4040.Full.Pdf

Published OnlineFirst February 25, 2020; DOI: 10.1158/1078-0432.CCR-19-2460

CLINICAL CANCER RESEARCH | PRECISION MEDICINE AND IMAGING

Discovery of Berberine that Targetedly Induces Autophagic Degradation of both BCR-ABL and BCR-ABL T315I through Recruiting LRSAM1 for Overcoming Imatinib Resistance Zhao Yin1,2,3,4, Guiping Huang1,3,4, Chunming Gu1,2,3,4, Yanjun Liu1,3,4, Juhua Yang1,3,4, and Jia Fei1,2,3,4

ABSTRACT ◥ Purpose: Imatinib, the breakpoint cluster region protein (BCR)/ Results: We discovered that BBR bound to the protein tyrosine Abelson murine leukemia viral oncogene homolog (ABL) inhibitor, is kinase domain of BCR-ABL. BBR inhibited the activity of widely used to treat chronic myeloid leukemia (CML). However, ima- BCR-ABLandBCR-ABLwiththeT315Imutation,anditalso tinib resistance develops in many patients. Therefore, new drugs with degraded these proteins via the autophagic lysosome pathway by improved therapeutic effects are urgently needed. Berberine (BBR) is a recruiting E3 ubiquitin-protein ligase LRSAM1. BBR inhibited potent BCR-ABL inhibitor for imatinib-sensitive and -resistant CML. the cell viability and colony formation of CML cells and pro- Experimental Design: Protein structure analysis and virtual screen- longed survival in CML mouse models with imatinib sensitivity ing were used to identify BBR targets in CML. Molecular docking and resistance. analysis, surface plasmon resonance imaging, nuclear magnetic res- Conclusions: The results show that BBR directly binds to and onance assays, and thermoshift assays were performed to conﬁrm the degrades BCR-ABL and BCR-ABL T315I via the autophagic BBR target. The change in BCR-ABL protein expression after BBR lysosome pathway by recruiting LRSAM1. The use of BBR is a treatment was assessed by Western blotting. The effects of BBR were new strategy to improve the treatment of patients with CML with assessed in vitro in cell lines, in vivo in mice, and in human CML bone imatinib sensitivity or resistance. marrow cells as a potential strategy to overcome imatinib resistance. See related commentary by Elf, p. 3899

