Ferella, M., Andersson, B., Guarnera, E.A., and Angel, S.O. 2004. Identification and characterization of serine proteinase inhibitors from Neospora caninum. Mol. Biochem. Parasitol. 136: 101-107.

Bushnell, W.R. and Rowell, J.B. 1981. Suppressors of defense reactions: a model for roles in specificity. Phytopathology 71: 1012-1014.

Chichkova, N.V., Kim, S.H., Titova, E.S., Kalkum, M., Morozov, V.S., Rubtsov, Y.P., Kalinina, N.O., Taliansky, M.E., and Vartapetian, A.B. 2004. A plant caspase-like protease activated during the hypersensitive response. Plant Cell 16: 157-171.

Coffey, M.D. and Wilson, U.E. 1983. Histology and cytology of infection and disease caused by Phytophthora. In Phytophthora (eds. D.C. Erwin S. Bartnicki-Garcia, and P.H. Tsao), pp. 289-301. Am. Phytopathol. Soc., St. Paul.

D'Silva, I., Poirier, G.G., and Heath, M.C. 1998. Activation of cysteine proteases in cowpea plants during the hypersensitive response-a form of programmed cell death. Exp. Cell Res. 245: 389-399.

Damasceno, C.M.B., Ripoll, D.R., Kamoun, S., Bishop, J., and Rose, J.K.C. 2004. Molecular cloning and characterization of the GIP gene family from Phytophthora infestans. Phytopathology 94: S24.

Dangl, J.L. and Jones, J.D. 2001. Plant pathogens and integrated defence responses to infection. Nature 411: 826-833.

De Lorenzo, G., D'Ovidio, R., and Cervone, F. 2001. The role of polygalacturonase- inhibiting proteins (PGIPs) in defense against pathogenic fungi. Annu. Rev. Phytopathol. 39: 313-335.

11 Duncan, J.M. 1999. Phytophthora-an abiding threat to our crops. Microbiol. Today 26: 114-116.

Fellbrich, G., Romanski, A., Varet, A., Blume, B., Brunner, F., Engelhardt, S., Felix, G., Kemmerling, B., Krzymowska, M., and Nurnberger, T. 2002. NPP1, a Phytophthora- associated trigger of plant defense in parsley and Arabidopsis. Plant J. 32: 375-390.

Fry, W.E. and Goodwin, S.B. 1997. Resurgence of the Irish potato famine fungus. Bioscience 47: 363-371.

Garelik, G. 2002. Agriculture. Taking the bite out of potato blight. Science 298: 1702- 1704.

Gornhardt, B., Rouhara, I., and Schmelzer, E. 2000. Cyst germination proteins of the potato pathogen Phytophthora infestans share homology with human mucins. Mol. Plant- Microbe Interact. 13: 32-42.

Guevara, M.G., Oliva, C.R., Huarte, M., and Daleo, G.R. 2002. An aspartic protease with antimicrobial activity is induced after infection and wounding in intercellular fluids of potato tubers. Eur. J. Plant Pathol. 108: 131-137.

Hatsugai, N., Kuroyanagi, M., Yamada, K., Meshi, T., Tsuda, S., Kondo, M., Nishimura, M., and Hara-Nishimura, I. 2004. A plant vacuolar protease, VPE, mediates virus- induced hypersensitive cell death. Science 305: 855-858.

Heath, M.C. 2000. Hypersensitive response-related death. Plant Mol. Biol. 44: 321-334.

Huitema, E., Bos, J.I., Tian, M., Win, J., Waugh, M.E., and Kamoun, S. 2004. Linking sequence to phenotype in Phytophthora-plant interactions. Trends Microbiol. 12: 193- 200.

Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P., and Valent, B. 2000. Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. EMBO J. 19: 4004-4014.

Judelson, H.J. 1996. Recent advances in the genetics of oomycete plant-pathogens. Mol. Plant-Microbe Interact. 9: 443-449.

Judelson, H.J. 1997. The genetics and biology of Phytophthora infestans: Modern approaches to a historical challenge. Fungal Genet. Biol. 22: 65-76.

Kamoun, S. 2003. Molecular genetics of pathogenic oomycetes. Eukaryotic Cell 2: 191- 199.

Kamoun, S., Dong, S., Hamada, W., Huitema, E., Kinney, D., Morgan, W.R., Styer, A., Testa, A., and Torto, T. 2002. From sequence to phenotype: Functional genomics of Phytophthora. Can. J. Plant Pathol. 24: 6-9. 12 Kamoun, S., Huitema, E., and Vleeshouwers, V.G.A.A. 1999. Resistance to oomycetes: A general role for the hypersensitive response? Trends Plant Sci. 4: 196-200.

Knogge, W. 1996. Fungal infections of plants. Plant Cell 8: 1711-1722.

Kruger, J., Thomas, C.M., Golstein, C., Dixon, M.S., Smoker, M., Tang, S., Mulder, L., and Jones, J.D. 2002. A tomato cysteine protease required for Cf-2-dependent disease resistance and suppression of autonecrosis. Science 296: 744-747.

Latijnhouwers, M., Ligterink, W., Vleeshouwers, V.G., van West, P., and Govers, F. 2004. A Gα subunit controls zoospore motility and virulence in the potato late blight pathogen Phytophthora infestans. Mol. Microbiol. 51: 925-936.

Lauge, R. and De Wit, P.J. 1998. Fungal avirulence genes: structure and possible functions. Fungal Genet. Biol. 24: 285-297.

Liu, Y., Dammann, C., and Bhattacharyya, M.K. 2001. The matrix metalloproteinase gene GmMMP2 is activated in response to pathogenic infections in soybean. Plant Physiol. 127: 1788-1797.

Liu, Z., Bos, J.I., Armstrong, M., Whisson, S.C., da Cunha, L., Torto-Alalibo, T., Win, J., Avrova, A.O., Wright, F., Birch, P.R., et al. 2004. Patterns of diversifying selection in the phytotoxin-like scr74 gene family of Phytophthora infestans. Mol. Biol. Evol. in press.

Margulis, L. and Schwartz, K.V. 2000. Five Kingdoms: An Illustrated Guide to the Phyla of Life on Earth. W.H. Freeman and Co., New York.

McLeod, A., Smart, C.D., and Fry, W.E. 2002. Characterization of 1,3-b glucanase and 1,3;1,4-b glucanase genes from Phytophthora infestans. Fungal Genet. Biol. 38: 250-263.

Milstone, A.M., Harrison, L.M., Bungiro, R.D., Kuzmic, P., and Cappello, M. 2000. A broad spectrum Kunitz type serine protease inhibitor secreted by the hookworm Ancylostoma ceylanicum. J. Biol. Chem. 275: 29391-29399.

Morris, M.T., Cheng, W.C., Zhou, X.W., Brydges, S.D., and Carruthers, V.B. 2004. Neospora caninum expresses an unusual single-domain Kazal protease inhibitor that is discharged into the parasitophorous vacuole. Int. J. Parasitol. 34: 693-701.

Mosolov, V.V., Grigor'eva, L.I., and Valueva, T.A. 2001. Involvement of proteolytic enzymes and their inhibitors in plant protection. Appl. Biochem. Microbiol. 37: 115-123.

Panstruga, R. 2003. Establishing compatibility between plants and obligate biotrophic pathogens. Curr. Opin. Plant Biol. 6: 320-326.

Pszenny, V., Angel, S.O., Duschak, V.G., Paulino, M., Ledesma, B., Yabo, M.I., Guarnera, E., Ruiz, A.M., and Bontempi, E.J. 2000. Molecular cloning, sequencing and

13 expression of a serine proteinase inhibitor gene from Toxoplasma gondii. Mol. Biochem. Parasitol. 107: 241-249.

Pszenny, V., Ledesma, B.E., Matrajt, M., Duschak, V.G., Bontempi, E.J., Dubremetz, J.F., and Angel, S.O. 2002. Subcellular localization and post-secretory targeting of TgPI, a serine proteinase inhibitor from Toxoplasma gondii. Mol. Biochem. Parasitol. 121: 283-286.

Qutob, D., Kamoun, S., and Gijzen, M. 2002. Expression of a Phytophthora sojae necrosis-inducing protein occurs during transition from biotrophy to necrotrophy. Plant J. 32: 361-373.

Randall, T.A., Dwyer, R.A., Huitema, E., Beyer, K., Cvitanich, C., Kelkar, H., Ah Fong, A.M.V., Gates, K., Roberts, S., Yatzkan, E., et al. 2004. Large-scale gene discovery in the oomycete Phytophthora infestans reveals likely components of phytopathogenicity shared with true fungi. Mol. Plant-Microbe Interact. in press.

Ristaino, J.B. 2002. Tracking historic migrations of the Irish potato famine pathogen, Phytophthora infestans. Microbes Infect. 4: 1369-1377.

Rojo, E., Martin, R., Carter, C., Zouhar, J., Pan, S., Plotnikova, J., Jin, H., Paneque, M., Sanchez-Serrano, J.J., Baker, B., et al. 2004. VPEγ exhibits a caspase-like activity that contributes to defense against pathogens. Curr. Biol. 14: 1897-1906.

Rose, J.K., Ham, K.S., Darvill, A.G., and Albersheim, P. 2002. Molecular cloning and characterization of glucanase inhibitor proteins: coevolution of a counterdefense mechanism by plant pathogens. Plant Cell 14: 1329-1345.

Sanchez, L.M., Ohno, Y., Miura, Y., Kawakita, K., and Doke, N. 1992. Host selective suppression by water-soluble glucans from Phytophthora spp. of hypersensitive cell death of suspension-cultured cells from some solanaceous plants caused by hyphal wall elicitors of the fungi. Ann. Phytopathol. Soc. Japan 58: 664-670.

Shan, W., Cao, M., Leung, D., and Tyler, B.M. 2004. The Avr1b locus of Phytophthora sojae encodes an elicitor and a regulator required for avirulence on soybean plants carrying resistance gene Rps1b. Mol. Plant-Microbe Interact. 17: 394-403.

Shattock, R.C. 2002. Phytophthora infestans: populations, pathogenicity and phenylamides. Pest Manag. Sci. 58: 944-950.

Smart, C.D. and Fry, W.E. 2001. Invasions by the late blight pathogen: renewed sex and enhanced fitness. Biol. Invas. 3: 235-243.

Sogin, M.L., and Silberman, J.D. 1998. Evolution of the protists and protistan parasites from the perspective of molecular systematics. Int. J. Parasitol. 28: 11-20.

14 Solomon, M., Belenghi, B., Delledonne, M., Menachem, E., and Levine, A. 1999. The involvement of cysteine proteases and protease inhibitor genes in the regulation of programmed cell death in plants. Plant Cell 11: 431-444.

Stahl, E.A. and Bishop, J.G. 2000. Plant-pathogen arms races at the molecular level. Curr. Opin. Plant Biol. 3: 299-304.

Stotz, H.U., Bishop, J.G., Bergmann, C.W., Koch, M., Albershem, P., Darvill, A.G., and Labavitch, J.M. 2000. Identification of target amino acids that affect interactions of fungal polygalacturonases and their plant inhibitors. Physiological and Molecular Plant Pathology 56: 117-130.

Suty, L., Lequeu, J., Lancon, A., Etienne, P., Petitot, A.S., and Blein, J.P. 2003. Preferential induction of 20S proteasome subunits during elicitation of plant defense reactions: towards the characterization of "plant defense proteasomes". Int. J. Biochem. Cell Biol. 35: 637-650.

Tian, M., Huitema, E., Da Cunha, L., Torto-Alalibo, T., and Kamoun, S. 2004. A Kazal- like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. J. Biol. Chem. 279: 26370-26377.

TÖR, M., YEMM, A., and HOLUB, E. 2003. The role of proteolysis in R gene mediated defence in plants. Mol. Plant Pathol. 4: 287-296.

Tornero, P., Conejero, V., and Vera, P. 1997. Identification of a new pathogen-induced member of the subtilisin-like processing protease family from plants. J. Biol. Chem. 272: 14412-14419.

Torto, T.A., Li, S., Styer, A., Huitema, E., Testa, A., Gow, N.A., van West, P., and Kamoun, S. 2003. EST mining and functional expression assays identify extracellular effector proteins from the plant pathogen Phytophthora. Genome Res. 13: 1675-1685.

Torto, T.A., Rauser, L., and Kamoun, S. 2002. The pipg1 gene of the oomycete Phytophthora infestans encodes a fungal-like endopolygalacturonase. Curr. Genet. 40: 385-390.

Tyler, B.M. 2002. Molecular basis of recognition between Phytophthora pathogens and their hosts. Annu. Rev. Phytopathol. 40: 137-167. van der Hoorn, R.A. and Jones, J.D. 2004. The plant proteolytic machinery and its role in defence. Curr. Opin. Plant Biol. 7: 400-407.

Xia, Y., Suzuki, H., Borevitz, J., Blount, J., Guo, Z., Patel, K., Dixon, R.A., and Lamb, C. 2004. An extracellular aspartic protease functions in Arabidopsis disease resistance signaling. EMBO J. 23: 980-988.

15 Yoshioka, H., Hayakawa, Y., and Doke, N. 1995. Suppression of phenylalanine ammonia-lyase mRNA accumulation by suppressors from Phytophthora infestans. Ann. Phytopathol. Soc. Japan 61: 7-12.

Zeng, L.R., Qu, S., Bordeos, A., Yang, C., Baraoidan, M., Yan, H., Xie, Q., Nahm, B.H., Leung, H., and Wang, G.L. 2004. Spotted leaf11, a negative regulator of plant cell death and defense, encodes a U-box/armadillo repeat protein endowed with E3 ubiquitin ligase activity. Plant Cell 16: 2795-2808.

Zhao, Y., Thilmony, R., Bender, C.L., Schaller, A., He, S.Y., and Howe, G.A. 2003. Virulence systems of Pseudomonas syringae pv. tomato promote bacterial speck disease in tomato by targeting the jasmonate signaling pathway. Plant J. 36: 485-499.

16 CHAPTER 2

A KAZAL-LIKE EXTRACELLULAR SERINE PROTEASE INHIBITOR FROM

PHYTOPHTHORA INFESTANS TARGETS THE TOMATO PATHOGENESIS-

RELATED PROTEASE P69B

2.1 ABSTRACT

The oomycetes form one of several lineages within the eukaryotes that independently evolved a parasitic lifestyle, and consequently are thought to have developed alternative mechanisms of pathogenicity. The oomycete Phytophthora infestans causes late blight, a ravaging disease of potato and tomato. Little is known about processes associated with P. infestans pathogenesis, particularly the suppression of host defense responses. We describe and functionally characterize an extracellular protease inhibitor, EPI1, from P. infestans. EPI1 contains two domains with significant similarity to the Kazal family of serine protease inhibitors. Database searches suggested that Kazal-like proteins are mainly restricted to animals and apicomplexan parasites, but appear to be widespread and diverse in the oomycetes. Recombinant EPI1 specifically inhibited subtilisin A among major serine proteases, and inhibited and interacted with the pathogenesis-related P69B subtilisin-like serine protease of tomato in intercellular fluids.

17 The epi1 and P69B genes were coordinately expressed and up-regulated during infection

of tomato by P. infestans. Inhibition of tomato proteases by EPI1 could form a novel type

of defense-counterdefense mechanism between plants and microbial pathogens. This

study points to a common virulence strategy between the oomycete plant pathogen P.

infestans and several mammalian parasites, such as the apicomplexan Toxoplasma gondi.

2.2 INTRODUCTION

Parasitic and pathogenic lifestyles have evolved repeatedly in eukaryotes (Sogin

1998). Several parasitic eukaryotes represent deep phylogenetic lineages, suggesting that

they feature unique molecular processes for infecting their hosts. One such lineage is

formed by the oomycetes, a group of fungus-like organisms that are distantly related to

fungi but closely related to brown algae and diatoms in the Stramenopiles (Sogin 1998;

Margulis and Schwartz 2000; Kamoun 2003). One of the most notorious and destructive

oomycete is the Irish famine pathogen, Phytophthora infestans. This species causes late

blight, a reemerging and ravaging disease of potato and tomato (Birch and Whisson 2001;

Smart and Fry 2001; Ristaino 2002; Shattock 2002). During the early stages of infection,

P. infestans requires living host cells but later causes extensive necrosis of host tissue, a

lifestyle that is known as hemibiotrophy. As with other biotrophic plant pathogens,

processes associated with P. infestans pathogenesis are thought to include the suppression

of host defense responses (Heath 2000; Bouarab et al. 2002; Kamoun 2003). In P.

infestans, water soluble glucans have been reported to suppress host defenses in a plant

cultivar-specific manner (Sanchez et al. 1992; Yoshioka et al. 1995; Andreu et al. 1998).

Nevertheless, the molecular basis of suppression of host defenses by Phytophthora

18 remains poorly understood (Kamoun 2003). It is tempting to speculate that unique classes of suppressor genes have been recruited to aid in infection and counteract host defenses during the evolution of pathogenesis in the oomycete lineage.

Parasitic eukaryotes often face inhospitable environments in their hosts. For example, parasites that colonize or transit through the mammalian digestive tract must adapt to the diverse and abundant array of proteases secreted in the gastric juices (Dubey

1998; Milstone et al. 2000; Morris et al. 2002). Some of these parasites secrete inhibitors that target host proteases and may aid in survival and colonization of the host. For instance, the apicomplexan obligate parasite Toxoplasma gondii secretes TgPI-1 and

TgPI-2, four-domain serine protease inhibitors of the Kazal family (Pszenny et al. 2000;

Lindh et al. 2001; Morris et al. 2002; Pszenny et al. 2002; Morris and Carruthers 2003),

and the intestinal hookworm Ancylostoma ceylanicum secretes an 8-kDa broad spectrum

serine protease inhibitor of the Kunitz family (Milstone et al. 2000). In plants, the

apoplast (intercellular fluid) forms a protease-rich environment that is colonized by many

pathogens, including P. infestans and the fungus Cladosporium fulvum. In tomato,

apoplastic proteases are integral components of the plant defense response. Serine

proteases of the P69 subtilase family have long been tied to pathogen defense and two

isoforms P69B and P69C are known as pathogenesis-related proteins (PR-7 class)

(Tornero et al. 1997; Jorda et al. 1999; van Loon and van Strien 1999). More recently, an

apoplastic papain-like cysteine protease, Rcr3, was shown to be required for specific

resistance to C. fulvum (Kruger et al. 2002). In addition, several C. fulvum extracellular proteins are processed or degraded by host proteases in the apoplast resulting in altered functionality (Van den Ackerveken et al. 1993; Joosten et al. 1997).

19 Despite the importance of extracellular proteases in plant defense, to date no protease inhibitor has been reported from microbial plant pathogens. In this paper, we describe and functionally characterize an extracellular protease inhibitor, EPI1, from P. infestans. EPI1 contains two domains with significant similarity to the Kazal family of serine protease inhibitors, which also occurs in many animal species and in apicomplexan parasites. In vitro studies indicated that recombinant EPI1 (rEPI1) specifically inhibited subtilisin A among the major serine proteases. rEPI1 was further demonstrated to inhibit and interact with tomato P69B subtilisin-like serine protease. The epi1 and P69B genes were coordinately expressed and upregulated during infection of tomato by P. infestans.

Overall these results suggest that inhibition of tomato proteases by P. infestans EPI1 could form a novel type of defense-counterdefense mechanism between plants and microbial pathogens. In addition, this study points to a common virulence strategy between the oomycete plant pathogen P. infestans and mammalian parasites, such as the apicomplexan T. gondii.

2.3 MATERIALS AND METHODS

Phytophthora strains and culture conditions

P. infestans isolate 90128 (A2 mating type, race 1.3.4.7.8.9.10.11) was used throughout the study. P. infestans 90128 was routinely grown on rye agar medium supplemented with 2% sucrose (Caten and Jinks 1968). For RNA extraction, plugs of mycelium were transferred to modified Plich medium (Kamoun et al. 1993) and grown for 2-3 weeks before harvesting.

20 Bacterial strains and plasmids

Escherichia coli XL1-Blue was used in this study and was routinely grown at

37°C in Luria-Bertani (LB) media (Sambrook et al. 1989). Plasmid pFLAG-EPI1 was constructed by cloning polymerase chain reaction (PCR) amplified DNA fragment corresponding to the mature sequence of EPI1 into the HindIII site of pFLAG-ATS

(Sigma, St. Louis, MO), a vector that allows secreted expression in E. coli. The oligonucleotides EPI1-F1 (5’-GCGAAGCTTCAAAGCCCGCAAGTCATCAG-3’) and

EPI1-R1 (5’-GCGAAGCTTATCCCTCCTGCGGTGTC-3’) were used to amplify the fragment. The introduced HindIII restriction sites are underlined. The N-terminal

sequence of the processed recombinant FLAG-EPI1 (rEPI1) protein is

“DYKDDDDKVKLQSPQVISPAP...”. The FLAG epitope sequence is underlined, and the first 10 amino acids of mature EPI1 are shown in bold.

Plant growth, BTH treatment, and infection by P. infestans

Tomato (Lycopersicon esculentum) cultivar Ohio 7814 was used throughout the study and grown in pots at 25°C, 60% humidity, under 16 hour-light/8 hour-dark cycle.

We used the salicylic acid analog benzo-(1, 2, 3)-thiadiazole-7-carbothioic acid S-methyl ester (BTH) to mimic pathogen infection. For BTH treatment, 10 ml of a 25 µg/ml BTH solution was applied to 3-week-old tomato plants by soil drench. Plants treated with 10 ml water were used as controls. Leaves from BTH-treated and control plants were detached for isolation of intercellular fluids 6 days after treatment. Time courses of P. infestans infection of tomato leaves were performed exactly as described earlier (Kamoun et al. 1998). 10 µl droplets containing 1,000 zoospores of P. infestans were used to inoculate the underside of detached tomato leaves. Leaf discs of similar sizes were

21 dissected from the inoculated regions while making sure that the inoculation spot is in the center of sampled area. Leaf discs were frozen in liquid nitrogen and stored at –80°C for later use in RNA extraction. For isolation of intercellular fluids, tomato leaves were sprayed with zoospore suspensions at the concentration mentioned above (105/ml), and the intact leaves were collected at different time points for immediate preparation of intercellular fluids.

Isolation of intercellular fluids

Intercellular fluids were prepared using a 0.24 M sorbitol solution according to the method of de Wit and Spikman (1982). The intercellular fluids were filter sterilized

(0.22 µM), and were used immediately or stored at –20°C.

Sequence analyses

GC counting was performed as described elsewhere (Huitema et al. 2003).

PexFinder and signal peptide predictions were performed as described by Torto et al.

(2003). Similarity searches were performed locally on an Intel Linux or a Mac OSX workstation, or through the internet on the NCGR (www.ncgr.org) and Whitehead

Institute web servers (www-genome.wi.mit.edu/resources.html). Search programs included BLAST (Altschul et al. 1997), and the similarity search programs implemented in the BLOCKS (Henikoff et al. 2000), pfam (Bateman et al. 2002), SMART (Letunic et al. 2002), and InterPro (Apweiler et al. 2001) websites. The examined sequence databases included GenBank nonredundant, dBEST, and TraceDB (Karsch-Mizrachi and Ouellette

2001), PGC (Waugh et al. 2000), SPC, a proprietary database of Syngenta Inc. containing ca. 75,000 ESTs from P. infestans (courtesy of the Syngenta Phytophthora Consortium,

Research Triangle Park, NC), and the genome sequences of the fungal species

22 Aspergillus nidulans, Magnaporthe grisea, Neurospora crassa, and Fusarium

graminearum available through the Whitehead Institute Fungal Genome Initiative

Databases (www-genome.wi.mit.edu/resources.html). Multiple alignments of the Kazal

domains were conducted using the program CLUSTAL-X (Thompson et al. 1997). The

P. infestans sequences described in this chapter were deposited in GenBank under

accession numbers AY586273-AY586284. Other sequences were obtained from NCBI

nr, dBEST or Trace Archive databases (www.ncbi.nlm.nih.gov) (Table 2.1).

RNA isolation, northern blot and RT-PCR analyses

RNA isolation and northern blot hybridizations were performed as described

earlier (Torto et al. 2003). Probes for epi1, actA, and tomato alpha tubulin were generated

by random primer labeling using gel-purified fragments digested or PCR amplified from

the corresponding cDNA clones (Unkles et al. 1991) (this study). Probe for tomato P69B

was generated from a gel-purified RT-PCR fragment amplified from total RNA isolated

from infected tomato tissue. For RT-PCR, total RNA was treated with DNA-freeTM

(Ambion, Austin, TX) to remove contaminating DNA and first-strand cDNAs were synthesized using the ThermoScriptTM RT-PCR system from 5 µg of total RNA following the instructions of the manufacturer (Invitrogen, Carlsbad, CA). PCR amplifications were carried out with 0.005% of the cDNA product. The oligonucleotide primer pairs, P69A-RTF1 (5’-TGGCAGGTGGTGGAGTTCCGAGGG-3’) and P69A-

RTR1 (5’-CATTGGATCAACAAAAGTGCAATTGG-3’), P69B-RTF1 (5’- CAGCACT

CGGCCATGTAGCCAATGTT-3’) and P69B-RTR1 (5’-CTAGGCAGACACAACTGC

AATTGGACTTC-3’), P69D-RTF1 (5’-TGCGAAGTATAAGTCTTCTCAGAGTTGC-

3’) and P69D-RTR1 (5’-TCAGCAGACACTCTAACTGCAATTGGAC-3’), were

23 designed to be gene-specific based on the published P69 gene sequences (Jorda et al.

1999), and were used for the amplification of P69A, P69B and P69D sequences respectively. The oligonucleotides EPI1-F1 and EPI1-R1, previously used for cloning epi1 into pFLAG-ATS vector, were used to detect epi1 transcripts by RT-PCR. Primer

specificity was confirmed by sequencing the RT-PCR products. The expression of P69A,

P69B and P69D was controlled with primer pair EF1α-F1 (5’-GCTGCTGTAACAAGGT

TTGCTTTAATTCG -3’) and EF1α-R1 (5’-CCAGCATCACACTGCACAGTTCACTTC

-3’), which are specific for the constitutively expressed tomato elongation factor 1 alpha gene (EF1α (Shewmaker et al. 1990). The expression of epi1 was controlled with P. infestans elongation factor 2 alpha (EF2α gene using the primer pair described previously

(Torto et al. 2002).

SDS-PAGE and western blot analyses

Proteins were subjected to 10%-15% sodium dodecyl sulfate-polyacrylamide gel

electrophoresis (SDS-PAGE) as previously described (Sambrook et al. 1989). Following

electrophoresis, gels were stained with silver nitrate following the method of Merril et al.

(1981), stained with Coomassie Brilliant Blue (Sambrook et al. 1989), or the proteins

were transferred to supported nitrocellulose membranes (BioRad Laboratories, Hercules,

CA) using a Mini Trans-Blot apparatus (BioRad Laboratories, Hercules, CA). Detection

of antigen-antibody complexes was carried out with a western blot alkaline phosphatase

kit (BioRad Laboratories, Hercules, CA). Antisera to P69 subtilases were produced by

immunizing rabbits with the keyhole limpet hemocyanin (KLH) conjugated peptide,

H2N-TTHTPSFLGLQQNC-amide. The sequence underlined is located at N-terminus of

mature P69B and P69D proteins (Jorda et al. 1999), and was chosen for its highly 24 antigenic characteristics and conservation among P69 proteins. Selection of peptides for highly antigenic characteristics, peptide synthesis and conjugation, as well as antisera production were performed by Rockland Immunochemicals (Gilbertsville, PA). In

Western blot analyses, the antisera to the P69 peptide reacted only with ca. 70 kDa bands from tomato intercellular fluids.

Expression and purification of rEPI1

Expression of rEPI from pFLAG-EPI1 was conducted as described previously

(Kamoun et al. 1997). Overnight cultures of E. coli XL1-blue containing pFLAG-EPI1 were diluted (1:100) in LB medium containing ampicilin (50 µg/ml) and incubated at

37°C. When the OD600 of the cultures reached 0.6, IPTG was added to a final concentration of 0.4 mM. The cultures were further incubated for 5 to 6 h before processing. Recombinant EPI1 was recovered from the culture supernatant and was purified by immunoaffinity using gravity column packed with Anti-FLAG M2 affinity gel (Sigma, St. Luis, MO). Proteins were eluted with 0.1 M glycine (pH 3.5) and immediately equilibrated to neutral pH with 20 µl 1 M Tris, pH 8.0, for each 1 ml eluted fraction. Protein concentrations were determined using the BioRad protein assay (BioRad

Laboratories, Hercules, CA). 0.5 µg of the purified protein was run on a SDS-PAGE gel followed by staining with silver nitrate to determine the purity.

Assays of protease inhibition

Inhibition assays of commercial serine proteases by rEPI1 was performed by the colorimetric QuantiCleaveTM Protease Assay Kit (Pierce, Rockford, IL). 20 pmol of rEPI1 was preincubated with 20 pmol of trypsin (Pierce, Rockford, IL), chymotrypsin

(Sigma, St. Luis, MO), or subtilisin A (Carlsberg) (Sigma, St. Luis, MO), in a volume of

25 50 µl for 30 min at 25°C, and followed by incubation with 100 µl of succinylated casein

(2mg/ml) in 50 mM Tirs buffer pH8, containing 20 mM CaCl2 at room temperature for

20 min. Protease activity was measured as absorbance at 405 nm using HTS 7000 Bio

Assay Reader (Perkin Elmer) 20 min after the addition of chromogenic reagent 2,4,6- trinitrobenzene sulfonic acid, which reacts with the primary amine of digested peptide and produces the color reaction which can be quantified by absorbance reader. Detailed kinetic analysis of subtilisin A inhibition by rEPI1 was performed as follows. 2 pmol subtilisin A was preincubated with increasing concentrations of rEPI1 in a volume of 50

µl for 15 min at 25°C, and was followed by the addition of 150 µl assay buffer: 50 mM

Tris-Cl, pH 8.0, containing 2.5% DMSO, and 500 µM subtilisin chromogenic substrate

Boc-Gly-Gly-Leu-pNA (Calbiochem, La Jolla, CA). Experiments were performed three

times and in triplicate each time. Initial reaction velocities were measured by monitoring

absorbance change at 405 nm over reaction time using HTS 7000 Bio Assay Reader

(Perkin Elmer). Kiapp was determined following the method described by Morris et al.

app app (2002). The slope of the linear plot of [V0/Vi]-1 versus [I] was estimated as 1/Ki . Ki

was converted to Ki according to the formula Ki = Kiapp/(1+ [S]/Km) (Delaria et al.

1997). Varying concentrations of substrate were incubated with 2 pmol subtilisin A in a total volume of 200 µl under the conditions described above and initial velocities were measured by monitoring the absorbance at 405 nm. The Km was determined graphically by Double-reciprocal Lineweaver-Burk plots of 1/[v] versus 1/[s].

Inhibition assays of plant proteases by rEPI1 were carried out with the

QuantiCleaveTM Protease Assay Kit (Pierce, Rockford, IL) and in-gel protease assays

using BIO-RAD’s zymogram buffer system. For the first method, 50 µl intercellular 26 fluids were preincubated with or without 10 pmol of rEPI1 at 25°C for 30 min and the protease activities were subsequently measured. For the in-gel protease assays, 10 pmol rEPI1 were preincubated with 8 µl of intercellular fluids for 30 min at 25°C and then mixed with zymogram sample buffer and loaded on a 10% SDS-polyacrylamide gel without boiling or addition of reducing reagents. Following electrophoresis, the gel was incubated in 1X zymogram renaturation buffer for 30 min twice. Then, the gel was incubated in 1X zymogram development buffer for 4 hours at 37°C before staining with

0.5% Coomassie Brilliant Blue.

Coimmunoprecipitation

Coimmunoprecipitation of rEPI1 and tomato intercellular fluid proteins was performed using the FLAG Tagged Protein Immunoprecipitation Kit (Sigma, St. Louis,

MO) following the manufacturer’s instructions. 100 pmol of purified rEPI1 were preincubated with 200 µl tomato intercellular fluid for 30 min at 25°C. 50 µl anti-flag M2 resin was added and incubated at 4°C for 2 hours with gentle shaking. The precipitated protein complexes were eluted in 60 µl of FLAG peptide solution (150 ng/µl) and were analyzed by SDS-PAGE and western blot analyses.

Tandem mass spectrometric sequencing

Tandem mass spectrometric sequencing was performed at the proteomics facility of The Cleveland Clinic Foundation (Cleveland, OH). The selected protein band was cored from the gel and protein digestion was carried out as previously described (Hanna et al. 2000). The LC-MS system used is a Finnigan LCQ-Deca ion trap mass spectrometer system with a Protana microelectrospray ion source interfaced to a self- packed 10 cm x 75 µm Phenomenex Jupiter C18 reversed-phase capillary

27 chromatography column. 2 µl volumes of the peptide extract were injected and the peptides were eluted from the column by an acetonitrile/0.05 M acetic acid gradient at a flow rate of 0.2 µl/min. The microelectrospray ion source was operated at 2.5 kV. The digest was analyzed using the data dependent multitask capability of the instrument resulting in approximately 1000 collision induced dissociation (CID) spectra of ions ranging in abundance over several orders of magnitude. The data were analyzed by using all CID spectra collected in the experiment to search the NCBI non-redundant database with the search program TurboSequest. All matching spectra were verified by manual interpretation.

2.4 RESULTS

EPI1 belongs to the Kazal family of protease inhibitors

We mined an EST data set generated from tomato leaves three days after infection with P. infestans using two methods: (1) GC counting to distinguish between

Phytophthora and tomato sequences (Huitema et al. 2003); (2) PexFinder to identify cDNAs encoding extracellular proteins (Torto et al. 2003). 488 out of 2808 ESTs examined showed a GC content higher than 53%. Of these 42 were predicted to encode extracellular proteins using the criteria of Torto et al. (2003). These ESTs were then annotated by similarity and motif searches against public databases. One EST, PC064G6

(GC content, 57.4%), showed similarity to proteins of the Kazal serine protease inhibitor family. DNA sequencing of the full cDNA revealed an open reading frame (ORF) of 450 bp corresponding to a predicted translated product of 149 amino acids (Figure 2.1A).

SignalP (Nielsen et al. 1997) analysis of the predicted protein identified a 16-amino acid 28 signal peptide with a significant mean S value of 0.88 and HMM score of 0.97. Similarity searches of the predicted protein against the nonredundant database of GenBank using the

BLASTP program (Altschul et al. 1997) revealed significant matches to Kazal protease inhibitors with the best hit corresponding to the signal crayfish protease inhibitor PAPI-1

(E value = 10-10). Searches against the InterPro database (Apweiler et al. 2001) revealed two domains similar to InterPro IPR002350 for Kazal inhibitors (Figure 2.1A). Based on these analyses, we propose that the examined P. infestans cDNA is likely to encode a two-headed Kazal serine protease inhibitor and we designated the cDNA epi1

(extracellular protease inhibitor 1).

Proteins with Kazal domains are diverse and ubiquitous in oomycetes

We used EPI1 and other Kazal domain sequences to search for Kazal-like motifs in sequence databases from oomycetes and other microbial plant pathogens (see Material and Methods). We failed to identify sequences similar to the Kazal domain in all examined fungal and bacterial databases, except for a predicted protein from the ammonia-oxidizing bacterium Nitrosomonas europaea (GenBank accession NP_841298)

(Chain et al. 2003). On the other hand, we unravelled a total of 35 different putative

proteins with 56 predicted Kazal-like domains (range, 1 to 4 per protein) in five plant

pathogenic oomycete species, P. infestans, Phytophthora sojae, Phytophthora ramorum,

Phytophthora brassicae, and the downy mildew Plasmopara halstedii (Table 2.1). These

oomycete Kazal motifs were identified in ESTs from a variety of developmental stages,

including host tissue infected with P. sojae and Pl. halstedii. We identified a putative full

open reading frame (ORF) sequence for 27 of the identified genes and the putative start

29 codon for 33 of the genes. All these 33 genes were predicted to have signal peptides based on SignalP (Nielsen et al. 1997; Nielsen and Krogh 1998).

We used Clustal X (Thompson et al. 1997) to generate a multiple alignment of representative oomycete Kazal domains with domains from signal crayfish PAPI-1 (the best hit in BLASTP searches against GenBank nonredundant database) and T. gondii

TgPI1 (Figure 2.1B). Amino acid residues defining the Kazal family signature, including the cysteine backbone, tyrosine and asparagine residues, were highly conserved. The oomycete domain structure was usually C-x(3,4)-C-x(7)-C-x(6)-Y-x(3)-C-x(6)-C- x(9,12,13,14)-C. The first EPI1 domain was atypical and lacked C3 and C6 but retained the other four cysteines (Figure 2.1A). The predicted active site P1, which is central to the specificity of Kazal inhibitors (Lu et al. 1997; Lu et al. 2001), was variable with ten different amino acids represented (A, D, E, H, K, M, N, R, S, and T). Remarkably, half

(28/56) the P1 residues, including those of EPI1, were aspartate (D), an uncommon P1 amino acid in other natural Kazal inhibitors. These results suggest that genes encoding proteins with Kazal domains are diverse and ubiquitous in plant pathogenic oomycetes.

EPI1 inhibits the serine protease subtilisin A

To determine whether EPI1 functions as a serine protease inhibitor as predicted by bioinformatic analyses, we expressed in E. coli and affinity purified recombinant EPI1

(rEPI1) as a fusion protein with the FLAG epitope tag at the amino-terminus. Silver staining of the purified protein on the SDS-PAGE gel revealed a single band indicating high purity. Chymotrypsin, trypsin, and subtilisin A, representing three major classes of serine proteases, were selected for inhibition assays with the purified rEPI1. Protease

30 activity was measured with or without EPI1. In repeated assays, rEPI1 was found to inhibit about 90% of the measured activity of subtilisin A, but did not cause apparent

inhibition of the other two proteases (Figure 2.2A). Time courses of chromogenic

substrate hydrolysis by subtilisin A in the presence of increasing amounts of rEPI1 were

performed and indicated that rEPI1 inhibition followed a typical dose-response pattern

(Figure 2.2B). The inhibitory constant (Ki) for subtilisin A inhibition by rEPI1 was

determined at 2.77 +/- 1.07 nM. These results suggest that epi1 encodes a functional

protease inhibitor that specifically targets the subtilisin class of serine proteases.

EPI1 inhibits BTH-induced apoplastic proteases from tomato

In tomato, some members of the subtilisin-like family P69, namely P69B and

P69C, are known to be induced by pathogens and stress treatments and are classified as

PR proteins (PR-7 class) (Tornero et al. 1997; Jorda et al. 1999; van Loon and Van Strien

1999). To test whether rEPI1 inhibits PR-like proteases in tomato, the salicylic acid

analog BTH was applied to tomato plants to induce defense-related proteases. In-gel

protease assays of tomato leaf intercellular fluid from both H2O-treated and BTH-treated plants revealed that, as expected, BTH induced the production of abundant extracellular proteases in tomato that migrated as two separate but close bands (Figure 2.3A).