Introduction both in vitro and in vivo. BBR is a clinically important natural isoquinoline alkaloid derived from the plant Berberis vulgaris that is Chronic myeloid leukemia (CML) results from the transformation known to have multiple pharmacologic activities, including anticancer of primitive hematopoietic cells by the breakpoint cluster region effects (5–7). However, the mechanisms underlying the effects of BBR protein (BCR)/Abelson murine leukemia viral oncogene homolog on cancer cells have not been fully elucidated. In this study, BBR (ABL) oncogene. Imatinib, a tyrosine kinase inhibitor that binds to significantly inhibited CML cell viability and colony formation and the ATP-binding site of ABL, is remarkably effective at treating CML. prolonged survival in both imatinib-sensitive and -resistant CML However, resistance, which develops in many patients, is the main mouse models. Hence, BBR is a promising new inhibitor for use in barrier to prolonged survival, and the use of a single tyrosine kinase CML treatment, particularly for imatinib-resistant CML. inhibitor cannot cure CML. Thus, the development of novel targeted therapeutic agents, or the use of imatinib in combination with other drugs, is required to improve response rates and overcome imatinib Materials and Methods – resistance (1 4). Human samples and cell lines Here, we describe the identification and characterization of the Healthy peripheral blood mononuclear cells (PBMC) and CML mechanism of action of berberine (BBR) as an ABL-binding agent that bone marrow (BM) mononuclear cells were obtained from adult can capable of degrading BCR-ABL and overcome imatinib resistance donors in Guangdong Provincial Emergency Hospital/the Guangdong Second Provincial General Hospital after written informed consent was obtained according to the institutional guidelines and the Dec- 1Department of Biochemistry and Molecular Biology, Medical College of Jinan University, Guangzhou, China. 2Institute of Chinese Integrative Medicine, Med- laration of Helsinki. These cells were cultured in medium containing ical College of Jinan University, Guangzhou, China. 3Engineering Technology 100 ng/mL stem cell factor (SCF), 100 ng/mL granulocyte-colony Research Center of Drug Development for Small Nucleic Acids, Guangdong, stimulating factor (G-CSF), 20 ng/mL FMS-like tyrosine kinase 3 þ China. 4Antisense Biopharmaceutical Technology Co., Ltd., Guangzhou, China. (FLT3), 20 ng/mL IL3, and 20 ng/mL IL6. Preparation of CD34 from Note: Supplementary data for this article are available at Clinical Cancer umbilical cord blood was performed with the EasySep human cord þ Research Online (http://clincancerres.aacrjournals.org/). blood CD34 selection kit (StemCell Technologies) according to fi Z. Yin, G. Huang, and C. Gu contributed equally to this article. the manufacturer's instructions and incubated in Iscove modi ed Dulbecco medium supplemented with 10% FBS (8, 9). The studies Corresponding Author: Jia Fei, Medical College of Jinan University, 601 Western Huangpu Avenue, Guangzhou 510632, China. Phone: 8620-8522-0256; were approved by Institutional Review Board, Jinan University Fax: 8620-8522-01314; E-mail: [email protected] (Guangzhou, China). The imatinib-sensitive CML cell line K562 was purchased from Clin Cancer Res 2020;26:4040–53 Shanghai Cell Bank (Chinese Academy of Sciences, Shanghai). doi: 10.1158/1078-0432.CCR-19-2460 The imatinib-sensitive CML cell line KCL-22 was kindly provided 2020 American Association for Cancer Research. by Dr. Muschen (The Children's Hospital, Los Angeles, CA). The