Inhibition assays revealed that rEPI1 dramatically inhibited these BTH-induced proteases as well as partially inhibited a constitutive protease. The total endo-protease activity of tomato intercellular fluids was also measured in the absence or presence of rEPI1.

Significant inhibition of endo-protease activity was observed and corresponded to 28% and 27% of total activity in control and BTH-treated tomato, respectively (Figure 2.4).

31

EPI1 interacts with pathogenesis-related subtilases of the tomato P69 subfamily

To identify the plant proteases targeted by rEPI1, coimmunoprecipitation was performed on tomato intercellular fluid incubated with rEPI1 using FLAG antibody covalently linked agarose beads. In addition to rEPI1, two proteins were pulled down with the FLAG antibody only in the presence of rEPI1 (Figure 2.5A). These two proteins exhibited a similar molecular weight of approximately 70 kD (Figure 2.5A) and were more abundant in BTH-induced intercellular fluid (Figure 2.5B). These results prompted us to test whether these proteins could be tomato P69 subtilisin-like proteases. Western blot analyses with antisera raised against a peptide specific to P69 subtilisin-like proteases strongly interacted with both bands suggesting that rEPI1 interacts with P69 subtliases of tomato (Figure 2.5B). To confirm the results obtained with the western blot and further identify which P69 isoforms are the main targets of rEPI1, the two closely migrated protein bands (Figure 2.5) were cored from the coomassie-blue stained SDS-

PAGE gel as one sample and analyzed by tandem mass spectrometry. A total of 21 trypsin-digested peptides were sequenced and perfectly matched the subtilisin-like protease P69B (GenBank accession number T07184 or CAA76725) (Figure 2.6). Among these 21 peptides, 13 peptides were specific to P69B and did not match any of the other five known P69 isoforms. At this stage it cannot be ruled out that the two closely migrated protein bands contain other isoforms in minor amounts, but the results from the tandem mass spectrometry clearly showed that P69B is the main target of rEPI1.

32 The epi1 and P69B gene are concurrently expressed during infection of tomato by P. infestans

Expression pattern of both epi1 and P69 genes during infection of tomato by P.

infestans was studied by northern blot and RT-PCR analyses. The epi1 gene displayed the

highest mRNA levels three day post-inoculation and was moderately up-regulated (ca.

2X based on phosphoimager quantification) compared to in vitro grown mycelium and

relative to the constitutive actA gene (Figure 2.7A). Semi-quantitative RT-PCR analyses

confirmed these results (Figure 2.7B). The expression of P69 protease genes was induced

after inoculation with P. infestans and attained the highest level two and three days after

inoculation (Figure 2.7A). Semi-quantitative RT-PCR amplifications using primers

specific for P69A, P69B, and P69D, indicated that the pathogenesis-related P69B gene is

the only gene that is up-regulated during interaction with P. infestans (Figure 2.7B). We

could not assess the expression of P69C, the other pathogenesis related gene of the P69

family (Jorda et al. 1999) since we repeatedly failed to amplify P69C from tomato

cultivar Ohio 7814 based on published sequences. Increase in P69 protein during

infection of tomato by P. infestans was also noted by western blot analyses with P69

antisera of intercellular fluids obtained from a time course infection (Figure 2.7C).

Altogether, these results suggest that epi1 and P69 genes are concurrently expressed

during infection, and support the possibility of direct interaction between P. infestans

EPI1 and plant P69 proteases, particularly P69B, at the infection interface.

33 2.5 DISCUSSION

Plant pathogens manipulate biochemical and physiological processes in their host plants through a diverse array of virulence or avirulence molecules, known as effectors.

In susceptible plants, biotrophic plant pathogens produce effectors that promote infection by suppressing defense responses. Here, we describe EPI1, a two-domain extracellular protease inhibitor from P. infestans that inhibits apoplastic subtilases of tomato, namely the PR proteins P69. Based on its biological activity and expression pattern, EPI1 may function as a disease effector molecule and may play an important role in P. infestans colonization of host apoplast.

Suppression of host defenses is thought to play a critical role in plant-microbe

interactions, especially those involving biotrophic pathogens that require live plant cells

to establish a successful infection (Heath 1995; Heath 2000). Nonetheless, only a few

pathogen molecules that suppress host defenses have been identified. Examples include

tomatinase, a saponin-detoxifying enzyme from the fungal pathogen Septoria lycopersici,

that was recently shown to indirectly suppress host defense responses through its

degradation products (Bouarab et al. 2002). Phytophthora sojae secretes glucanase

inhibitor proteins (GIPs) that inhibit a soybean endo-β-1,3 glucanase and are thought to function as counterdefensive molecules that inhibit the degradation of β-1,3/1,6 glucans in the pathogen cell wall and/or the release of defense-eliciting oligosaccharides by host endo-β-1,3 glucanases (Rose et al. 2002). P. infestans and other Phytophthora species produce water-soluble glucans that suppress induction of host defense responses

(Sanchez et al. 1992; Yoshioka et al. 1995; Andreu et al. 1998). Here, we describe a novel class of pathogen suppressors of plant defense response, namely extracellular

34 protease inhibitors that directly interact with and inhibit host proteases. This interaction could form another type of defense-counterdefense mechanism between plants and microbial pathogens

We scanned GenBank and several other sequence databases for the occurrence of

Kazal-like domains. The examined data sets included the full genome sequence of several plant pathogenic bacteria and fungi. A 235 amino-acid protein from the ammonia- oxidizing bacterium Nitrosomonas europaea (GenBank accession NP_841298) was the only bacterial or fungal protein with significant similarity to the Kazal motif. In sharp contrast, 56 Kazal-like motifs were detected in 35 predicted proteins of five plant pathogenic oomycete species, P. infestans, P. sojae, P. ramorum, P. brassicae, and Pl.

halstedii (Table 2.1). Interestingly, oomycete Kazal motif genes are often expressed

during host colonization. Five of the identified sequences were from cDNAs obtained

from infected-plant tissue corresponding to diverse oomycete pathosystems: P. infestans-

tomato/potato, P. sojae-soybean, and Pl. halstedii-sunflower. Taken together, the

common occurrence of Kazal motifs in several plant pathogenic oomycetes, their in-

planta expression, and the functional analyses of EPI1 suggest that inhibition of host

proteases could be a conserved virulence strategy among oomycete pathogens. It remains

unclear whether other plant pathogenic microbes have evolved inhibitors to counteract

plant proteases. If so these inhibitors apparently belong to structural classes other than the

Kazal inhibitor domain.

Several plant proteases have been linked to plant defense responses. In tomato,

P69 and Rcr3 are two extracellular proteases that have been implicated in the defense

response (Tornero et al. 1997; Jorda et al. 1999; Kruger et al. 2002). The precise mode of

35 action of these proteases remains unclear. They could degrade secreted proteins from the pathogen, thereby directly contributing to defense. Alternatively, plant proteases could contribute to defense signaling by processing endogenous or pathogen proteins to generate bioactive peptides. Future experiments will focus on determining whether EPI1 contributes to virulence by protecting other secreted proteins of P. infestans from proteolytic degradation in the host apoplast, or by perturbing defense signaling in host plants.

P1 is the primary specificity-determining residue of Kazal inhibitors (Lu et al.

1997; Lu et al. 2001). Remarkably, half (28/56) the predicted P1 residues of oomycete

Kazal-like inhibitors, including two thirds (14/21) of the P. infestans inhibitor domains, are aspartate (D). This is an uncommon P1 amino acid in natural Kazal inhibitors of animals and apicomplexans.This striking feature is remarkable in light of a recent finding that two oat proteases with caspase activity and specificity are subtilisin-like serine proteases that are involved in pathogen-induced programmed cell death (Coffeen and

Wolpert 2004). Coffeen and Wolpert (2004) coined these enzymes saspases since their active-site residue is a serine (S) and they require an asparate (D) residue in the P1 position of the substrate. Saspases could be the enigmatic functional analogs of animal caspases that have been tied to multiple cases of pathogen-induced programmed cell death (Woltering et al. 2002). Phytophthora EPIs that carry aspartate as the P1 residue might therefore target plant saspases and suppress host cell death. This engaging hypothesis will warrant a close examination.

Proteins with Kazal inhibitor domains have a restricted taxonomic distribution as

determined by our exhaustive search of sequence and protein motif databases. In addition

36 to oomycetes, they are mainly found in animal species and in apicomplexans such as T.

gondii, a parasite that transits through the mammalian digestive tract (Pszenny et al.

2000; Lindh et al. 2001; Morris et al. 2002; Pszenny et al. 2002; Morris and Carruthers

2003). An interesting analogy can be made between plant apoplasts and mammalian

digestive tracts. Both environments are rich in proteases, but, nevertheless, are colonized

by a variety of microbial pathogens. Apparently, P. infestans and T. gondii, even though

phylogenetically unrelated, have independently recruited secreted proteins of the Kazal

family to inhibit host proteases and adapt to protease-rich host environments.

Interestingly, unlike the T. gondii inhibitors (Morris et al. 2002; Morris and Carruthers

2003), EPI1 does not inhibit trypsin and chymortrypsin suggesting that co-evolution

between the inhibitors and their target proteases may have shaped the inhibitor

specificity. Future structural and functional characterization of Kazal protease inhibitors

from animal and plant pathogens will shed some light on interesting questions on the

evolution of pathogenesis in eukaryotic microbes and the coevolution of pathogen

effectors with host targets.

2.6 ACKNOWLEDGEMENTS

I am grateful to Edgar Huitema, Luis da Cunda and Trudy Torto-Alalibo, Caitlin

Cardina for their contribution in Northern blot, Shujing Dong, Diane Kinney, and Kristin

Wille for technical assistance, Drs. Margaret Redinbaugh and Saskia Hogenhout for their

valuable advice on the protein work, Tea Meulia and the staff of the OARDC Molecular

and Cellular Imaging Center for help with DNA sequencing, Andrew Keightley and Mike

Kinter for performing the tandem mass spectrometry experiment. This work was

37 supported by the OARDC Research Enhancement Grant Program and Syngenta

Biotechnology Inc. We thank the Syngenta Phytophthora Consortium for access to sequences of P. infestans and P. brassicae. Salaries and research support were provided by State and Federal Funds appropriated to the Ohio Agricultural Research and

Development Center, the Ohio State University.

2.7 REFERENCES

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 17: 3389-3402.

Andreu, A., Tonón, C., Van Damme, M., Van Damme, M., Huarte, M., Huarte, M., and Daleo, G. 1998. Effect of glucans from different races of Phytophthora infestans on defense reactions in potato tuber. Eur. J. Plant Pathol. 104: 777-783.

Apweiler, R., Attwood, T.K., Bairoch, A., Bateman, A., Birney, E., Biswas, M., Bucher, P., Cerutti, L., Corpet, F., Croning, M.D., et al. 2001. The InterPro database, an integrated documentation resource for protein families, domains and functional sites. Nucleic Acids Res. 29: 37-40.

Bateman, A., Birney, E., Cerruti, L., Durbin, R., Etwiller, L., Eddy, S.R., Griffiths-Jones, S., Howe, K.L., Marshall, M., and Sonnhammer, E.L. 2002. The Pfam protein families database. Nucleic Acids Res. 30: 276-280.

Birch, P.R.J. and Whisson, S. 2001. Phytophthora infestans enters the genomics era. Mol. Plant Pathol. 2: 257-263.

Bouarab, K., Melton, R., Peart, J., Baulcombe, D., and Osbourn, A. 2002. A saponin- detoxifying enzyme mediates suppression of plant defences. Nature 418: 889-892.

Caten, C.E. and Jinks, J.L. 1968. Spontaneous variability of single isolates of Phytophthora infestans. I. Cultural variation. Can. J. Bot. 46: 329-347.

Chain, P., Lamerdin, J., Larimer, F., Regala, W., Lao, V., Land, M., Hauser, L., Hooper, A., Klotz, M., Norton, J., et al. 2003. Complete genome sequence of the ammonia- oxidizing bacterium and obligate chemolithoautotroph Nitrosomonas europaea. J. Bacteriol. 185: 2759-2773.

38 Coffeen, W.C. and Wolpert, T.J. 2004. Purification and characterization of serine proteases that exhibit caspase-like activity and are associated with programmed cell death in Avena sativa. Plant Cell 16(4): 857-873

de Wit, P.J.G.M. and Spikman, G. 1982. Evidence for the occurence of race and cultivar- specific elicitors of necrosis in intercellular fluids of compatible interactions of Cladosporium fulvum and tomato. Physiol. Plant Pathol. 21: 1-11.

Delaria, K.A., Muller, D.K., Marlor, C.W., Brown, J.E., Das, R.C., Roczniak, S.O., and Tamburini, P.P. 1997. Characterization of placental bikunin, a novel human serine protease inhibitor. J. Biol. Chem. 272: 12209-12214.

Dubey, J.P. 1998. Re-examination of resistance of Toxoplasma gondii tachyzoites and bradyzoites to pepsin and trypsin digestion. Parasitology 116 ( Pt 1): 43-50.

Hanna, S.L., Sherman, N.E., Kinter, M.T., and Goldberg, J.B. 2000. Comparison of proteins expressed by Pseudomonas aeruginosa strains representing initial and chronic isolates from a cystic fibrosis patient: an analysis by 2-D gel electrophoresis and capillary column liquid chromatography-tandem mass spectrometry. Microbiology 146 ( Pt 10): 2495-2508.

Heath, M.C. 1995. Signal exchange between higher plants and rust fungi. Can. J. Bot. 73(SUPPL. 1): S616-S623.

Heath, M.C. 2000. Hypersensitive response-related death. Plant Mol. Biol. 44: 321-334.

Henikoff, J.G., Greene, E.A., Pietrokovski, S., and Henikoff, S. 2000. Increased coverage of protein families with the blocks database servers. Nucleic Acids Res. 28: 228-230.

Huitema, E., Torto, T.A., Styer, A., and Kamoun, S. 2003. Combined ESTs from plant- microbe interactions: Using GC counting to determine the species of origin. In Functional genomics: Methods and Protocols (ed. E. Grotewold), pp. in press. Humana Press.

Joosten, M.H.A.J., Vogelsang, R., Cozijnsen, T.J., Verberne, M.C., and de Wit, P.J.G.M. 1997. The biotrophic fungus Cladosporium fulvum circumvents Cf-4 mediated resistance by producing unstable AVR4 elicitors. Plant Cell 9: 367-379.

Jorda, L., Coego, A., Conejero, V., and Vera, P. 1999. A genomic cluster containing four differentially regulated subtilisin-like processing protease genes is in tomato plants. J. Biol. Chem. 274: 2360-2365.

Kamoun, S. 2003. Molecular genetics of pathogenic oomycetes. Eukaryotic Cell 2: 191- 199.

39 Kamoun, S., van West, P., de Jong, A.J., de Groot, K., Vleeshouwers, V., and Govers, F. 1997. A gene encoding a protein elicitor of Phytophthora infestans is down-regulated during infection of potato. Mol. Plant-Microbe Interact. 10: 13-20.

Kamoun, S., van West, P., Vleeshouwers, V.G., de Groot, K.E., and Govers, F. 1998. Resistance of Nicotiana benthamiana to Phytophthora infestans is mediated by the recognition of the elicitor protein INF1. Plant Cell 10: 1413-1426.

Kamoun, S., Young, M., Glascock, C., and Tyler, B.M. 1993. Extracellular protein elicitors from Phytophthora: Host-specificity and induction of resistance to fungal and bacterial phytopathogens. Mol. Plant-Microbe Interact. 6: 15-25.

Karsch-Mizrachi, I. and Ouellette, B.F. 2001. The GenBank sequence database. Methods Biochem. Anal. 43: 45-63.

Kruger, J., Thomas, C.M., Golstein, C., Dixon, M.S., Smoker, M., Tang, S., Mulder, L., and Jones, J.D. 2002. A tomato cysteine protease required for Cf-2-dependent disease resistance and suppression of autonecrosis. Science 296: 744-747.

Letunic, I., Goodstadt, L., Dickens, N.J., Doerks, T., Schultz, J., Mott, R., Ciccarelli, F., Copley, R.R., Ponting, C.P., and Bork, P. 2002. Recent improvements to the SMART domain-based sequence annotation resource. Nucleic Acids Res. 30: 242-244.

Lindh, J.G., Botero-Kleiven, S., Arboleda, J.I., and Wahlgren, M. 2001. A protease inhibitor associated with the surface of Toxoplasma gondii. Mol. Biochem. Parasitol. 116: 137-145.

Lu, S.M., Lu, W., Qasim, M.A., Anderson, S., Apostol, I., Ardelt, W., Bigler, T., Chiang, Y.W., Cook, J., James, M.N., et al. 2001. Predicting the reactivity of proteins from their sequence alone: Kazal family of protein inhibitors of serine proteinases. Proc. Natl. Acad. Sci. U. S. A. 98: 1410-1415.

Lu, W., Apostol, I., Qasim, M.A., Warne, N., Wynn, R., Zhang, W.L., Anderson, S., Chiang, Y.W., Ogin, E., Rothberg, I., et al. 1997. Binding of amino acid side-chains to S1 cavities of serine proteinases. J. Mol. Biol. 266: 441-461.

Margulis, L. and Schwartz, K.V. 2000. Five Kingdoms: An Illustrated Guide to the Phyla of Life on Earth. W.H. Freeman and Co., New York.

Merril, C.R., Goldman, D., Sedman, S.A., and Ebert, M.H. 1981. Ultrasensitive stain for proteins in polyacrylamide gels shows regional variation in cerebrospinal fluid proteins. Science 211: 1437-1438.

Milstone, A.M., Harrison, L.M., Bungiro, R.D., Kuzmic, P., and Cappello, M. 2000. A broad spectrum Kunitz type serine protease inhibitor secreted by the hookworm Ancylostoma ceylanicum. J. Biol. Chem. 275: 29391-29399.

40 Morris, M.T. and Carruthers, V.B. 2003. Identification and partial characterization of a second Kazal inhibitor in Toxoplasma gondii. Mol. Biochem. Parasitol. 128: 119-122.

Morris, M.T., Coppin, A., Tomavo, S., and Carruthers, V.B. 2002. Functional analysis of Toxoplasma gondii protease inhibitor 1. J. Biol. Chem. 277: 45259-45266.

Nielsen, H., Engelbrecht, J., Brunak, S., and von Heijne, G. 1997. A neural network method for identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Int. J. Neural Syst. 8: 581-599.

Nielsen, H. and Krogh, A. 1998. Prediction of signal peptides and signal anchors by a hidden Markov model. In Proceedings of the Sixth International Conference on Intelligent Systems for Molecular Biology (ISMB 6), pp. pp. 122--130. AAAI Press, Menlo Park, California.

Pszenny, V., Angel, S.O., Duschak, V.G., Paulino, M., Ledesma, B., Yabo, M.I., Guarnera, E., Ruiz, A.M., and Bontempi, E.J. 2000. Molecular cloning, sequencing and expression of a serine proteinase inhibitor gene from Toxoplasma gondii. Mol. Biochem. Parasitol. 107: 241-249.

Pszenny, V., Ledesma, B.E., Matrajt, M., Duschak, V.G., Bontempi, E.J., Dubremetz, J.F., and Angel, S.O. 2002. Subcellular localization and post-secretory targeting of TgPI, a serine proteinase inhibitor from Toxoplasma gondii. Mol. Biochem. Parasitol. 121: 283-286.

Ristaino, J.B. 2002. Tracking historic migrations of the Irish potato famine pathogen, Phytophthora infestans. Microbes Infect. 4: 1369-1377.

Rose, J.K., Ham, K.S., Darvill, A.G., and Albersheim, P. 2002. Molecular cloning and characterization of glucanase inhibitor proteins: coevolution of a counterdefense mechanism by plant pathogens. Plant Cell 14: 1329-1345.

Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

Sanchez, L.M., Ohno, Y., Miura, Y., Kawakita, K., and Doke, N. 1992. Host selective suppression by water-soluble glucans from Phytophthora spp. of hypersensitive cell death of suspension-cultured cells from some solanaceous plants caused by hyphal wall elicitors of the fungi. Ann. Phytopathol. Soc. Japan 58: 664-670.

Shattock, R.C. 2002. Phytophthora infestans: populations, pathogenicity and phenylamides. Pest Manag. Sci. 58: 944-950.

Shewmaker, C.K., Ridge, N.P., Pokalsky, A.R., Rose, R.E., and Hiatt, W.R. 1990. Nucleotide sequence of an EF-1 alpha genomic clone from tomato. Nucleic Acids Res. 18: 4276.

41 Smart, C.D. and Fry, W.E. 2001. Invasions by the late blight pathogen: renewed sex and enhanced fitness. Biol. Invas. 3: 235-243.

Sogin, M.L., and Silberman, J.D. 1998. Evolution of the protists and protistan parasites from the perspective of molecular systematics. Int. J. Parasitol. 28: 11-20.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25: 4876-4882.

Tornero, P., Conejero, V., and Vera, P. 1997. Identification of a new pathogen-induced member of the subtilisin-like processing protease family from plants. J. Biol. Chem. 272: 14412-14419.

Torto, T., Li, S., Styer, A., Huitema, E., Testa, A., Gow, N.A.R., van West, P., and Kamoun, S. 2003. EST mining and functional expression assays identify extracellular effector proteins from Phytophthora. Genome Res. 13(7): 1675-1685.

Torto, T.A., Rauser, L., and Kamoun, S. 2002. The pipg1 gene of the oomycete Phytophthora infestans encodes a fungal-like endopolygalacturonase. Curr. Genet. 40: 385-390.

Unkles, S.E., Moon, R.P., Hawkins, A.R., Duncan, J.M., and Kinghorn, J.R. 1991. Actin in the oomycetous fungus Phytophthora infestans is the product of several genes. Gene 100: 105-112.

Van den Ackerveken, G.F., Vossen, P., and De Wit, P.J. 1993. The AVR9 race-specific elicitor of Cladosporium fulvum is processed by endogenous and plant proteases. Plant Physiol. 103: 91-96.

van Loon, L.C. and van Strien, E.A. 1999. The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiological and Molecular Plant Pathology 55: 85-97.

Waugh, M., Hraber, P., Weller, J., Wu, Y., Chen, G., Inman, J., Kiphart, D., and Sobral, B. 2000. The Phytophthora genome initiative database: informatics and analysis for distributed pathogenomic research. Nucleic Acids Res. 28: 87-90.

Woltering, E.J., van der Bent, A., and Hoeberichts, F.A. 2002. Do plant caspases exist? Plant Physiol. 130: 1764-1769.

Yoshioka, H., Hayakawa, Y., and Doke, N. 1995. Suppression of phenylalanine ammonia-lyase mRNA accumulation by suppressors from Phytophthora infestans. Ann. Phytopathol. Soc. Japan 61: 7-12.

42

Figure 2.1. EPI1 belongs to the Kazal family of serine protease inhibitors. A, Schematic representation of EPI1 structure. The signal peptide (SP) and two Kazal domains (EPI1a, EPI1b) are shown in gray. Numbers indicate position of amino acid residues starting from the N terminus. The cysteine residues corresponding to the two Kazal domains are indicated by C and the disulfide linkages predicted based on the structure of other Kazal domains are shown. The positions of the P1 residues D (aspartate) are indicated by arrows. B, Sequence alignment of EPI domains with representative Kazal family inhibitor domains. Protein names correspond to protease inhibitors of the oomycetes Phytophthora infestans (EPI1a-b, this study), Phytophthora sojae (PsojEPI1a-d, this study), and Plasmopara halstedii (PhaEPI1, GenBank accession number CB174657), the crayfish Pacifastacus leniusculus (PAPI-1a-d, CAA56043), as well as the apicomplexan Toxoplasma gondii (TgPI-1a-d, AF121778). Amino acid residues that define the Kazal family protease inhibitor domain are marked with asterisks. The predicted P1 residues are shown by the arrowhead.

43

Figure 2.2. rEPI1 inhibits subtilisin A. A, Protease activity of chymotrypsin, subtilisin A, and trypsin in the absence (gray column) or presence of rEPI1 (black column). The activities were determined using the QuantiCleaveTM Protease Assay Kit as described in the methods. Activity is expressed as a percentage of total protease activity in the absence of protease inhibitors. The bars correspond to the mean of three independent replications of one representative experiment out of three performed. The error bars represent the standard errors calculated from the three replications. B, Time course of substrate hydrolysis by subtilisin A in the presence of varying concentrations of rEPI1. Protease activity was measured as absorbance at 405 nm based on hydrolysis of a chromogenic substrate. The final concentration of subtilisin A is 10 nM. The concentrations of rEPI1 are indicated next to the curves.

44

Figure 2.3. rEPI1 inhibits BTH-induced tomato proteases. A, Intercellular fluids (IF) obtained from water-treated (-) and BTH-treated (+) tomato plants were run on SDS- PAGE gel followed by staining with Coomassie Brilliant Blue (left panel), or were used in zymogen in-gel protease assays (right panel). The asterisks represent known pathogenesis-related proteins PR1, PR3, and PR2 (from bottom to top) and confirm the induction of defense responses by BTH. The arrows indicate BTH-induced protease activities that migrated as two close bands. B, Inhibition of tomato proteases by rEPI1. Intercellular fluids from BTH-treated tomato leaves were incubated in the absence (- rEPI1) or presence of rEPI1 (+ rEPI1) and then analyzed using zymogen in-gel protease assays. The arrows indicate the BTH-induced protease bands.

45

Figure 2.4. rEPI1 inhibition of total protease activity from tomato intercellular fluids. Total protease activity of Intercellular fluids (IF) obtained from water-treated (-BTH) and BTH-treated (+BTH) tomato plants was measured in the absence (grey column) or presence (black column) of rEPI1 using the QuantiCleaveTM Protease Assay Kit as described in the methods. Activity is expressed as absorbance at 405 nm. The bars correspond to the mean of three independent replications of one representative experiment out of three performed. The error bars represent the standard errors calculated from the three replications.

46

Figure 2.5. Co-immunoprecipitation of rEPI1 and P69 subtilases using FLAG antisera. A, Eluates from co-immunoprecipitation of rEPI1 with proteins in tomato intercellular fluids were run on SDS-PAGE gel followed by staining with silver nitrate. The sizes on the left indicate the molecular weight of the marker proteins (M) in kDa. rEPI1 indicates whether or not rEPI1 was added to the reaction mix. BTH indicates whether or not the intercellular fluids were obtained from plants treated with BTH. The lower molecular weight band corresponds to rEPI1 and the high molecular weight bands to the rEPI1- interacting protein(s). B, The same eluate samples were run on SDS-PAGE gel followed by staining with Coomassie Brilliant Blue (Coom.), or immunobloting with antisera raised against a peptide specific for the tomato P69 family (α-P69), and FLAG (α- FLAG), respectively. The top two panels (Coom. and α-P69) correspond to the high molecular weight bands of panel (A), whereas the lower panel (α-FLAG) corresponds to the low molecular weight band.

47

Figure 2.6. Tandem mass spectrometry (MS) identifies P69B as the main target of rEPI1. The amino acid sequence of P69B subtilisin-like protease precursor is shown with the signal peptide sequence in italics and the propeptide domain sequence in gray. The 21 peptides sequenced by tandem MS are shown in bold. Each sequenced peptide ends with an Arg (R) or a Lys (K) residue, which is highlighted in bold italics. Underlined sequences are specific to P69B among the known P69 isoforms.

48

Figure 2.7. The epi1 and P69 genes are concurrently expressed during colonization of tomato by Phytophthora infestans. A, Time course of expression of P. infestans epi1 and actA, and tomato P69B and tubulin during colonization of tomato by P. infestans. Total RNA isolated from infected leaves of tomato, 0, 1, 2, 3, or 4 days after inoculation, from non-infected leaves (To), and from P. infestans mycelium grown in synthetic medium (My) was hybridized with probes from the four genes. The approximate sizes of the transcripts are approximately 600 nucleotides for epi1, 1600 nucleotides for actA, 2500 nucleotides for P69B and tubulin. B, RT-PCR analysis of epi1, P69A, P69B and P69D expression during colonization by P. infestans. Total RNA from a time course similar to the one described in panel (A) was used in RT-PCR amplifications as described in text. Amplification of P. infestans elongation factor 2 alpha (Pief2α) and tomato elongation factor 1 alpha (Toef1α) were used as controls to determine the relative expression of epi1 and P69 genes respectively. C, Western blot analyses of tomato P69 subtilases during colonization by P. infestans. The time course is as described in panel (A). Equal volumes of intercellular fluids were obtained from infected tomato leaves, subjected to SDS- PAGE, and immunoblotted with P69 antisera (α-P69). 49 Number of GenBank Signal Kazal-like P1 Species Protein accession peptide Expression stage domains residue P. infestans EPI1 AY586273 Yes infected tomato 2 D, D

P. infestans EPI2 AY586274 Yes mycelium, H2O2-treated 2 D, D P. infestans EPI3 AY586275 Yes genomic sequence 1 E P. infestans EPI4 AY586276 Yes mycelium, nitrogen starvation 3 T, D, D P. infestans EPI5 AY586277 Yes mating culture 1 R P. infestans EPI6 AY586278 NAb infected tomato 2 D, D P. infestans EPI7 AY586279 Yes genomic sequence 1 D P. infestans EPI8 AY586280 Yes genomic sequence 1 D P. infestans EPI9 AY586281 Yes mycelium, non-sporulating growth 1 R P. infestans EPI10 AY586282 Yes zoospores 3 D, D, D P. infestans EPI11 AY586283 Yes mating culture 1 D P. infestans EPI12 AY586284 Yes infected potato, germinating cysts 1 S P. infestans EPI13 317886987a Yes genomic sequence 1 E P. infestans EPI14 317892389a Yes genomic sequence 1 H P. sojae PsojEPI1 CF842223 Yes infected soybean 4 A, E, K, A P. sojae PsojEPI2 AAO24652 Yes mycelium 1 E P. sojae PsojEPI3 274204995a Yes genomic sequence 3 M, D, E P. sojae PsojEPI4 273523724a Yes genomic sequence 3 D, T, D P. sojae PsojEPI5 273752552a Yes genomic sequence 1 R P. sojae PsojEPI6 273759065a Yes genomic sequence 1 E P. sojae PsojEPI7 324111439a Yes genomic sequence 1 D P. sojae PsojEPI8 273566013a Yes genomic sequence 1 D P. sojae PsojEPI9 274071280a Yes genomic sequence 1 R P. sojae PsojEPI10 273704880a Yes genomic sequence 1 A P. sojae PsojEPI11 324096913a Yes genomic sequence 1 D P. sojae PsojEPI12 324106054a Yes genomic sequence 1 D P. ramorum PramEPI1 303509335a Yes genomic sequence 3 D, M, E P. ramorum PramEPI4 324426165a Yes genomic sequence 3 D, T, D P. ramorum PramEPI5 324427992a Yes genomic sequence 1 R P. ramorum PramEPI9 303791515a Yes genomic sequence 1 R P. ramorum PramEPI10 303447516a Yes genomic sequence 3 D, D, D P. ramorum PramEPI11 303578321a Yes genomic sequence 1 D P. brassicae PbraEPI1 AY589086 Yes mycelium, nitrogen starvation 2 N, M P. brassicae PbraEPI2 AY589087 NAb mycelium 1 H Pl. halstedii PhaEPI1 CB174657 Yes infected sunflower 1 R

Table 2.1. Predicted Kazal-like proteins from the oomycete plant pathogens Phytophthora infestans, Phytophthora sojae, Phytophthora ramorum, Phytophthora brassicae, and Plasmopara halstedii. a Ti (Trace Identifier) number from NCBI Trace Archive (http://www.ncbi.nlm.nih.gov/Traces/trace.cgi). b Not available.

50 CHAPTER 3

EVOLUTION OF KAZAL-LIKE PROTEASE INHIBITORS IN

PHYTOPHTHORA WAS DRIVEN BY GENE DUPLICATION, DOMAIN

SHUFFLING, AND DIVERSIFYING SELECTION

3.1 ABSTRACT

Secreted proteins with Kazal serine protease inhibitor domains occur in animals, apicomplexans, and oomycetes among the eukaryotes. They are particularly diverse in plant pathogenic oomycetes, such as the destructive Phytophthora spp. In total, 35 putative proteins with 56 predicted Kazal-like domains were identified in five plant pathogenic oomycete species. The function of the majority of oomycete

Kazal-like proteins remains unknown but one of the Phytophthora infestans Kazal- like inhibitors, EPI1, was shown to inhibit proteases of the host plant tomato and was implicated in counterdefense. We describe detailed evolutionary and comparative analyses of Kazal-like genes of oomycetes with an emphasis on the epi1-14 genes of

P. infestans. Some, but not all, P. infestans epi genes are fast evolving and lack orthologues in other Phytophthora species. Phylogenetic analyses of oomycete Kazal- like EPI domains suggested significant domain shuffling and occasional gene duplication. We detected higher nonsynonymous nucleotide substitution rates in sequences encoding putative protease contact residues than in those encoding noncontact residues suggesting that these residues have been under diversifying

51 selection. Expression analyses of the 14 epi genes revealed diverse transcriptional profiles. Overall, these results led us to suggest a model for epi gene evolution. Gene duplication, domain shuffling, and diversifying selection in key contact residues, driven by coevolution with target proteases, may have resulted in novel inhibitory specificities. In contrast, phylogenetic analyses of Kazal proteins of four species of apicomplexan animal parasites indicated that in these species domain duplication was the major mechanism of evolution of Kazal domain proteins. The analyses described in this study were exploited to devise specific hypotheses regarding the function of the Phytophthora inhibitors and the nature of their target proteases.

3.2 INTRODUCTION

The oomycetes form a diverse group of fungus-like organisms that are distantly related to fungi but closely related to brown algae and diatoms in the

Stramenopiles (or heterokonts), one of several major eukaryotic kingdoms (Sogin

1998; Baldauf et al. 2000; Margulis and Schwartz 2000). Among the oomycetes,

Phytophthora spp. cause some of the most destructive plant diseases in the world, and are arguably the most devastating pathogens of dicotyledonous plants (Erwin and

Ribeiro 1996). Phytophthora infestans, the most notorious and destructive oomycete, was responsible for the Irish potato famine in the nineteenth century and remains a devastating pathogen of potato and tomato (Birch and Whisson 2001; Smart and Fry

2001; Ristaino 2002; Shattock 2002). Research on P. infestans and other

Phytophthora spp. has entered the genomics era. Current resources include expressed sequence tags (ESTs) from a variety of developmental and infection stages, as well as whole genome shotgun and other types of genomic sequences (Kamoun 2003;

Huitema et al. 2004; Randall et al. 2004). A number of studies have been initiated

52 to exploit the sequence resources to better our understanding of P. infestans pathogenicity (Kamoun 2003; Huitema et al. 2004). For example, Tian et al. (2004) used data mining of P. infestans sequence databases to identify 14 genes encoding

extracellular protease inhibitors (EPI1 to EPI14) with similarity to the Kazal-like

serine protease inhibitor family. Kazal-like proteins are restricted to animals,

apicomplexan parasites, and oomycetes among the eukaryotes (Tian et al. 2004). In

oomycetes, they are particularly ubiquitous and diverse. In total, 35 putative proteins

with 56 predicted Kazal-like domains (range, 1 to 4 per protein) were identified from

five plant pathogenic oomycete species, P. infestans, Phytophthora sojae,

Phytophthora ramorum, Phytophthora brassicae, and the biotrophic downy mildew

Plasmopara halstedii (Tian et al. 2004). Based on analogy to animal Kazal inhibitors,

the conserved domains of oomycete EPI proteins are thought to play a critical role in

inhibiting the activity of various serine proteases involved in diverse physiological

processes. Putative protease contact residues in Kazal domains are functionally

important in recognizing and covalently binding the corresponding serine protease

(Read et al. 1983; Laskowski et al. 1987; Lu et al. 1997; Lu et al. 2001).

Suppression of host defenses is a key virulence mechanism for plant

pathogens that require living host cells to establish a successful infection (so called

biotrophs and hemibiotrophs) (Bushnell and Rowell 1981; Heath 1995; Heath 2000;

Panstruga 2003). However, Only a few pathogen molecules that suppress host

defenses have been identified. For example, the oomycete Phytophthora sojae

secretes glucanase inhibitor proteins (GIPs) that function as counterdefensive

molecules (Rose et al. 2002). GIPs inhibit soybean endo-β-1,3 glucanase, a cell wall

degrading enzyme, effectively blocking the degradation of β-1,3/1,6 glucans in the

pathogen cell wall and/or the release of defense-eliciting oligosaccharides by host

53 endo-β-1,3 glucanase (Rose et al. 2002). P. infestans and other Phytophthora species produce water-soluble glucans that suppress induction of host defense responses in a cultivar-specific manner (Sanchez et al. 1992; Yoshioka et al. 1995; Andreu et al.

1998). Tomatinase, a saponin-detoxifying enzyme from the fungal pathogen Septoria lycopersici, suppresses host defense responses indirectly through its degradation products (Bouarab et al. 2002). The interactions between suppressor molecules and their targets imply antagonistic coevolution of pathogens and hosts. Based on the

“arms race” model, adaptation and counter-adaptation between interacting pathogen and host proteins is likely to drive their antagonistic coevolution and generate the evolutionary forces that shape their corresponding genes.

The function of the majority of oomycete Kazal-like proteins remains unknown but one of the P. infestans Kazal-like inhibitors, EPI1, was implicated in counterdefense (Tian et al. 2004). EPI1 specifically inhibits and interacts with the pathogenesis-related P69B subtilisin-like serine protease of the host plant tomato

(Tian et al. 2004). Both epi1 and P69B genes are concurrently expressed and up- regulated during infection of tomato by P. infestans (Tian et al. 2004). Also, recent results from our laboratory indicated that EPI1 protects several secreted proteins of P. infestans from degradation by P69B (M. Tian and S. Kamoun, manuscript in preparation). Altogether, these findings suggest that inhibition of host proteases by P. infestans protease inhibitors, such as EPI1, is a novel mechanism of pathogen suppression of plant defenses (Tian et al. 2004). Interestingly, inhibition of host proteases by Kazal-like proteins could be a common virulence strategy between plant and mammalian parasites. Kazal-like proteins have also been implicated in virulence of the apicomplexans Toxoplasma gondii and Neospora caninum, a group of mammalian parasites that transit through the digestive tract (Pszenny et al. 2000;

54 Lindh et al. 2001; Bruno et al. 2004; Morris et al. 2004). Four putative proteins with

Kazal-like domains were also identified in the genome sequence of another apicomplexan animal parasite Cryptosporidium parvum (Abrahamsen et al. 2004).

Little is known about the molecular evolution of Kazal-like domain genes in oomycetes. Understanding the evolutionary history of Kazal-like domains is likely to shed light on their biological functions and the nature of their target proteases. For example, inhibitors that have coevolved with host proteases are more likely to exhibit hallmarks of rapid evolution and diversifying selection than inhibitors that target endogenous proteases and function in basic cellular or developmental processes.

Based on these premises, we performed detailed evolutionary and comparative analyses of Kazal-like genes of oomycetes with an emphasis on the epi1-14 genes of

P. infestans. We found that some, but not all, P. infestans epi genes are fast evolving and lack orthologues in other Phytophthora species. Phylogenetic analysis of oomycete Kazal-like EPI domains suggested significant domain shuffling and occasional gene duplication. The majority of amino acids in Kazal domains of P. infestans EPIs are likely to be under purifying selection. However, we found significantly higher nonsynonymous nucleotide substitution rates in sequences encoding putative protease contact residues than in those encoding noncontact residues suggesting that these residues are under diversifying selection. We, therefore, put together a model that proposes that adaptive nucleotide substitution changes in the predicted protease contact residues of EPI domains were fixed by diversifying selection following duplication of epi genes and shuffling of Kazal-like domains.

Gene duplication, domain shuffling, and diversifying selection in key contact residues, driven by coevolution with target proteases, may have resulted in novel inhibitory specificities.

55

3.3 MATERIALS AND METHODS

Data sets

The nucleotide and predicted protein sequences of the 35 epi genes described by Tian et al.(2004) were used in this study. These sequences were obtained from whole genome shotgun sequences of three species, P. infestans (ca. 1X coverage)

(Randall et al. 2004), P. sojae (ca. 10X) and P. ramorum (ca. 10X) (NCBI Trace

Archive), as well as more than 100,000 ESTs from P. infestans and P. sojae (NCBI dBEST). Members of the EPI family cannot be properly aligned across their entire length because they have different lengths and different numbers of domains (Figure

3.1). This prevents proper phylogenetic and nucleotide substitution analyses of the entire coding sequences. We therefore extracted the 56 Kazal-like domain sequences of the EPI proteins and used these sequences in phylogenetic analyses and investigation of patterns of nucleotide substitutions (Figure 3.2).

A set of 150 complete P. infestans coding sequences was used to estimate average sequence identity to P. sojae and P. ramorum proteins and this data set will be described in details elsewhere (J. Win and S. Kamoun, manuscript in preparation).

Apicomplexan Kazal proteins were obtained from GenBank based on literature, similarity to canonical Kazal sequences, and keyword searches. Accession numbers are shown in Figure 3.7.

Sequence and phylogenetic analyses

All analyses were performed on Mac OSX workstations. Similarity searches were performed locally using BLAST (Altschul et al. 1997). Multiple sequence alignments were generated using Clustal X (Thompson et al. 1997) and were subsequently adjusted manually based on the three- dimensional structure of

56 Kazal domains (Read et al. 1983; Lu et al. 1997; Lu et al. 2001). Sequence Logos

program (http://www.bio.cam.ac.uk/seqlogo) was used to generate consensus

sequences based on the multiple protein sequence alignment of EPI domains.

Phylogenetic trees were constructed using the neighbor-joining method implemented

in Clustal X program (Thompson et al. 1997). A total of 1,000 bootstrap replications

were performed and the trees were rooted with two Kazal domains of the crayfish

Pacifastacus leniusculus PAPI (PAPI-b and PAPI-c; GenBank accession number

CAA56043). Tree topologies were viewed with the program TreeView PPC 1.6.6

(Page 1996). Clusters of orthologous epi genes from P. infestans, P. sojae, and P.

ramorum were determined using pairwise reciprocal BLAST searches as described

elsewhere (Tatusov et al. 1997). Sequences were assigned to an orthologous group if

(1) they gave best hits to each other in reciprocal BLAST similarity searches, (2)

exhibited similar domain organization, and (3) showed overall sequence similarity or

similarity outside the Kazal domains.

Diversifying selection

The 21 Kazal-like domains of P. infestans EPI1-14 were used for investigating patterns of nucleotide substitutions. We applied the approximate method (also known as counting method) of Yang and Nielsen (2000) implemented in YN00 program of the PAML software package (http://abacus.gene.ucl.ac.uk/software/paml.html). First, we analyzed the entire domain sequences. We calculated the number of nonsynonymous nucleotide substitutions per nonsynonymous site (dN) and the number of synonymous nucleotide substitutions per synonymous site (dS) for all pairs of 21 sequences. Second, we partitioned the EPI domains into two parts, one consisting of putative protease contact residue sequences and the other containing the other residue sequences. The partitioning was performed according to three-

57 dimensional structures of Kazal domain-protease complexes and alignment to canonical Kazal domains (Read et al. 1983; Lu et al. 2001).

Semi-quantitative RT-PCR

Time courses of P. infestans infection of detached tomato leaves were

performed exactly as described earlier (Kamoun et al. 1998; Tian et al. 2004). Tomato

(Lycopersicon esculentum) cultivar Ohio 7814 plants were grown in pots at 25°C,

60% humidity, under 16 hour-light/8 hour-dark cycle. P. infestans isolate 90128 (A2

mating type, race 1.3.4.7.8.9.10.11) was cultured on rye agar medium supplemented

with 2% sucrose (Caten and Jinks 1968). For RNA extraction from mycelium, plugs

of P. infestans mycellium were transferred to modified Plich medium (Kamoun et al.

1993) and grown for 2 weeks before harvesting. Leaf discs from inoculated tomato

leaves were dissected and frozen in liquid nitrogen for immediate use or stored at –

80°C for later RNA extraction. RNA isolation and semi-quantitative RT-PCR were

performed as described elsewhere (Torto et al. 2003; Tian et al. 2004). The

oligonucleotides used to amplify epi transcrips are listed in Table 3.1. Amplifications

of P. infestans elongation factor 2 alpha (ef2α gene using the primer pair described

previously (Torto et al. 2002) were used as controls to determine the relative

transcript levels of epi genes. All primer pairs used for RT-PCR amplified expected

PCR products from genomic DNA of P. infestans 90128.

3.4 RESULTS

Kazal-like proteins in oomycetes

We previously identified a total of 35 predicted proteins with 56 Kazal-like

domains (range, 1 to 4 per protein) in five plant pathogenic oomycete species, P.

infestans, P. sojae, P. ramorum, P. brassicae, and P. halstedii (Tian et al.

58 2004). The sequence data sets examined included whole genome shotgun sequences

of three species, P. infestans (ca. 1X coverage) (Randall et al. 2004), P. sojae (ca.

10X) and P. ramorum (ca. 10X) (NCBI Trace Archive), as well as more than 100,000

ESTs from P. infestans and P. sojae. A schematic representation of the domain

structure of 14 P. infestans EPI proteins is shown in Figure 3.1.

Alignment of oomycete Kazal-like domains

A multiple sequence alignment and a consensus sequence of the core region of

the 56 oomycete Kazal-like domains are shown in Figure 3.2. Typically, oomycete

Kazal-like domains consist of a backbone of six conserved cysteine residues that form

three disulfide bridges and a few other conserved residues, such as Pro, Val, Gly, Tyr,

Asn, and Ala (Figure 3.2B). Most oomycete Kazal domains follow the consensus

pattern C-X3,4-C-X7-C-X6-Y-X3-C-X6-C-X9,12,13,14-C. However, several domains are atypical. A total of 14 domains lack Cys 3 and Cys 6 and are predicted to form only two disulfide bridges. A number of other domains display amino acid replacements in the highly conserved residues mentioned above. A total of 12 protease contact residues were predicted based on similarity to canonical animal Kazal domains

(Figure 3.2) (Read et al. 1983; Laskowski et al. 1987; Lu et al. 1997). We examined the distribution of the predicted active site P1, which is central to the specificity of

Kazal inhibitors (Laskowski and Kato 1980; Komiyama et al. 1991). P1 was variable with ten different amino acids represented (Ala, Asp, Glu, His, Lys, Met, Asn, Arg,

Ser, and Thr) (Figure 3.3). However, 50% (28/56) the P1 residues were Asp, an uncommon P1 amino acid in other natural Kazal inhibitors. P1 with Arg and Lys residues, typical of inhibitors of trypsin and chymotrypsin, were represented although at low frequency (8/56 or 14%).

59 Putative orthologous epi genes in P. infestans, P. sojae, and P. ramorum

We determined putative clusters of orthologous epi genes from P. infestans, P. sojae, and P. ramorum using reciprocal BLAST searches (all-versus-all method)

(Tatusov et al. 1997). Of the 35 epi genes identified in the three genomes, only three clusters showed unambiguous 1:1:1 relationships and similar domain structure (Table

3.2). EPI4, PsojEPI4, and PramEPI4 all contain three Kazal-like domains and similarity between these proteins is evident throughout their entire sequence (Figure

3.4). Two other orthologue clusters were represented by the single domain EPI5,

PsojEPI5, and PramEPI5, as well as EPI9, PsojEPI9, and PramEPI9. These proteins are remarkable in carrying the only Kazal-like domains in the three species with an

Arg in the P1 position.

Fast evolving P. infestans epi genes

We examined the average sequence identity between the 14 P. infestans EPI proteins and their best matches in P. sojae and P. ramorum. Amino acid identities ranged from 28 to 69% over regions of significant similarity. The average identity was 50.2% to P. sojae proteins and 50.4% to P. ramorum proteins (Figure 3.5). This was considerably lower than the average identity obtained with a set of 150 complete

P. infestans coding sequences. In this case, average identity was 75.8% and 74.8% to

P. sojae and P. ramorum, respectively (J. Win and S. Kamoun, manuscript in preparation). Four P. infestans EPI proteins, EPI1, EPI2, EPI7, and EPI12, were the most divergent with less than 40% amino acid identities to their best matches. In contrast, EPI4, EPI5, and EPI9, which have clear-cut orthologues in P. sojae and P. ramorum, showed 55-67% identities to their best matches.

60 Phylogenetic analysis of EPI domains

Since the number of Kazal-like domains varies among the oomycete proteins, we could not generate whole protein alignments towards phylogenetic analyses.

Nonetheless, to investigate phylogenetic relationships among the 56 Kazal-like EPI domains we constructed a neighbor-joining tree using alignments of the domains described in Figure 3.2A. The phylogeny pointed to several clusters of related domains with significant bootstrap replication values (Figure 3.6). The overall topology of the tree indicated that significant domain shuffling has occurred during the evolution of the epi genes. Different domains from a given protein were always scattered throughout the tree. For example, the three-domain EPI4 and EPI10 appeared to be a mosaic of unrelated domains. We did not detect a single example of domain duplication, in which different domains from a given protein are more related to each other than to domains from other proteins. However, we found evidence for recent gene duplication within a given genome. For example, the two domains of

EPI1 and EPI2 of P. infestans clustered together. This is consistent with the results of

BLAST searches that indicated that these two proteins are more similar to each other than to any other Kazal-like protein.

The tree confirmed the three clusters of orthologous genes described above.

The unique domains of PramEPI5, EPI5, and PsojEPI5, as well as PramEPI9, EPI9, and PsojEPI9 clustered together. Also, the domains of EPI4, PsojEPI4, and PramEPI4 formed three distinct clusters in different branches of the tree suggesting that the three-domain organization of these proteins predates speciation in Phytophthora.

As described above, a total of 14 domains lack Cys 3 and 6 and were predicted to form only two disulfide bridges compared to the typical three disulfide bridge structure of Kazal domains. All of these 14 domains formed a significant

61 cluster (Figure 3.6) suggesting that the loss of one disulfide bridge in Phytophthora

Kazal-like domains predates speciation.

There was some correlation between the identity of the P1 residue and domain

phylogeny. Domains with P1 Asp, the most common residue, were spread throughout

the tree. P1 Asp was either the ancestral residue in oomycete Kazal proteins or it has

evolved repeatedly and independently. P1 Asp was particularly common among the

two-disulfide bridge domains (10/14) and may have been the ancestral residue in this

class of domains. As noted above, the six Phytophthora domains with P1 Arg are

related to each other and occur in proteins with clear orthologues suggesting that domains with this residue are ancient and slow evolving in Phytophthora.

Comparison between oomycete and apicomplexan Kazal-like domain

phylogenies

The observation that oomycete Kazal-like domains show phylogenetic

patterns suggestive of domain shuffling prompted us to investigate whether similar

patterns occur in Kazal-like proteins of apicomplexan parasites. We therefore

constructed a neighbor-joining tree using alignments of 31 Kazal domains from the

apicomplexans Toxoplasma gondii, Neospora caninum, and Cryptosporidium parvum obtained from GenBank. These domains were coded by seven different proteins

(range, 1-12 domains per protein). The overall toplogy of the tree was markedly different from the oomycete tree and suggested extensive domain duplication (Figure

3.7). For example, all four domains of TgPI-1 clustered together, a situation that was never observed for oomycete domains from a single protein. These results suggest that unlike their oomycete counterparts, apicomplexan Kazal-like proteins evolved mainly by domain duplication.

62

Synonymous and nonsynonymous nucleotide substitution rates in EPI domain sequences

To determine the selection forces that shaped the epi genes, we estimated the average ratios of the numbers of nonsynonymous nucleotide substitutions per

nonsynonymous sites (dN) and synonymous nucleotide substitutions per synonymous sites (dS) among 21 EPI domain sequences of P. infestans using the approximate method of Yang and Nielsen (2000) as implemented in the YN00 program of the

PAML software package. We found that all 210 pairwise comparisons among the 21

EPI domain sequences have average ratios ω = dN / dS < 1, with a range of 0.0341 to

0.7165 (Figure 3.8). This suggests that purifying selection has been acting on the entire EPI domains of P. infestans.

dN / dS ratios are higher in sequences encoding putative protease contact residues than those encoding noncontact residues

Nonsynonymous to synonymous nucleotide substitution rate ratio (dN / dS) across entire protein or domain sequences is not a sensitive method for detecting diversifying selection. In order to further investigate whether diversifying selection affected particular amino acids within EPI domains, we estimated the dN and dS rates separately for putative protease contact residue and noncontact residue sequences of the 21 EPI domains of P. infestans. Using the approximate method of Yang and

Nielsen (2000), we found that about 23.3% (49/210) pairwise comparisons had higher dN than dS in the sequences encoding putative contact residues (ω = dN / dS >1) indicating diversifying selection (Figure 3.9A). In contrast, only around 0.95%

(2/210) pairwise comparisons had higher dN than dS in the sequences encoding

63 predicted noncontact residues (Figure 3.9B). These results indicate that diversifying

selection has affected the putative protease contact residue region of the EPI domains.

In planta expression of P. infestans epi genes

We studied the expression of the 14 P. infestans epi genes during infection of tomato and in mycelium cultured in vitro using semi-quantitative RT-PCR (Reverse

Transcription Polymerase Chain Reaction) analyses (Figure 3.10). We detected transcripts for 11 of the 14 genes examined in at least one of the examined stages.

Among these, nine genes were expressed during colonization of tomato. In contrast, transcripts for epi3 and epi14 were only detected in mycelium. Five genes, epi1, epi2, epi6, epi10, and epi12, appeared up-regulated during infection compared to mycelium and relative to the constitutive elongation factor 2 alpha (ef2 ) gene. Of these, epi10 and epi12 showed dramatic induction, whereas the other three genes, epi1, epi2, and epi6, showed moderate levels of up-regulation. Independent confirmation of the moderate up-regulation of epi1, epi2, and epi6 was obtained using Northern blot hybridizations (Tian et al. 2004) (data not shown). Finally, four genes, epi4, epi5, epi9, and epi11, showed constitutive patterns of expression similar to ef2 .

Remarkably, we observed some correlation between expression patterns and evolutionary history of the epi genes. Three of the four constitutively expressed genes, epi4, epi5, and epi9 are slow evolving genes with obvious orthologues in P. sojae and P. ramorum. In contrast, three of the four fastest evolving genes, epi1, epi2, and epi12 are up-regulated during infection of tomato.

64 3.5 DISCUSSION

There are no recent phylogenetic analyses of Kazal domain proteins in contrast to other families of protease inhibitors, such as serpins (Irving et al. 2000;

Atchley et al. 2001; van Gent et al. 2003). In this paper, we describe detailed evolutionary and comparative analyses of Kazal-like genes of oomycetes with an emphasis on the epi1-14 genes of P. infestans. We found that some, but not all, P.

infestans epi genes are fast evolving and lack orthologues in other Phytophthora

species. Phylogenetic analysis of oomycete Kazal-like EPI domains suggests

significant gene duplication and domain shuffling. The entire Kazal domains of P.

infestans EPIs are likely to be under purifying selection. However, we found

significantly higher nonsynonymous nucleotide substitution rates in sequences

encoding putative protease contact residues than in those encoding noncontact

residues. These analyses offer an insight into the possible biological function of

Kazal-like domain proteins of plant pathogenic oomycetes and allow us to devise

specific hypotheses regarding the nature of their target proteases.

The neutral theory of molecular evolution maintains that most molecular

polymorphisms within a species and most molecular divergence between species are

driven by random fixation of selectively neutral mutations (Kimura 1983). In most

proteins, neutral and purifying selection are thought to be major evolutionary forces,

with a high proportion of amino acid sites conserved as a result of structural and

functional constraints (Li 1997; Golding and Dean 1998). Under such circumstances,

pairwise comparisons of a whole protein or domain sequence using the approximate

method may not be sensitive enough to detect diversifying selection because they

average ω ratios over all sites (Yang and Bielawski 2000). However, if information

about which residues in a protein are expected to be under diversifying selection is

65 available, the sequence can be partitioned into different subsets. Testing diversifying

selection using the partitioned data is more sensitive than testing the entire protein or

domain sequence (Yang et al. 2000; Yang 2002). A classical example is diversifying

selection in proteins of the human Major Histocompatibility Complex (MHC).

According to the three dimensional structure of MHC proteins, Hughes and Nei

(1988) separately estimated ω ratios for different regions of MHC. They found diversifying selection (ω > 1) in regions of MHC coding for the antigen recognition site (ARS) and purifying selection (ω < 1) in other regions. In the present study, we used a similar data partition approach based on structural information on Kazal domain-protease complexes. We did not find evidence of diversifying selection when we applied the approximate method to the entire EPI domain sequences. However, after applying the approximate method to subsets of residues of EPI domains, we found that dN > dS in sequences encoding the twelve predicted protease contact residues but not in noncontact residues. These results suggest that diversifying selection affected epi genes but was restricted to protease contact residues. These results are consistent with earlier observations that protease contact residues in bird

Kazal domains are hypervariable and under diversifying selection (Laskowski et al.

1987).

Why are there striking differences in the rates of nucleotide substitutions between the putative protease contact and noncontact residues and what could be driving diversifying selection in these domains? A co-evolutionary arms race between

EPI inhibitors and their target serine proteases could have resulted in adaptive nucleotide substitution changes in the protease contact residues resulting in new inhibitory specificities. One of the P. infestans EPI proteins, EPI1, was shown to inhibit the defense protease P69B of the host plant tomato (Tian et al. 2004) and

66 protect other P. infestans secreted proteins from degradation by host proteases

(Chapter 6), suggesting a role in counterdefense and virulence. Interestingly, the epi

genes of Phytophthora join a growing list of genes related to plant-microbe

interactions that are under diversifying selection (Stahl and Bishop 2000). The pattern

of evolution identified here for EPI proteins is consistent with a role in counterdefense

and diversifying selection may have resulted from a coevolutionary arms race with

host proteases. To test this hypothesis, we are currently assaying the extent to which

the P69B gene is polymorphic in the host plants tomato and potato. In addition, site-

directed mutagenesis experiments combined with functional analyses will help to

unravel the importance of the hypervariable sites of EPI proteins.

We performed comparative genomic analyses of epi genes by comparing P.

infestans sequences to the draft genome sequences of P. sojae and P. ramorum. These

analyses revealed that many P. infestans epi genes, particularly epi1, epi2, epi7, and epi12, are fast evolving in Phytophthora. Rapid rates of evolution may have been driven by functional divergence following speciation and are consistent with the detection of diversifying selection in these genes. Such association between rapid rates of evolution and diversifying selection is consistent with several studies. For example, many rapidly evolving genes between the dicot plants Arabidopsis thaliana and Arabidopsis lyrata have been under diversifying selection and were proposed to be involved in adaptive divergence between these species (Barrier et al. 2003).

Similarly, it is tempting to speculate that these four epi genes have species-specific functions and contribute to adaptive divergence of P. infestans. In contrast to the fast evolving epi genes, other genes, such as epi4, epi5, and epi9, evolved at slower rates and have evident orthologs in the three species. These genes are likely to fulfill conserved functions in Phytophthora.

67 Phylogenetic analyses of EPI domains suggest occasional gene duplication

and significant domain shuffling during the evolution of these genes in Phytophthora.

Based on these analyses, we put forward a model of the evolution of epi genes in

Phytophthora. We propose that adaptive nucleotide substitution changes in the predicted protease contact residues of EPI domains were fixed by diversifying selection following duplication of epi genes and shuffling of Kazal-like domains.

Consequently, gene duplication, domain shuffling, and diversifying selection in key contact residues, likely driven by coevolution with target proteases, may have lead to diversification in EPI domain sequences resulting in novel inhibitory specificities.

Inhibition of host proteases was proposed to be a shared virulence strategy between oomycete plant pathogens and apicomplexan animal parasites (Tian et al.

2004). Interestingly, phylogenetic analyses of Kazal domain in four species of apicomplexan parasites indicated that in these species domain duplication was the major mechanism of evolution of Kazal domain genes. Why did Kazal proteins evolve through different mechanisms in oomycete and apicomplexan parasites? One possibility is the significant difference in genome size and structure between these eukaryotic microbes. For example, whereas the examined Phytophthora genomes

range from 65 to 240 Mbp, the apicompexan genomes are smaller, ranging from 9 to

23 Mbp (Abrahamsen et al. 2004; Randall et al. 2004; B. M. Tyler, pers. comm.).

Estimated total number of genes is also significantly smaller for apicomplexans,

ranging from 3,800 to 5,300, versus at least 16,000 genes for Phytophthora

(Abrahamsen et al. 2004; Randall et al. 2004; B. M. Tyler, pers. comm.). This

suggests that novel genes are more likely to emerge in the Phytophthora lineage and

that domain shuffling might be more prevalent overall. However, the extent to which

such differences in genome evolution apply to other gene families in these parasite

68 genomes remains to be determined.

The fourteen epi genes of P. infestans exhibited distinct expression patterns in vitro and in planta during colonization of tomato. These expression profiles lead to specific hypotheses regarding the nature of the protease targets and function of these inhibitors. For example, besides epi1, four other genes, epi2, epi6, epi10, and epi12, were up-regulated during infection of tomato and are therefore attractive candidates for targeting host proteases and functioning in virulence. In contrast, epi3 and epi14 were expressed in mycelium but not in planta suggesting that their targets are most likely endogenous proteases. Other genes, epi4, epi5, epi9, and epi11, showed constitutive levels of expression and may target either endogenous or host proteases.

Remarkably, there was a striking correlation between expression patterns and evolutionary history of some epi genes providing independent support for the functional predictions. To identify candidate target proteases for EPI proteins, we are complementing the studies described here with parallel phylogenetic and expression analyses of serine proteases from Phytophthora and host plants.

Analyses of rates of evolution and diversifying selection in protease inhibitor genes should help to discriminate between models of coevolution between the inhibitors and their target proteases. For example, inhibitor and proteases involved in a dynamic “arms race” coevolution, such as in interactions between pathogens and hosts, are more likely to be fast evolving and under diversifying selection than those involved in evolutionarily stable interactions. Inhibitor and protease interactions that contribute to basic cellular or developmental functions are expected to be evolutionarily static. Thus, we propose that the evolutionary analyses described here can be exploited to devise specific hypotheses regarding the function of the inhibitors as well as help to identify and prioritize candidate genes among different members

69 of a family. Phylogenetic analyses can therefore augment other selection criteria, such as differential gene expression, to identify candidate genes (Liu et al. 2004). For example, our analyses lead us to hypothesize that epi2 and epi12, which are among

the fastest evolving epi genes in P. infestans and are up-regulated during infection of

tomato, target host proteases and function in virulence. In contrast, we hypothesize

that the constitutively expressed genes, epi4, epi5, and epi9, which are slow evolving genes with obvious orthologues in P. sojae and P. ramorum, target endogenous proteases and function in basic cellular processes. Future functional analyses will test these hypotheses and evaluate the usefulness of these evolutionary analyses in helping to conceive functional predictions.

3.6 ACKNOWLEDGMENTS

The diversifying selection part is the work of Zhenyu Liu with the help of Ian

Holford and Xiaodong Bai for computer-related issues. We also thank Joe Win for

critical reading of early drafts of this manuscript. Salaries and research support were provided by State and Federal Funds appropriated to the Ohio Agricultural Research and Development Center, the Ohio State University.

A modified version of this chapter has been submitted for publication as:

Tian, M., Liu, Z., and Kamoun, S. 2004. Evolution of Kazal-like protease inhibitors in

Phytophthora was driven by gene duplication, domain shuffling, and diversifying selection.

3.7 REFERENCES

Abrahamsen, M.S., Templeton, T.J., Enomoto, S., Abrahante, J.E., Zhu, G., Lancto, C.A., Deng, M., Liu, C., Widmer, G., Tzipori, S., et al. 2004. Complete 70 genome sequence of the apicomplexan, Cryptosporidium parvum. Science 304: 441- 445.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 17: 3389-3402.

Andreu, A., Tonón, C., Van Damme, M., Van Damme, M., Huarte, M., Huarte, M., and Daleo, G. 1998. Effect of glucans from different races of Phytophthora infestans on defense reactions in potato tuber. Eur. J. Plant Pathol. 104: 777-783.

Atchley, W.R., Lokot, T., Wollenberg, K., Dress, A., and Ragg, H. 2001. Phylogenetic analyses of amino acid variation in the serpin proteins. Mol. Biol. Evol. 18: 1502-1511.

Baldauf, S.L., Roger, A.J., Wenk-Siefert, I., and Doolittle, W.F. 2000. A kingdom- level phylogeny of eukaryotes based on combined protein data. Science 290: 972-977.

Barrier, M., Bustamante, C.D., Yu, J., and Purugganan, M.D. 2003. Selection on rapidly evolving proteins in the Arabidopsis genome. Genetics 163: 723-733.

Birch, P.R.J. and Whisson, S. 2001. Phytophthora infestans enters the genomics era. Mol. Plant Pathol. 2: 257-263.

Bouarab, K., Melton, R., Peart, J., Baulcombe, D., and Osbourn, A. 2002. A saponin- detoxifying enzyme mediates suppression of plant defences. Nature 418: 889-892.

Bruno, S., Duschak, V.G., Ledesma, B., Ferella, M., Andersson, B., Guarnera, E.A., and Angel, S.O. 2004. Identification and characterization of serine proteinase inhibitors from Neospora caninum. Mol. Biochem. Parasitol. 136: 101-107.

Bushnell, W.R. and Rowell, J.B. 1981. Suppressors of defense reactions: a model for roles in specificity. Phytopathology 71: 1012-1014.

Caten, C.E. and Jinks, J.L. 1968. Spontaneous variability of single isolates of Phytophthora infestans. I. Cultural variation. Can. J. Bot. 46: 329-347.

Erwin, D.C. and Ribeiro, O.K. 1996. Phytophthora Diseases Worldwide. APS Press, St. Paul, Minnesota.

Golding, G.B. and Dean, A.M. 1998. The structural basis of molecular adaptation. Mol. Biol. Evol. 15: 355-369.

Heath, M.C. 1995. Signal exchange between higher plants and rust fungi. Can. J. Bot. 73(SUPPL. 1): S616-S623.

Heath, M.C. 2000. Hypersensitive response-related death. Plant Mol. Biol. 44: 321- 334.

Hughes, A.L. and Nei, M. 1988. Pattern of nucleotide substitution at major histocompatibility complex class I loci reveals overdominant selection.

71 Nature 335: 167-170.

Huitema, E., Bos, J.I., Tian, M., Win, J., Waugh, M.E., and Kamoun, S. 2004. Linking sequence to phenotype in Phytophthora-plant interactions. Trends Microbiol. 12: 193-200.

Irving, J.A., Pike, R.N., Lesk, A.M., and Whisstock, J.C. 2000. Phylogeny of the serpin superfamily: implications of patterns of amino acid conservation for structure and function. Genome Res. 10: 1845-1864.

Kamoun, S. 2003. Molecular genetics of pathogenic oomycetes. Eukaryotic Cell 2: 191-199.

Kamoun, S., van West, P., Vleeshouwers, V.G., de Groot, K.E., and Govers, F. 1998. Resistance of Nicotiana benthamiana to Phytophthora infestans is mediated by the recognition of the elicitor protein INF1. Plant Cell 10: 1413-1426.

Kamoun, S., Young, M., Glascock, C., and Tyler, B.M. 1993. Extracellular protein elicitors from Phytophthora: Host-specificity and induction of resistance to fungal and bacterial phytopathogens. Mol. Plant Microbe Interact. 6: 15-25.

Kimura, M. 1983. The Neutral Theory of Molecular Evolution. Cambridge University Press, Cambridge.

Komiyama, T., Bigler, T.L., Yoshida, N., Noda, K., and Laskowski, M., Jr. 1991. Replacement of P1 Leu18 by Glu18 in the reactive site of turkey ovomucoid third domain converts it into a strong inhibitor of Glu-specific Streptomyces griseus proteinase (GluSGP). J. Biol. Chem. 266: 10727-10730.

Laskowski, M., Jr. and Kato, I. 1980. Protein inhibitors of proteinases. Annu. Rev. Biochem. 49: 593-626.

Laskowski, M., Jr., Kato, I., Ardelt, W., Cook, J., Denton, A., Empie, M.W., Kohr, W.J., Park, S.J., Parks, K., Schatzley, B.L., et al. 1987. Ovomucoid third domains from 100 avian species: isolation, sequences, and hypervariability of enzyme-inhibitor contact residues. Biochemistry 26: 202-221.

Li, W.H. 1997. Molecular Evolution. Sinauer Associates, Sunderland, MA.

Lindh, J.G., Botero-Kleiven, S., Arboleda, J.I., and Wahlgren, M. 2001. A protease inhibitor associated with the surface of Toxoplasma gondii. Mol. Biochem. Parasitol. 116: 137-145.

Liu, Z., Bos, J.I.B., Armstrong, M., Whisson, S.C., da Cunha, L., Torto-Alalibo, T., Win, J., Avrova, A.O., Wright, F., Birch, P.R.J., et al. 2004. Patterns of diversifying selection in the phytotoxin-like scr74 gene family of Phytophthora infestans. Mol. Biol. Evol. in press.

Lu, S.M., Lu, W., Qasim, M.A., Anderson, S., Apostol, I., Ardelt, W., Bigler, T., Chiang, Y.W., Cook, J., James, M.N., et al. 2001. Predicting the reactivity of proteins from their sequence alone: Kazal family of protein inhibitors of serine

72 proteinases. Proc. Natl. Acad. Sci. U. S. A. 98: 1410-1415.

Lu, W., Apostol, I., Qasim, M.A., Warne, N., Wynn, R., Zhang, W.L., Anderson, S., Chiang, Y.W., Ogin, E., Rothberg, I., et al. 1997. Binding of amino acid side-chains to S1 cavities of serine proteinases. J. Mol. Biol. 266: 441-461.

Margulis, L. and Schwartz, K.V. 2000. Five Kingdoms: An Illustrated Guide to the Phyla of Life on Earth. W.H. Freeman and Co., New York.

Morris, M.T., Cheng, W.C., Zhou, X.W., Brydges, S.D., and Carruthers, V.B. 2004. Neospora caninum expresses an unusual single-domain Kazal protease inhibitor that is discharged into the parasitophorous vacuole. Int. J. Parasitol. 34: 693-701.

Page, R.D. 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12: 357-358.

Panstruga, R. 2003. Establishing compatibility between plants and obligate biotrophic pathogens. Curr. Opin. Plant Biol. 6: 320-326.

Pszenny, V., Angel, S.O., Duschak, V.G., Paulino, M., Ledesma, B., Yabo, M.I., Guarnera, E., Ruiz, A.M., and Bontempi, E.J. 2000. Molecular cloning, sequencing and expression of a serine proteinase inhibitor gene from Toxoplasma gondii. Mol. Biochem. Parasitol. 107: 241-249.

Randall, T.A., Dwyer, R.A., Huitema, E., Beyer, K., Cvitanich, C., Kelkar, H., Ah Fong, A.M.V., Gates, K., Roberts, S., Yatzkan, E., et al. 2004. Large-scale gene discovery in the oomycete Phytophthora infestans reveals likely components of phytopathogenicity shared with true fungi. Mol. Plant Microbe Interact. in press.

Read, R.J., Fujinaga, M., Sielecki, A.R., and James, M.N. 1983. Structure of the complex of Streptomyces griseus protease B and the third domain of the turkey ovomucoid inhibitor at 1.8-A resolution. Biochemistry 22: 4420-4433.

Ristaino, J.B. 2002. Tracking historic migrations of the Irish potato famine pathogen, Phytophthora infestans. Microbes Infect. 4: 1369-1377.

Rose, J.K., Ham, K.S., Darvill, A.G., and Albersheim, P. 2002. Molecular cloning and characterization of glucanase inhibitor proteins: coevolution of a counterdefense mechanism by plant pathogens. Plant Cell 14: 1329-1345.

Sanchez, L.M., Ohno, Y., Miura, Y., Kawakita, K., and Doke, N. 1992. Host selective suppression by water-soluble glucans from Phytophthora spp. of hypersensitive cell death of suspension-cultured cells from some solanaceous plants caused by hyphal wall elicitors of the fungi. Ann. Phytopathol. Soc. Japan 58: 664-670.

Shattock, R.C. 2002. Phytophthora infestans: populations, pathogenicity and phenylamides. Pest Manag. Sci. 58: 944-950.

Smart, C.D. and Fry, W.E. 2001. Invasions by the late blight pathogen: renewed sex and enhanced fitness. Biol. Invas. 3: 235-243.

Sogin, M.L., and Silberman, J.D. 1998. Evolution of the protists and protistan 73 parasites from the perspective of molecular systematics. Int. J. Parasitol. 28: 11-20.

Stahl, E.A. and Bishop, J.G. 2000. Plant-pathogen arms races at the molecular level. Curr. Opin. Plant Biol. 3: 299-304.

Tatusov, R.L., Koonin, E.V., and Lipman, D.J. 1997. A genomic perspective on protein families. Science 278: 631-637.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25: 4876-4882.

Tian, M., Huitema, E., Da Cunha, L., Torto-Alalibo, T., and Kamoun, S. 2004. A Kazal-like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. J. Biol. Chem. 279: 26370-26377.

Torto, T., Li, S., Styer, A., Huitema, E., Testa, A., Gow, N.A.R., van West, P., and Kamoun, S. 2003. EST mining and functional expression assays identify extracellular effector proteins from Phytophthora. Genome Res. 13: 1675-1685.

Torto, T.A., Rauser, L., and Kamoun, S. 2002. The pipg1 gene of the oomycete Phytophthora infestans encodes a fungal-like endopolygalacturonase. Curr. Genet. 40: 385-390.

van Gent, D., Sharp, P., Morgan, K., and Kalsheker, N. 2003. Serpins: structure, function and molecular evolution. Int. J. Biochem. Cell Biol. 35: 1536-1547.

Yang, Z. 2002. Inference of selection from multiple species alignments. Curr. Opin. Genet. Dev. 12: 688-694.

Yang, Z. and Bielawski, J.P. 2000. Statistical methods for detecting molecular adaptation. Trends Ecol. Evol. 15: 496-503.

Yang, Z. and Nielsen, R. 2000. Estimating synonymous and nonsynonymous substitution rates under realistic evolutionary models. Mol. Biol. Evol. 17: 32-43.

Yang, Z., Nielsen, R., Goldman, N., and Pedersen, A.M. 2000. Codon-substitution models for heterogeneous selection pressure at amino acid sites. Genetics 155: 431- 449.

Yoshioka, H., Hayakawa, Y., and Doke, N. 1995. Suppression of phenylalanine ammonia-lyase mRNA accumulation by suppressors from Phytophthora infestans. Ann. Phytopathol. Soc. Japan 61: 7-12.

74

Figure 3.1. Schematic representation of the structure of Phytophthora infestans EPI1- EPI14 proteins. Predicted signal peptides (SP) and Kazal domains are shown in gray. The disulfide linkages predicted based on the structure of other Kazal domains are shown. The putative P1 residues are indicated by arrows. Numbers indicate the positions of amino acid residues starting from the N terminus. Boxes with dashed lines represent incomplete amino acid sequences. The scale bar represents 20 amino acids.

75

Figure 3.2. Sequence alignment of 56 Kazal domains of plant pathogenic oomycetes and their corresponding consensus sequence pattern. A, Multiple sequence alignment of EPI domains with representative Kazal family inhibitor domains. Domain names correspond to protease inhibitors of the oomycetes Phytophthora infestans (EPI1-14a- c), Phytophthora sojae (PsojEPI1-12a-d), Phytophthora ramorum (PramEPI1, 4-5, 9- 11a-c), Phytophthora brassicae (PbraEPI1-2a-b), Plasmopara halstedii (PhaEPI1), and the crayfish Pacifastacus leniusculus (PAPI-1b-c) with their predicted P1 residues indicated by the double-headed arrow. The predicted contact residues with the cognate proteases are marked with asterisks. B, Consensus sequence pattern of oomycete Kazal domains. Consensus sequence was calculated at http://www.bio.cam.ac.uk/seqlogo. Predicted contact residues are indicated by black letters and noncontact residues by gray letters. The bigger the letter, the more conserved the amino acid site. The positions of amino acids in the consensus sequence correspond to the positions in the sequence alignment. The P1 positions are indicated by the double-headed arrow. 76

Figure 3.3. Distribution of P1 residues among oomycete Kazal domains. Frequency represents the number of Kazal domains containing a given amino acid residue at the P1 position.

77

Figure 3.4. Sequence alignment of EPI4, PsojEPI4 and PramEPI4 of Phytophthora infestans, Phytophthora sojae and Phytophthora ramorum, respectively. The predicted proteins are encoded by a cluster of orthologous genes in the three species. The putative signal peptides are shaded. The three Kazal domains are indicated in boxes.

78

Figure 3.5. Amino acid identity between Phytophthora infestans EPI proteins and their best matching proteins in Phytophthora sojae and Phytophthora ramorum. The squares correspond to the % identity of the EPI1-14 to their best matches from P. sojae and P. ramorum. The dashed lines indicate the average amino acid identity of a control set of 150 P. infestans proteins to their best matches in P. sojae and P. ramorum. Solid lines represent the average amino acid identity of the 14 EPI proteins.