AACRJournals.org | 4040

Berberine Induces Autophagic BCR-ABL T315I Degradation

The timing of the procedures was as follows: at 0–260 seconds, the Translational Relevance system was prewashed to infiltrate the surface of the chip with running Acquired imatinib resistance is frequently characterized by buffer. At this point, the resonance intensity was about 0 resonance breakpoint cluster region protein/Abelson murine leukemia units (RU). At 260–520 seconds, binding began, with BBR on the chip viral oncogene homolog (BCR-ABL) mutations that affect imatinib surface starting to capture the protein targets in the cell lysate. At 520– binding and kinase inhibition in patients with chronic myeloid 820 seconds, the chip was washed to gradually remove nonbound and leukemia (CML). In this study, we found that Berberine (BBR), nonspecific molecules, while the target protein that specifically bound a Chinese traditional medicine, significantly inhibited the cell to the BBR remained on the chip surface. Resonance intensity viability and colony formation of CML cells and prolonged survival decreased until it reached a plateau at approximately 542.65 RU. As in CML mouse models with imatinib sensitivity and resistance. nonspecific binding to the nonspotted areas gradually decreased, the Further studies demonstrated that BBR not only inhibit BCR-ABL background resonance intensity gradually decreased to baseline tyrosine kinase activity but also directly bind to ABL1, which (37.72 RU), that is, the chip background noise returned to the induce autophagic degradation of both BCR-ABL and BCR-ABL normal level. T315I through recruiting LRSAM1 for overcoming imatinib resistance. Our finding would be of remarkable value for further therapy Molecular docking of CML with BCR-ABL mutation. The molecular docking assays between BBR and ABL1 were generated as described previously (11). Using the Protein Preparation Wizard module of Schrodinger€ Maestro 9.3 software (Schrodinger),€ a model of BBR with ABL1 was processed using default settings. A imatinib-resistant CML cell line SFO2 (which does not express BCR- molecular docking analysis was implemented using the Ligand Dock- ABL) was obtained from Dr. Muschen (The Children's Hospital, Los ing tab of the Glide module. Regarding the docking parameters, Angeles, CA). BaF3-P210 and BaF3-P210-T315I cells were kindly precision was set as extra precision (XP), ligand sampling was set presented by Professor Wen li Feng (Chong qin Medical University, as flexible, the number of poses per ligand was set at 5, and other China). These cells were grown in RPMI1640 medium containing 10% parameters were set at the default values. The residue compounds were FBS and 1% penicillin/streptomycin (all purchased from Gibco). Plat- further subjected to Prime molecular mechanics (MM)-generalized E cells were generously provided by Dr. Jing Xuan Pan (Pharmacy Born surface area (GBSA) calculations and vision analysis. College Jinan University, Guangzhou, China; ref. 10). Imatinib and BBR were purchased from Sigma. Protein expression and purification Protein expression and purification assays were performed accord- Identification and quantification of BBR target proteins using ing to our previous report (12). Escherichia coli BL21 (DE3) was surface plasmon resonance and high-performance liquid transformed with a hexa-histidine–tagged recombinant human pro- chromatography mass spectrometry tein tyrosine kinase (PTK) domain of ABL1 (isoform 2). After bacterial To explore the direct cell target of BBR, we designed an surface growth in Terrific Broth containing 30 mg/L kanamycin at 37Ctoan plasmon resonance-high-performance liquid chromatography-mass optical density (OD) at 600 nm of 0.4–0.6, induction was carried out at spectrometry (SPR-HPLC-MS) assay. BBR at a concentration of 18C using 0.5 mmol/L isopropyl-b-D-thiogalactoside (IPTG), and 100 mmol/L was formulated with 50% dimethyl sulfoxide (DMSO). growth was then continued at 18C overnight. Bacteria were collected Consistent BBR samples were produced on a chip surface by auto- by centrifugation. The pellets were immediately resuspended in lysis spotting three times using a BioDot-1520 array printer. The chip buffer (20 mmol/L PB, 150 mmol/L NaCl, pH 7.4) containing a surface was printed with a 50 50 matrix of 18.75 mL (1.875 mmol/L) protease inhibitor cocktail. Cell lysis was performed in an ultrasonic BBR sample in total, with 2.5 nL of projected point of the solution. ice bath to generate crude protein samples. Extracted proteins were diluted 5-fold with balance buffer (500 mmol/L NaCl, 20 Calibration of cell lysate mmol/L Tris, pH 8.0), incubated with Ni-agarose beads (CWBio), The protein concentration of K562 and KCL22 cell lysate, including and washed to remove unbound proteins and proteases. The proteins membrane proteins, was calibrated after extraction with certain SOPs, were eluted using different concentrations of imidazole (20, 50, 200, using a Bicinchoninic Acid (BCA) Protein Assay Kit (Thermo Fisher and 500 mmol/L) to determine the absorption peak, and then purified Scientific), which led to a measurement of 332.1 mg/mL. The con- samples of the PTK domain of ABL1 were collected according to the centration was adjusted using a 1 lysate stock solution to a final identified absorption peak. concentration of 200 mg/mL. SPR imaging Calibration of chip performance SPR imaging (SPRi) assays were performed as described previous- Each chip was manufactured by Lumera Co. Ltd, with batch ly (11). BBR was bound to a sensor chip, and protein samples were difference <0.5%. The resonance angle was automatically tuned to injected into the chip at a rate of 2 mL/s at 25C. Oval regions of interest the optimum value using a bScreen LB 991 system (Berthold (ROI) in the imaging area were automatically set using the data Technologies). collection software. ROIs of rapamycin and DMSO were used as positive and negative controls, respectively. The protein samples were Target protein capture process diluted in PBS containing Tween 20 (0.05%), pH 7.4, and used as During the SPR assays, BBR was immobilized on the surface of the analytes with an association and dissociation flow rate of 2 mL/second chip and K562 or KCL22 cell lysate was used as the liquid phase. The at different concentrations by serial dilution. A solution of glycine-HCl H2 sample curve signal indicated target protein binding on the area (pH 2.0) was used to regenerate the surface of the sensor chip by spotted with BBR. The background curve indicated the change in the removing bound proteins, enabling the sensor chip to be reused for signal in the nonspotted area. subsequent analyte injections.

AACRJournals.org Clin Cancer Res; 26(15) August 1, 2020 4041

Yin et al.

Differential scanning fluorimetry assay were carefully collected. If precipitates appeared during collection, the Thermoshift assays were carried out in 96-well PCR plates with a samples were centrifuged again. PTK standards were prepared accord- real-time thermo-cycler (CFX96, Bio-Rad California) and the fluo- ing to the manufacturer's instructions for the PTK activity assay. The rescent dye SYPRO Orange (1:1,000). The fluorescence signal was total volume in each well in the micro-ELISA strip plates was 50 mL. initially measured at a temperature of 25C, which was then increased Ten wells were used for a 1:2 dilution series of standards (final to 100C with a step size of 0.5C/minute. Interactions of SYPRO concentrations: 3600, 2400, 1200, 600, and 300 U/mL). One well was Orange with hydrophobic surfaces increase the quantum yield of the left empty as a negative control. In the sample wells, 40 mL sample dye (13). Binding was assessed using a melting curve analysis. dilution buffer and 10 mL cell lysate samples were added. Samples were loaded into the bottom of wells without touching the well walls. The Nuclear magnetic resonance assay solutions were mixed well by gentle shaking and the plates were sealed BBR and the BBR–PTK complex were dissolved in heavy water. All with plate membrane and incubated for 30 minutes at 37C. The 1H-Nuclear magnetic resonance (NMR) experiments were performed solutions were then aspirated from the wells and the wells were washed on an AVANCE I-600 spectrometer (Bruker) at 25C (298.0 K), using for 30 seconds with wash solution five times. Next, 50 mL horseradish a probe tuned at 600 MHz. The chemical shift of BBR was assessed. peroxidase (HRP)-conjugated reagent was added to each well, except the blank control, and then the plates were incubated and washed as Extraction of BM cells from mice described above. Thereafter, 50 mL Chromogen Solution A and 50 mL BM cells were obtained from C57/BL6 mice by flushing the Chromogen Solution B were added to each well, mixed by gentle cavities of femurs and tibias with PBS. After filtration through a shaking, and incubated at 37C for 15 minutes. Finally, 50 mL stop 70-mm filter and depletion of erythrocytes using lysis buffer solution was added to each well to terminate the reaction and the OD at (BD PharmLyse, BD Biosciences), the cells were washed with PBS 450 nm was determined using a microplate reader. The OD value of the andculturedwith10ng/mLrecombinantmouseIL3,25ng/mL blank control well was set at zero. Assays were performed in triplicate, recombinant mouse IL6, and 50 ng/mL recombinant mouse SCF and two-sided paired t tests were used for statistical analyses. medium (14). In vitro tyrosine kinase assay Cell viability assay The in vitro tyrosine kinase assay was performed as described Cell viability was assessed using 3-(4,5-dimethylthiazol-2-yl)-2,5- previously with some modifications (15). The ABL kinase activity was diphenyltetrazolium bromide (MTT) assays. Cells were seeded in 96- tested using the Kinase-Glo Luminescent Kinase Assay Platform well plates at a density of 5 103 cells/well, treated with either BBR or (Promega Corporation, catalog no. V6072), which provides a homo- imatinib at the indicated concentrations(0–20 mmol/L), and incubated geneous, high-throughput screening method for measuring kinase at 37C for 48 hours. Thereafter, 20 mL MTT was added to each well. activity by quantization the