79

Figure 3.6. Phylogenetic relationships of 56 oomycete Kazal domains. The neighbor- joining tree was generated as described in Methods based on the alignment illustrated in Figure 3.2. Domain names are described in the legend of Figure 3.2. Bootstrap values higher than 500 from 1,000 replications are shown. The length of the branches reflects weighted amino acid substitutions and the scale bar indicates 10% weighted sequence divergence. Domains from the same multi-domain protein and from the same orthologous cluster are coded with the same color. The cluster containing the 14 Kazal domains with two disulfide bridges is indicated by a vertical line.

80

Figure 3.7. Phylogenetic analysis of 31 Kazal domains from apicomplexan Kazal-like proteins. Domain names correspond to Kazal proteins of Toxoplasma gondii (TgPI- 1a-d, TgPI-2a-d), Neospora caninum (NCPl-S), and Cryptosporidium parvum (EAK89616; EAK87660-a-g; EAK88032-a-b; EAK87770-a-l). For clarity, the genus names and GenBank accession numbers are included in the domain names. The neighbor-joining phylogenetic tree was constructed as described in Methods. Bootstrap values higher than 500 from 1,000 replications are shown. The length of the branches reflects weighted amino acid substitutions and the scale bar indicates 10% weighted sequence divergence. Domains belonging to a given multi-domain protein are indicated by the same color. Note the contrast in domain clustering with Figure 3.6.

81

Figure 3.8. Pairwise comparison of nonsynonymous substitution rates (dN) and synonymous substitution rates (dS) among 21 EPI domain sequences from Phytophthora infestans. The diagonal line corresponds to dN = dS, indicating neutral selection. Points below the line suggest purifying selection.

82

Figure 3.9. Pairwise comparison of nonsynonymous (dN) and synonymous (dS) substitution rates within putative contact residues (A) and noncontact residues (B) among 21 EPI domains from Phytophthora infestans. Ratios of rates of nonsynonymous to synonymous nucleotide substitutions, ω = dN / dS > 1, ω = 1, and ω < 1 indicate diversifying, neutral and purifying selection, respectively.

83

Figure 3.10. Reverse Transcription Polymerase Chain Reaction (RT-PCR) analysis of epi1-14 in mycelium and during a time course of colonization of tomato by Phytophthora infestans. Total RNA isolated from non-infected leaves (To), infected leaves of tomato, 1, 2, 3, or 4 days after inoculation, and from P. infestans mycelium grown in synthetic medium (My) was used in RT-PCR amplifications. Amplifications of P. infestans elongation factor 2 alpha (ef2α) were used as controls to determine the relative expression of epi genes.

84 Genes Forward (F)/Reverse (R) primers epi1 F: 5’-gcgaagcttCAAAGCCCGCAAGTCATCAG-3’ R: 5’-gcgaagcTTATCCCTCCTGCGGTGTC-3’ epi2 F: 5’-gcgaagcttCTAGTCACACATGATCTCAG-3’ R: 5’-gcgaagcttCTAGTGAAGTTGCACCCTC-3’ epi3 F: 5’-gcggaattcTGACTCCGTCTCTGCTCGAAAG-3’ R: 5’-gcgggtacCTACGTCGCCGCGCAAGTACTC-3’ epi4 F: 5’-gcggaattcTGGTAGCTCGCTGAAGGATGCTAAA-3’ R: 5’-gcgggtaccCTAAACAGCGACGGTTTTCGTCG-3’ epi5 F: 5’-gcggaattcGGACGAGGCCATGCTGCACGTGAC-3’ R: 5’-gcgggtaccTTAGTGTTTCTTAATGCACTTGC-3’ epi6 F: 5’-gcggaattccTCGTACTGCCCCAACATCATGTG-3 R: 5’-gcgggtaccTCACTTCGAGCTGCAGGCGCCATCT-3’ epi7 F: 5’-ggaaatcgatTAAGGCTACCACACTCCCTGTC-3’ R: 5’-ggaagcggccgcCAGTACATGTTATAGTCGAATGGC-3’ epi8 F: 5’-ggaaatcgatCAGTAATTCACTGCAACGATCC-3’ R: 5’-ggaagcggccgcGCCATCTTCATATAGCGCTCG-3’ epi9 F: 5’-gcggaattcTAGGCTGGGAGAGGCACAGATCTAC-3’ R: 5’-gcgggtaccTCATTGTTTGCATTTGCCCTTGT-3’ epi10 F: 5’-gcggaattcTGCAGACGACAACTGCTCTTTTGG-3’ R: 5’-gcgggtaccTTATGTGGCTACCATCTCGTTAC-3’ epi11 F: 5’-GCGTCCGGAGCTACACAAGTCC-3’ R: 5’-ACACGCCCGAGCATCCAGAACC-3’ epi12 F: 5’-gcggaattcTGCTGGCCAAGCGCTGGACCCG-3’ R: 5’-gcgggtaccTCAAGCCTCAACTGACTTCTGAG-3’ epi13 F: 5’-gcggaattcTGCTTATGATAGCCCGATCATGATAAG-3’ R: 5’-gcgggtacCTATGGGCCCGTAACGGATGGAG-3’ epi14 F: 5’-gcggaattcTGGAAACCACTTCATGATGAACGAC-3’ R: 5’-gcgggtacCTAGATTCGCTCTTGCTCACCTTGG-3’

Table 3.1. Primers used for RT-PCR amplifications of epi genes from P. infestans. The letters in upper case represent gene-specific nucleotide sequence. The letters in lower case represent added nucleotides for the convenience of cloning.

85 Orthologous Genes Number P1 residues Number Average identity clusters of Kazal of amino of proteins from domains acids three pairwise comparisons epi4 3 Thr, Asp, Asp 318 I Psojepi4 3 Thr, Asp, Asp 294 60.3%

Pramepi4 3 Thr, Asp, Asp 326

epi5 1 Arg 88 II 62.0% Psojepi5 1 Arg 86 Pramepi5 1 Arg 85

epi9 1 Arg 80 III Psojepi9 1 Arg 106 58.7% Pramepi9 1 Arg 77

Table 3.2. Putative orthologous epi genes in P. infestans, P. sojae and P. ramorum.

86 CHAPTER 4

A SECOND KAZAL-LIKE PROTEASE INHIBITOR FROM PHYTOPHTHORA

INFESTANS INHIBITS AND INTERACTS WITH THE TOMATO

PATHOGENESIS-RELATED PROTEASE P69B

4.1 ABSTRACT

Plant apoplastic proteases have been tied to plant defense responses. Previously, a Kazal-like extracellular protease inhibitor EPI1 from oomycete plant pathogen

Phytophthora infestans was found to inhibit and interact with tomato pathogenesis- related P69B subtilase, suggesting that inhibition of plant defense-related proteases represents a novel type of counterdefense mechanism. Here, we describe and functionally characterize a second extracellular protease inhibitor, EPI10, from P. infestans. EPI10 contains three domains with significant similarity to the Kazal family of serine protease inhibitors. The expression of epi10 was up-regulated during infection, suggesting a role in P. infestans-plant interactions. Recombinant EPI10 specifically inhibited subtilisin A among major serine proteases, and interacted with and inhibited tomato P69B.

Recruitment of at least two distinct Kazal-like protease inhibitors to target the same defense-related protease, suggesting that inhibition of plant proteases by Kazal inhibitors might be a critical virulence strategy for the devastating plant pathogen P. infestans.

87 4.2 INTRODUCTION

The plant apoplast forms a protease-rich environment in which proteases are

integral components of the plant defense response (Tornero et al. 1997; Jorda et al. 1999;

van Loon and van Strien 1999; Kruger et al. 2002; Xia et al. 2004). The extracellular

P69B subtilisin-like serine protease of tomato has long been tied to plant defense and can be induced by multiple plant pathogens, including the oomycete Phytophthora infestans, citrus exocortis viroid and the bacterium Peusomonas syringae (Tornero et al. 1997;

Zhao et al. 2003; Tian et al. 2004). Rcr3, an apoplastic papain-like cysteine protease from

tomato, is required for specific resistance to Cladosporium fulvum (Kruger et al. 2002). In

Arabidopsis, the extracellular aspartic protease CDR1 functions in desease resistance

signaling as a positive regulator of cell death (Xia et al. 2004). Suppression of plant

protease-mediated host defenses could be one of the diverse strategies that plant

pathogens have evolved to survive in the plant intercellular space and colonize plant

tissue. Indeed, our laboratory recently reported that plant pathogenic oomycetes secrete a

diverse family of Kazal-like extracellular serine protease inhibitors with at least 35

members identified from Phytophthora infestans, Phytophthora sojae, Phytophthora

ramorum, Phytophthora brassicae, and the downy mildew Plasmopara halstedii (Tian et

al. 2004). Among these, the two-domain EPI1 protein of P. infestans was found to inhibit

and interact with the tomato pathogenesis-related P69B subtilase (Tian et al. 2004).

Protease inhibitors might be ubiquitous among eukaryotic plant pathogens. Avr2, a small

secreted peptide of the fungus Cladosporium fulvum, was shown to inhibit tomato

cysteine protease Rcr3 (J. D. Jones, pers. comm.). Therefore, inhibition of plant proteases

by secreted plant pathogen proteins might represent a novel counterdefense mechanism.

88 P. infestans causes late blight, a reemerging and ravaging disease of potato and

tomato (Birch and Whisson 2001; Smart and Fry 2001; Ristaino 2002; Shattock 2002). P. infestans belongs to the oomycetes, a group of fungus-like organisms that are distantly related to fungi but closely related to brown algae and diatoms in the Stramenopiles

(Sogin 1998; Margulis and Schwartz 2000; Kamoun 2003). P. infestans is a hemibiotrophic pathogen that requires living cells to establish a successful infection. As with other biotrophic plant pathogens, processes associated with P. infestans pathogenesis are thought to include the suppression of host defense responses. Water- soluble glucans have been reported to be one of the strategies that P. infestans applies to suppress defense responses (Sanchez et al. 1992; Yoshioka et al. 1995; Andreu et al.

1998). The recent finding that P. infestans Kazal-like extracellular protease inhibitor

EPI1 targets tomato pathogenesis-related P69B subtilase suggests a distinct counterdefense mechanism (Tian et al. 2004). Fourteen Kazal-like extracellular serine protease inhibitors (EPI1-EPI14) from P. infestans form a diverse family (Tian et al.

2004)(Chapter 3). These EPI proteins were predicted to be Kazal-like inhibitors based on conserved Kazal domain motifs in their amino acid sequence. The number of Kazal domains for each EPI protein ranges from one to three. The individual Kazal domains from a multi-domain inhibitor can be effective against different serine proteases (Scott et al. 1987; Mitsudo et al. 2003; Mende et al. 2004). Therefore, it is likely that multi-domain

EPI proteins are able to inhibit multiple different serine proteases. Detailed phylogenetic and comparative analyses indicate that these EPI proteins have evolved by significant domain shuffling, occasional gene duplication and diversifying selection in contact residues determining the reactivity and specificity with the cognate serine proteases

89 (Chapter 3). With such a diverse family of extracellular protease inhibitors from P. infestans, complex inhibition of a diverse array of plant proteases might occur at the plant-microbe interaction interface. The same EPI protein might target different plant proteases, while different EPI proteins could also target the same plant protease.

An additivity-based sequence to reactivity algorithm has been developed and validated to predict inhibition constants (Ki) between Kazal domains and serine proteases

(Lu et al. 2001). For each Kazal domain, there are 12 contact positions (P6, P5, P4, P3,

P2, P1, P1’, P2’, P3’, P14’, P15’ and P18’) responsible for the interactions between Kazal domains and the cognate serine proteases (Read et al. 1983; Laskowski et al. 1987; Lu et al. 1997; Lu et al. 2001). Changes in noncontact residues often do not affect equilibrium constants (Ka, the reciprocal of Ki), whereas changes in contact residues cause significant alterations of Ka (Lu et al. 2001). Among the 12 contact residues, P3 and P15’ are conserved with cysteines and asparagines, respectively, and show little variation in different naturally occurring Kazal domains, but the remaining ten contact residues are hypervarible (Lu et al. 2001). The algorithm was established based on the 10 hypervariable contact residues and allows for the calculation of Ka or Ki of a Kazal domain against a selected set of six serine proteases based on the domain sequence alone

(Lu et al. 2001).

In this paper, we describe and functionally characterize the P. infestans Kazal-like extracellular serine protease inhibitor, EPI10. EPI10 contains three Kazal domains, one of which was predicted to be an efficient inhibitor of subtilisin A by the additivity-based sequence to reactivity algorithm developed by Lu et al. (2001). EPI10 was up-regulated during infection of tomato suggesting a role during P. infestans-host interactions.

90 Recombinant EPI10 (rEPI10) specifically inhibited subtilisin A among the major serine proteases, and inhibited and interacted with the pathogenesis-related subtilase P69B of tomato. Therefore, P. infestans evolved at least two Kazal-like inhibitors to target the same defense-related protease, suggesting that inhibition of plant defense-related proteases by Kazal protease inhibitors might be a critical virulence strategy for P. infestans.

4.3 MATERIALS AND METHODS

Prediction of inhibition constants

The putative 10 hypervariable contact residues of 21 P. infestans Kazal-like

domains were identified based on similarity to canonical animal Kazal domains (Read et

al. 1983; Laskowski et al. 1987; Lu et al. 1997). Predicted inhibition constants of 17

domains against the serine protease subtilisin A (Carlsberg) were generated by Drs.

Qasim and Laskowski, Purdue University, with the additivity-based sequence to

reactivity algorithm developed by Lu et al. (2001).

Phytophthora strain and culture conditions

P. infestans isolate 90128 (A2 mating type, race 1.3.4.7.8.9.10.11) was routinely

grown on rye agar medium supplemented with 2% sucrose (Caten and Jinks 1968). For

RNA extraction, plugs of mycelium were transferred to modified Plich medium (Kamoun

et al. 1993) and grown for 2 weeks before harvesting.

Plant growth, BTH treatment and infection by P. infestans

Tomato (Lycopersicon esculentum) cultivar Ohio 7814 and Nicotiana benthamiana plants were grown in pots at 25°C, 60% humidity, under 16 hour-light/8

91 hour-dark cycle. BTH treatment of tomato plants followed the exact same procedure

described previously (Tian et al. 2004). Time courses of P. infestans infection of tomato

leaves were performed exactly as described earlier (Kamoun et al. 1998; Tian et al.

2004).

Bacterial strains and plasmids

Escherichia coli XL1-Blue and Agrobacterium tumefaciens GV3101 were used in this study and routinely grown in Luria-Bertani (LB) media (Sambrook et al. 1989) at

37°C and 28°C respectively. Plasmid pFLAG-EPI10 was constructed by cloning PCR amplified DNA fragment corresponding to the mature sequence of EPI10 into the EcoRI and KpnI sites of pFLAG-ATS (Sigma, St. Louis, MO), a vector that allows secreted expression in E. coli. The oligonucleotides EPI10-F1 (5’- GCGGAATTCTGCAGACGA

CAACTGCTCTTTTGG -3’) and EPI10-R1 (5’- GCGGGTACCTTATGTGGCTACCAT

CTCGTTAC -3’) were used to amplify the fragment. The introduced EcoRI and KpnI

restriction sites are underlined. The N-terminal sequence of the processed recombinant

FLAG-EPI10 (rEPI10) protein is “DYKDDDDKVKLLENSADDNCSFGCL...”. The

FLAG epitope sequence is underlined, and the first 10 amino acids of mature EPI10 are

shown in bold. Plasmid pCB-P69B was constructed by cloning PCR amplified DNA

fragment corresponding to the open reading frame of P69B (GenBankTM accession

number Y17276) fused with HA tag (YPYDVPDYA ) at the C-terminus into the BamHI

and SpeI sites of a binary vector pCB302-3 (Xiang et al. 1999). The oligonucleotides

P69B-F1 (5’- GCGGGATCCATGGGATTATTGAAAATCCTTCTTGTTTTC -3’) and

P69B-R1 (5’- GCGTCTAGACTAagcgtaatctggaacatcgtatgggtaGGCAGACACAACTGC

92 AATTGGAC -3’) were used to amplify the fragment. The introduced BamHI and XbaI

sites are underlined. The introduced HA-encoding sequence is in lower case.

Semi-quantitative RT-PCR

RNA isolation and semi-quantitative RT-PCR were performed as described

earlier (Torto et al. 2003; Tian et al. 2004). The oligonucleotides EPI10-F1 and EPI10-

R1, previously used for cloning epi10 into pFLAG-ATS vector, were used to detect epi10 transcripts by RT-PCR. The expression of epi10 was controlled with P. infestans

elongation factor 2 alpha (ef2α) gene using the primer pair described previously (Torto et al. 2002).

SDS-PAGE and western blot analyses

Proteins were subjected to 10%-15% sodium dodecyl sulfate-polyacrylamide gel

electrophoresis (SDS-PAGE) as previously described (Sambrook et al. 1989). Following

electrophoresis, gels were stained with silver nitrate following the method of Merril et al.

(1981), or the proteins were transferred to supported nitrocellulose membranes (BioRad

Laboratories, Hercules, CA) using a Mini Trans-Blot apparatus (BioRad Laboratories,

Hercules, CA). Detection of antigen-antibody complexes was carried out with a Western

blot alkaline phosphatase kit (BioRad Laboratories, Hercules, CA). Antisera to P69

subtilases were raised against a peptide specific for the tomato P69 family (Tian et al.

2004). Monoclonal anti-FLAG M2 and anti-HA antibodies were purchased from Sigma

(St. Louis, MO).

Expression and purification of rEPI10

Expression and purification of rEPI10 was conducted as described previously

(Kamoun et al. 1997; Tian et al. 2004). Protein concentrations were determined using the

93 BioRad protein assay (BioRad Laboratories, Hercules, CA). 0.5 µg of the purified protein

was run on a SDS-PAGE gel followed by staining with silver nitrate to determine the

purity.

Transient expression of P69B subtilase in planta

Transient expression of P69B-HA in planta was performed according to the

methods described previously (Kruger et al. 2002). Agrobacterium tumefaciens strains carrying plasmids pCB-P69B, empty vector pCB302-3 (Xiang et al. 1999), and pCB301- p19 (Win and Kamoun 2004) were used. pCB301-p19 is a construct expressing P19 protein of tomato bushy stunt virus (TBSV), a suppressor of post-transcriptional gene silencing in Nicotiana benthamiana (Voinnet et al. 2003). Overnight agrobacteria cultures were harvested by centrifugation at 2000 g for 20 min, and resuspended in 10 mM MgCl2, 10 mM MES (pH 5.6) and 150 µM acetosyringone. Resuspended agrobacteria culture of pCB-P69B or pCB302-3 with an optical density (OD600) of 1.0 was mixed with equal volume of culture of pCB301-p19 with an optical density (OD600) of 2.0. The mixtures were kept at room temperature for 3 h and then infiltrated into leaves of 6-week-old N. benthamiana plants. Intercellular fluids from infiltrated leaves were isolated 5 days after infiltration.

Isolation of intercellular fluids

Intercellular fluids were prepared from tomato and N. bethamiana leaves according to the method of de Wit and Spikman (1982). For tomato leaves, a 0.24 M sorbitol solution was used as extraction buffer. For leaves from N. benthamiana, a solution of 300 mM NaCl, 50 mM NaPO4 pH 7 (Kruger et al. 2002) was used as

94 extraction buffer. The intercellular fluids were filter sterilized (0.45 µM), and were used immediately or stored at –20°C.

In-gel protease assays

In-gel protease assays with intercellular fluids from N. benthamiana were

performed using BIO-RAD’s zymogram buffer system as described previously (Tian et

al. 2004).

Assays of protease inhibition

Inhibition assays of commercial serine proteases by rEPI10 was performed by the

colorimetric QuantiCleaveTM Protease Assay Kit (Pierce, Rockford, IL) as described

previously (Tian et al. 2004). 20 pmol of rEPI10 was preincubated with 20 pmol of

trypsin (Pierce, Rockford, IL), chymotrypsin (Sigma, St. Luis, MO), or subtilisin A

(Carlsberg) (Sigma, St. Luis, MO), in a volume of 50 µl for 30 min at 25°C, and followed by incubation with 100 µl of succinylated casein (2 mg/ml) in 50 mM Tris buffer pH 8, containing 20 mM CaCl2 at room temperature for 20 min. Protease activity was measured as absorbance at 405 nm using HTS 7000 Bio Assay Reader (Perkin Elmer) 20 min after the addition of chromogenic reagent 2,4,6-trinitrobenzene sulfonic acid, which reacts with the primary amine of digested peptide and produces the color reaction which can be quantified by absorbance reader.

Inhibition assays of plant protease P69B by rEPI10 were carried out with in-gel protease assays described earlier in this chapter. 20 pmol of rEPI10 were preincubated with 10 µl of intercellular fluids for 30 min at 25°C and the remaining protease activity was detected.

95 Coimmunoprecipitation

Coimmunoprecipitation of rEPI10 and tomato intercellular fluids was performed

using the FLAG-tagged protein immunoprecipitation kit (Sigma, St. Louis, MO) as described previously (Tian et al. 2004). 800 pmol of purified rEPI10 were preincubated with 200 µl of tomato intercellular fluids for 20 min at 25°C. 40 µl of anti-FLAG M2

resin was added and incubated at 4°C for 2 h with gentle shaking. The precipitated

protein complexes were eluted in 60 µl of FLAG peptide solution (150 ng/µl) and were analyzed by SDS-PAGE and Western blot analyses.

4.4 RESULTS epi10 is predicted to encode an inhibitor of subtilisin A and is strongly upregulated

during infection of tomato by P. infestans

Previously, we used data mining of expressed sequence tags (ESTs) and random

genomic sequence of P. infestans to identify 14 Kazal-like extracellular serine protease inhibitors (EPI1- EPI14) (Tian et al. 2004). One of these proteins, the two-domain EPI1, was shown to inhibit and interact with subtilisin-like proteases, including tomato pathogenesis-related P69B. To identify additional subtilisin inhibitors, we used the additivity-based sequence to reactivity algorithm developed by Lu et al. (2001) to predict the inhibition constants (Ki) of P. infestans Kazal domains against subtilisin A. Of the 17

EPI domains that could be assessed with the algorithm, the first domain of EPI1 (EPI1a) and the second domain of EPI10 (EPI10b) were the only domains predicted to inhibit subtilisin A with a Ki of lower than 10-9 M. We examined the expression of epi10 gene

during infection by semiquantitative RT-PCR. epi10 was found to be highly induced 96 during the infection of tomato compared with in vitro grown mycellium (Figure 4.1), suggesting that EPI10 plays a role during infection of tomato plants. Altogether, these data suggest that EPI10 is a good candidate to function as a subtilisin inhibitor and to target host proteases similar to EPI1. We therefore proceeded to perform detailed molecular and functional characterization of epi10.

epi10 encodes a Kazal-like extracellular serine protease inhibitor related to EPI1

epi10 was first identified from an EST dataset generated from zoospores of P. infestans 88069 (Tian et al. 2004). DNA sequencing of the full cDNA revealed an open reading frame of 675 bp corresponding to a predicted translated product of 224 amino acids and the sequence was deposited in NCBI GenBank under accession number

AY586282. SignalP 3.0 (Bendtsen et al. 2004) analysis of the putative protein identified a

21-amino acid signal peptide with a significant mean S value of 0.939. Searches against

InterPro database (http://www.ebi.ac.uk/InterProScan/) revealed three domains similar to

InterPro IPR002350 for Kazal inhibitors (Figure 4.2A). We used Clustal X (Thompson et al. 1997) to generate a multiple alignment of Kazal domains from P. infestans EPI1,

EPI10, the signal crayfish Pacifastacus leniusculus Kazal inhibitor PAPI-1 (Johansson et al. 1994) and the apicomplexan Toxoplasma gondii TgPI1 (Pszenny et al. 2000) (Figure

4.2B). The first domain (EPI10a) and the third domain (EPI10c) of EPI10 are typical kazal domains, containing all the highly conserved amino acid residues defining the

Kazal family signature, including 6 cysteine residues forming 1-5/2-4/3-6 disulfide bond pattern, tyrosine, and asparagine residues. Like the first domain (EPI1a) of EPI1, the second domain (EPI10b) of EPI10 is atypical, and lacks the third and sixth cysteines but

97 retains the other four cysteines (Figure 4.2). For all the three domains of EPI10, the

predicted P1 residues, which are central to the specificity of Kazal inhibitors (Laskowski

and Kato 1980; Komiyama et al. 1991; Lu et al. 1997), are aspartate (Asp) and this is the

exactly same case for EPI1.

EPI10 inhibits the serine protease subtilisin A

To determine whether EPI10 functions as a subtilisin inhibitor as predicted by

bioinformatic analyses, we expressed in E. coli and affinity purified recombinant EPI10

(rEPI10) as a fusion protein with the FLAG epitope tag at the amino-terminus. Silver

staining of the purified rEPI10 after SDS-PAGE revealed a single band indicating high

purity (Figure 4.3). Three major commercial serine proteases chymotrypsin, trypsin, and

subtilisin A were selected for inhibition assays with the purified rEPI10. Protease activity was measured with or without rEPI10. In repeated assays, rEPI10 was found to inhibit about 96% of the measured activity of subtilisin A, but did not cause apparent inhibition of the other two proteases (Figure 4.4). This result suggests that epi10 encodes a

functional protease inhibitor that specifically targets the subtilisin class of serine

proteases.

EPI10 interacts with BTH-induced tomato P69 subtilases

Since the epi10 gene encodes a functional protease inhibitor of subtilisins and is

up-regulated during host infection, we hypothesized that it interacts with tomato

proteases, particularly P69 subtilases. To test this hypothesis, we performed

coimmunoprecipitation on tomato intercellular fluids incubated with rEPI10 using FLAG

98 antibody covalently linked agarose beads. The eluates were run on SDS-PAGE followed

by sequential immunobloting with P69 and FLAG antisera (Figure 4.5). Western blot

analyses with P69 antisera revealed two closely migrated protein bands of ~70 kDa only

from coimmunoprecipitation of samples incubated with rEPI10. This indicates interaction of P69 subtilases with rEPI10. The two closely migrated protein bands reacting with P69 antisera were similar to the ones identified by coimmunoprecipitation of rEPI1 with tomato intercellular fluids (Tian et al. 2004). In both cases, the interacting P69 subtilases were induced by BTH suggesting that the BTH-inducible P69 isoform P69B is the main target. Western blot with FLAG antisera confirmed the presence of rEPI10 in the eluted protein complexes. However, rEPI10 was processed in tomato intercellular fluids.

Besides the full length rEPI10, several FLAG reacting bands smaller than rEPI10 were detected (Figure 4.5). It is likely that rEPI10 was processed by BTH-induced tomato proteases given that the extent of degradation of rEPI10 was higher in BTH-treated tomato intercellular fluids compared to H2O-treated intercellular fluids.

Transient expression of tomato P69B subtilase in Nicotiana benthamiana

To test whether rEPI10 inhibits the tomato subtilase P69B and independently

confirm the coimmunoprecipitation experiment, we transiently expressed P69B in the

apoplast of Nicotiana benthamiana plants. A construct with P69B fused to epitope tag

HA at the C-terminus was expressed in N. benthamiana plants by agroinfiltration. The whole open reading frame of P69B (GenBank accession number Y17276) encodes a prepropeptide of 745 amino acids, including N- terminal signal peptide of 21 amino acids followed by 92-amino acid prosequence, and C-terminal mature protein sequence which

99 is responsible for the protease activity (Jorda et al. 1999). We extracted intercellular

fluids from infiltrated leaves of N. benthamiana and performed Western blot with HA antisera to detect P69B-HA. A distinct band of ~ 70 kDa was detected in intercellular fluids from leaves infiltrated with A. tumefaciens carrying the plasmid pCB-P69B, but not from leaves infiltrated with A. tumefaciens containing the empty binary vector, indicating that the mature form of P69B-HA was successfully expressed (Figure 4.6A). To test if the expressed fusion protein P69B-HA is a functional protease, 10 µl intercellular fluids from two treatments were used for in-gel protease assay. An extra protease band was clearly visible in the P69B-expressing sample but not in the control and is likely to reflect the protease activity of P69B (Figure 4.6B).

EPI10 inhibits the tomato pathogenesis-related serine protease P69B

To test whether rEPI10 inhibits the protease activity of P69B, N. bethamiana intercellular fluids containing the P69B-HA protein were incubated with or without rEPI10 and the protease activity was detected by in-gel protease assay. rEPI10 totally inhibited the protease activity of P69B, and also reduced the activity of two other protease bands from N. benthamiana (Figure 4.7). These bands are likely to be subtilisin- like serine proteases of N. benthamiana, possibly homologs of tomato P69 subtilases.

However, their exact identity remains unknown. This experiment independently confirms that EPI10 inhibits P69 subtilases and that it specifically targets P69B.

100 4.5 DISCUSSION

Plant apoplastic proteases have long been tied to defense responses. Previously, a two-domain Kazal-like protease inhibitor EPI1 from P. infestans was characterized to inhibit and interact with the pathogenesis-related P69B subtilisin-like serine protease of

the host plant tomato, suggesting that inhibition of plant defense-related proteases is a

virulence mechanism of P. infestans to suppress plant defense. In this study, a second

Kazal-like extracellular protease inhibitor of P. infestans, EPI10, was also found to inhibit and interact with P69B. EPI10 is strongly upregulated during colonization of tomato. Based on its biological activity and expression pattern, EPI10 may function as a disease effector molecule similar to EPI1.

The finding that P. infestans evolved two distinct protease inhibitors to target the

same plant protease, suggest that inhibition of P69B could be an important infection

mechanism for P. infestans. The EPI1 and EPI10 proteins are divergent in amino acid

sequence, molecular mass and number of Kazal domains, but the expression patterns of

epi1 and epi10 during infection of tomato by P. infestans is similar (Tian et al., 2004).

Both genes are up-regulated, although the induction level of epi10 is higher than epi1.

The concurrent expression pattern of these two genes suggests that they could play

complementary roles in order to completely inhibit P69B, a highly abundant apoplastic

protein.

During coimmunoprecipitation of rEPI10 with tomato intercellular fluids, we

found that some BTH-induced plant proteases could proteolytically process rEPI10.

Independent experiments by incubating rEPI10 in H2O-treated and BTH-induced tomato intercellular fluids followed by immunobloting with FLAG antisera observed the same

101 result (data not shown). P69B subtilase is BTH-induced and our later experiments showed that P69B is involved in plant defense by degrading pathogen proteins (Chapter

6). However, it is unlikely that P69B processes rEPI10. The experiments in Chapter 6 also showed that preincubation of tomato intercellular fluids with purified recombinant

EPI1 protein (rEPI1) protects P. infestans proteins from degradation by P69B. However, preincubation of tomato intercellular fluids with rEPI1 did not protect rEPI10 from processing (data not shown), suggesting some BTH-induced plant proteases other than

P69B process rEPI10. Degrading pathogen proteins by multiple plant defense-related proteases might represent an important mechanism of plant proteases to confer defense responses. Thus, the inhibition of plant defense-related proteases by P. infestans extracellular protease inhibitors could be critical for the pathogenesis of this pathogen.

Despite that rEPI10 was processed in tomato intercellular fluids, we still pulled down P69 subtilases in the coimmunoprecipitation experiment. There are several explanations that might account for this. First, the processed amino-terminal fragments containing one or two Kazal domains might be functional in interacting with P69 subtilases. There are many examples that one domain or several domains derived from a multi-domain inhibitor is an active inhibitor (Scott et al. 1987; Magert et al. 1999;

Mitsudo et al. 2003; Jayakumar et al. 2004; Mende et al. 2004). Second, rEPI10 was not totally processed and some intact molecules could still be detected in the eluates (Figure

4.5). The remaining full-length molecules might be responsible for the interaction with

P69. Further experiments to characterize the nature and reactivity of the processed EPI10 fragments will clarify this issue.

102 The additivity-based sequence to reactivity algorithm predicted the second

domain of EPI10 (EPI10b) to be a strong subtilisin inhibitor. Our experimental data

indeed confirmed that EPI10 is an inhibitor of subtilisn A and inhibits and interacts with

P69B subtisin-like serine protease of the host plant tomato. Moreover, the prediction of

EPI1 was also consistent with the experimentally determined data (Tian et al. 2004). The

additivity-based sequence to reactivity algorithm would be a useful tool for us to choose

the right candidate. However, we can not assess the accuracy of this algorithm to predict

the reactivity of P. infestans Kazal domains because the experimental data were obtained

with the entire two-domain EPI1 and three-domain EPI10. Further inhibition assays with

individual Kazal domains will reveal the applicability of this algorithm to predict P.

infestans Kazal domains.

The first domain (EPI1a) of EPI1 and the second domain (EPI10b) of EPI10 were

predicted to be strong inhibitors of subtilisin A, and both of them are atypical Kazal

domains with the loss of Cys 3, Cys 6 and the corresponding disulfide bridge. These

atypical two disulfide bridge domains are common in plant pathogenic oomycetes.

Among 56 Kazal domains identified from 5 plant pathogenic oomycetes, 14 belong to

this type (Chapter 3). These 14 domains come from 14 different proteins of three

Phytophthora species, P. infestans, P. ramorum and P. sojae. Interestingly, the phylogenetic analysis with all 56 Kazal domains revealed that all these 14 atypical domains form a significant cluster, suggesting that the loss of one disulfide bridge in

Phytophthora Kazal-like domains predates speciation (Chapter 3). Further experiments to characterize these atypical two disulfide bridge domains would help understand the

103 biochemical and biological functions of these diverse Kazal-like inhibitors of plant

pathogenic oomycetes.

Agrobacterium tumefaciens-mediated transient expression of plant proteins in

Nicotiana benthamiana provides an ideal tool for functional characterization of plant proteases. A large number of proteases have a prodomain which must be removed for the protease to become active. Commonly used heterologous expression systems, such as

Escherichia coli expression, are usually not effective for proteases (Bromme et al. 2004).

During the expression of proteases in E. coli., the presence of prodomains is essential for correct folding and further steps to obtain active enzymes by removing prodomains are required (Bromme et al. 2004). Heterologous expression of proteases in planta avoids all those steps. In N. benthamiana plants, the prodomains of plant proteases are expected to

be processed and active proteases can be obtained in vivo. The active tomato cysteine

protease Rcr3 was successfully expressed in N. benthamiana using agroinfiltration

(Kruger et al. 2002). In this study, the active tomato subtiliase P69B was also effectively

expressed by agroinfiltration resulting in a functional protein. With the availability of

genome sequence from an increased number of plant species, a large number of plant

proteases have been discovered. For example, the Arabidopsis thaliana genome has over

550 protease sequences representing all five catalytic types: serine, cysteine, aspartic

acid, metallo and threonine (Beers et al. 2004). Plant proteases have been implicated in

important processes from regulating basic plant growth and development to mediating

defense responses against stress and pathogen attack (Beers et al. 2004). The availability

of efficient protease expression systems is critical for characterizing diverse arrays of

biologically important plant proteases.

104

4.6 ACKNOWLEDGEMENT

We are grateful to Dr. Michael Laskowski Jr. and Dr. M. A. Qasim from Purdue

University for predicting the inhibition constants, Brett Benedetti and Diane Kinney for technical assistance. Salaries and research support were provided by State and Federal

Funds appropriated to the Ohio Agricultural Research and Development Center, the Ohio

State University.

4.7 REFERENCES

Andreu, A., Tonón, C., Van Damme, M., Van Damme, M., Huarte, M., Huarte, M., and Daleo, G. 1998. Effect of glucans from different races of Phytophthora infestans on defense reactions in potato tuber. Eur. J. Plant Pathol. 104: 777-783.

Beers, E.P., Jones, A.M., and Dickerman, A.W. 2004. The S8 serine, C1A cysteine and A1 aspartic protease families in Arabidopsis. Phytochemistry 65: 43-58.

Bendtsen, J.D., Nielsen, H., von Heijne, G., and Brunak, S. 2004. Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340: 783-795.

Birch, P.R.J. and Whisson, S. 2001. Phytophthora infestans enters the genomics era. Mol. Plant Pathol. 2: 257-263.

Bromme, D., Nallaseth, F.S., and Turk, B. 2004. Production and activation of recombinant papain-like cysteine proteases. Methods 32: 199-206.

Caten, C.E. and Jinks, J.L. 1968. Spontaneous variability of single isolates of Phytophthora infestans. I. Cultural variation. Can. J. Bot. 46: 329-347. de Wit, P.J.G.M. and Spikman, G. 1982. Evidence for the occurence of race and cultivar- specific elicitors of necrosis in intercellular fluids of compatible interactions of Cladosporium fulvum and tomato. Physiol. Plant Pathol. 21: 1-11.

Jayakumar, A., Kang, Y., Mitsudo, K., Henderson, Y., Frederick, M.J., Wang, M., El- Naggar, A.K., Marx, U.C., Briggs, K., and Clayman, G.L. 2004. Expression of LEKTI domains 6-9' in the baculovirus expression system: recombinant LEKTI domains 6-9' inhibit trypsin and subtilisin A. Protein Expr. Purif. 35: 93-101.

105 Johansson, M.W., Keyser, P., and Soderhall, K. 1994. Purification and cDNA cloning of a four-domain Kazal proteinase inhibitor from crayfish blood cells. Eur. J. Biochem. 223: 389-394.

Jorda, L., Coego, A., Conejero, V., and Vera, P. 1999. A genomic cluster containing four differentially regulated subtilisin-like processing protease genes is in tomato plants. J. Biol. Chem. 274: 2360-2365.

Kamoun, S. 2003. Molecular genetics of pathogenic oomycetes. Eukaryotic Cell 2: 191- 199.

Kamoun, S., van West, P., de Jong, A.J., de Groot, K., Vleeshouwers, V., and Govers, F. 1997. A gene encoding a protein elicitor of Phytophthora infestans is down-regulated during infection of potato. Mol. Plant-Microbe Interact. 10: 13-20.

Kamoun, S., van West, P., Vleeshouwers, V.G., de Groot, K.E., and Govers, F. 1998. Resistance of Nicotiana benthamiana to Phytophthora infestans is mediated by the recognition of the elicitor protein INF1. Plant Cell 10: 1413-1426.

Kamoun, S., Young, M., Glascock, C., and Tyler, B.M. 1993. Extracellular protein elicitors from Phytophthora: Host-specificity and induction of resistance to fungal and bacterial phytopathogens. Mol. Plant-Microbe Interact. 6: 15-25.

Komiyama, T., Bigler, T.L., Yoshida, N., Noda, K., and Laskowski, M., Jr. 1991. Replacement of P1 Leu18 by Glu18 in the reactive site of turkey ovomucoid third domain converts it into a strong inhibitor of Glu-specific Streptomyces griseus proteinase (GluSGP). J. Biol. Chem. 266: 10727-10730.

Kruger, J., Thomas, C.M., Golstein, C., Dixon, M.S., Smoker, M., Tang, S., Mulder, L., and Jones, J.D. 2002. A tomato cysteine protease required for Cf-2-dependent disease resistance and suppression of autonecrosis. Science 296: 744-747.