amount of ATP remaining in solution After incubation for 4 hours, OD at 540 nm was determined using a following a kinase reaction. The assays are performed in a single well of microplate reader. a multi-well plate by adding a volume of Kinase Glo Reagent equal to the volume of a completed kinase reaction and measuring lumines- Colony formation assay cence. The luminescent signal is correlated with the amount of ATP A colony formation assay for dispersed single cells was per- present and is inversely correlated with the amount of kinase activity. formed. Single cells (BaF3-P210 or BaF3-P210-T315I) were seeded Briefly, a 50 mL mixture containing 1 mL of BBR (0, 2, 4, 8, or 10 mmol/ into a 24-well plate and mixed completely with 0.9% methylcellu- L), 2 mLof(1mg) ABL1(ABL protein tyrosine kinase: Pro137-Ser554, lose solution in RPMI1640 medium containing 20% FBS and 5 65 kDa, containing protein tyrosine kinase activity, was supplied by mmol/L BBR. Single cells were randomly and evenly distributed Sino Biological Inc (Shanghai, China), 2 mLof(1mg) ABL1 kinase throughout the wells. Colonies were formed during incubation for substrate (EAIYAAPFAKKK; Substrate peptide of ABL1 was synthe- 1–2 weeks at 37 Cwith5%CO2. Light microscopy was used to sized by GL Biochem (Shanghai, China) and 5 mL of ATP (2 mmol/L) in observe and count the colonies (>50 cells). 40 mL kinase buffer [50 mmol/L HEPES (pH 7.3), 10 mmol/L MgCl2, 0.1% BSA, 2 mmol/L DTT] was added to the wells, and the reactions Real-time PCR were incubated for 20 minutes at 30C; the control wells did not To assess the levels of BCR-ABL mRNA, total RNA was isolated contain BBR. The reaction was stopped by addition of 50 mL Kinase- from K562 cells using a TRIzol Total RNA Isolation kit (Tiangen) and Glo reagent, and the plate was read after a 10-minute incubation time reverse transcribed using a Fast Quant RT Kit (Tiangen). An SYBR at Cytation5 Cell Imaging Multi-Mode Reader (Bio-Tek) Green kit (Tiangen) was used for PCR. BCR-ABL primer sequences (forward, AGCATTCCGCTGACCATCAA; reverse, GCCTAA- Western blotting GACCCGGAGCTTTT) were designed using Primer-Basic Local Cells were lysed in radioimmunoprecipitation assay (RIPA) buffer Alignment Search Tool (BLAST). b-Actin served as an internal in the presence of protease inhibitors (Selleck Chemicals). Protein control, with b-actin primers being purchased from Sangon Biotech concentrations were determined using the BCA method (Bioss), and (Shanghai, China). The cycling conditions were as follows: 95C for 15 the proteins were then denatured in Laemmli sample buffer (Bio-Rad) minutes; 30 cycles of 95C for 10 seconds, 55C for 30 seconds, and for 5 minutes at 100C. Total protein extracts (50 mg) were subjected to 72C for 30 seconds. Data were processed using CFX Manager 3.0 SDS-PAGE on 10% gels and transferred to nitrocellulose membranes. software (Bio-Rad). The membranes were then blocked with 5% (w/v) fat-free milk powder in Tris-buffered saline with Tween 20 (TBST) for 1 hours. The PTK activity assay membranes were first incubated with a primary anti-BCR antibody CML cells were diluted to 100/mL in PBS (pH 7.2–7.4) and lysed by (1:1,000; Abcam) at 4C overnight and then washed twice with TBST repeated freezing and thawing to release the intracellular components. for 10 minutes and incubated with HRP-conjugated secondary anti- After centrifugation for 20 minutes at 2,000–3,000g, the supernatants body for 1 hour. BCR protein was detected using a chemiluminescence

4042 Clin Cancer Res; 26(15) August 1, 2020 CLINICAL CANCER RESEARCH

Berberine Induces Autophagic BCR-ABL T315I Degradation

kit (Millipore). Densitometric quantification was performed using mutation, which express a mutant form of the BCR-ABL protein that ImageJ software (NIH, Bethesda, MD). is resistant to imatinib) were injected into the tail veins of female BALB/c nu/nu mice (5 mice per group, 6 weeks of age). Before Plasmid transfections injection, the mice were irradiated with 2.5 Gy X-rays. After 10 days, To analyze the effects of LRSAM1 in BBR-mediated degradation of the mice were treated daily for 7 days via intraperitoneal injection with BCR-ABL, K562 cells stably overexpressing LRSAM1 or control were BBR (15 mg/kg) or imatinib (50 mg/kg) and in vivo images were established by transfecting K562 cells with LRSAM1 expression vector assessed using an Xtreme system (Bruker). or empty vector. The cells were selected in medium containing To assess the effects of BBR in tumor xenograft models, 106 BaF3- puromycin (1 mg/mL). P210-T315I cells were implanted subcutaneously into female BALB/c nu/nu mice (6 weeks of age). Tumors were allowed to reach 100 mm3 in siRNA transfections size before the mice were randomly assigned to treatment groups. Five The sequences used in this study were: LRSAM1 siRNA target mice per group were treated with BBR (15 mg/kg), imatinib (50 mg/kg), sequence (CCACGATAATCAGCTGACA). The siRNA was synthe- BBR plus imatinib daily for 15 days or vehicle control (saline solution) sized and purified by Ribobio, and stored at 20C. All siRNA via intraperitoneal injection twice daily for 15 days in two independent (100 nmol/L) were transfected into K562 cells using Lipofectamine experiments. Tumor volumes were assessed using Vernier calipers, 2000 according to the manufacturer's instructions. and the expression of ABL1 and BCR-ABL in tumors was assessed by IHC. Immunoprecipitation The immunoprecipitation assay was performed as described pre- Retroviral construction viously by us with some modifications (16). K562 cells were treated High-titer helper-free retroviruses were produced by transient under the indicated conditions in 10-cm plates and then lysed with transfection of Plat-E cells with the retroviral construct murine stem lysis buffer containing phosphatase and protease inhibitor. Lysates cell virus (MSCV)-BCR-ABL-internal ribosome entry site (IRES)- were mixed with 4 mL primary anti-BCR antibody (Abcam) and enhanced GFP (EGFP), as described previously (17). incubated overnight at 4C with rocking. Protein A/G agarose beads (Santa Cruz Biotechnology) were added to the mixture and, after BM transduction and transplantation to build CML-like mice 4 hours, the beads were pelleted, washed with lysis buffer, resuspended model in loading buffer, heated at 100C for 10 minutes, and analyzed by BM transduction was generated as described previously (10). Donor SDS-PAGE followed by Western blotting. Antibodies against ABL1 male C57BL/6 mice (Jinan University Animal Research Center, (Santa Cruz Biotechnology) and E3 ubiquitin-protein ligase LRSAM1 Guangzhou, China) were pretreated with 5-fluorouracil (5-FU, (Abcam) were used to detect the proteins in the immunoprecipitates. 200 mg/kg) and, 5 days later, BM cells were harvested. These cells were transduced for two rounds with the MSCV-BCR-ABL- Autophagy assay IRES-EGFP retrovirus in the presence of cytokines (SCF, IL3, and K562, KCL-22, BaF3-P210, and BaF3-P210-T315I cells were IL6). The cells were then transplanted into sublethally irradiated (550 incubated for the indicated times with different concentrations of cGy) recipient female C57BL/6 mice. Following transplantation, the BBR(0,1,3,and5mmol/L). Thereafter, the levels of the following mice were treated with vehicle, BBR (15 mg/kg/day, i.p.), or imatinib autophagy-related proteins were assessed by Western blotting: light (50 mg/kg/day, i.p.) for 14 days (18). chain 3B (LC3B; Cell Signaling Technology), Beclin1 (BECN1; Cell Signaling Technology), and P62 (Sigma). In addition, in experi- IHC ments in which the autophagy inhibitors chloroquine (CQ, 10 Tissue section staining was performed as described previously (12). mmol/L) and 3-methyladenine (MA, 25 mmol/L; Selleck Chemicals) Anti-ABL1 antibody (Santa Cruz Biotechnology) was used at a dilu- were used, the cells were pretreated for 4 hours with an autophagy tion of 1:50. Sections were processed and developed using a Bond RX inhibitor before the addition of BBR for 48 hours, or treated with research stainer (Leica Biosystems). Images were obtained using a the autophagy inhibitor alone or BBR alone for 48 hours. After Pannoramic 250 Flash Whole Slide Digital Scanner (Perkin Elmer) and treatment, levels of BCR-ABL protein were assessed by Western analyzed using ImageJ Plus software (NIH, Bethesda, MD). blotting. Statistical analyses Colocalization immunofluorescence Statistical analyses were carried out using GraphPad Prism 5 (Systat K562 cells were treated with 5 mmol/L BBR for 24 hours, treated with Software). Results are expressed as mean SD. Paired analyses were lysosome dye (KGMP006-1, Keygentec), smeared on slides, fixed for calculated using Student t test, and comparison of multiple groups by 10 minutes, and incubated with anti-ABL or anti-P62 antibodies. one-way ANOVA, post hoc intergroup comparisons, Tukey test. Images were captured using a laser scanning confocal microscope Kaplan–Meier survival curves were analyzed by log-rank test. P values (TCS SP8, Leica). In addition, K562 cells were treated with 5 mmol/L <0.05 were considered statistically significant. BBR for 24 hours, smeared on slides, fixed for 10 minutes, and incubated with anti-ABL or anti-LRSAM1 antibodies. Images were again captured using the above microscope. Results BBR directly bound to ABL1 according to SPR-HPLC-MS Imatinib-resistant CML T315I-luciferase mouse model To screen for the direct targets of BBR in K562 and KCL22 CML Experiments were performed on mice and these mice were sacri- cells, SPR combined with HPLC-MS was used, as shown in Fig. 1A. ficed according to the guidelines of the Jinan University Animal BBR was immobilized on a chip, K562 and KCL22 cell lysates were Research Committee (Guangzhou, China). First, 106 BaF3-P210- incubated with the chip, and the possible targets of BBR were identified T315I cells (BaF3 cells harboring the T315I-luciferase BCR-ABL by HPLC-MS. A total of 28 proteins from both K562 and KCL22 cells