Laskowski, M., Jr. and Kato, I. 1980. Protein inhibitors of proteinases. Annu. Rev. Biochem. 49: 593-626.

Laskowski, M., Jr., Kato, I., Ardelt, W., Cook, J., Denton, A., Empie, M.W., Kohr, W.J., Park, S.J., Parks, K., Schatzley, B.L., et al. 1987. Ovomucoid third domains from 100 avian species: isolation, sequences, and hypervariability of enzyme-inhibitor contact residues. Biochemistry 26: 202-221.

Lu, S.M., Lu, W., Qasim, M.A., Anderson, S., Apostol, I., Ardelt, W., Bigler, T., Chiang, Y.W., Cook, J., James, M.N., et al. 2001. Predicting the reactivity of proteins from their sequence alone: Kazal family of protein inhibitors of serine proteinases. Proc. Natl. Acad. Sci. U. S. A. 98: 1410-1415.

106 Lu, W., Apostol, I., Qasim, M.A., Warne, N., Wynn, R., Zhang, W.L., Anderson, S., Chiang, Y.W., Ogin, E., Rothberg, I., et al. 1997. Binding of amino acid side-chains to S1 cavities of serine proteinases. J. Mol. Biol. 266: 441-461.

Magert, H.J., Standker, L., Kreutzmann, P., Zucht, H.D., Reinecke, M., Sommerhoff, C.P., Fritz, H., and Forssmann, W.G. 1999. LEKTI, a novel 15-domain type of human serine proteinase inhibitor. J. Biol. Chem. 274: 21499-21502.

Margulis, L. and Schwartz, K.V. 2000. Five Kingdoms: An Illustrated Guide to the Phyla of Life on Earth. W.H. Freeman and Co., New York.

Mende, K., Lange, U., and Nowak, G. 2004. Three recombinant serine proteinase inhibitors expressed from the coding region of the thrombin inhibitor dipetalogastin. Insect Biochem. Mol. Biol. 34: 971-979.

Merril, C.R., Goldman, D., Sedman, S.A., and Ebert, M.H. 1981. Ultrasensitive stain for proteins in polyacrylamide gels shows regional variation in cerebrospinal fluid proteins. Science 211: 1437-1438.

Mitsudo, K., Jayakumar, A., Henderson, Y., Frederick, M.J., Kang, Y., Wang, M., El- Naggar, A.K., and Clayman, G.L. 2003. Inhibition of serine proteinases plasmin, trypsin, subtilisin A, cathepsin G, and elastase by LEKTI: a kinetic analysis. Biochemistry 42: 3874-3881.

Pszenny, V., Angel, S.O., Duschak, V.G., Paulino, M., Ledesma, B., Yabo, M.I., Guarnera, E., Ruiz, A.M., and Bontempi, E.J. 2000. Molecular cloning, sequencing and expression of a serine proteinase inhibitor gene from Toxoplasma gondii. Mol. Biochem. Parasitol. 107: 241-249.

Read, R.J., Fujinaga, M., Sielecki, A.R., and James, M.N. 1983. Structure of the complex of Streptomyces griseus protease B and the third domain of the turkey ovomucoid inhibitor at 1.8-A resolution. Biochemistry 22: 4420-4433.

Ristaino, J.B. 2002. Tracking historic migrations of the Irish potato famine pathogen, Phytophthora infestans. Microbes Infect. 4: 1369-1377.

Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

Sanchez, L.M., Ohno, Y., Miura, Y., Kawakita, K., and Doke, N. 1992. Host selective suppression by water-soluble glucans from Phytophthora spp. of hypersensitive cell death of suspension-cultured cells from some solanaceous plants caused by hyphal wall elicitors of the fungi. Ann. Phytopathol. Soc. Japan 58: 664-670.

Scott, M.J., Huckaby, C.S., Kato, I., Kohr, W.J., Laskowski, M., Jr., Tsai, M.J., and O'Malley, B.W. 1987. Ovoinhibitor introns specify functional domains as in the related and linked ovomucoid gene. J. Biol. Chem. 262: 5899-5907. 107 Shattock, R.C. 2002. Phytophthora infestans: populations, pathogenicity and phenylamides. Pest Manag. Sci. 58: 944-950.

Smart, C.D. and Fry, W.E. 2001. Invasions by the late blight pathogen: renewed sex and enhanced fitness. Biol. Invas. 3: 235-243.

Sogin, M.L., and Silberman, J.D. 1998. Evolution of the protists and protistan parasites from the perspective of molecular systematics. Int. J. Parasitol. 28: 11-20.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25: 4876-4882.

Tian, M., Huitema, E., Da Cunha, L., Torto-Alalibo, T., and Kamoun, S. 2004. A Kazal- like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. J. Biol. Chem. 279: 26370-26377.

Tornero, P., Conejero, V., and Vera, P. 1997. Identification of a new pathogen-induced member of the subtilisin-like processing protease family from plants. J. Biol. Chem. 272: 14412-14419.

Torto, T.A., Li, S., Styer, A., Huitema, E., Testa, A., Gow, N.A., van West, P., and Kamoun, S. 2003. EST mining and functional expression assays identify extracellular effector proteins from the plant pathogen Phytophthora. Genome Res. 13: 1675-1685.

Torto, T.A., Rauser, L., and Kamoun, S. 2002. The pipg1 gene of the oomycete Phytophthora infestans encodes a fungal-like endopolygalacturonase. Curr. Genet. 40: 385-390.

van Loon, L.C. and van Strien, E.A. 1999. The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiological and Molecular Plant Pathology 55: 85-97.

Voinnet, O., Rivas, S., Mestre, P., and Baulcombe, D. 2003. An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J. 33: 949-956.

Win, J. and Kamoun, S. 2004. pCB301-p19: a binary plasmid vector to enhance transient expression of transgenes by agroinfiltration. http://www.Kamounlab.net.

Xia, Y., Suzuki, H., Borevitz, J., Blount, J., Guo, Z., Patel, K., Dixon, R.A., and Lamb, C. 2004. An extracellular aspartic protease functions in Arabidopsis disease resistance signaling. EMBO J. 23: 980-988.

Xiang, C., Han, P., Lutziger, I., Wang, K., and Oliver, D.J. 1999. A mini binary vector series for plant transformation. Plant Mol. Biol. 40: 711-717.

108 Yoshioka, H., Hayakawa, Y., and Doke, N. 1995. Suppression of phenylalanine ammonia-lyase mRNA accumulation by suppressors from Phytophthora infestans. Ann. Phytopathol. Soc. Japan 61: 7-12.

Zhao, Y., Thilmony, R., Bender, C.L., Schaller, A., He, S.Y., and Howe, G.A. 2003. Virulence systems of Pseudomonas syringae pv. tomato promote bacterial speck disease in tomato by targeting the jasmonate signaling pathway. Plant J. 36: 485-499.

109

Figure 4.1. RT-PCR analysis of epi10 in mycelium and during a time course of colonization of tomato by P. infestans. Total RNA isolated from non-infected leaves (To), infected leaves of tomato, 1, 2, 3, or 4 days after inoculation, and from P. infestans mycelium grown in synthetic medium (My) was used in RT-PCR amplifications. Amplifications of P. infestans elongation factor 2 alpha (ef2α) were used as controls to determine the relative expression of epi10.

110

Figure 4.2. EPI10 belongs to the Kazal family of serine protease inhibitors. A, Schematic representation of EPI10 structure. The signal peptide (SP) and three Kazal domains (EPI10a, EPI10b and EPI10c) are shown in gray. Numbers indicate positions of amino acid residues starting from the N terminus. The putative disulfide linkages formed by cysteine residues within the predicted Kazal domains are shown. The positions of the P1 residues D (aspartate) are indicated by arrows. B, Sequence alignment of EPI domains with representative Kazal family inhibitor domains. Protein names correspond to protease inhibitors of Phytophthora infestans EPI1 (EPI1a-b, AY586273), EPI10 (EPI10a-c, AY586282), and the crayfish Pacifastacus leniusculus (PAPI-1a-d, CAA56043), as well as the apicomplexan Toxoplasma gondii (TgPI-1a-d, AF121778). Amino acid residues that define the Kazal family protease inhibitor domain are marked with asterisks. The predicted P1 residues are shown by the arrowhead. The positions of two missing cysteine residues in EPI domains are shown in arrows.

111

Figure 4.3. Affinity purified rEPI10 visualized on SDS-PAGE stained with silver nitrate. M, protein standard with the numbers on the left representing the molecular masses.

112

Figure 4.4. rEPI10 inhibits subtilisin A. Protease activities of chymotrypsin, subtilisin A, and trypsin in the absence (gray column) or presence of rEPI10 (black column) were determined using the QuantiCleaveTM Protease Assay Kit as described in the methods. Activity is expressed as a percentage of total protease activity in the absence of protease inhibitors. The bars correspond to the mean of three independent replications of one representative experiment out of three performed. The error bars represent the standard errors calculated from the three replications.

113

Figure 4.5. Coimmunoprecipitation of rEPI10 and P69 subtilases using FLAG antisera. Eluates from coimmunoprecipitation of rEPI10 with proteins in tomato intercellular fluids were run on SDS-PAGE gel followed by immunobloting sequentially with P69 antibody (α -P69) and FLAG antibody (α -FLAG). The bands immunobloted with each antibody are indicated by arrows. Lane M was loaded with protein standard and the numbers on the left indicate the molecular masses. Lane C was loaded with rEPI10 only. Other lanes were loaded with eluates from coimmunoprecipitation. rEPI10 indicates whether or not rEPI10 was added to the reaction mix. BTH indicated whether or not the intercellular fluids were obtained from plants treated with BTH.

114

Figure 4.6. Transient expression of P69B subtilase in Nicotiana benthamiana. Intercellular fluids were isolated from N. benthamiana leaves infiltrated with A. tumefaciens containing the binary vector pCB302-3 (-) or pCB-P69B (+). A. tumefaciens containing pCB301-P19 was always coinfiltrated in order to enhance protein expression. Intercellular fluids were applied for Western blot with HA antisera (A) and in-gel protease assay (B). The band corresponding to the protease activity of P69B is indicated by an arrow.

115

Figure 4.7. EPI10 inhibits P69B subtilase. Intercellular fluids from N. benthamiana leaves coinfiltrated with A. tumefaciens containing pCB-P69B and A. tumefaciens containing pCB301-P19 were incubated in the absence (-) or presence of rEPI10 (+) and the remaining protease activity was analyzed using zymogen in-gel protease assays. The arrow indicates the band location corresponding to the protease activity of P69B.

116 CHAPTER 5

AN ATYPICAL TWO DISULFIDE BRIDGE KAZAL DOMAIN FROM

PHYTOPHTHORA EXHIBITS STABLE INHIBITORY ACTIVITY AGAINST

SERINE PROTEASES OF THE SUBTILISIN FAMILY

5.1 ABSTRACT

Kazal-like serine protease inhibitors are defined by the conserved motif in their amino acid sequence. A typical Kazal domain contains six cysteine residues leading to 3 disulfide bonds with 1-5/2-4/3-6 pattern. Most of Kazal domains found so far belong to this type. However, a novel type of Kazal domains with 2 disulfide bridges resulting from the missing of the third and sixth cysteine residues have been found in biologically important molecules and are referred here as atypical Kazal domains. Atypical Kazal domains are ubiquitous in plant pathogenic oomycetes. Previously, A Kazal-like extracellular protease inhibitor from oomycete plant pathogen Phytophthora infestans,

EPI1, was characterized to be a tight-binding inhibitor of subtilisin A and target pathogenesis-related P69B subtilase of the host plant tomato, suggesting a novel virulence mechanism. EPI1 is composed of two Kazal domains, atypical domain EPI1a and typical domain EPI1b. We predicted the inhibition constants of EPI1a and EPI1b to

117 subtilisin A using the additivity-based sequence to reactivity algorithm. The atypical domain EPI1a was predicted to have strong inhibitory activity against subtilisin A, but not the typical domain EPI1b. Inhibition assays and coimmunoprecipitation experiments showed that recombinant atypical Kazal domain EPI1a exhibited stable inhibitory activity against subilisin A and solely responsible for the inhibition and interaction with tomato

P69B subtilase, providing evidence that the missing two cysteine residues and the corresponding disulfide bond from typical Kazal domains might not be essential for inhibitor reactivity and stability. This report also suggests that the additivity-based sequence to reactivity algorithm originally developed and validated with typical Kazal domains might operate accurately for atypical Kazal domains.

5.2 INTRODUCTION

Serine protease inhibitors of the Kazal family are widely spread in animals, apicomplexans and oomycetes. They are thought to play important roles in maintenance of normal cellular and physiological processes of animals (Magert et al. 2002;

Kreutzmann et al. 2004), and pathogenesis of mammalian parasitic apicomplexans and plant pathogenic oomycetes (Pszenny et al. 2000; Pszenny et al. 2002; Morris et al. 2004;

Tian et al. 2004). Kazal-like serine protease inhibitors are defined by a conserved motif in their amino acid sequences. Typical Kazal domains contain six cysteine residues forming a 1-5/2-4/3-6 disulfide bond pattern (Laskowski and Kato 1980; Kreutzmann et al. 2004).

118 Most Kazal domains described so far belong to this type. However, a novel type of Kazal

domains has been described in recent years, in which the third and sixth cysteine residues

are missing resulting in the loss of the 3-6 disulfide bond (Magert et al. 1999;

Kreutzmann et al. 2004; Tian et al. 2004). These two disulfide bridge domains are

referred here as atypical Kazal domains.

Atypical Kazal domains were first reported in the human serine proteinase

inhibitor LEKTI, a 15-domain inhibitor associated with the severe congenital disease

Netherton syndrome (Magert et al. 1999; Magert et al. 2002). Domain 2 and 15 of LEKTI

are typical Kazal domains with complete 6 cysteine residues, whereas the remaining 13

domains represent atypical two disulfide bridge Kazal domains (Magert et al. 1999;

Jayakumar et al. 2004; Kreutzmann et al. 2004). The functionality of some atypical Kazal

domains from LEKTI has been examined. Domain 1 of LEKTI does not inhibit any of the

standard proteases (Lauber et al. 2003). Domain 6 exhibits significant inhibitory activity on trypsin, but this inhibition is only temporary (Magert et al. 1999; Lauber et al. 2003;

Kreutzmann et al. 2004). A recombinant protein containing four atypical domains of

LEKTI (domain 6, 7, 8 and 9) inhibits both trypsin and subtilisin A permanently

(Jayakumar et al. 2004), indicating that atypical Kazal domains can be effective inhibitors. However, it is unclear whether a single atypical domain can be a stable inhibitor. Multi-domain interactions could be responsible for the stable inhibitory activity observed for the recombinant protein (Jayakumar et al. 2004). Additional structural and functional studies on atypical Kazal domains are needed to understand the impact of the disulfide bridges on inhibitor activity and stability.

119 Thanks to exhaustive biochemical studies of the third domain of turkey ovomucoid protein, much is known about the relationship between domain sequence and inhibition specificity in Kazal inhibitor-serine protease interactions. This work culminated in the development of an additivity-based sequence to reactivity algorithm that predicts the inhibition constants (Ki) between Kazal domains and a set of six serine proteases based solely on the sequence of the inhibitors (Lu et al. 2001; Laskowski et al.

2003). Structural studies of Kazal domain-protease complexes revealed that there are 12 contact positions (P6, P5, P4, P3, P2, P1, P1’, P2’, P3’, P14’, P15’ and P18’) responsible for interactions between Kazal domains and their cognate serine proteases (Read et al.

1983; Laskowski et al. 1987; Lu et al. 1997; Lu et al. 2001). Changes in noncontact residues often do not affect equilibrium constants (Ka, the reciprocal of Ki), whereas changes in contact residues result in significant alterations of Ka (Lu et al. 2001). Among the 12 contact residues, P3, the second conserved cysteine residue, and P15’, a conserved asparagine, show little variation in different naturally occurring Kazal domains, but the remaining ten contact residues are hypervariable (Lu et al. 2001). Therefore, the algorithm of Lu et al. (2001) was established based on the residues at the 10 contact positions and allows for the calculation of Ka or Ki of a Kazal domain against a selected set of six serine proteases based on the domain sequence alone (Lu et al. 2001;

Laskowski et al. 2003; Qasim et al. 2003). This algorithm was developed based on 191 variants of turkey ovomucoid third domain (19 amino acid mutants in the ten contact residues plus the wild type) and was validated with a number of typical Kazal domains

(Lu et al. 2001; Laskowski et al. 2003; Qasim et al. 2003). Theoretically, the algorithm could be applicable to atypical two disulfide bridge Kazal domains since the missing

120 cysteine residues are different from the hypervariable contact residues. However, the

accuracy of the algorithm in predicting the reactivity of atypical Kazal domains has not been tested (M. Laskowski, Jr., pers. comm.).

The oomycetes form a diverse group of fungus-like organisms that are distantly related to fungi but closely related to brown algae and diatoms in the Stramenopiles (or heterokonts), one of several major eukaryotic Kingdoms (Sogin 1998; Baldauf et al.

2000; Margulis and Schwartz 2000). Oomycetes include many devastating plant pathogens (Kamoun 2003). Among them, Phytophthora infestans was responsible for the

Irish potato famine in the nineteenth century and remains a destructive pathogen of potato

and tomato (Birch and Whisson 2001; Smart and Fry 2001; Ristaino 2002). The Kazal-

like inhibitors are ubiquitous in plant pathogenic oomycetes (Tian et al. 2004). A total of

35 putative extracellular proteins with 56 predicted Kazal-like domains were identified

from five plant pathogenic oomycete species (Tian et al. 2004). Among them, the P.

infestans Kazal inhibitors EPI1 and EPI10 inhibit and interact with the pathogenesis-

related P69B subtilisin-like serine protease of the host plant tomato, suggesting an

important virulence mechanism (Tian et al. 2004)(Chapter 4). Both EPI1 and EPI10

contain an atypical two disulfide bridge Kazal domain (Tian et al. 2004)(Chapter 4).

Atypical domains are common in Kazal-like inhibitors of plant pathogenic oomycetes. A

total of 14 domains among the 56 oomycete domains belong to this type (Chapter 3).

These 14 domains are distributed in 14 different proteins from three Phytophthora

species, P. infestans, P. ramorum and P. sojae, some of which have multiple domains.

Remarkably, phylogenetic analysis of the 56 domains revealed that the 14 atypical

domains form a significantly distinct cluster, suggesting that the loss of one disulfide

121 bridge in Phytophthora Kazal-like domains predates speciation. Characterizing the atypical Kazal domains would help to understand the biochemical and biological functions of these inhibitors.

P. infestans EPI1 was chosen as an ideal candidate to characterize the atypical

Kazal domain. EPI1 was identified as a tight-binding inhibitor of subtilisin A and inhibits and interacts with P69B subtilisin-like serine protease (Tian et al. 2004). EPI1 is composed of two putative Kazal domains, with the first domain atypical with two disulfide bridges (Tian et al. 2004). A region encompassing 46 amino acids and ranging between the first and the sixth cysteine residues of the second domain is defined as domain EPI1b. A region of the same length starting from the first cysteine residue of the first domain is defined as domain EPI1a. The predicted 12 contact residues of both domains follow the Kazal consensus, with P3 and P15’ conserved cysteines and asparagines, respectively, and the remaining 10 contact residues variable relative to other

Kazal domains. In this study, we predicted the inhibition constants of EPI1a and EPI1b to subtilisin A using the additivity-based sequence to reactivity algorithm (Lu et al. 2001).

The atypical domain EPI1a, but not the typical domain EPI1b, was predicted to be a strong inhibitor of subtilisin A. A recombinant EPI1a exhibited stable inhibitory activity against subilisin A and appeared solely responsible for inhibition and interaction with tomato P69B subtilase, providing evidence that the missing two cysteine residues and the corresponding disulfide bond might not be essential for inhibitor reactivity and stability.

This report also suggests that the additivity-based sequence to reactivity algorithm originally developed and validated with typical Kazal domains might operate accurately for atypical domains.

122

5.3 MATERIALS AND METHODS

Prediction of inhibition constants

The ten putative contact residues of EPI1a and EPI1b were identified based on similarity to canonical animal Kazal domains (Read et al. 1983; Laskowski et al. 1987;

Lu et al. 1997) and are shown in Figure 5.1. Predicted inhibition constants for the EPI1 domains against subtilisin A (Carlsberg) were generated by Drs. Qasim and Laskowski,

Purdue University, with the additivity-based sequence to reactivity algorithm (Lu et al.

2001).

Expression and purification of rEPI1a and rEPI1b

Plasmids pFLAG-EPI1a and pFLAG-EPI1b for protein expression were constructed by cloning the PCR amplified DNA fragments corresponding to the coding sequence of Kazal domains EPI1a and EPI1b together with some flanking sequence into

EcoRI and KpnI sites of pFLAG-ATS (Sigma, St. Louis, MO), a vector that allows secreted expression in Escherichia coli. The primers used for amplification of epi1a are epi1a-F1(5’-gcggaattcTCAAAGCCCGCAAGTCATCAG-3’) and epi1a-R1(5’-gcgggtacc

TTACTTGCTGGGAGGCTGCTCGCCAG-3’). The primers used for amplification of epi1b are epi1b-F1(5’-gcggaattcCACCGGTAGCTCCACTGGCGAGCAGC-3’) and epi1b-R1(5’-gcgggtaccTTATCCCTCCTGCGGTGTC-3’). The introduced EcoRI and

KpnI restriction sites for cloning are underlined. The letters in upper case represent gene specific sequence. The detailed sequence information for the expressed fusion proteins

FLAG-EPI1a (rEPI1a) and FLAG-EPI1b (rEPI1b) is shown in Figure 5.2A.

123 Escherichia coli XL1-Blue was used for protein expression and routinely grown in Luria-Bertani (LB) media (Sambrook et al. 1989). Expression and purification of rEPI1a and rEPI1b was conducted as described previously (Kamoun et al. 1997; Tian et al. 2004). Protein concentrations were determined using the BioRad protein assay kit

(BioRad Laboratories, Hercules, CA). 0.5 µg of the purified protein was run on a SDS-

PAGE gel followed by staining with silver nitrate to determine the purity.

SDS-PAGE and Western blot analyses

Proteins were subjected to 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) as previously described (Sambrook et al. 1989). Following electrophoresis, gels were stained with silver nitrate following the method of Merril et al.

(1981) or stained with Coomassie Brilliant Blue (Sambrook et al. 1989), or the proteins were transferred to supported nitrocellulose membranes (BioRad Laboratories, Hercules,

CA) using a Mini Trans-Blot apparatus (BioRad Laboratories, Hercules, CA). Detection of antigen-antibody complexes was carried out with a Western blot alkaline phosphatase kit (BioRad Laboratories, Hercules, CA). Antisera to P69 subtilases were raised against a peptide specific for the tomato P69 family (Tian et al. 2004). Monoclonal anti-FLAG M2 antibody was purchased from Sigma (St. Louis, MO).

Transient expression of P69B subtilase in Nicotiana Benthamiana

Transient expression of P69B fused with HA epitope tag at the C-terminus using the plasmid pCB-P69B was performed exactly as described in Chapter 4. Plasmid pCB-

P69B is a construct with P69B-HA encoding sequence in a binary vector pCB302-3 and was described in Chapter 4. Intercellular fluids were prepared from infiltrated leaves

124 according to the method of de Wit and Spikman (1982) using the extraction solution

containing 300 mM NaCl, 50 mM NaPO4 pH 7 (Kruger et al. 2002). The intercellular fluids were filter sterilized (0.45 µM), and were used immediately or stored at –20°C.

Preparation of BTH-treated tomato intercellular fluids

Tomato (Lycopersicon esculentum) cultivar Ohio 7814 was used and grown in pots at 25°C, 60% humidity, under 16 hour-light/8 hour-dark cycle. BTH treatment and isolation of intercellular fluids from tomato followed the exact same procedure described elsewhere (Tian et al. 2004).

In-gel protease assay

In-gel protease assays were performed using BIO-RAD’s zymogram buffer

system as described earlier (Tian et al. 2004).

Inhibition assays of subtilisin A by EPI1 Kazal domains

Inhibition assays of subtilisin A by EPI1 Kazal domains were performed using colorimetric QuantiCleaveTM Protease Assay Kit (Pierce, Rockford, IL). 0.2 µM of subtilisin A (Carlsberg) (Sigma, St. Luis, MO) was preincubated with different amount of purified EPI1 Kazal domains, in a volume of 50 µl buffer for 30 min at 25°C, and then the remaining protease activity was measured following the procedures as described previously (Tian et al. 2004). Analysis of the stable inhibitory activity of rEPI1a against subtilisin A was performed by incubating 0.2 µM of subtilisin A with 0.15 µM of rEPI1a in 50 µl buffer (50mM Tris, pH 8.0) for a time period of 0-180 min at 25°C and then measuring residue enzyme activity.

125 Coimmunoprecipitation

Coimmunoprecipitation of Kazal domains rEPI1a and rEPI1b with BTH-treated tomato intercellular fluids was performed using the FLAG-tagged protein immunoprecipitation kit (Sigma, St. Luis, MO) as described previously (Tian et al. 2004).

100 pmol of purified rEPI1a or rEPI1b were preincubated with 300 µl of tomato intercellular fluids for 30 min at 25°C. 40 µl of anti-FLAG M2 resin was added and incubated at 4°C for 2 h with gentle shaking. The precipitated protein complexes were eluted in 60 µl of FLAG peptide solution (150 ng/µl) and were analyzed by SDS-PAGE and Western blot analyses.

5.4 RESULTS

The atypical Kazal domain of EPI1 was predicted to be a functional inhibitor of subtilisin A

The inhibition constants of the two domains of EPI1 to subtilisin A were predicted using the additivity-based sequence to reactivity algorithm developed by Lu et al. (2001) based on the sequence of their 10 contact residues (Figure 5.1). Interestingly, the atypical

Kazal domain EPI1a was predicted to be a strong inhibitor of subtilisin A with a Ki of 4.3 nM, a value that is remarkably similar to the experimentally determined Ki of 2.77 +/-

1.07 nM for the entire EPI1 protein against subtilisin A (Tian et al. 2004). In contrast, the typical Kazal domain EPI1b, which contains the complete set of six cysteine residues, may not be functional against subtilisin A since the predicted Ki was high at 50 mM.

Therefore, these analyses predicted that the atypical domain EPI1a is solely responsible for the inhibition of subtilisin A. 126

Expression and purification of the two Kazal domains of EPI1

To test the protease inhibitory activities of EPI1a and EPI1b, the two Kazal domains of EPI1, and assess the predictions of the sequence to reactivity algorithm, we expressed and purified the two recombinant domains in E. coli as fusion proteins with the

FLAG epitope tag at amino-terminus. The sequences of the recombinant proteins are shown in Figure 5.2A. The predicted molecular mass for FLAG-EPI1a (rEPI1a) and

FLAG-EPI1b (rEPI1b) was 10181 Da and 8996 Da, respectively. To determine the purity of the purified recombinant proteins, we ran 0.5 µg of purified rEPI1a and rEPI1b on

SDS-PAGE gel and stained with silver nitrate. Bands of the expected sizes were observed for both proteins. There was only a single band for rEPI1b, indicating high purity (Figure

5.2B). The rEPI1a revealed two closely-migrated bands (Figure 5.2B). The two bands reacted to the FLAG antibody and are likely to represent rEPI1a with and without the signal peptide OMPA, which is located immediately before the FLAG peptide in the vector pFLAG-ATS and is responsible for secreted expression in E. coli. Similar release of the mature protein was commonly observed with other proteins expressed using pFLAG-ATS (M. Tian and S. Kamoun, unpublished). We also stained the gel loaded with purified rEPI1a protein with Coomassie blue. Compared with the band corresponding to the rEPI1a without OMPA, the slower-migrated band was much weaker

(Data not shown), indicating the secreted version of rEPI1a was the major component of the purified rEPI1a protein solution. Besides these two bands, no other proteins were detected by silver staining suggesting that the rEPI1a preparation was highly pure.

127 The atypical Kazal domain EPI1a inhibits the serine protease subtilisin A

We performed inhibition assays of subtilisin A by incubating 0.2 µM of subtilisin

A with 0.2 µM of rEPI1a, rEPI1b or buffer control in a volume of 50 µl. The remaining

protease activity was measured using the QuantiCleaveTM Protease Assay Kit as described in methods. In repeated assays, rEPI1a was found to inhibit about 91% of the measured activity of subtilisin A, whereas rEPI1b did not display any significant

inhibition (Figure 5.3). These results are consistent with the prediction of the additivity-

based sequence to reactivity algorithm (Figure 5.1).

EPI1a inhibits the tomato pathogenesis-related P69B subtilase

EPI1 inhibits and interacts with the pathogenesis-related P69B subtilase of tomato

(Tian et al. 2004). To test which of the two domains of EPI1 inhibits P69B, we first used

agroinfiltration to transiently express P69B fused with the epitope tag HA at the C-

terminus in Nicotiana benthamiana leaves. Intercellular fluids were collected from leaves infiltrated with either A. tumefaciens containing pCB302-P69B, or A. tumecaciens containing the empty binary vector pCB302-3. 10 µl of intercellular fluids from the two treatments were used in in-gel protease assays. A distinct additional protease band was observed in the P69B-expressing sample but not in the control suggesting that P69B-HA is functional (Figure 5.4A). 10 µl of P69B-expressing N. bethamiana intercellular fluids were incubated with 20 pmol of the EPI1 recombinant protein rEPI1 (Tian et al. 2004), rEPI1a, rEPI1b, or buffer and the remaining protease activity was detected by in-gel protease assay. rEPI1a, containing the atypical Kazal domain, completely inhibited the

P69B band similar to rEPI1. rEPI1 and rEPI1a also inhibited the activity of two other 128 extracellular proteases from N. benthamiana (Figure 5.4B). The identity of these N. benthamiana proteases is unknown but they could also be subtilisin-like serine proteases, such as homologs of tomato P69. In these experiments, rEPI1b did not exhibit any inhibition towards P69B or other protease bands.

EPI1a interacts with tomato P69

We previously showed that rEPI1 interacts with P69B (Tian et al. 2004). Here, we

tested whether the atypical Kazal domain EPI1a interacts with P69B subtilase by

coimmunoprecipitation. Coimmunoprecipitation was performed on BTH-induced tomato

intercellular fluids incubated with rEPI1a, rEPI1b or buffer control using FLAG antibody

covalently linked agarose beads. Western blots were performed sequentially with P69 and

FLAG antisera and revealed that P69 subtilases co-precipitated with rEPI1a (Figure 5.5).

This indicates that rEPI1a interacts with P69 subtilases. Since P69 family of subtilases

have at least 6 homologs (P69A-P69F) (Jorda et al. 1999; Jorda et al. 2000) and the

peptide used to generate P69 antisera is conserved among several homologs (Tian et al.

2004), we can not conclude P69B subtilase is the protein pulled down together with

rEPI1a only based on the Western blot analysis with P69 antisera. However, when we

used the lower percentage of SDS-PAGE for the Western blot, the bands reacted with

P69 antisera actually contain two closely-migrated bands with molecular mass of ~70kDa

and this pattern was exactly same as when we used the entire EPI1 protein to do the

coimmunoprecipitation (Tian et al. 2004). Previous experiment with tandem mass

spectrometry identified P69B as the main target of the entire EPI1 protein from the two

closely-migrated protein bands (Tian et al. 2004). Given that rEPI1a is solely responsible

129 for inhibition of subtilisin A and P69B subtilase in a similar way to the entire EPI1, it is

likely that P69B is the main target of rEPI1a. rEPI1b could not be detected after the

coimmunoprecipitation procedure with BTH-induced tomato intercellular fluids (Figure

5.5), whereas it was able to be detected after the same coimmunoprecipitation procedure

with the extraction buffer of tomato intercellular fluids (data not shown), suggesting that rEPI1b is not stable in BTH-induced tomato intercellular fluids.

EPI1a exhibits stable inhibitory activity

So far, there is no report of single atypical Kazal domain that function as a stable protease inhibitor. Domain 6 (LD-6) of LEKT1 is a temporary trypsin inhibitor (Magert et al. 1999; Lauber et al. 2003; Kreutzmann et al. 2004). To determine whether EPI1a is a temporary or stable inhibitor of subtilisin, we performed stability analyses by incubating subtilisin A with or without rEPI1a for increasing periods of time and measuring the remaining protease activity. To determine the optimal concentration of

EPI1a for the stability analyses, we first performed inhibition assays with varying concentrations of EPI1a (Figure 5.6A). The concentration of 0.15 µM of EPI1a resulted in inhibition levels of about 80% of the measured protease activity and was selected for the stability analysis. This concentration is within the linear part of the curve (Figure

5.6A), suggesting that hydrolysis of rEPI1a could be easily detected as a decrease in inhibitory activity. The inhibitory activity of rEPI1a did not show any decrease over 3 hours of incubation with subtilisin A (Figure 5.6B), indicating that EPI1a is a stable inhibitor of subtilisin A. These results are in sharp contrast with those reported for

130 domain LD-6 of LEKTI, which lost 50% of inhibitory activity after 1 hour of incubation

with trypsin and lost all inhibitory effect after 3-4 hours (Kreutzmann et al. 2004).

5.5 DISCUSSION

Two disulfide bridge atypical Kazal domains occur in biologically important molecules. The 15-domain human serine protease inhibitor LEKTI that carries 13 atypical Kazal domains is associated with the severe congenital disorder Netherton syndrome (Magert et al. 2002). P. infestans Kazal-like inhibitors EPI1 and EPI10 contain an atypical Kazal domain and account for an important virulence mechanism of this devastating plant pathogen (Tian et al. 2004)(Chapter 4). Although the structure and function of atypical Kazal domains from LEKTI have been studied, the effects of the loss of Cys3, Cys6 and the corresponding disulfide bond on inhibitor reactivity and stability can not be assessed since there is no evidence showing that a single atypical Kazal domain can be a stable inhibitor by itself (Lauber et al. 2003; Jayakumar et al. 2004;

Kreutzmann et al. 2004). In this study, we describe that the atypical domain EPI1a of the two-domain EPI1 protein is a stable inhibitor of the subtilisin family of serine proteases.

No loss of inhibitory activity was found even after incubating EPI1a with subtilisin A for

3 hours. The loss of Cys 3, Cys 6 and the corresponding disulfide bond does not have major adverse effects on inhibitory activity or stability, indicating that these two cysteine residues might not be essential for the function of Kazal domains. This finding is important for determining the biochemical and biological functions of Kazal inhibitors containing atypical Kazal domain(s). Kazal-like proteins have been reported from animals, apicomplexans, oomycetes, as well as the bacterium Nitrosomonas europaea

131 (Tian et al. 2004). An increasing number of atypical Kazal inhibitors might be found with

the availability of genomic sequence from these and other organisms. For example, so

far, a total of 14 atypical Kazal domains have been identified in plant pathogenic

oomycetes (Chapter 3).

The structural mechanism underlying the stability of EPI1a is not clear. The three- dimensional structure of the atypical domain 6 (LD6) of LEKTI was determined. The overall structure of LD6 resembles the three-dimensional fold of typical Kazal-type inhibitors, but the backbone geometry of its canonical loop is not well defined, providing a possible explanation for its temporary inhibitory activity (Lauber et al. 2003). There are

13 residues between the first cysteine residue (Cys 1) and the second one (Cys 2) for

LD6, instead of 6-9 for most typical Kazal domains (Lauber et al. 2003). The lack of one disulfide bond and the longer sequence stretch between the first two cysteines were proposed to be the factors responsible for the instability of LD6 (Lauber et al. 2003).

Indeed, the longer sequence stretch between the first two cysteines could explain the difference between EPI1a and LD6. There are only 3 residues between Cys 1 and Cys 2 of EPI1a, which is shorter than in most Kazal domains. The longer sequence stretch of

LD6 might lead to the abnormal canonical loop and the non-permanent inhibitory activity. Future work to determine the three-dimensional structure of EPI1a and compare it with LD6 of LEKTI and other Kazal domains should help to unravel the structural mechanism underlying the functionality of atypical Kazal domains.

The additivity-based sequence to reactivity algorithm was developed and validated based on typical Kazal domains (Lu et al. 2001; Laskowski et al. 2003). The algorithm exploits an exhaustive analysis of all amino acid variants in the ten

132 hypervariable contact residues of turkey ovomucoid third domain, a typical Kazal

domain. The accuracy of the algorithm in predicting the reactivity of atypical Kazal

domains has not been evaluated (M. Laskowski Jr., pers. comm.). Here we found that the

algorithm correctly predicted which of the two EPI domains is likely to inhibit subtilisins.

Our experimental data showed that the atypical Kazal domain EPI1a inhibited subtilisin

A, and inhibited and interacted with P69 subtilase similar to the entire EPI1 protein (Tian et al. 2004). Also, using the algorithm, the atypical Kazal domain EPI1a was predicted to be a strong inhibitor of subtilisin A with a predicted Ki of 4.3 nM, which was in very good agreement with the experimentally determined Ki of 2.77+/-1.07nM (Tian et al.

2004). As expected from the predicted Ki of 50 mM, the typical EPI1b domain was not an effective inhibitor of subtilisin A. In summary, it appears that the additivity-based sequence to reactivity algorithm operates accurately for atypical Kazal domains such as

EPI1a. Perhaps, this is expected since the Cys 3 and Cys 6 residues of typical Kazal domains are not contact positions. Nonetheless, our observations and the concordance between predicted and experimental data suggest that gross structural changes that could result from the loss of one disulfide bridge in atypical Kazal domains may not affect the specificity of the interactions between Kazal domains and their cognate serine proteases.

Atypical Kazal domains are ubiquitous in Kazal-like inhibitors of plant

pathogenic oomycetes (Chapter 3). 14 of total 56 Kazal-like domains identified from five

plant pathogenic oomycetes were predicted to belong to the atypical type. These 14 domains are scattered in 14 different proteins from three Phytophthora species, P.

infestans, P. ramorum and P. sojae. Remarkably, the phylogenetic analysis with all 56

Kazal domains revealed that all of these 14 atypical domains form a significant cluster,

133 suggesting that the loss of one disulfide bridge in Phytophthora Kazal-like domains occurred prior to speciation in Phytophthora. So far, we identified two Kazal-like inhibitors EPI1 and EPI10 from P. infestans targeting the defense-related protease P69B of the host plant tomato. The atypical Kazal domain of EPI1 is solely functional in inhibiting and interacting with P69B. The second domain of the three-domain inhibitor

EPI10 is also an atypical domain and was predicted to be functional against subtilisin A

(Chapter 4). All the above facts raise some interesting questions. What is the significance of the loss of one disulfide bridge? Is there any advantage of the two-disulfide bridge

Kazal domain over the three-disulfide bridge domain in counteracting with host proteases? More functional and structural studies are needed before getting those answers.

5.6 ACKNOWLEDGMENTS

We are grateful to Dr. Michael Laskowski Jr. and Dr. M. A. Qasim from Purdue

University for predicting the inhibition constants, and Diane Kinney for technical assistance. Salaries and research support were provided by State and Federal Funds appropriated to the Ohio Agricultural Research and Development Center, the Ohio State

University.

5.7 REFERENCES

Baldauf, S.L., Roger, A.J., Wenk-Siefert, I., and Doolittle, W.F. 2000. A kingdom-level phylogeny of eukaryotes based on combined protein data. Science 290: 972-977.

Birch, P.R.J. and Whisson, S. 2001. Phytophthora infestans enters the genomics era. Mol. Plant Pathol. 2: 257-263.

134 de Wit, P.J.G.M. and Spikman, G. 1982. Evidence for the occurence of race and cultivar- specific elicitors of necrosis in intercellular fluids of compatible interactions of Cladosporium fulvum and tomato. Physiol. Plant Pathol. 21: 1-11.

Jayakumar, A., Kang, Y., Mitsudo, K., Henderson, Y., Frederick, M.J., Wang, M., El- Naggar, A.K., Marx, U.C., Briggs, K., and Clayman, G.L. 2004. Expression of LEKTI domains 6-9' in the baculovirus expression system: recombinant LEKTI domains 6-9' inhibit trypsin and subtilisin A. Protein Expr. Purif. 35: 93-101.

Jorda, L., Coego, A., Conejero, V., and Vera, P. 1999. A genomic cluster containing four differentially regulated subtilisin-like processing protease genes is in tomato plants. J. Biol. Chem. 274: 2360-2365.

Jorda, L., Conejero, V., and Vera, P. 2000. Characterization of P69E and P69F, two differentially regulated genes encoding new members of the subtilisin-like proteinase family from tomato plants. Plant Physiol. 122: 67-73.

Kamoun, S. 2003. Molecular genetics of pathogenic oomycetes. Eukaryotic Cell 2: 191- 199.

Kamoun, S., van West, P., de Jong, A.J., de Groot, K., Vleeshouwers, V., and Govers, F. 1997. A gene encoding a protein elicitor of Phytophthora infestans is down-regulated during infection of potato. Mol. Plant-Microbe Interact. 10: 13-20.

Kreutzmann, P., Schulz, A., Standker, L., Forssmann, W.G., and Magert, H.J. 2004. Recombinant production, purification and biochemical characterization of domain 6 of LEKTI: a temporary Kazal-type-related serine proteinase inhibitor. J. Chromatogr. B. Analyt. Technol. Biomed. Life Sci. 803: 75-81

Kruger, J., Thomas, C.M., Golstein, C., Dixon, M.S., Smoker, M., Tang, S., Mulder, L., and Jones, J.D. 2002. A tomato cysteine protease required for Cf-2-dependent disease resistance and suppression of autonecrosis. Science 296: 744-747.

Laskowski, M., Jr. and Kato, I. 1980. Protein inhibitors of proteinases. Annu. Rev. Biochem. 49: 593-626.

Laskowski, M., Jr., Kato, I., Ardelt, W., Cook, J., Denton, A., Empie, M.W., Kohr, W.J., Park, S.J., Parks, K., Schatzley, B.L., et al. 1987. Ovomucoid third domains from 100 avian species: isolation, sequences, and hypervariability of enzyme-inhibitor contact residues. Biochemistry 26: 202-221.

Laskowski, M., Jr., Qasim, M.A., and Yi, Z. 2003. Additivity-based prediction of equilibrium constants for some protein-protein associations. Curr. Opin. Struct. Biol. 13: 130-139.

135 Lauber, T., Schulz, A., Schweimer, K., Adermann, K., and Marx, U.C. 2003. Homologous proteins with different folds: the three-dimensional structures of domains 1 and 6 of the multiple Kazal-type inhibitor LEKTI. J. Mol. Biol. 328: 205-219.

Lu, S.M., Lu, W., Qasim, M.A., Anderson, S., Apostol, I., Ardelt, W., Bigler, T., Chiang, Y.W., Cook, J., James, M.N., et al. 2001. Predicting the reactivity of proteins from their sequence alone: Kazal family of protein inhibitors of serine proteinases. Proc. Natl. Acad. Sci. U. S. A. 98: 1410-1415.

Lu, W., Apostol, I., Qasim, M.A., Warne, N., Wynn, R., Zhang, W.L., Anderson, S., Chiang, Y.W., Ogin, E., Rothberg, I., et al. 1997. Binding of amino acid side-chains to S1 cavities of serine proteinases. J. Mol. Biol. 266: 441-461.

Magert, H.J., Kreutzmann, P., Standker, L., Walden, M., Drogemuller, K., and Forssmann, W.G. 2002. LEKTI: a multidomain serine proteinase inhibitor with pathophysiological relevance. Int. J. Biochem. Cell Biol. 34: 573-576.

Magert, H.J., Standker, L., Kreutzmann, P., Zucht, H.D., Reinecke, M., Sommerhoff, C.P., Fritz, H., and Forssmann, W.G. 1999. LEKTI, a novel 15-domain type of human serine proteinase inhibitor. J. Biol. Chem. 274: 21499-21502.

Margulis, L. and Schwartz, K.V. 2000. Five Kingdoms: An Illustrated Guide to the Phyla of Life on Earth. W.H. Freeman and Co., New York.

Merril, C.R., Goldman, D., Sedman, S.A., and Ebert, M.H. 1981. Ultrasensitive stain for proteins in polyacrylamide gels shows regional variation in cerebrospinal fluid proteins. Science 211: 1437-1438.

Morris, M.T., Cheng, W.C., Zhou, X.W., Brydges, S.D., and Carruthers, V.B. 2004. Neospora caninum expresses an unusual single-domain Kazal protease inhibitor that is discharged into the parasitophorous vacuole. Int. J. Parasitol. 34: 693-701.

Pszenny, V., Angel, S.O., Duschak, V.G., Paulino, M., Ledesma, B., Yabo, M.I., Guarnera, E., Ruiz, A.M., and Bontempi, E.J. 2000. Molecular cloning, sequencing and expression of a serine proteinase inhibitor gene from Toxoplasma gondii. Mol. Biochem. Parasitol. 107: 241-249.

Pszenny, V., Ledesma, B.E., Matrajt, M., Duschak, V.G., Bontempi, E.J., Dubremetz, J.F., and Angel, S.O. 2002. Subcellular localization and post-secretory targeting of TgPI, a serine proteinase inhibitor from Toxoplasma gondii. Mol. Biochem. Parasitol. 121: 283-286.

Qasim, M.A., Lu, W., Lu, S.M., Ranjbar, M., Yi, Z., Chiang, Y.W., Ryan, K., Anderson, S., Zhang, W., Qasim, S., et al. 2003. Testing of the additivity-based protein sequence to reactivity algorithm. Biochemistry 42: 6460-6466.

136 Read, R.J., Fujinaga, M., Sielecki, A.R., and James, M.N. 1983. Structure of the complex of Streptomyces griseus protease B and the third domain of the turkey ovomucoid inhibitor at 1.8-A resolution. Biochemistry 22: 4420-4433.

Ristaino, J.B. 2002. Tracking historic migrations of the Irish potato famine pathogen, Phytophthora infestans. Microbes Infect. 4: 1369-1377.

Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

Smart, C.D. and Fry, W.E. 2001. Invasions by the late blight pathogen: renewed sex and enhanced fitness. Biol. Invas. 3: 235-243.

Sogin, M.L., and Silberman, J.D. 1998. Evolution of the protists and protistan parasites from the perspective of molecular systematics. Int. J. Parasitol. 28: 11-20.

Tian, M., Huitema, E., Da Cunha, L., Torto-Alalibo, T., and Kamoun, S. 2004. A Kazal- like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. J. Biol. Chem. 279: 26370-26377.

137

Figure 5.1. Primary structure alignment of two Kazal domains of EPI1 and the predicted inhibition constants against subtilisin A. The conserved cysteine residues in both domains are shown in bold. The putative P1-P1’ sites and the disulfide linkages predicted based on the structure of other Kazal domains are shown. The putative 10 hypervariable contact residues are marked with asterisks. The numbers represent the predicted inhibition constants of two Kazal domains against subtilisin A.

Figure 5.2. Heterologous expression of two Kazal domains of EPI1. A, Amino acid sequences of recombinant Kazal domains rEPI1a and rEPI1b. The letters in upper case represent the amino acid sequence from EPI1 protein. The letters in lower case represent the vector derived sequence with the underlined ones representing FLAG epitope tag. Numbers indicate position of amino acid residues starting from the N terminus of EPI1 protein. B, Affinity purified recombinant Kazal domains visualized on SDS-PAGE stained with silver nitrate. The numbers on the left represent the size of molecular weight markers.

138

Figure 5.3. The atypical Kazal domain EPI1a inhibits subtilisin A. The remaining protease activity of subtilisin A was measured after incubating with rEPI1a, rEPI1b or without protease inhibitors (Std) using the QuantiCleaveTM Protease Assay Kit as described in the methods. Activity is expressed as a percentage of total protease activity in the absence of protease inhibitors. The bars correspond to the mean of three independent experiments with three replications for each experiment. The error bars represent the standard errors calculated from the mean of three experiments.

139

Figure 5.4. The atypical Kazal domain rEPI1a inhibits P69B subtilase. A, In-gel protease assay of N. benthamiana intercellular fluids expressing the empty binary vector pCB302- 3 (-) or pCB-P69B (+). B, Inhibition assay of P69B by recombinant EPI1 entire protein and the single Kazal domains. P69B-expressing N. benthamiana intercellular fluids were incubated in the presence of rEPI1, rEPI1a, rEPI1b or the absence of protease inhibitors (Buffer) and then the remaining protease activity was analyzed using zymogen in-gel protease assays. The arrow indicates the band location corresponding to the protease activity of P69B.

140

Figure 5.5. Coimmunoprecipitation of the recombinant Kazal domains and P69 subtilases using FLAG antisera. Eluates from coimmunoprecipitation of rEPI1a, rEPI1b or buffter with proteins in BTH-treated tomato intercellular fluids were run on SDS- PAGE gel followed by immunobloting sequentially with P69 (α-P69) and FLAG (α- FLAG) antisera.

141

Figure 5.6. The atypical Kazal domain rEPI1a exhibits stable inhibitory activity against subtilisin A. A, Protease activity of subtilisin A (0.2 µM) in the presence of rEPI1a in concentrations ranging from 2 nM to 0.3 µM. Activity is expressed as a percentage of total protease activity in the absence of protease inhibitors. B, Protease activity of subtilisin A (0.2 µM) after preincubation with 0.15 µM of rEPI1a (black column) or without protease inhibitors ( gray column) for a period of time ranging from 30 min to 180 min. Activity is expressed as a percentage of total protease activity in the absence of protease inhibitors at each treatment. The bars correspond to the mean of three independent replications of one representative experiment out of three performed. The error bars represent the standard errors calculated from the three replications.

142 CHAPTER 6

KAZAL-LIKE SERINE PROTEASE INHIBITOR EPI1 FROM PHYTOPHTHORA

INFESTANS IS INVOLVED IN VIRULENCE BY INITIATING CASCADES OF

INHIBITION OF PLANT DEFENSE-RELATED PROTEASES

6.1 ABSTRACT

Plant proteolytic machinery plays important roles in plant defense. Plant pathogens have co-evolved protease inhibitors for counterdefense. Previously, we described a diverse family of Kazal-like extracellular serine protease inhibitors (EPI1-

EPI14) from oomycete plant pathogen Phytophthora infestans. Among them, EPI1 and

EPI10 inhibit and interact with the pathogenesis-related P69B subtilisin-like serine

protease of the host plant tomato, suggesting that protease inhibitors represent an

important virulence strategy of P. infestans. Here, we describe a new family of putative extracellular protease inhibitors with cystatin-like domains (EPIC1-EPIC4) from P. infestans. The epiC1 and epiC2 genes were relatively fast-evolving within P. infestans

and were upregulated during infection of tomato, suggesting a role during P. infestans-

host interactions. In vitro experiments showed that EPIC1 and EPIC2B were degraded by

P69B subtilase and the Kazal-like inhibitor EPI1 protected both proteins from

degradation. EPIC1 could be detected in tomato apoplast isolated from infected leaves,

143 providing indirect in vivo evidence that EPI1 was involved in counterdefense by protecting pathogen proteins from degradation by P69B during infection.

Coimmunoprecipitation experiments revealed that EPIC2B interacted with a novel papain-like extracellular cysteine protease PIP1, which was pathogenesis-related and closely related to Rcr3, an apoplastic cysteine protease required for tomato Cf-2 and

Cladosporium fulvm Avr2-dependent defense response. Moreover, EPIC1 and EPIC2B also interacted with Rcr3. Together, our results suggest that complex cascades of inhibition of host proteases initiated by EPI1 might occur in the plant apoplast during infection and could lead to multifaceted suppression of plant defense responses.

Moreover, this study provides biochemical evidence for the roles of defense- counterdefense mediated by tomato P69B subtilase and P. infestans Kazal-like inhibitor

EPI1. This work also revealed a mechanism by which tomato P69B subtilase mediates plant defense.

6.2 INTRODUCTION

There is emerging evidence that plant proteolytic machinery plays important roles in plant defense. For example, several apoplastic proteases have been linked to defense.

Rcr3, a secreted cysteine protease from tomato, is required for Cf-2-mediated resistance against the fungus Cladosporium fulvum carrying the Avr2 avirulence gene (Kruger et al.

2002). An apoplastic aspartic protease CDR1 from Arabidopsis activates defense signaling by generating an unknown mobile endogenous peptide elicitor (Xia et al. 2004).

The roles of proteases in plant defense are also reflected in their involvement in hypersensitive response (HR), a form of programmed cell death (PCD) that is associated

144 with resistance to pathogens (D'Silva et al. 1998; Solomon et al. 1999; Mosolov et al.

2001; Chichkova et al. 2004). Proteasome involved in ubiquitin-mediated protein degradation pathway has been implicated in PCD and disease resistance (Suty et al. 2003;

TÖR et al. 2003; Zeng et al. 2004). PCD inhibition using caspase inhibitors pointed to a role of plant proteases with caspase-like activity (cleavage after Asp residues) in the HR

(D'Silva et al. 1998; Solomon et al. 1999; Chichkova et al. 2004; van der Hoorn and

Jones 2004). Plant vacuolar processing enzymes (VPEs) were recently identified to be cysteine proteases with caspase-like activity that are essential for a virus-induced HR and virus resistance (Hatsugai et al. 2004; Rojo et al. 2004). Interestingly, VPEs not only contribute to resistance to avirulent pathogens (incompatible interactions), but also to basic defense to pathogens during susceptible interactions (compatible interactions)

(Hatsugai et al. 2004; Rojo et al. 2004). Knockout of VPEγ from Arabidopsis results in increased susceptibility to Botrytis cinerea and turnip mosaic virus (Rojo et al. 2004). A variety of proteases from various plants are up-regulated during infection by plant pathogens suggesting a potential role in plant defense (Tornero et al. 1997; Avrova et al.

1999; Liu et al. 2001; Guevara et al. 2002; Zhao et al. 2003; Avrova et al. 2004; Tian et al. 2004). For example, the pathogenesis-related protein P69B of tomato is an apoplastic subtilisin-like serine protease that accumulates upon infection by multiple plant pathogens including citrus exocortis viroid, Pseudomonas syringae, and Phytophthora infestans (Tornero et al. 1997; Zhao et al. 2003; Tian et al. 2004). Despite the overwhelming evidence showing that plant proteases are important components of defense responses, the precise mechanisms of actions remain largely unknown. They can act at the level of perception, signaling and execution (van der Hoorn and Jones 2004).

145 During the perception of invaders, plant proteases might actively release elicitors by processing pathogen proteins, or the altered protease activity resulting from the binding with pathogen proteins somehow induces defense response (van der Hoorn and Jones

2004). During the defense signaling, plant proteases could modulate the positive or negative regulators to activate defense responses (van der Hoorn and Jones 2004). In addition, they might act at the level of execution by degrading pathogen effector proteins, and/or activating plant defensive molecules (van der Hoorn and Jones 2004).

Plants and plant pathogens have co-evolved diverse defense and counterdefense

strategies in their arms race for survival (Stahl and Bishop 2000). For example, plants use

the pathogenesis-related proteins β-1, 3-endoglucanases to damage pathogen cell walls

either rendering the pathogen more susceptible to other plant defense responses, or

releasing oligosaccharide elicitors to activate plant defense (Rose et al. 2002). The

oomycete pathogen Phytophthora sojae has evolved a counterdefense mechanism by

secreting glucanase inhibitor proteins (GIPs) that suppress the activity of a soybean β-1,

3-endoglucanase (Rose et al. 2002). An analogous plant enzyme-pathogen inhibitor co-

evolution might involve plant proteases and pathogen protease inhibitors. So far, protease

inhibitors have only been reported from oomycete plant pathogens. A diverse family of

Kazal-like extracellular serine protease inhibitors with at least 35 members was described

in five plant pathogenic oomycetes Phytophthora infestans, Phytophthora sojae,

Phytophthora ramorum, Phytophthora brassicae, and the downy mildew Plasmopara

halstedii (Tian et al. 2004). Among the 14 Kazal-like inhibitors (EPI1-EPI14) of P.

infestans, EPI1 and EPI10 were found to inhibit and interact with the pathogenesis-

related P69B subtilisin-like serine protease of the host plant tomato (Tian et al. 146 2004)(Chapter 4). This suggests an important counterdefense mechanism of P. infestans to suppress plant defense. However, the mechanism underlying how P69B-EPI1/EPI10 interactions mediate defense-counterdefense remains to be elucidated.

P. infestans causes late blight, a reemerging and ravaging disease of potato and tomato (Birch and Whisson 2001; Smart and Fry 2001; Ristaino 2002; Shattock 2002).

During infection of host plants by this pathogen, various plant proteases could be involved in defense. Besides serine proteases, such as P69B, other catalytic types of proteases were also found to be upregulated during infection by P. infestans. These include an extracellular aspartic protease (AP), as well as two cysteine proteases CYP and StCathB from potato (Avrova et al. 1999; Guevara et al. 2002; Avrova et al. 2004).

These protease genes are differentially induced in potato plants with different resistance

(Avrova et al. 1999; Guevara et al. 2002; Avrova et al. 2004). For instance, StCathB is rapidly induced during R gene-mediated reistance but its expression level is gradually increased in a potato cultivar with partial resistance (Avrova et al. 2004). The induction of AP expression is higher and faster in a resistant potato cultivar than in a susceptible one (Guevara et al. 2002). Differential induction in plants with different resistance suggests a role in plant defense for these proteases. It is likely that P. infestans has evolved additional protease inhibitors besides Kazal-like serine protease inhibitors, to target different catalytic types of proteases for counterdefense.

In our laboratory, we have been annotating and characterizing secreted proteins from P. infestans in order to identify candidate effectors (Torto et al. 2003; Liu et al.

2004; Tian et al. 2004). Motif searches of 1294 P. infestans unigenes with predicted signal peptides revealed a new family of putative protease inhibitors with cystatin-like

147 domains (EPIC1 to EPIC4, InterPro IPR000010 and/or IPR003243, MEROPS family

I25). Among these, the epiC1 and epiC2 genes lacked orthologs in Phytophthora sojae and Phytophthora ramorum, were relatively fast-evolving within P. infestans and were

upregulated during infection of tomato, suggesting a role during P. infestans-host

interactions. In vitro experiments showed that EPIC1 and EPIC2B were degraded by

tomato pathogenesis-related P69B subtilase and the Kazal-like inhibitor EPI1 protected

both proteins from degradation. EPIC1 could be detected in tomato apoplast isolated

from infected leaves, providing indirect in vivo evidence that EPI1 protected pathogen

proteins during infection. Interestingly, coimmunoprecipitation experiments revealed that

EPIC2B interacted with a novel papain-like extracellular cysteine protease PIP1, which

was pathogenesis-related and closely related to Rcr3, an apoplastic cysteine protease

required for tomato Cf-2 and Cladosporium fulvm Avr2-dependent defense response

(Kruger et al. 2002). Moreover, EPIC1 and EPIC2B also interacted with Rcr3. Together,

our results suggest that complex cascades of inhibition of host proteases initiated by EPI1

might occur in the plant apoplast during infection. In addition, this study provides strong

biochemical evidence for the roles of defense-counterdefense mediated by tomato

pathogenesis-related protease P69B (PR7) and P. infestans Kazal-like inhibitor EPI1.

This work also revealed a mechanism by which tomato P69B subtilase mediates plant

defense.

6.3 MATERIALS AND METHODS

Phytophthora strain and culture conditions

P. infestans isolate 90128 (A2 mating type, race 1.3.4.7.8.9.10.11) was routinely

148 grown on rye agar medium supplemented with 2% sucrose (Caten and Jinks 1968). For

RNA extraction and culture filtrate, plugs of mycelium were transferred to modified Plich

medium (Kamoun et al. 1993) and grown for 2 weeks before harvesting.

Bacterial strains and plasmids

Escherichia coli XL1-Blue and Agrobacterium tumefaciens GV3101 were used in this study and routinely grown in LB medium (Sambrook et al. 1989) at 37°C and 28°C respectively. Plasmid pFLAG-EPIC1 and pFLAG-EPIC2B were constructed by cloning

PCR amplified DNA fragments corresponding to the mature sequence of EPIC1 and

EPIC2B into the EcoRI and KpnI sites of pFLAG-ATS (Sigma, St. Louis, MO), a vector that allows secreted expression in E. coli. The oligonucleotides epiC1-F/R and epiC2B-

F/ R (Table 6.1) were used to amplify mature EPIC1 and EPIC2B sequence respectively.

The N-terminal sequence of the processed recombinant proteins FLAG-EPIC1 (rEPIC1) and FLAG-EPIC2B (rEPIC2B) are “DYKDDDDKvkllensQVDGGYSKKE...” and

“DYKDDDDKvkllensQLNGYSKKEV...”, respectively. The FLAG epitope sequence is underlined, and the first 10 amino acids of mature EPIC1 and EPIC2B are shown in bold.

Plasmid pHIS-EPI1 was constructed by cloning PCR amplified DNA fragment corresponding to the mature sequence of EPI1 into the EcoRI and KpnI sites of pHIS-

ATS, a vector modified from pFLAG-ATS for secreted expression of N-terminal HIS tagged fusion proteins in E. coli (Tian M. and Kamoun S., unpublished data). The oligonucleotides epi1-F and epi1-R (Table 6.1) were used to amplify the DNA fragment

corresponding to mature EPI1 sequence. The N-terminal sequence of the processed

recombinant protein HIS-EPI1 is “HHHHHHkllensQSPQVISPAP...”. The HIS epitope sequence is underlined, and the first 10 amino acids of mature EPI1 are shown in bold.

149 Plasmid pCB302-P69B was constructed by cloning PCR amplified DNA fragment corresponding to the open reading frame of P69B (GenBankTM accession number

Y17276) fused with the HA tag (YPYDVPDYA ) at the C-terminus into a binary vector pCB302-3 (Xiang et al. 1999) and was described in Chapter 4. Plasmid pMWBin19Rcr3:His:HA, was provided by Jonathan D. G. Jones and described by

Kruger et al. (2002).

Tomato plant growth, BTH treatment, and infection by P. infestans

Tomato (Lycopersicon esculentum) plants were grown in pots at 25°C, 60% humidity, under 16 hour-light/8 hour-dark cycle. Tomato cultivar Ohio 7814, the Rcr3pim- carrying tomato line and rcr3-3 mutant were used for this study. We used the salicylic acid analog benzo-(1, 2, 3)-thiadiazole-7-carbothioic acid S-methyl ester (BTH) to mimic pathogen infection. BTH treatment and infection of tomato leaves by P. infestans were performed using 3-week-old and 8-week-old Ohio 7814 tomato plants respectively following the methods described earlier (Tian et al. 2004).

Expression and purification of recombinant proteins in E. coli

Expression of FLAG-EPIC1 (rEPIC1), FLAG-EPIC2B (rEPIC2B) and HIS-EPI1 in E. coli using plasmids pFLAG-EPIC1, pFLAG-EPIC2B and pHIS-EPI1 was conducted as described previously (Kamoun et al. 1997; Tian et al. 2004). Purification of

FLAG-EPIC1 and FLAG-EPIC2B was performed as described earlier (Kamoun et al.

1997; Tian et al. 2004). HIS-EPI1 was purified using gravity column packed with BD

TALON™ Metal Affinity Resins (BD Biosciences) following manufacturer’s instructions. Protein concentrations were determined using the BioRad protein assay

(BioRad Laboratories, Hercules, CA). 0.5 µg of the purified protein was run on a SDS-

150 PAGE gel followed by staining with silver nitrate to determine the purity.

Transient expression of P69B subtilase and Rcr3pim in Nicotiana Benthamiana

Transient expression of P69B using plasmid pCB302-P69B was performed exactly as described in Chapter 4. Transient expression of Rcr3pim using plasmid pMWBin19Rcr3:His:HA was performed as described by Kruger et al. (2002).

Isolation of intercellular fluids

Intercellular fluids were prepared from tomato and N. bethamiana leaves according to the method of de Wit and Spikman (1982). For tomato leaves, a 0.24 M sorbitol solution was used as extraction buffer. For leaves from N. benthamiana, a solution of 300 mM NaCl, 50 mM NaPO4 pH 7 (Kruger et al. 2002) was used as extraction buffer. The intercellular fluids were filter sterilized (0.45 µM), and were used immediately or stored at –20°C.

RNA isolation, and semi-quantitative RT-PCR

RNA isolation and semi-quantitative RT-PCR were performed as described elsewhere (Torto et al. 2003; Tian et al. 2004). The oligonucleotides epiC1-F/R, epiC2B-

F/R, epiC3-F/R and epiC4-F/R used to amplify epiC transcripts are listed in Table 6.1.

Amplifications of P. infestans elongation factor 2 alpha (ef2α gene using the primer pair described previously (Torto et al. 2002) were used as controls to determine the relative transcript levels of epiC genes.

SDS-PAGE and Western blot analyses

Proteins were subjected to 10%-15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) as previously described (Sambrook et al. 1989). Following electrophoresis, gels were visualized by silver nitrate staining following the method of 151 Merril et al. (1981), Colloidal Coomassie blue staining (Anderson et al. 1991), or the

proteins were transferred to supported nitrocellulose membranes (BioRad Laboratories,

Hercules, CA) using a Mini Trans-Blot apparatus (BioRad Laboratories, Hercules, CA).

Detection of antigen-antibody complexes was carried out with a Western blot alkaline phosphatase kit (BioRad Laboratories, Hercules, CA). Antisera to P69 subtilases were raised against a peptide specific for the tomato P69 family (Tian et al. 2004). Antisera to

PIP1 were produced by immunizing rabbits with the peptide, H2N-INGYEVVPSDESSL-

COOH, conjugated with keyhole limpet hemocyanin (KLH) via added cysteine residue at the N-terminal region. The peptide sequence was chosen for its highly antigenic characteristics and uniqueness for PIP1 in Genbank. Selection of peptides for highly antigenic characteristics, peptide synthesis and conjugation, as well as antisera production were performed by Sigma Genosys. In Western blot analyses, the antisera to PIP1 reacted only with a single band of around 30 kDa from tomato intercellular fluids. Antibody to

EPIC1 was raised by immunizing rabbits with recombinant protein rEPIC1 by Cocalico

Biologicals (Reamstown, PA) and it reacted with rEPIC1 and a single band of similar size from P. infestans culture filtrate and infected intercellular fluids. Monoclonal anti-

FLAG M2 antibody and anti-polyHistidine antibody were purchased from Sigma (St.

Louis, MO).

Coimmunoprecipitation

Coimmunoprecipitations of rEPIC1 and rEPIC2B with intercellular fluid proteins

from tomato and N. benthamiana were performed using the FLAG tagged Protein

Immunoprecipitation Kit (Sigma, St. Louis, MO) following the manufacturer’s instructions. Purified rEPIC1 and rEPIC2B were preincubated with intercellular fluids for

152 30 min at 25°C. 40 µl anti-flag M2 resin was added and incubated at 4°C for 2 hours with

gentle shaking. The precipitated protein complexes were eluted in 60 µl of FLAG peptide solution (150 ng/µl) and were analyzed by SDS-PAGE.

Tandem mass spectrometric sequencing

Tandem mass spectrometric sequencing for PIP1 was performed at the proteomics facility of The Cleveland Clinic Foundation (Cleveland, OH) as described previously

(Tian et al. 2004). Capillary-liquid chromatography tandem mass spectrometry (Nano-

LC/MS/MS) for Rcr3 was performed on a Micromass in a hybrid quadruple time-of- flight Q-Tof(tm) II (Micromass, Wythemshawe, UK) at the Mass Spectrometry &

Proteomics Facility of The Ohio Sate University (Columbus, OH) as described by

Calikowski et al. (2003).

Sequence and phylogenetic analyses

Similarity searches were performed locally using BLAST (Altschul et al. 1997).

Search programs included BLAST (Altschul et al. 1997), and the similarity search programs implemented in the BLOCKS (Henikoff et al. 2000), pfam (Bateman et al.

2002), SMART (Letunic et al. 2002), and InterPro (Apweiler et al. 2001) websites. The examined sequence databases included GenBank nonredundant, dBEST, and TraceDB

(Karsch-Mizrachi and Ouellette 2001), PGC (Waugh et al. 2000), SPC, a proprietary database of Syngenta Inc. containing ca. 75,000 ESTs from P. infestans (courtesy of the

Syngenta Phytophthora Consortium, Research Triangle Park, NC), PFGD

(http://www.pfgd.org/) and the whole genome sequences of Phytophthora sojae and

Phytophthora ramorum (available at GenBank Trace Archive). The sequences described in this chapter were deposited in GenBank under accession numbers listed in Table 6.2. 153 Multiple sequence alignments were generated using Clustal X (Thompson et al. 1997).

Phylogenetic trees were constructed using the neighbor-joining method implemented in the Clustal X program (Thompson et al. 1997). A total of 1,000 bootstrap replications were performed and the tree topologies were viewed with the program TreeView PPC

1.6.6 (Page 1996). Clusters of orthologous epiC genes from P. infestans, P. sojae, and P. ramorum were determined using pairwise reciprocal BLAST searches exactly as described in Chapter 3.

6.4 RESULTS

A family of cystatin-like extracellular protease inhibitors in Phytophthora spp.

We mined currently available expressed sequence tags (ESTs) and whole genome shortgun sequences of P. infestans using two methods: 1) PexFinder (Torto et al. 2003) to identify genes encoding putative extracellular proteins and 2) similarity searches described in Methods to annotate the predicted extracellular proteins. Among 1294 P. infestans unigenes with predicted signal peptides, a total of 5 sequences were found to encode putative protease inhibitors with cystatin-like domains (IPR000010 or

IPR003243, MEROPS family I25). These proteins were designated as EPICs

(Extracellular Protease Inhibitors of Cystatin-like domain). Two of the sequences were very similar to each other, and the divergence only occurred at 8 amino acids of total 125 residues. We proposed that these two sequences represent different polymorphisms of a single gene epiC2 and they were named as epiC2A and epiC2B. We focused on epiC2B in this study because the sequence of the RCR product amplified from cDNAs of P. infestans 90128 with the primers epiC2B-F/R listed in Table 6.1 exactly matched

154 epiC2B. The remaining sequences were designated as epiC1, epiC3, and epiC4. The

cDNA sequences of epiC1 and epiC4 were confirmed by re-sequencing the cDNA clones

PH050H7 and PA050F5. The cDNA sequence of epiC3 was confirmed by sequencing

the RCR product amplified from cDNAs of P. infestans 90128 with primers epiC3-F/R listed in Table 6.1. The four epiC genes encoded proteins ranging from 125 to 172 amino acids. All of them were predicted to have signal peptides with a significant mean S value of over 0.9 based on SignalP analyses (Nielsen et al. 1997; Nielsen and Krogh 1998).

Searches against the InterPro database (Apweiler et al. 2001) revealed that each EPIC protein contained a single domain similar to motif IPR000010 or IPR003243 for cystatin- like protease inhibitors and possessed the signature sequence of cystatin-like cysteine proteinase inhibitors described at PROSITE (http://us.expasy.org/prosite/) with the documentation number of PDOC00259. A schematic representation of the 4 EPIC proteins is shown in Figure 6.1A.

We used the amino acid sequences of the 4 EPIC proteins to search for cystatin-like protease inhibitors from P. sojae and P. ramorum by performing tblastn search against whole genome sequence of P. sojae and P. ramorum. 4 sequences from each genome were identified to contain a cystatin-like domain, and all of them were predicted to have signal peptides (Table 6.2).

The phylogenetic relationships among 13 EPIC proteins from the three plant pathogenic Phytophthora species P. infestans, P. sojae and P. ramorum were investigated by constructing a neighbor-joining tree (Figure 6.1B). Interestingly, both EPIC3 and

EPIC4 were found to have closely related corresponding homologs from P. sojae and P. ramorum, indicating that EPIC3 and EPIC4 are highly conserved in these three plant

155 pathogenic oomycetes. However, EPIC1 and EPIC2 were found to be restricted to P.

infestans, but missing from P. sojae and P. ramorum. We further determined putative

clusters of orthologous epiC genes from three genome using reciprocal BLAST searches

(all-versus-all method) (Tatusov et al. 1997). Two clusters (cluster I, epiC3, PsepiC3 and

PrepiC3; cluster II, epiC4, PsepiC4, and PrEepiC4) showed unambiguous 1:1:1 relationships (Figure 6.1B) and high similarity among protein sequences in the same cluster is evident through the entire sequence.

We studied the expression of the four epiC genes during infection of tomato by P. infestans and in mycelium cultured in vitro using semi-quantitative RT-PCR (Reverse

Transcription Polymerase Chain Reaction) analyses (Figure 6.2). All of these genes were expressed during colonization of tomato, among them epiC1 and epiC2B appeared significantly up-regulated during infection compared to mycelium and relative to the constitutive elongation factor 2 alpha (ef2α) gene. Altogether, the restriction of epiC1 and epiC2 to P. infestans, the polymorphic nature of epiC2, as well as the upregulation of epiC1 and epiC2B, suggest that these genes may have coevolved with host proteases and could presumably play important functions during infection of host plants.

EPIC1 and EPIC2 are unstable in tomato intercellular fluids

To functionally characterize the cystatin-like extracellular protease inhibitors

EPIC1 and EPIC2B, we expressed in E. coli and affinity purified recombinant EPIC1

(rEPIC1) and EPIC2B (rEPIC2B) as fusion proteins with the FLAG epitope tag at the amino-terminus. Silver staining of the purified recombinant proteins after SDS-PAGE was performed to determine the purity of rEPIC1 and rEPIC2B. There was a single band

156 for rEPIC2B, indicating high purity. As for rEPIC1, there were two closely-migrated bands (data not shown), with the lower molecular mass band likely representing the secreted fusion protein rEPIC1 and the higher molecular mass band representing the recombinant protein rEPIC1 with the signal peptide of the OMPA protein, which is located immediately before the FLAG peptide in the vector pFLAG-ATS (Sigma, St.

Luis, MO). The two-band pattern of rEPIC1 was also observed in Western blots with the

FLAG antibody (Figure 6.3), indicating that both bands represent FLAG-EPIC1. Except the two rEPIC1 bands, there was not any other protein band in the gel, indicating high purity of rEPIC1 (data not shown).

Previous experiments to identify the interacting proteases of P. infestans Kazal-like

serine protease inhibitors (EPIs) by coimmunoprecipitation of purified FLAG-EPIs with

BTH-induced tomato intercellular fluids showed that a number of EPI proteins, for

instance EPI2, EPI3, EPI5, EPI10 and EPI12, were not stable in tomato intercellular

fluids, suggesting that some tomato proteases degrade P. infestans secreted proteins (data not shown) (Chapter 4). To test the stability of rEPIC1 and rEPIC2B, 15 pmol of rEPIC1 and rEPIC2B were incubated with 10 µl of BTH-induced tomato intercellular fluids for

30 min at 25°C and then run SDS-PAGE for Western blot with FLAG antibody. Both rEPIC1 and rEPIC2B were unstable in tomato intercellular fluids. rEPIC1 was almost completely degraded whereas rEPIC2B was only partially degraded. These results suggest that the two EPIC proteins could be degraded by tomato extracellular proteases

(Figure 6.3).

157 Tomato pathogenesis-related P69B subtilase degrades EPIC1 and EPIC2B

P69B subtilase is pathogen-induced and abundant in the apoplast of tomato leaves

infected with pathogens or treated with the salicylic acid analog BTH (Tornero et al.

1997; Zhao et al. 2003; Tian et al. 2004). We speculated that P69B could contribute to

defense by degrading secreted proteins of P. infestans (Tian et al. 2004). This prompted us to test whether P69B is associated with the degradation of EPIC1 and EPIC2B.

Previously, we successfully expressed a functional P69B in N. benthamiana plants by agroinfiltration (Chapter 4). We incubated 15 pmol of rEPIC1 and rEPIC2B with 10 µl

(10-fold concentrated) of N. benthamiana intercellular fluids isolated from leaves expressing empty vector control or P69B. Both rEPIC1 and rEPIC2B were stable in control intercellular fluids, but degraded in P69B-expressing intercellular fluids, indicating that P69B degrades the P. infestans secreted proteins EPIC1 and EPIC2B

(Figure 6.4).

EPI1 protects EPIC1 and EPIC2 from degradation by P69B subtilase

We showed earlier that EPI1 is a tight binding inhibitor of P69B subtilase (Tian et al. 2004). Also, EPI1 is stable in BTH-induced tomato intercellular fluids (data not shown). This raised the possibility that EPI1 could protect EPIC1 and EPIC2B from degradation in tomato extracts. To test this, two lines of experiments were performed.

The first experiment was to test if EPI1 is able to protect rEPIC1 and rEPIC2B from degradation in BTH-induced tomato intercellular fluids. 10 µl of BTH-induced tomato intercellular fluids were preincubated with 5 pmol of HIS-EPI1 or buffer control for 30 min at 25°C, followed by incubation with 15 pmol of rEPIC1 and rEPIC2B for an 158 additional 30 min. rEPIC1 and rEPIC2B were detected by Western blot with FLAG antibody. The results showed that both rEPIC1 and rEPIC2B were stable in tomato intercellular fluids preincubated with HIS-EPI1, suggesting that EPI1 protects both of

them from degradation in tomato intercellular fluids (Figure 6.5A). The second

experiment was to test if EPI1 is able to protect rEPIC1 and rEPIC2B from degradation

by P69B subtilase. 10 µl of 10-fold concentrated P69B-expressing N. benthamiana

intercellular fluids were preincubated with 5 pmol of HIS-EPI1 or buffer control for 30

min at 25°C, followed by incubation with rEPIC1 and rEPIC2B for an additional 30 min.

rEPIC1 and rEPIC2B were found to be stable in P69B-expressing intercellular fluids in

presence of HIS-EPI1 (Figure 6.5B). Results from both experiments clearly demonstrated

that EPI1 protected EPIC1 and EPIC2B from degradation by the tomato subtilase P69B.