AACRJournals.org Clin Cancer Res; 26(15) August 1, 2020 4043

Yin et al.

were identified, including ABL1 (Fig. 1B and C). SPRi assays of the BBR binding to the PTK domain of ABL1 was confirmed by NMR, binding between the domains of ABL1 and BBR were executed, and the SPRi, and thermo shift assays PTK domain bound most strongly out of the tested ABL1 domains To confirm that BBR can directly bind to ABL1, we performed an (Supplementary Fig. S3C). NMR assay. BBR and BBR with the PTK domain were dissolved in the same solvent (heavy water). By comparing the chemical shift of BBR BBR bound to the PTK domain of ABL1 according to the (blue line) with that of the BBR-PTK complex (red line), we found that molecular docking analysis PTK markedly changed the chemical shift of BBR. The NMR results To reveal which domain is the direct binding site of BBR, indicated that BBR noncovalently bound to the PTK domain (Fig. 2C). we conducted a computer-based molecular docking analysis To confirm this finding, we performed SPRi. BBR was bound to a using Schrodinger€ Maestro software. We found that two sites of ABL1 sensor chip, and then the pure PTK domain protein (Supplementary (LWEIATYGMSP and NAVVLLYMATQ) bound to BBR (Fig. 1D). Fig. S3B) was passed over the chip surface, and a binding image was These binding sites are in the PTK domain of ABL1 (Fig. 2E and F, obtained. The mean equilibrium dissociation constant (Kd) between left). We then synthesized these peptides and conducted an SPRi assay, the PTK domain and BBR was up to 10 7, indicating that BBR can which indicated that both sites bound to BBR (Fig. 2E and F, right). directly interact with PTK (Fig. 2A and B).