EPIC1 protein is abundantly secreted in tomato apoplast during infection

The P69B gene is highly induced during the infection of tomato by P. infestans and

the P69B protein accumulates in tomato apoplast accounting in part for the significant

increase of total endoprotease activity (Tian et al. 2004). EPI1 is also upregulated during

infection (Tian et al. 2004) and the above in vitro experiments showed that EPI1 was able

to protect EPIC1 from degradation by P69B. If this is the case in vivo during the

infection, EPIC1 should be stable in tomato apoplast isolated from infected leaves. As we

expected, Western blot with antisera generated against rEPIC1 detected EPIC1 in

infected tomato intercellular fluid at the protein level (Figure 6.6), indicating that EPIC1

is protected from P69B during infection.

159 EPIC2B interacts with a tomato papain-like cysteine protease PIP1

Tomato Rcr3 is a secreted papain-like cysteine protease required for tomato Cf-2

and Cladosporium fulvm Avr2-dependent defense response (Kruger et al. 2002). Avr2

was shown to be a protease inhibitor that interacts with Rcr3 ( J. D. G. Jones, pers.

comm.). To test the possibility that EPIC1 and EPIC2B interact with tomato Rcr3, we did

coimmunoprecipitation of rEPIC1 and rEPIC2B with intercellular fluids isolated from

12-week tomato plants containing Rcr3pim or the mutated gene rcr3-3, which contains

premature stop codon of Rcr3pim (Kruger et al. 2002). Since rEPIC2B, unlike rEPIC1, was only partially degraded in tomato extracts, the coimmunoprecipitation of rEPIC2B was successful, and resulted in recovery of rEPIC2B and another protein of approximately

30kDa (Figure 6.7A). We could not detect rEPIC1 after the coimmunoprecipitation process (data not shown) probably because it was completely degraded as shown in

Figure 6.3. The rEPIC2B-interacting protein was pulled down from intercellular fluids isolated from both tomato lines, excluding the possibility that it was Rcr3 (Figure 6.7A).

To identify this protein, the protein band from the coimmunoprecipitation with intercellular fluids isolated from Rcr3pim-containing plants was cored from the gel and analyzed by tandem mass spectrometry. Two peptides of 14 amino acids and 13 amino acids were sequenced, and matched several EST sequences in NCBI dBEST database. All the matching sequences corresponded to the consensus sequence TC118154 in The

Institute of Genome Research (TIGR) database. Based on the putative encoding sequence of TC118154, a pair of primers (Table 6.1) were designed to amplify the whole Open

Reading Frame (ORF) from infected tomato cDNAs and the PCR product was sequenced. The cDNA sequence encodes a protein of 345 amino acids, with only one

160 residue different from the TC118154-encoded protein sequence (V87 vs. I87). The protein was named Phytophthora Interacting Protein 1 (PIP1). Similarity searches indicated that

PIP1 is a papain-like cysteine protease (subfamily C1A, MEROPS peptidase database,

http://merops.sanger.ac.uk/), with conserved protease catalytic triad residues ( C154, H287, and N309) based on the consensus patterns of eukaryotic thiol (cysteine) protease active sites (PROSITE: PDOC00126) (Figure 6.7B).

PIP1 is closely related to Rcr3

Papain-like cysteine proteases (C1A) are widely distributed in different plant species. In Arabidopsis, there are 30 proteins homologous to the C1A subfamily of proteases. To gain insights regarding their roles in a variety of plant processes, Beer et al.

(2004) generated a phylogenetic tree with 138 plant papain-like proteases. The phylogenetic tree is highly structured with 8 different groups designated C1A-1 to C1A-

8. For the similar purpose with PIP1, we reconstructed the tree with PIP1, 138 C1A proteases described by Beer et al. (2004), and a putative C1A protease encoded by EST

CK295119, which is a homolog of PIP1 from Nicotiana benthamiana with 70% identity.

Remarkably, PIP1 was found to be closely related to tomato defense-related cysteine protease Rcr3 (Figure 6.8), belonging to C1A-5 group (Beers et al. 2004).

PIP1 is a salicylic acid (SA) induced pathogenesis-related protein

Among the EST sequences forming the consensus TC118154, BG352024 and

AI780572 were shown to be differentially regulated upon pathogen infection (Xiao et al.

2001; Zhao et al. 2003). BG352024 (P271) was highly induced in transgenic tomato

161 plants overexpressing the R gene Pto and by infection of Pto-containing tomato plants with avrPto-carrying P. syringae pv tomato (Xiao et al. 2001). AI780572 was shown to be co-regulated with a large number of PR genes including PR1, PR2, PR3 and PR7 that are induced in a SA-dependent manner (Zhao et al. 2003). AI780572 and the PR genes were down-regulated in wild-type tomato compared to jasmonic acid (JA)-insensive mutant (jai1) during the infection of tomato by P. syringae pv. tomato strain DC3000

(Zhao et al. 2003). To test if pip1 is indeed regulated in a SA-dependent manner, intercellular fluids isolated from H2O-treated and salicylic acid analog BTH-treated tomato plants were used in Western blots with PIP1 antisera. PIP1 was highly induced by

BTH treatment (Figure 6.9A), suggesting that it is regulated in a SA-dependent manner.

To further investigate if pip1 is induced by P. infestans, intercellular fluids from P.

infestans-inoculated and mock-inoculated leaves at different time points postinoculation

were applied to detect the expression level of PIP1. PIP1 accumulated in tomato fluids

during P. infestans infection (Figure 6.9B).

EPIC1 and EPIC2 interact with tomato Rcr3

Coimmunoprecipitation with intercellular fluids from tomato lines carrying Rcr3pim gene did not pull down Rcr3. However, since PIP1 is closely related to Rcr3, we further investigated if EPIC1 and EPIC2B interact with tomato Rcr3 using agroinfiltration.

Rcr3pim was transiently expressed in N. benthmiana leaves by agroinfiltration of vector pMWBin19Rcr3:His:HA (Figure 6.10A) (Kruger et al. 2002). Coimmunoprecipitation was performed by incubating rEPIC1 or rEPIC2B with N. benthamiana intercellular fluids expressing an empty vector control or Rcr3 protein using FLAG antibody

162 covalently linked agarose beads. Both rEPIC1 and rEPIC2B were pulled down together

with a protein of about 30 kDa in Rcr3-expressing intercellular fluids but not the control

(Figure 6.10B). To confirm that the interacting protein is Rcr3, the 30 kDa band from the eluate of EPIC2B coimmunoprecipitation was cored and analyzed by tandem mass spectrometry. One sequenced peptide of 15 amino acid residues exactly matched the amino acid sequence of Rcr3pim (Genbank accession number AF493232) (Figure 6.10C), suggesting that EPIC1 and EPIC2B interact with the tomato papain-like cysteine protease

Rcr3.

6.5 DISCUSSION

A number of plant proteases of different catalytic types have been implicated in plant defense against P. infestans (Avrova et al. 1999; Guevara et al. 2002; Avrova et al.

2004; Tian et al. 2004). One of these, the pathogenesis-related P69B subtilisin-like serine protease of tomato is targeted by the Kazal-like serine protease inhibitor EPI1 and EPI10 of P. infestans, suggesting that inhibition of defense-related proteases represents an important virulence mechanism for this pathogen (Tian et al. 2004)(Chapter 4). In this study, we describe a new family of cystatin-like extracellular protease inhibitors (EPIC1 to EPIC4) from P. infestans. These epiC genes were identified based on motif annotation of putative secreted proteins. Among them, the epiC1 and epiC2 genes are relatively fast- evolving within Phytophthora and upregulated during the infection, suggesting a role in

P. infestans-host interactions. Interestingly, EPIC1 and EPIC2 are degraded by P69B but

EPI1 protects both proteins from degradation. Coimmunoprecipitation experiments revealed that EPIC2B interacts with a novel papain-like extracellular cysteine protease

163 PIP1, which is pathogenesis-related and closely related to Rcr3, an apoplastic cysteine protease required for tomato Cf-2 and Cladosporium fulvm Avr2-dependent defense response (Kruger et al. 2002). Moreover, EPIC1 and EPIC2B also interact with Rcr3.

The significance of this study is multiple-fold. First, our overall results suggest that complex cascades of inhibition of host proteases by diverse extracellular protease inhibitors of P. infestans might occur in the plant apoplast during infection and could lead to multifaceted suppression of plant defense responses. Second, this work demonstrates that tomato P69B subtilase mediates plant defenses by degrading secreted pathogen proteins. Finally, this study provides strong biochemical evidence for the role of EPI1 in virulence. By inhibiting P69B, EPI1 protects other secreted proteins of P. infestans from degradation.

Our data lead us to suggest a model on the role in inhibition of host proteases by two families of extracellular protease inhibitors of P. infestans based on cascades of inhibitions (Figure 6.11). In our model, the Kazal-like inhibitor EPI1 secreted by P. infestans initiates the first cascade of inhibition by inhibiting P69B. Since P69B subtilase degrades EPIC1 and EPIC2B, these proteins are protected as a result of the first cascade of inhibition. The protected EPIC1 and EPIC2B then target the tomato defense-related cysteine proteases PIP1 and Rcr3 to block the defense responses. It is important to note that the model in Figure 6.11 is likely to be a simplified version. Cascades of inhibition of plant proteases are likely to be more complex. Besides EPIC1 and EPIC2B, EPI1 also protects the Kazal-like inhibitors EPI2 and EPI12 from degradation in BTH-induced tomato intercellular fluids (data not shown). The protected EPI2 and EPI12 might inhibit additional plant proteases for counterdefense. In addition, EPI10 also targets P69B

164 subtilase (Chapter 4) and might also protect EPIC1 and EPIC2B from degradation.

Meanwhile, EPI10 itself might also require protection from host proteases since EPI10 is unstable in tomato intercellular fluids (Chapter 4). In summary, it appears that P. infestans has evolved an elegant and complex mechanism to cope with plant protease-

mediated defense responses. Extracellular protease inhibitors might represent a critical

virulence mechanism for the devastating plant pathogen P. infestans.

The tomato apoplastic P69B subtilase can be induced by multiple plant pathogens, including P. infestans, citrus exocortis viroid and Peudomonas syringae and has long

been identified as a pathogenesis-related protein belonging to the PR-7 class (Vera and

Conejero 1988; Tornero et al. 1997; Zhao et al. 2003; Tian et al. 2004). However, little is

known about the mechanism by which this protease contributes to plant defense. Previous

studies suggested that P69B might contribute to plant defense by activating defense

signaling molecules. A tomato leucine-rich repeat (LRR) protein LRP was reported to be

processed proteolytically to a lower molecular weight form by citrus exocortis viroid-

induced P69 subtilases (Tornero et al. 1996). LRP represents a candidate molecule

mediating plant defense signaling since it contains four tandem repeats of the canonical

24 amino acid LRR sequence present in proteins that mediate molecular recognition, and

its expression is upregulated in tomato plants infected with citrus exocortic viroid

(Tornero et al. 1996). The processing of LRP by P69 subtilases might activate this protein

from its inactive precursor and activate plant defense. This mechanism sounds

convincing. However, whether LRP has a role related to plant defense has not been

established so far and thus we can not conclude that P69B mediates plant defense by this

mechanism. In this study, we showed that P69B degrades the extracellular proteins

165 EPIC1 and EPIC2B of P. infestans. Besides EPIC1 and EPIC2B, two other proteins EPI2

and EPI12 are also likely to be degraded by P69B subtilase (data not shown). Degrading

extracellular proteins from plant pathogens might be an important mechanism by which

P69B mediates plant defenses. However, this conclusion raises some interesting questions. During infection of tomato by P. infestans, a large number of proteins from both the host and the pathogen are secreted in the apoplast. As a pathogenesis-related protease involved in plant defenses, P69B would have to selectively degrade pathogen

proteins, but not plant proteins. How P69B discriminates pathogen proteins from plant

proteins remains unclear. Plant proteins might have different translational modifications

from P. infestans proteins. Alternatively, the cleavage sites of P69B might be common in

P. infestans, but rare in plants. Additional work is needed to determine the specificity of

P69B and the mechanism of selective degradation.

PIP1 represents a novel pathogenesis-related (PR) protein that is induced by SA

(salicylic acid) and pathogens. PR proteins have been defined as plant proteins that are

induced specifically in pathological or related situations (van Loon et al. 1994; van Loon

and van Strien 1999). Based on the criteria described by van Loon and van Strien (1999),

a PR protein must be induced by a pathogen in tissues that do not normally express this

protein, and the induction must occur in at least two different plant-pathogen interactions,

or the induction in a single plant-pathogen interaction must be confirmed independently

by different investigators. pip1 is induced by the salicylic acid analog BTH, the oomycete

P. infestans, and the bacterium P. syingae (Xiao et al. 2001). PIP1 can be regarded as a

PR protein since it fulfils both the definition and the criteria. Obviously, PIP1 is also

expressed in 12-week-old healthy tomato plants since we pulled down PIP1 from

166 intercellular fluids isolated from those plants. However, this does not exclude that PIP1

represents a PR protein, since PR proteins are often expressed in healthy plants at specific developmental stages (van Loon et al. 1994). The role of PIP1 in plant defense responses remains to be demonstrated although it is a PR protein and it is closely related to Rcr3, a secreted cysteine protease required for Cf-2-mediated resistance against the fungus

Cladosporium fulvum carrying the Avr2 avirulence gene (Kruger et al. 2002). Based on the models described by van der Hoorn and Jones (2004), PIP1 could act at multiple levels of plant defense, including perception of invading microbes, mediation of defense signaling, and execution of defense responses.

Several PR proteins, such as glucanases, chitinases, and proteases, are hydrolytic enzymes. Plant pathogens have evolved various mechanisms to protect themselves from the activity of these PR proteins. To avoid the attack by host chitinases, Colletotrichum lagenarium deacetylates chitin in the cell wall rapidly upon infection of plants to render the polymer chain not susceptible to chitinases (Seigrist and Kauss 1990; Punja 2004),

Colletotrichum lindemuthianum excludes chitin as a component of the cell wall within the infection structures (O' Connell and Ride 1990; Punja 2004), and Cladosporium fulvum shields chitin by binding it with secreted AVR4 protein molecules (van den Burg et al. 2004). Pathogens might also evade PR proteins by releasing elicitors below the threshold required for activating defense responses, therefore accumulating lower level of

PR proteins (Krebs and Grumet 1993; Punja 2004). The plant pathogenic bacteria

Pseudomonas syringae suppress SA-dependent pathway by activating the antagonistic JA signaling with the phytotoxin coronatine (COR) (Kloek et al. 2001; Zhao et al. 2003;

Abramovitch and Martin 2004). Apparently, most pathogens attempt to escape from PR

167 proteins. Interestingly, plant pathogenic oomycetes have developed an alternative

mechanism by directly inhibiting PR proteins. P. sojae secretes glucanase inhibitor

proteins (GIPs) to directly inhibit a β-1, 3- glucanase belonging to the PR-2 class (Rose et

al. 2002). The Kazal-like inhibitors EPI1 and EPI10 from P. infestans directly inhibit the pathogenesis-related P69B subtilase to protect other pathogen proteins from degradation.

Here, we also show that the P. infestans cystatin-like extracellular protease inhibitor

EPIC2B targets a novel tomato pathogenesis-related protease PIP1.

EPIC1 is degraded by P69B subtilase in tomato or N. benthamiana intercellular fluids. However, we found that EPIC1 is abundant in intercellular fluids from tomato leaves infected with P. infestans although high levels of P69B can be detected in the same extracts (Tian et al. 2004). This suggests that P69B activity is altered during infection, perhaps through the action of P. infestans protease inhibitors. Since in vitro experiments showed that EPI1 protects rEPIC1 from degradation by P69B and the expression of EPI1 corresponds to P69B temporally and spatially (Tian et al. 2004),

EPI1would be one of the candidates that protect EPIC1 by targeting P69B during the infection process. This data provide indirect in vivo evidence of the roles of P69B and

EPI1 involved in defense and counterdefense.

EPIC2B was found to interact with both PIP1 and Rcr3 in separate experiments.

However, during the coimmunoprecipitation of rEPIC2B with intercellular fluids isolated

from 12-week tomato plants containing Rcr3pim gene, we only pulled down PIP1. There are a couple of explanations that might account for this. First, Rcr3 may not be as abundant as PIP1 although 12-week old plants was used to isolate intercellular fluids for this experiment and Rcr3 is expressed at this growth stage (Kruger et al. 2002). In such

168 case, the levels of Rcr3 may have been too low to be detected by silver staining and

tandem mass spectrometry (Figure 6.7). Second, Rcr3 may have lower binding affinity to

EPIC2B compared to PIP1 and this may have interfered with the coimmunoprecipitation.

It is remarkable that the cystatin-like extracellular protease inhibitors EPIC1 and

EPIC2B of the oomycete P. infestans interact with tomato Rcr3, a defense-related

protease required for resistance to another plant pathogen, the fungus Cladosporium fulvum (Kruger et al. 2002). The molecular mechanism by which Rcr3 mediates

resistance of Cf-2-carrying tomato against Cladosporium fulvum with the Avr2 avirulence

gene is unclear (Kruger et al. 2002; van der Hoorn and Jones 2004; Xia 2004). Among

various possibilities proposed, one guard model proposes that Avr2 inhibits Rcr3 and the

R protein Cf-2 guarding Rcr3 detects such inhibition (van der Hoorn and Jones 2004).

This model seems plausible since Avr2 has now been shown to be a protease inhibitor (J.

D. G. Jones, pers. comm.). P. infestans EPIC1 and EPIC2B may represent effector

proteins that have independently evolved the ability to target Rcr3. The targeting of Rcr3

by effectors from two phylogenetically unrelated plant pathogens suggests that Rcr3

might be a point of convergence in plant defenses against different plant pathogens and

thus has become a shared target. Such observation that plant pathogens attack shared

targets is common in plant-microbe interactions and is consistent with the prediction of

the guard model of pathogen recognition (Dangl and Jones 2001). For example,

Arabidopsis RIN4 has been shown to be a convergence point for the activity of three

unrelated P. syringae type III effectors (Axtell and Staskawicz 2003; Mackey et al.

2003). However, our observation that Rcr3 is targeted by fungal and oomycete pathogens

is the first example of a plant proteins that is targeted by phylogenetically unrelated

169 pathogens.

6.6 ACKNOWLEDGEMENT

We are grateful to Zhenyu Liu and Diane Kinney for technical assistance, Joe win

for critical reading of the draft, Jonathan D. G. Jones from John Innes Centre for

providing us with the seeds of Rcr3 tomato line and the mutants, and the plasmid pMWBin19Rcr3:His:HA. Salaries and research support were provided by State and

Federal Funds appropriated to the Ohio Agricultural Research and Development Center, the Ohio State University.

6.7 REFERENCES

Abramovitch, R.B. and Martin, G.B. 2004. Strategies used by bacterial pathogens to suppress plant defenses. Curr. Opin. Plant Biol. 7: 356-364.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 17: 3389-3402.

Anderson, N.L., Esquer-Blasco, R., Hofmann, J.P., and Anderson, N.G. 1991. A two- dimensional gel database of rat liver proteins useful in gene regulation and drug effects studies. Electrophoresis 12: 907-930.

Apweiler, R., Attwood, T.K., Bairoch, A., Bateman, A., Birney, E., Biswas, M., Bucher, P., Cerutti, L., Corpet, F., Croning, M.D., et al. 2001. The InterPro database, an integrated documentation resource for protein families, domains and functional sites. Nucleic Acids Res. 29: 37-40.

Avrova, A.O., Stewart, H.E., De Jong, W.D., Heilbronn, J., Lyon, G.D., and Birch, P.R. 1999. A cysteine protease gene is expressed early in resistant potato interactions with Phytophthora infestans. Mol. Plant-Microbe Interact. 12: 1114-1119.

Avrova, A.O., Taleb, N., Rokka, V., Heilbronn, J., Campbell, E., Hein, I., Gilroy, E.M., Cardle, L., Bradshaw, J.E., Stewart, H.E., et al. 2004. Potato oxysterol binding protein and cathepsin B are rapidly up-regulated in independent defence pathways that

170 distinguish R gene-mediated and field resistances to Phytophthora infestans. Mol. Plant Pathol. 5: 45-46.

Axtell, M.J. and Staskawicz, B.J. 2003. Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112: 369-377.

Bateman, A., Birney, E., Cerruti, L., Durbin, R., Etwiller, L., Eddy, S.R., Griffiths-Jones, S., Howe, K.L., Marshall, M., and Sonnhammer, E.L. 2002. The Pfam protein families database. Nucleic Acids Res. 30: 276-280.

Beers, E.P., Jones, A.M., and Dickerman, A.W. 2004. The S8 serine, C1A cysteine and A1 aspartic protease families in Arabidopsis. Phytochemistry 65: 43-58.

Birch, P.R.J. and Whisson, S. 2001. Phytophthora infestans enters the genomics era. Mol. Plant Pathol. 2: 257-263.

Calikowski, T.T., Meulia, T., and Meier, I. 2003. A proteomic study of the arabidopsis nuclear matrix. J. Cell Biochem. 90: 361-378.

Caten, C.E. and Jinks, J.L. 1968. Spontaneous variability of single isolates of Phytophthora infestans. I. Cultural variation. Can. J. Bot. 46: 329-347.

Chichkova, N.V., Kim, S.H., Titova, E.S., Kalkum, M., Morozov, V.S., Rubtsov, Y.P., Kalinina, N.O., Taliansky, M.E., and Vartapetian, A.B. 2004. A plant caspase-like protease activated during the hypersensitive response. Plant Cell 16: 157-171.

D'Silva, I., Poirier, G.G., and Heath, M.C. 1998. Activation of cysteine proteases in cowpea plants during the hypersensitive response-a form of programmed cell death. Exp. Cell Res. 245: 389-399.

Dangl, J.L. and Jones, J.D. 2001. Plant pathogens and integrated defence responses to infection. Nature 411: 826-833. de Wit, P.J.G.M. and Spikman, G. 1982. Evidence for the occurence of race and cultivar- specific elicitors of necrosis in intercellular fluids of compatible interactions of Cladosporium fulvum and tomato. Physiol. Plant Pathol. 21: 1-11.

Guevara, M.G., Oliva, C.R., Huarte, M., and Daleo, G.R. 2002. An aspartic protease with antimicrobial activity is induced after infection and wounding in intercellular fluids of potato tubers. Eur. J. Plant Pathol. 108: 131-137.

Hatsugai, N., Kuroyanagi, M., Yamada, K., Meshi, T., Tsuda, S., Kondo, M., Nishimura, M., and Hara-Nishimura, I. 2004. A plant vacuolar protease, VPE, mediates virus- induced hypersensitive cell death. Science 305: 855-858.

Henikoff, J.G., Greene, E.A., Pietrokovski, S., and Henikoff, S. 2000. Increased coverage of protein families with the blocks database servers. Nucleic Acids Res. 28: 228-230. 171 Kamoun, S., van West, P., de Jong, A.J., de Groot, K., Vleeshouwers, V., and Govers, F. 1997. A gene encoding a protein elicitor of Phytophthora infestans is down-regulated during infection of potato. Mol. Plant-Microbe Interact. 10: 13-20.

Kamoun, S., Young, M., Glascock, C., and Tyler, B.M. 1993. Extracellular protein elicitors from Phytophthora: Host-specificity and induction of resistance to fungal and bacterial phytopathogens. Mol. Plant-Microbe Interact. 6: 15-25.

Karsch-Mizrachi, I. and Ouellette, B.F. 2001. The GenBank sequence database. Methods Biochem. Anal. 43: 45-63.

Kloek, A.P., Verbsky, M.L., Sharma, S.B., Schoelz, J.E., Vogel, J., Klessig, D.F., and Kunkel, B.N. 2001. Resistance to Pseudomonas syringae conferred by an Arabidopsis thaliana coronatine-insensitive (coi1) mutation occurs through two distinct mechanisms. Plant J. 26: 509-522.

Krebs, S.L. and Grumet, R. 1993. Characterization of celery hydrolytic enzymes produced in response to infection by Fusarium oxysporum. Physiological and Molecular Plant Pathology 43: 193-208.

Kruger, J., Thomas, C.M., Golstein, C., Dixon, M.S., Smoker, M., Tang, S., Mulder, L., and Jones, J.D. 2002. A tomato cysteine protease required for Cf-2-dependent disease resistance and suppression of autonecrosis. Science 296: 744-747.

Letunic, I., Goodstadt, L., Dickens, N.J., Doerks, T., Schultz, J., Mott, R., Ciccarelli, F., Copley, R.R., Ponting, C.P., and Bork, P. 2002. Recent improvements to the SMART domain-based sequence annotation resource. Nucleic Acids Res. 30: 242-244.

Liu, Y., Dammann, C., and Bhattacharyya, M.K. 2001. The matrix metalloproteinase gene GmMMP2 is activated in response to pathogenic infections in soybean. Plant Physiol. 127: 1788-1797.

Liu, Z., Bos, J.I., Armstrong, M., Whisson, S.C., da Cunha, L., Torto-Alalibo, T., Win, J., Avrova, A.O., Wright, F., Birch, P.R., et al. 2004. Patterns of diversifying selection in the phytotoxin-like scr74 gene family of Phytophthora infestans. Mol. Biol. Evol. in press.

Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R., and Dangl, J.L. 2003. Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Cell 112: 379-389.

Merril, C.R., Goldman, D., Sedman, S.A., and Ebert, M.H. 1981. Ultrasensitive stain for proteins in polyacrylamide gels shows regional variation in cerebrospinal fluid proteins. Science 211: 1437-1438.

Mosolov, V.V., Grigor'eva, L.I., and Valueva, T.A. 2001. Involvement of proteolytic enzymes and their inhibitors in plant protection. Appl. Biochem. Microbiol. 37: 115-123.

172 Nielsen, H., Engelbrecht, J., Brunak, S., and von Heijne, G. 1997. A neural network method for identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Int. J. Neural Syst. 8: 581-599.

Nielsen, H. and Krogh, A. 1998. Prediction of signal peptides and signal anchors by a hidden Markov model. In Proceedings of the Sixth International Conference on Intelligent Systems for Molecular Biology (ISMB 6), pp. 122--130. AAAI Press, Menlo Park, California.

O' Connell, R.J. and Ride, J.P. 1990. Chemical detection and ultrastructural localization of chitin in cell walls of Collectotrichum lindemuthianum. Physiological and Molecular Plant Pathology 37: 39-53.

Page, R.D. 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12: 357-358.

Punja, Z.K. 2004. Fungal Disease Resistance in Plants. Food Products Press, Binghamton, NY.

Ristaino, J.B. 2002. Tracking historic migrations of the Irish potato famine pathogen, Phytophthora infestans. Microbes Infect. 4: 1369-1377.

Rojo, E., Martin, R., Carter, C., Zouhar, J., Pan, S., Plotnikova, J., Jin, H., Paneque, M., Sanchez-Serrano, J.J., Baker, B., et al. 2004. VPEγ exhibits a caspase-like activity that contributes to defense against pathogens. Curr. Biol. 14: 1897-1906.

Rose, J.K., Ham, K.S., Darvill, A.G., and Albersheim, P. 2002. Molecular cloning and characterization of glucanase inhibitor proteins: coevolution of a counterdefense mechanism by plant pathogens. Plant Cell 14: 1329-1345.

Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

Seigrist, J. and Kauss, H. 1990. Chitin deacetylase in cucumber leaves infected by Colletotrichum lagenarium. Physiolgical and Molecualr Plant Pathology 36: 267-275.

Shattock, R.C. 2002. Phytophthora infestans: populations, pathogenicity and phenylamides. Pest Manag. Sci. 58: 944-950.

Smart, C.D. and Fry, W.E. 2001. Invasions by the late blight pathogen: renewed sex and enhanced fitness. Biol. Invas. 3: 235-243.

Solomon, M., Belenghi, B., Delledonne, M., Menachem, E., and Levine, A. 1999. The involvement of cysteine proteases and protease inhibitor genes in the regulation of programmed cell death in plants. Plant Cell 11: 431-444.

173 Stahl, E.A. and Bishop, J.G. 2000. Plant-pathogen arms races at the molecular level. Curr. Opin. Plant Biol. 3: 299-304.

Suty, L., Lequeu, J., Lancon, A., Etienne, P., Petitot, A.S., and Blein, J.P. 2003. Preferential induction of 20S proteasome subunits during elicitation of plant defense reactions: towards the characterization of "plant defense proteasomes". Int. J. Biochem. Cell Biol. 35: 637-650.

Tatusov, R.L., Koonin, E.V., and Lipman, D.J. 1997. A genomic perspective on protein families. Science 278: 631-637.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25: 4876-4882.

Tian, M., Huitema, E., Da Cunha, L., Torto-Alalibo, T., and Kamoun, S. 2004. A Kazal- like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. J. Biol. Chem. 279: 26370-26377.

TÖR, M., YEMM, A., and HOLUB, E. 2003. The role of proteolysis in R gene mediated defence in plants. Mol. Plant Pathol. 4: 287-296.

Tornero, P., Conejero, V., and Vera, P. 1997. Identification of a new pathogen-induced member of the subtilisin-like processing protease family from plants. J. Biol. Chem. 272: 14412-14419.

Tornero, P., Mayda, E., Gomez, M.D., Canas, L., Conejero, V., and Vera, P. 1996. Characterization of LRP, a leucine-rich repeat (LRR) protein from tomato plants that is processed during pathogenesis. Plant J. 10: 315-330.

Torto, T.A., Li, S., Styer, A., Huitema, E., Testa, A., Gow, N.A., van West, P., and Kamoun, S. 2003. EST mining and functional expression assays identify extracellular effector proteins from the plant pathogen Phytophthora. Genome Res. 13: 1675-1685.

Torto, T.A., Rauser, L., and Kamoun, S. 2002. The pipg1 gene of the oomycete Phytophthora infestans encodes a fungal-like endopolygalacturonase. Curr. Genet. 40: 385-390. van den Burg, H.A., Spronk, C.A., Boeren, S., Kennedy, M.A., Vissers, J.P., Vuister, G.W., de Wit, P.J., and Vervoort, J. 2004. Binding of the AVR4 elicitor of Cladosporium fulvum to chitotriose units is facilitated by positive allosteric protein-protein interactions: the chitin-binding site of AVR4 represents a novel binding site on the folding scaffold shared between the invertebrate and the plant chitin-binding domain. J. Biol. Chem. 279: 16786-16796. van der Hoorn, R.A. and Jones, J.D. 2004. The plant proteolytic machinery and its role in defence. Curr. Opin. Plant Biol. 7: 400-407. 174 van Loon, L.C., Pierpoint, W.S., Boller, T., and Conejero, V. 1994. Recommendations for naming plant pathogenesis-related proteins. Plant Molecular Biology Reporter 12: 245-264.

van Loon, L.C. and van Strien, E.A. 1999. The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiological and Molecular Plant Pathology 55: 85-97.

Vera, P. and Conejero, V. 1988. Pathogenesis-related proteins of tomato. Plant Physiol. 87: 58-63.

Waugh, M., Hraber, P., Weller, J., Wu, Y., Chen, G., Inman, J., Kiphart, D., and Sobral, B. 2000. The Phytophthora genome initiative database: informatics and analysis for distributed pathogenomic research. Nucleic Acids Res. 28: 87-90.

Xia, Y. 2004. Proteases in pathogenesis and plant defence. Cell Microbiol. 6: 905-913.

Xia, Y., Suzuki, H., Borevitz, J., Blount, J., Guo, Z., Patel, K., Dixon, R.A., and Lamb, C. 2004. An extracellular aspartic protease functions in Arabidopsis disease resistance signaling. EMBO J. 23: 980-988.

Xiang, C., Han, P., Lutziger, I., Wang, K., and Oliver, D.J. 1999. A mini binary vector series for plant transformation. Plant Mol. Biol. 40: 711-717.

Xiao, F., Tang, X., and Zhou, J.M. 2001. Expression of 35S::Pto globally activates defense-related genes in tomato plants. Plant Physiol. 126: 1637-1645.

Zeng, L.R., Qu, S., Bordeos, A., Yang, C., Baraoidan, M., Yan, H., Xie, Q., Nahm, B.H., Leung, H., and Wang, G.L. 2004. Spotted leaf11, a negative regulator of plant cell death and defense, encodes a U-box/armadillo repeat protein endowed with E3 ubiquitin ligase activity. Plant Cell 16: 2795-2808.

Zhao, Y., Thilmony, R., Bender, C.L., Schaller, A., He, S.Y., and Howe, G.A. 2003. Virulence systems of Pseudomonas syringae pv. tomato promote bacterial speck disease in tomato by targeting the jasmonate signaling pathway. Plant J. 36: 485-499.

175

Figure 6.1. A family of cystatin-like extracellular protease inhibitors from Phytophthora spp. A, Schematic representation of the structure of Phytophthora infestans EPIC1- EPIC4 proteins. Predicted signal peptides (SP) and cystatin-like domains are shown in gray. The letters above the box represent the amino acid sequence of cystatin-like domains determined based on the signature of cystatin-like cysteine proteinase inhibitors described at PROSITE (http://us.expasy.org/prosite/) with the documentation number of PDOC00259. Numbers represent the positions of amino acid residues starting from the N terminus. B, Phylogenetic relationships of 13 cystatin-like extracellular proteinase inhibitors from P. infestans, P. sojae and P. ramorum (Table 6.2). The neighbor-joining tree was generated as described in Methods. Bootstrap values higher than 500 from 1,000 replications are shown. The length of the branches reflects weighted amino acid substitutions and the scale bar indicates 10% weighted sequence divergence. Two clusters of orthologous genes from three species are indicated by vertical lines. 176

Figure 6.2. RT-PCR analysis of expression of epiC genes during time course of colonization of tomato by P. infestans. Total RNA isolated from non-infected leaves (To), infected leaves of tomato, 1, 2, 3, or 4 days after inoculation, and from P. infestans mycelium grown in synthetic medium (My) was used in RT-PCR amplifications. Amplifications of P. infestans elongation factor 2 alpha (ef2α) were used as controls to determine the relative expression of epiC genes.

177

Figure 6.3. rEPIC1 and rEPIC2B are unstable in BTH-induced tomato intercellular fluids (TIF). rEPIC1 and rEPIC2B were incubated with BTH-induced TIF (+) or with the corresponding buffer control (-) for 30min at 25 oC, followed by immunobloting with FLAG antibody. The numbers on the left indicate the molecular masses of the marker proteins in kDa.

178

Figure 6.4. Tomato P69B subtilase degrades EPIC1 and EPIC2B. rEPIC1 and rEPIC2B were incubated with intercellular fluids isolated from N. benthamiana leaves infiltrated with A. tumefaciens containing the binary vector pCB302-3 (-) or pCB302-P69B (+) for 30min at 25 oC, followed by immunoblotting with FLAG antibody. The expression and protease activity of P69B was tested by Western blot and in-gel protease assay, respectively, and described in Chapter 4. The same amount of rEPIC1 and rEPIC2B were loaded as controls (C).

179

Figure 6.5. P. infestans EPI1 protects EPIC1 and EPIC2B from degradation. rEPIC1 and rEPIC2B were incubated with BTH-treated tomato leaf intercellular fluids (TIF) (A), or P69B-expressing N. benthamiana intercellular fluids (NIF-P69B) (B), which were pre- incubated with or without HIS-EPI1. HIS-EPI1, rEPIC1 and rEPIC2B without the addition of intercellular fluids were taken as controls. HIS-EPI1, TIF, NIF-P69B indicate whether or not they were added to the reaction mix. rEPIC1 and rEPIC2B indicate that they were added to the reaction mix. All the samples were applied for SDS-PAGE gel followed by immunobloting using both FLAG (α-FLAG) and HIS (α-HIS) antibody.

180

Figure 6.6. EPIC1 protein is abundantly secreted in tomato apoplast during infection. Equal volumes of tomato intercellular fluids isolated from non-infected leaves (To), infected leaves of tomato, 1, 2, 3, or 4 days after inoculation, and P. infestans culture filtrate (CF) were applied for Western blot analyses with EPIC1 antisera.

181

Figure 6.7. EPIC2B interacts with a tomato cysteine protease of papain family. A, coimmunoprecipitation of rEPIC2B with intercellular fluids from tomato plants containing wild-type Rcr3pim gene and mutated rcr3-3 with anti-FLAG antibody. Rcr3 or rcr3-3 indicates intercellular fluids from Rcr3pim or rcr3-3 plants were added to the reaction mix. rEPIC2B indicates whether or not rEPIC2B was added to the mix. Eluates from coimmunoprecipitation were run on the SDS-PAGE gel followed by staining with silver nitrate. The band cored for tandem mass spectrometry is indicated by a circle. B, The alignment of PIP1 with papain from Carica papaya (Genbank gi:67642), the type member of C1A cysteine proteases. The predicted signal peptide sequences are shown in italics. The two peptides of PIP1 sequenced by tandem mass spectrometry are underlined in bold. The conserved protease catalytic triad residues ( C154, H287, and N309 ) predicted based on the consensus patterns of eukaryotic thiol (cysteine) protease active sites (PROSITE: PDOC00126) are shown by asterisks. The conserved sequences around catalytic residues are shaded.

182

Figure 6.8. PIP1 is closely related to tomato defense-related cysteine protease Rcr3. The neighbor-joining phylogenetic tree was constructed with PIP1, 138 plant papain-like C1A proteases described by Beers et al. (2004), and a putative C1A protease encoded by Nicotiana benthamiana EST CK295119. Bootstrap values higher than 500 from 1,000 replications are shown. The length of the branches reflects weighted amino acid substitutions and the scale bar indicates 10% weighted sequence divergence. The genus name and the GenBank accession number are given for all sequences. The sequences that have been assigned to eight tentative groups (C1A-1-C1A-8) (Beers et al. 2004) are color-coded. PIP1 and tomato Rcr3 are indicated with arrows.

183

Figure 6.9. The expression of PIP1 is induced by BTH and P. infestans. A, Equal volumes of intercellular fluids isolated from H2O-treated (-) and BTH-treated (+) tomato plants were applied for Western blot analyses with PIP1 antisera. B, Equal volumes of tomato intercellular fluids isolated from untreated leaves (To), and detached leaves sprayed with H2O (-) or P. infestans 90128 zoospore suspension and harvested at 1 (1d), 2 (2d), 3 (3d) and 4 (4d) days postinoculation were applied for Western blot analyses with PIP1 antisera.

184

Figure 6.10. EPIC1 and EPIC2B interact with the tomato papain-like cysteine protease Rcr3. A, Expression of Rcr3pim in N. benthamiana using agroinfiltration. Intercellular fluids from leaves infiltrated with A. tumefaciens carrying an empty binary vector pMWBin19 (-) or a pMWBin19Rcr3:HIS:HA construct (+) were separated by SDS- PAGE and immunobloted with HIS antisera. B, Coimmunoprecipitation of rEPIC1 and rEPIC2B with intercellular fluids described in A using FLAG antisera. Pulldown eluates from each coimmunoprecipitation were separated by SDS-PAGE and stained with silver nitrate. The lower molecular mass bands correspond to rEPIC1 and rEPIC2B respectively, and the high molecular mass bands correspond to the interacting protein with rEPIC1 and rEPIC2B. The band cored for tandem mass spectrometry is indicated by a circle. C, The amino acid sequence of Rcr3pim (Genbank accession number AF493232) protease precursor is shown with the signal peptide sequence in italics and the propeptide domain sequence in gray. The peptide of 15 amino acids sequenced by tandem mass spectrometry is shown in underlined bold type.

185

Figure 6.11. Model of cascades of inhibition of tomato defense-related proteases mediated by extracellular protease inhibitors of P. infestans. Proteins secreted by P. infestans are shaded in gray. Proteins from tomato are shown in white.

186 Genes Primers epi1 F: 5’-gcggaattcTCAAAGCCCGCAAGTCATCAG-3’ R: 5’- gcgggtaccTTATCCCTCCTGCGGTGTC-3’ epiC1 F: 5’-gcggaattcCCAAGTGGACGGCGGATACT-3’ R: 5’-gcggcggccgcggtacCTACTTAACTGGGGTAATCGACGTCAC-3’ epiC2B F: 5’-gcggaattcCCAACTGAACGGATACTCAAAG-3’ R: 5’-gcggcggccgcggtaccTTAGTTGGCGGGCGTAATCGAC-3’ epiC3 F: 5’-gcgatcgATGGCTTTCACTCGTTCCATC -3’ R: 5’-gcggcggccgcggtaccTTATCCTTGGTACTCTGCAGGCGT-3’ epiC4 F: 5’-gcgaagcttCGCGACGTCGTTACTATCGGC-3’ R: 5’-gcggcggccgctctagaCTATACGAAATCAGAAAACATAGC-3’ pip1 F: 5’-gcgggatccATGGCTTCCAATTTTTTCCTCAAG-3’ R: 5’-gcgactagtTCAgtgatggtgatggtgatgAGCAGTAGGGAACGACGCAACCTTTGC-3’

Table 6.1. Primers used in Chapter 6. The letters in upper case represent gene-specific nucleotide sequence. The letters in lower case represent added nucleotides for the convenience of cloning. The restriction sites used for cloning epi1, epiC1 and epiC2B are underlined.

187

Species Protein GenBankTM Signal Expression stage accession number Peptide P. infestans EPIC1 AY935250 Yes Infected tomato, zoospores, germinating cysts P. infestans EPIC2A AY935251 Yes Genomic sequence P. infestans EPIC2B AY935252 Yes Infected tomato P. infestans EPIC3 AY935253 Yes Infected tomato, germinating cysts Infected tomato; mycellium, non-sporulating growth, nitrogen starvation; mating culture; ungerminated P. infestans EPIC4 AY935254 Yes sporangia P. sojae PsEPIC3 324122233 Yes genomic sequence P. sojae PsEPIC4 275924893 Yes genomic sequence P. sojae PsEPIC5 324093992 Yes genomic sequence P. sojae PsEPIC6 275780911 Yes genomic sequence P. ramorum PrEPIC3 324535088 Yes genomic sequence P. ramorum PrEPIC4 324478325 Yes genomic sequence P. ramorum PrEPIC5 324204607 Yes genomic sequence P. ramorum PrEPIC7 303543465 Yes genomic sequence

Table 6.2. Predicted cystatin-like extracellular protease inhibitors from the oomycete plant pathogens Phytophthora infestans, Phytophthora sojae and Phytophthora ramorum.

188 BIBLIOGRAPHY

Abrahamsen, M.S., Templeton, T.J., Enomoto, S., Abrahante, J.E., Zhu, G., Lancto, C.A., Deng, M., Liu, C., Widmer, G., Tzipori, S., et al. 2004. Complete genome sequence of the apicomplexan, Cryptosporidium parvum. Science 304: 441-445.

Abramovitch, R.B. and Martin, G.B. 2004. Strategies used by bacterial pathogens to suppress plant defenses. Curr. Opin. Plant Biol. 7: 356-364.

Allen, R.L., Bittner-Eddy, P.D., Grenville-Briggs, L.J., Meitz, J.C., Rehmany, A.P., Rose, L.E., and Beynon, J.L. 2004. Host-parasite coevolutionary conflict between Arabidopsis and downy mildew. Science 306: 1957-1960.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 17: 3389-3402.

Anderson, N.L., Esquer-Blasco, R., Hofmann, J.P., and Anderson, N.G. 1991. A two- dimensional gel database of rat liver proteins useful in gene regulation and drug effects studies. Electrophoresis 12: 907-930.

Andreu, A., Tonón, C., Van Damme, M., Van Damme, M., Huarte, M., Huarte, M., and Daleo, G. 1998. Effect of glucans from different races of Phytophthora infestans on defense reactions in potato tuber. Eur. J. Plant Pathol. 104: 777-783.

Apweiler, R., Attwood, T.K., Bairoch, A., Bateman, A., Birney, E., Biswas, M., Bucher, P., Cerutti, L., Corpet, F., Croning, M.D., et al. 2001. The InterPro database, an integrated documentation resource for protein families, domains and functional sites. Nucleic Acids Res. 29: 37-40.

Atchley, W.R., Lokot, T., Wollenberg, K., Dress, A., and Ragg, H. 2001. Phylogenetic analyses of amino acid variation in the serpin proteins. Mol. Biol. Evol. 18: 1502-1511.

Avrova, A.O., Stewart, H.E., De Jong, W.D., Heilbronn, J., Lyon, G.D., and Birch, P.R. 1999. A cysteine protease gene is expressed early in resistant potato interactions with Phytophthora infestans. Mol. Plant-Microbe Interact. 12: 1114-1119.

189 Avrova, A.O., Taleb, N., Rokka, V., Heilbronn, J., Campbell, E., Hein, I., Gilroy, E.M., Cardle, L., Bradshaw, J.E., Stewart, H.E., et al. 2004. Potato oxysterol binding protein and cathepsin B are rapidly up-regulated in independent defence pathways that distinguish R gene-mediated and field resistances to Phytophthora infestans. Mol. Plant Pathol. 5: 45-46.

Axtell, M.J. and Staskawicz, B.J. 2003. Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112: 369-377.

Baldauf, S.L., Roger, A.J., Wenk-Siefert, I., and Doolittle, W.F. 2000. A kingdom-level phylogeny of eukaryotes based on combined protein data. Science 290: 972-977.

Barrier, M., Bustamante, C.D., Yu, J., and Purugganan, M.D. 2003. Selection on rapidly evolving proteins in the Arabidopsis genome. Genetics 163: 723-733.

Bateman, A., Birney, E., Cerruti, L., Durbin, R., Etwiller, L., Eddy, S.R., Griffiths-Jones, S., Howe, K.L., Marshall, M., and Sonnhammer, E.L. 2002. The Pfam protein families database. Nucleic Acids Res. 30: 276-280.

Beers, E.P., Jones, A.M., and Dickerman, A.W. 2004. The S8 serine, C1A cysteine and A1 aspartic protease families in Arabidopsis. Phytochemistry 65: 43-58.

Bendtsen, J.D., Nielsen, H., von Heijne, G., and Brunak, S. 2004. Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340: 783-795.

Birch, P.R.J. and Whisson, S. 2001. Phytophthora infestans enters the genomics era. Mol. Plant Pathol. 2: 257-263.

Bos, J.I.B., Armstrong, M., Whisson, S.C., Torto, T., Ochwo, M., Birch, P.R.J., and Kamoun, S. 2003. Intraspecific comparative genomics to identify avirulence genes from Phytophthora. New Phytol. 159:63-72.

Bouarab, K., Melton, R., Peart, J., Baulcombe, D., and Osbourn, A. 2002. A saponin- detoxifying enzyme mediates suppression of plant defences. Nature 418: 889-892.

Bromme, D., Nallaseth, F.S., and Turk, B. 2004. Production and activation of recombinant papain-like cysteine proteases. Methods 32: 199-206.

Brunner, F., Wirtz, W., Rose, J.K., Darvill, A.G., Govers, F., Scheel, D., and Nurnberger, T. 2002. A beta-glucosidase/xylosidase from the phytopathogenic oomycete Phytophthora infestans. Phytochemistry 59: 689-696.

Bruno, S., Duschak, V.G., Ledesma, B., Ferella, M., Andersson, B., Guarnera, E.A., and Angel, S.O. 2004. Identification and characterization of serine proteinase inhibitors from Neospora caninum. Mol. Biochem. Parasitol. 136: 101-107.

190 Bushnell, W.R. and Rowell, J.B. 1981. Suppressors of defense reactions: a model for roles in specificity. Phytopathology 71: 1012-1014.

Calikowski, T.T., Meulia, T., and Meier, I. 2003. A proteomic study of the arabidopsis nuclear matrix. J. Cell Biochem. 90: 361-378.

Caten, C.E. and Jinks, J.L. 1968. Spontaneous variability of single isolates of Phytophthora infestans. I. Cultural variation. Can. J. Bot. 46: 329-347.

Chain, P., Lamerdin, J., Larimer, F., Regala, W., Lao, V., Land, M., Hauser, L., Hooper, A., Klotz, M., Norton, J., et al. 2003. Complete genome sequence of the ammonia- oxidizing bacterium and obligate chemolithoautotroph Nitrosomonas europaea. J. Bacteriol. 185: 2759-2773.

Chichkova, N.V., Kim, S.H., Titova, E.S., Kalkum, M., Morozov, V.S., Rubtsov, Y.P., Kalinina, N.O., Taliansky, M.E., and Vartapetian, A.B. 2004. A plant caspase-like protease activated during the hypersensitive response. Plant Cell 16: 157-171.

Coffeen, W.C. and Wolpert, T.J. 2004. Purification and characterization of serine proteases that exhibit caspase-like activity and are associated with programmed cell death in Avena sativa. Plant Cell 16(4): 857-873

Coffey, M.D. and Wilson, U.E. 1983. Histology and cytology of infection and disease caused by Phytophthora. In Phytophthora (eds. D.C. Erwin S. Bartnicki-Garcia, and P.H. Tsao), pp. 289-301. Am. Phytopathol. Soc., St. Paul.

Damasceno, C.M.B., Ripoll, D.R., Kamoun, S., Bishop, J., and Rose, J.K.C. 2004. Molecular cloning and characterization of the GIP gene family from Phytophthora infestans. Phytopathology 94: S24.

Dangl, J.L. and Jones, J.D. 2001. Plant pathogens and integrated defence responses to infection. Nature 411: 826-833.

De Lorenzo, G., D'Ovidio, R., and Cervone, F. 2001. The role of polygalacturonase- inhibiting proteins (PGIPs) in defense against pathogenic fungi. Annu. Rev. Phytopathol. 39: 313-335.

de Wit, P.J.G.M. and Spikman, G. 1982. Evidence for the occurence of race and cultivar- specific elicitors of necrosis in intercellular fluids of compatible interactions of Cladosporium fulvum and tomato. Physiol. Plant Pathol. 21: 1-11.

Delaria, K.A., Muller, D.K., Marlor, C.W., Brown, J.E., Das, R.C., Roczniak, S.O., and Tamburini, P.P. 1997. Characterization of placental bikunin, a novel human serine protease inhibitor. J. Biol. Chem. 272: 12209-12214.

191 D'Silva, I., Poirier, G.G., and Heath, M.C. 1998. Activation of cysteine proteases in cowpea plants during the hypersensitive response-a form of programmed cell death. Exp. Cell Res. 245: 389-399.

Dubey, J.P. 1998. Re-examination of resistance of Toxoplasma gondii tachyzoites and bradyzoites to pepsin and trypsin digestion. Parasitology 116 ( Pt 1): 43-50.

Duncan, J.M. 1999. Phytophthora-an abiding threat to our crops. Microbiol. Today 26: 114-116.

Erwin, D.C. and Ribeiro, O.K. 1996. Phytophthora Diseases Worldwide. APS Press, St. Paul, Minnesota.

Fellbrich, G., Romanski, A., Varet, A., Blume, B., Brunner, F., Engelhardt, S., Felix, G., Kemmerling, B., Krzymowska, M., and Nurnberger, T. 2002. NPP1, a Phytophthora- associated trigger of plant defense in parsley and Arabidopsis. Plant J. 32: 375-390.

Fry, W.E. and Goodwin, S.B. 1997. Resurgence of the Irish potato famine fungus. Bioscience 47: 363-371.

Garelik, G. 2002. Agriculture. Taking the bite out of potato blight. Science 298: 1702- 1704.

Golding, G.B. and Dean, A.M. 1998. The structural basis of molecular adaptation. Mol. Biol. Evol. 15: 355-369.

Gornhardt, B., Rouhara, I., and Schmelzer, E. 2000. Cyst germination proteins of the potato pathogen Phytophthora infestans share homology with human mucins. Mol. Plant- Microbe Interact. 13: 32-42.

Guevara, M.G., Oliva, C.R., Huarte, M., and Daleo, G.R. 2002. An aspartic protease with antimicrobial activity is induced after infection and wounding in intercellular fluids of potato tubers. Eur. J. Plant Pathol. 108: 131-137.

Hanna, S.L., Sherman, N.E., Kinter, M.T., and Goldberg, J.B. 2000. Comparison of proteins expressed by Pseudomonas aeruginosa strains representing initial and chronic isolates from a cystic fibrosis patient: an analysis by 2-D gel electrophoresis and capillary column liquid chromatography-tandem mass spectrometry. Microbiology 146 ( Pt 10): 2495-2508.

Hatsugai, N., Kuroyanagi, M., Yamada, K., Meshi, T., Tsuda, S., Kondo, M., Nishimura, M., and Hara-Nishimura, I. 2004. A plant vacuolar protease, VPE, mediates virus- induced hypersensitive cell death. Science 305: 855-858.

Heath, M.C. 1995. Signal exchange between higher plants and rust fungi. Can. J. Bot. 73(SUPPL. 1): S616-S623.

192 Heath, M.C. 2000. Hypersensitive response-related death. Plant Mol. Biol. 44: 321-334.

Henikoff, J.G., Greene, E.A., Pietrokovski, S., and Henikoff, S. 2000. Increased coverage of protein families with the blocks database servers. Nucleic Acids Res. 28: 228-230.

Hughes, A.L. and Nei, M. 1988. Pattern of nucleotide substitution at major histocompatibility complex class I loci reveals overdominant selection. Nature 335: 167- 170.

Huitema, E., Torto, T.A., Styer, A., and Kamoun, S. 2003. Combined ESTs from plant- microbe interactions: Using GC counting to determine the species of origin. In Functional genomics: Methods and Protocols (ed. E. Grotewold), pp. in press. Humana Press.

Irving, J.A., Pike, R.N., Lesk, A.M., and Whisstock, J.C. 2000. Phylogeny of the serpin superfamily: implications of patterns of amino acid conservation for structure and function. Genome Res. 10: 1845-1864.

Jayakumar, A., Kang, Y., Mitsudo, K., Henderson, Y., Frederick, M.J., Wang, M., El- Naggar, A.K., Marx, U.C., Briggs, K., and Clayman, G.L. 2004. Expression of LEKTI domains 6-9' in the baculovirus expression system: recombinant LEKTI domains 6-9' inhibit trypsin and subtilisin A. Protein Expr. Purif. 35: 93-101.

Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P., and Valent, B. 2000. Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. EMBO J. 19: 4004-4014.

Johansson, M.W., Keyser, P., and Soderhall, K. 1994. Purification and cDNA cloning of a four-domain Kazal proteinase inhibitor from crayfish blood cells. Eur. J. Biochem. 223: 389-394.

Joosten, M.H.A.J., Vogelsang, R., Cozijnsen, T.J., Verberne, M.C., and de Wit, P.J.G.M. 1997. The biotrophic fungus Cladosporium fulvum circumvents Cf-4 mediated resistance by producing unstable AVR4 elicitors. Plant Cell 9: 367-379.

Jorda, L., Coego, A., Conejero, V., and Vera, P. 1999. A genomic cluster containing four differentially regulated subtilisin-like processing protease genes is in tomato plants. J. Biol. Chem. 274: 2360-2365.

Jorda, L., Conejero, V., and Vera, P. 2000. Characterization of P69E and P69F, two differentially regulated genes encoding new members of the subtilisin-like proteinase family from tomato plants. Plant Physiol. 122: 67-73.

Judelson, H.J. 1996. Recent advances in the genetics of oomycete plant-pathogens. Mol. Plant-Microbe Interact. 9: 443-449.

193 Judelson, H.J. 1997. The genetics and biology of Phytophthora infestans: Modern approaches to a historical challenge. Fungal Genet. Biol. 22: 65-76.

Kamoun, S. 2003. Molecular genetics of pathogenic oomycetes. Eukaryotic Cell 2: 191- 199.

Kamoun, S., Dong, S., Hamada, W., Huitema, E., Kinney, D., Morgan, W.R., Styer, A., Testa, A., and Torto, T. 2002. From sequence to phenotype: Functional genomics of Phytophthora. Can. J. Plant Pathol. 24: 6-9.

Kamoun, S., Huitema, E., and Vleeshouwers, V.G.A.A. 1999. Resistance to oomycetes: A general role for the hypersensitive response? Trends Plant Sci. 4: 196-200.

Kamoun, S., van West, P., de Jong, A.J., de Groot, K., Vleeshouwers, V., and Govers, F. 1997. A gene encoding a protein elicitor of Phytophthora infestans is down-regulated during infection of potato. Mol. Plant-Microbe Interact. 10: 13-20.

Kamoun, S., van West, P., Vleeshouwers, V.G., de Groot, K.E., and Govers, F. 1998. Resistance of Nicotiana benthamiana to Phytophthora infestans is mediated by the recognition of the elicitor protein INF1. Plant Cell 10: 1413-1426.

Kamoun, S., Young, M., Glascock, C., and Tyler, B.M. 1993. Extracellular protein elicitors from Phytophthora: Host-specificity and induction of resistance to fungal and bacterial phytopathogens. Mol. Plant-Microbe Interact. 6: 15-25.

Karsch-Mizrachi, I. and Ouellette, B.F. 2001. The GenBank sequence database. Methods Biochem. Anal. 43: 45-63.

Kimura, M. 1983. The Neutral Theory of Molecular Evolution. Cambridge University Press, Cambridge.

Kloek, A.P., Verbsky, M.L., Sharma, S.B., Schoelz, J.E., Vogel, J., Klessig, D.F., and Kunkel, B.N. 2001. Resistance to Pseudomonas syringae conferred by an Arabidopsis thaliana coronatine-insensitive (coi1) mutation occurs through two distinct mechanisms. Plant J. 26: 509-522.

Knogge, W. 1996. Fungal infections of plants. Plant Cell 8: 1711-1722.

Komiyama, T., Bigler, T.L., Yoshida, N., Noda, K., and Laskowski, M., Jr. 1991. Replacement of P1 Leu18 by Glu18 in the reactive site of turkey ovomucoid third domain converts it into a strong inhibitor of Glu-specific Streptomyces griseus proteinase (GluSGP). J. Biol. Chem. 266: 10727-10730.

Krebs, S.L. and Grumet, R. 1993. Characterization of celery hydrolytic enzymes produced in response to infection by Fusarium oxysporum. Physiological and Molecular Plant Pathology 43: 193-208.

194 Kreutzmann, P., Schulz, A., Standker, L., Forssmann, W.G., and Magert, H.J. 2004. Recombinant production, purification and biochemical characterization of domain 6 of LEKTI: a temporary Kazal-type-related serine proteinase inhibitor. J. Chromatogr. B. Analyt. Technol. Biomed. Life Sci. 803: 75-81

Kruger, J., Thomas, C.M., Golstein, C., Dixon, M.S., Smoker, M., Tang, S., Mulder, L., and Jones, J.D. 2002. A tomato cysteine protease required for Cf-2-dependent disease resistance and suppression of autonecrosis. Science 296: 744-747.

Laskowski, M., Jr. and Kato, I. 1980. Protein inhibitors of proteinases. Annu. Rev. Biochem. 49: 593-626.

Laskowski, M., Jr., Kato, I., Ardelt, W., Cook, J., Denton, A., Empie, M.W., Kohr, W.J., Park, S.J., Parks, K., Schatzley, B.L., et al. 1987. Ovomucoid third domains from 100 avian species: isolation, sequences, and hypervariability of enzyme-inhibitor contact residues. Biochemistry 26: 202-221.

Laskowski, M., Jr., Qasim, M.A., and Yi, Z. 2003. Additivity-based prediction of equilibrium constants for some protein-protein associations. Curr. Opin. Struct. Biol. 13: 130-139.

Latijnhouwers, M., Ligterink, W., Vleeshouwers, V.G., van West, P., and Govers, F. 2004. A G subunit controls zoospore motility and virulence in the potato late blight pathogen Phytophthora infestans. Mol. Microbiol. 51: 925-936.

Lauber, T., Schulz, A., Schweimer, K., Adermann, K., and Marx, U.C. 2003. Homologous proteins with different folds: the three-dimensional structures of domains 1 and 6 of the multiple Kazal-type inhibitor LEKTI. J. Mol. Biol. 328: 205-219.

Lauge, R. and De Wit, P.J. 1998. Fungal avirulence genes: structure and possible functions. Fungal Genet. Biol. 24: 285-297.

Letunic, I., Goodstadt, L., Dickens, N.J., Doerks, T., Schultz, J., Mott, R., Ciccarelli, F., Copley, R.R., Ponting, C.P., and Bork, P. 2002. Recent improvements to the SMART domain-based sequence annotation resource. Nucleic Acids Res. 30: 242-244.

Li, W.H. 1997. Molecular Evolution. Sinauer Associates, Sunderland, MA.

Lindh, J.G., Botero-Kleiven, S., Arboleda, J.I., and Wahlgren, M. 2001. A protease inhibitor associated with the surface of Toxoplasma gondii. Mol. Biochem. Parasitol. 116: 137-145.

Liu, Y., Dammann, C., and Bhattacharyya, M.K. 2001. The matrix metalloproteinase gene GmMMP2 is activated in response to pathogenic infections in soybean. Plant Physiol. 127: 1788-1797.

195 Liu, Z., Bos, J.I.B., Armstrong, M., Whisson, S.C., da Cunha, L., Torto-Alalibo, T., Win, J., Avrova, A.O., Wright, F., Birch, P.R.J., et al. 2004. Patterns of diversifying selection in the phytotoxin-like scr74 gene family of Phytophthora infestans. Mol. Biol. Evol. in press.

Lu, S.M., Lu, W., Qasim, M.A., Anderson, S., Apostol, I., Ardelt, W., Bigler, T., Chiang, Y.W., Cook, J., James, M.N., et al. 2001. Predicting the reactivity of proteins from their sequence alone: Kazal family of protein inhibitors of serine proteinases. Proc. Natl. Acad. Sci. U. S. A. 98: 1410-1415.

Lu, W., Apostol, I., Qasim, M.A., Warne, N., Wynn, R., Zhang, W.L., Anderson, S., Chiang, Y.W., Ogin, E., Rothberg, I., et al. 1997. Binding of amino acid side-chains to S1 cavities of serine proteinases. J. Mol. Biol. 266: 441-461.

Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R., and Dangl, J.L. 2003. Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Cell 112: 379-389.

Magert, H.J., Standker, L., Kreutzmann, P., Zucht, H.D., Reinecke, M., Sommerhoff, C.P., Fritz, H., and Forssmann, W.G. 1999. LEKTI, a novel 15-domain type of human serine proteinase inhibitor. J. Biol. Chem. 274: 21499-21502.

Margulis, L. and Schwartz, K.V. 2000. Five Kingdoms: An Illustrated Guide to the Phyla of Life on Earth. W.H. Freeman and Co., New York.

McLeod, A., Smart, C.D., and Fry, W.E. 2002. Characterization of 1,3-b glucanase and 1,3;1,4-b glucanase genes from Phytophthora infestans. Fungal Genet. Biol. 38: 250-263.

Mende, K., Lange, U., and Nowak, G. 2004. Three recombinant serine proteinase inhibitors expressed from the coding region of the thrombin inhibitor dipetalogastin. Insect Biochem. Mol. Biol. 34: 971-979.

Merril, C.R., Goldman, D., Sedman, S.A., and Ebert, M.H. 1981. Ultrasensitive stain for proteins in polyacrylamide gels shows regional variation in cerebrospinal fluid proteins. Science 211: 1437-1438.

Milstone, A.M., Harrison, L.M., Bungiro, R.D., Kuzmic, P., and Cappello, M. 2000. A broad spectrum Kunitz type serine protease inhibitor secreted by the hookworm Ancylostoma ceylanicum. J. Biol. Chem. 275: 29391-29399.

Mitsudo, K., Jayakumar, A., Henderson, Y., Frederick, M.J., Kang, Y., Wang, M., El- Naggar, A.K., and Clayman, G.L. 2003. Inhibition of serine proteinases plasmin, trypsin, subtilisin A, cathepsin G, and elastase by LEKTI: a kinetic analysis. Biochemistry 42: 3874-3881.

Morris, M.T. and Carruthers, V.B. 2003. Identification and partial characterization of a second Kazal inhibitor in Toxoplasma gondii. Mol. Biochem. Parasitol. 128: 119-122. 196 Morris, M.T., Cheng, W.C., Zhou, X.W., Brydges, S.D., and Carruthers, V.B. 2004. Neospora caninum expresses an unusual single-domain Kazal protease inhibitor that is discharged into the parasitophorous vacuole. Int. J. Parasitol. 34: 693-701.

Morris, M.T., Coppin, A., Tomavo, S., and Carruthers, V.B. 2002. Functional analysis of Toxoplasma gondii protease inhibitor 1. J. Biol. Chem. 277: 45259-45266.

Mosolov, V.V., Grigor'eva, L.I., and Valueva, T.A. 2001. Involvement of proteolytic enzymes and their inhibitors in plant protection. Appl. Biochem. Microbiol. 37: 115-123.

Nielsen, H. and Krogh, A. 1998. Prediction of signal peptides and signal anchors by a hidden Markov model. In Proceedings of the Sixth International Conference on Intelligent Systems for Molecular Biology (ISMB 6), pp. pp. 122--130. AAAI Press, Menlo Park, California.

Nielsen, H., Engelbrecht, J., Brunak, S., and von Heijne, G. 1997. A neural network method for identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Int. J. Neural Syst. 8: 581-599.

O' Connell, R.J. and Ride, J.P. 1990. Chemical detection and ultrastructural localization of chitin in cell walls of Collectotrichum lindemuthianum. Physiological and Molecular Plant Pathology 37: 39-53.

Page, R.D. 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12: 357-358.

Panstruga, R. 2003. Establishing compatibility between plants and obligate biotrophic pathogens. Curr. Opin. Plant Biol. 6: 320-326.

Pszenny, V., Angel, S.O., Duschak, V.G., Paulino, M., Ledesma, B., Yabo, M.I., Guarnera, E., Ruiz, A.M., and Bontempi, E.J. 2000. Molecular cloning, sequencing and expression of a serine proteinase inhibitor gene from Toxoplasma gondii. Mol. Biochem. Parasitol. 107: 241-249.

Pszenny, V., Ledesma, B.E., Matrajt, M., Duschak, V.G., Bontempi, E.J., Dubremetz, J.F., and Angel, S.O. 2002. Subcellular localization and post-secretory targeting of TgPI, a serine proteinase inhibitor from Toxoplasma gondii. Mol. Biochem. Parasitol. 121: 283-286.

Punja, Z.K. 2004. Fungal Disease Resistance in Plants. Food Products Press, Binghamton, NY.

Qasim, M.A., Lu, W., Lu, S.M., Ranjbar, M., Yi, Z., Chiang, Y.W., Ryan, K., Anderson, S., Zhang, W., Qasim, S., et al. 2003. Testing of the additivity-based protein sequence to reactivity algorithm. Biochemistry 42: 6460-6466.

197 Qutob, D., Kamoun, S., and Gijzen, M. 2002. Expression of a Phytophthora sojae necrosis-inducing protein occurs during transition from biotrophy to necrotrophy. Plant J. 32: 361-373.

Randall, T.A., Dwyer, R.A., Huitema, E., Beyer, K., Cvitanich, C., Kelkar, H., Ah Fong, A.M.V., Gates, K., Roberts, S., Yatzkan, E., et al. 2004. Large-scale gene discovery in the oomycete Phytophthora infestans reveals likely components of phytopathogenicity shared with true fungi. Mol. Plant Microbe Interact. in press.

Read, R.J., Fujinaga, M., Sielecki, A.R., and James, M.N. 1983. Structure of the complex of Streptomyces griseus protease B and the third domain of the turkey ovomucoid inhibitor at 1.8-A resolution. Biochemistry 22: 4420-4433.

Ristaino, J.B. 2002. Tracking historic migrations of the Irish potato famine pathogen, Phytophthora infestans. Microbes Infect. 4: 1369-1377.

Rojo, E., Martin, R., Carter, C., Zouhar, J., Pan, S., Plotnikova, J., Jin, H., Paneque, M., Sanchez-Serrano, J.J., Baker, B., et al. 2004. VPE exhibits a caspase-like activity that contributes to defense against pathogens. Curr. Biol. 14: 1897-1906.

Rose, J.K., Ham, K.S., Darvill, A.G., and Albersheim, P. 2002. Molecular cloning and characterization of glucanase inhibitor proteins: coevolution of a counterdefense mechanism by plant pathogens. Plant Cell 14: 1329-1345.

Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

Sanchez, L.M., Ohno, Y., Miura, Y., Kawakita, K., and Doke, N. 1992. Host selective suppression by water-soluble glucans from Phytophthora spp. of hypersensitive cell death of suspension-cultured cells from some solanaceous plants caused by hyphal wall elicitors of the fungi. Ann. Phytopathol. Soc. Japan 58: 664-670.

Scott, M.J., Huckaby, C.S., Kato, I., Kohr, W.J., Laskowski, M., Jr., Tsai, M.J., and O'Malley, B.W. 1987. Ovoinhibitor introns specify functional domains as in the related and linked ovomucoid gene. J. Biol. Chem. 262: 5899-5907.

Seigrist, J. and Kauss, H. 1990. Chitin deacetylase in cucumber leaves infected by Colletotrichum lagenarium. Physiolgical and Molecualr Plant Pathology 36: 267-275.

Shan, W., Cao, M., Leung, D., and Tyler, B.M. 2004. The Avr1b locus of Phytophthora sojae encodes an elicitor and a regulator required for avirulence on soybean plants carrying resistance gene Rps1b. Mol. Plant-Microbe Interact. 17: 394-403.

Shattock, R.C. 2002. Phytophthora infestans: populations, pathogenicity and phenylamides. Pest Manag. Sci. 58: 944-950.

198 Shewmaker, C.K., Ridge, N.P., Pokalsky, A.R., Rose, R.E., and Hiatt, W.R. 1990. Nucleotide sequence of an EF-1 alpha genomic clone from tomato. Nucleic Acids Res. 18: 4276.

Smart, C.D. and Fry, W.E. 2001. Invasions by the late blight pathogen: renewed sex and enhanced fitness. Biol. Invas. 3: 235-243.

Sogin, M.L., and Silberman, J.D. 1998. Evolution of the protists and protistan parasites from the perspective of molecular systematics. Int. J. Parasitol. 28: 11-20.

Solomon, M., Belenghi, B., Delledonne, M., Menachem, E., and Levine, A. 1999. The involvement of cysteine proteases and protease inhibitor genes in the regulation of programmed cell death in plants. Plant Cell 11: 431-444.

Stahl, E.A. and Bishop, J.G. 2000. Plant-pathogen arms races at the molecular level. Curr. Opin. Plant Biol. 3: 299-304.

Stotz, H.U., Bishop, J.G., Bergmann, C.W., Koch, M., Albershem, P., Darvill, A.G., and Labavitch, J.M. 2000. Identification of target amino acids that affect interactions of fungal polygalacturonases and their plant inhibitors. Physiological and Molecular Plant Pathology 56: 117-130.

Suty, L., Lequeu, J., Lancon, A., Etienne, P., Petitot, A.S., and Blein, J.P. 2003. Preferential induction of 20S proteasome subunits during elicitation of plant defense reactions: towards the characterization of "plant defense proteasomes". Int. J. Biochem. Cell Biol. 35: 637-650.

Tatusov, R.L., Koonin, E.V., and Lipman, D.J. 1997. A genomic perspective on protein families. Science 278: 631-637.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25: 4876-4882.

Tian, M., Huitema, E., Da Cunha, L., Torto-Alalibo, T., and Kamoun, S. 2004. A Kazal- like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. J. Biol. Chem. 279: 26370-26377.

TÖR, M., YEMM, A., and HOLUB, E. 2003. The role of proteolysis in R gene mediated defence in plants. Mol. Plant Pathol. 4: 287-296.

Tornero, P., Conejero, V., and Vera, P. 1997. Identification of a new pathogen-induced member of the subtilisin-like processing protease family from plants. J. Biol. Chem. 272: 14412-14419.

199 Tornero, P., Mayda, E., Gomez, M.D., Canas, L., Conejero, V., and Vera, P. 1996. Characterization of LRP, a leucine-rich repeat (LRR) protein from tomato plants that is processed during pathogenesis. Plant J. 10: 315-330.

Torto, T.A., Li, S., Styer, A., Huitema, E., Testa, A., Gow, N.A., van West, P., and Kamoun, S. 2003. EST mining and functional expression assays identify extracellular effector proteins from the plant pathogen Phytophthora. Genome Res. 13: 1675-1685.

Torto, T.A., Rauser, L., and Kamoun, S. 2002. The pipg1 gene of the oomycete Phytophthora infestans encodes a fungal-like endopolygalacturonase. Curr. Genet. 40: 385-390.

Tyler, B.M. 2002. Molecular basis of recognition between Phytophthora pathogens and their hosts. Annu. Rev. Phytopathol. 40: 137-167.

Unkles, S.E., Moon, R.P., Hawkins, A.R., Duncan, J.M., and Kinghorn, J.R. 1991. Actin in the oomycetous fungus Phytophthora infestans is the product of several genes. Gene 100: 105-112.

Van den Ackerveken, G.F., Vossen, P., and De Wit, P.J. 1993. The AVR9 race-specific elicitor of Cladosporium fulvum is processed by endogenous and plant proteases. Plant Physiol. 103: 91-96. van den Burg, H.A., Spronk, C.A., Boeren, S., Kennedy, M.A., Vissers, J.P., Vuister, G.W., de Wit, P.J., and Vervoort, J. 2004. Binding of the AVR4 elicitor of Cladosporium fulvum to chitotriose units is facilitated by positive allosteric protein-protein interactions: the chitin-binding site of AVR4 represents a novel binding site on the folding scaffold shared between the invertebrate and the plant chitin-binding domain. J. Biol. Chem. 279: 16786-16796.

van der Hoorn, R.A. and Jones, J.D. 2004. The plant proteolytic machinery and its role in defence. Curr. Opin. Plant Biol. 7: 400-407.

van Gent, D., Sharp, P., Morgan, K., and Kalsheker, N. 2003. Serpins: structure, function and molecular evolution. Int. J. Biochem. Cell Biol. 35: 1536-1547.

van Loon, L.C. and van Strien, E.A. 1999. The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiological and Molecular Plant Pathology 55: 85-97.

van Loon, L.C., Pierpoint, W.S., Boller, T., and Conejero, V. 1994. Recommendations for naming plant pathogenesis-related proteins. Plant Molecular Biology Reporter 12: 245-264.

Vera, P. and Conejero, V. 1988. Pathogenesis-related proteins of tomato. Plant Physiol. 87: 58-63.

200 Voinnet, O., Rivas, S., Mestre, P., and Baulcombe, D. 2003. An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J. 33: 949-956.

Waugh, M., Hraber, P., Weller, J., Wu, Y., Chen, G., Inman, J., Kiphart, D., and Sobral, B. 2000. The Phytophthora genome initiative database: informatics and analysis for distributed pathogenomic research. Nucleic Acids Res. 28: 87-90.

Win, J. and Kamoun, S. 2004. pCB301-p19: a binary plasmid vector to enhance transient expression of transgenes by agroinfiltration. http://www.Kamounlab.net.

Woltering, E.J., van der Bent, A., and Hoeberichts, F.A. 2002. Do plant caspases exist? Plant Physiol. 130: 1764-1769.

Xia, Y. 2004. Proteases in pathogenesis and plant defence. Cell Microbiol. 6: 905-913.

Xia, Y., Suzuki, H., Borevitz, J., Blount, J., Guo, Z., Patel, K., Dixon, R.A., and Lamb, C. 2004. An extracellular aspartic protease functions in Arabidopsis disease resistance signaling. EMBO J. 23: 980-988.

Xiang, C., Han, P., Lutziger, I., Wang, K., and Oliver, D.J. 1999. A mini binary vector series for plant transformation. Plant Mol. Biol. 40: 711-717.

Xiao, F., Tang, X., and Zhou, J.M. 2001. Expression of 35S::Pto globally activates defense-related genes in tomato plants. Plant Physiol. 126: 1637-1645.

Yang, Z. 2002. Inference of selection from multiple species alignments. Curr. Opin. Genet. Dev. 12: 688-694.

Yang, Z. and Bielawski, J.P. 2000. Statistical methods for detecting molecular adaptation. Trends Ecol. Evol. 15: 496-503.

Yang, Z. and Nielsen, R. 2000. Estimating synonymous and nonsynonymous substitution rates under realistic evolutionary models. Mol. Biol. Evol. 17: 32-43.

Yang, Z., Nielsen, R., Goldman, N., and Pedersen, A.M. 2000. Codon-substitution models for heterogeneous selection pressure at amino acid sites. Genetics 155: 431-449.

Yoshioka, H., Hayakawa, Y., and Doke, N. 1995. Suppression of phenylalanine ammonia-lyase mRNA accumulation by suppressors from Phytophthora infestans. Ann. Phytopathol. Soc. Japan 61: 7-12.

Zeng, L.R., Qu, S., Bordeos, A., Yang, C., Baraoidan, M., Yan, H., Xie, Q., Nahm, B.H., Leung, H., and Wang, G.L. 2004. Spotted leaf11, a negative regulator of plant cell death and defense, encodes a U-box/armadillo repeat protein endowed with E3 ubiquitin ligase activity. Plant Cell 16: 2795-2808.

201 Zhao, Y., Thilmony, R., Bender, C.L., Schaller, A., He, S.Y., and Howe, G.A. 2003. Virulence systems of Pseudomonas syringae pv. tomato promote bacterial speck disease in tomato by targeting the jasmonate signaling pathway. Plant J. 36: 485-499.

202