A K562/KCL22 cell line Cell lysate

Target protein capturing Captured HPLC-MS analysis Data analysis Sensor chip Berberine BC Score_KCL22Score_K562 O43613_OX1R

P00519_ABL1 P18089_ADA2B

P24530_EDNRB

P03372_ESR1 Targets of BBR in Targets of BBR in P40763_STAT3 K562(14) KCL22(6) Q13639_5HT4R ABL1 P24468_COT2 28 P25101_EDNRA

Q99720_SGMR1 P10275_ANDR P11229_ACM1 P05362_ICAM1 P13726_TF

P35869_AHR Q9Y6K9_NEMO P37231_PPARG D P10828_THB 12 Q15722_LT4R1 1910 P05213_INSR 1773 1637 P16066_ANPRA 1501 P20594_ANPRB 1364 1228 P16581_SELE 1091 P41595_HTR2B 955 P35368_ADRA1B 818 682 P21333_FLNA 545 P29460_IL12B 409 P18825_ADRA2C 272 136 Q14289_FAK2 0.00

Figure 1. BBR directly bound to ABL1 in CML cells. A, BBR target identiﬁcation in K562 and KCL22 cells. B, Heatmap of BBR target proteins in K562 and KCL22 cells. C, Venn diagram of BBR target proteins in K562 and KCL22 cells, showing that 28 proteins (including ABL1) from both K562 and KCL22 cells were identiﬁed. D, Molecular docking model of BBR with ABL1.

4044 Clin Cancer Res; 26(15) August 1, 2020 CLINICAL CANCER RESEARCH

Berberine Induces Autophagic BCR-ABL T315I Degradation

A 1,000 B MW371 vs. PTK MW371 vs. Mus_IgG 800 MW371 vs. Rabt_IgG MW371 vs. PBST Stationary Moving Avg KD Int. ABS No. phase phase (M) level (tr_KD) 600 1 PTK BBR 8.58E-07 Stronge 20.1533 2 Mus_IgG BBR 4.79E-02 None 4.3842 400 3 Rabt_IgG BBR 2.71E-02 None 5.2063 200 BK PBST BBR 4.19E-01 None 0.4386 Response unit (RU) Response

0 200 400 600 800 1,000 Time (s) C D

Melt peak

200

BBR-PTK 150

100 (5 µmol/L, 94.3°C) (0 µmol/L, 91.5°C) –d(RFU)/dT

50 BBR (10 µmol/L, 95.8°C)

86 88 90 92 94 96 98 100 Temperature, celsius EF LWEIATYGMSP NAVVLLYMATQ

800 nmol/L 1,600 nmol/L 800 nmol/L 1,600 1,600 1,600 nmol/L 3,200 nmol/L 3,200 nmol/L 1,400 1,400 1,200 1,200 1,000 1,000 800 800 600 600 400 400

Pep_1-2 − MW371 Signal (RU) Pep_1-2 − MW371 200

Pep_1-1 − MW371 Signal (RU) − MW371 Pep_1-1 200 0 0

0 200 400 600 800 1,000 0200400600 800 1,000 Time (s) Time (s)

Figure 2. BBR directly bound to the PTK domain of ABL1 in CML cells. A, SPRi binding assay. Sensor chips with BBR (molecular weight [MW]: 371) immobilized on the surface were ﬁrst mock pretreated (Mock), and then treated with pure PTK domain protein, mouse IgG, or rabbit IgG. SPR signals are expressed in resonance units (RU). 1 B, Mean equilibrium dissociation constant (Kd) between PTK domain and BBR. C, Chemical shift of BBR based on H-NMR assays before and after adding PTK proteins. D, Thermoshift assays assessing the binding between BBR and the PTK domain of ABL1. E, Left, predicted binding site of BBR (LWEIATYGMSP) that targets the PTK domain. Right, SPRi assay involving LWEIATYGMSP peptide and BBR. F, Left, predicted binding site of BBR (NAVVLLYMATQ) that targets the PTK domain. Right, SPRi assay involving NAVVLLYMATQ peptide and BBR.

To further examine whether BBR directly binds to ABL1, thermo- BBR suppressed the viability of both imatinib-sensitive and shift assays were performed. Different concentrations (0, 5, and 10 -resistant cell lines mmol/L) of BBR were added to the PTK domain protein and incubated To determine whether BBR affected CML cell viability, imatinib- at 4C overnight. On the second day, SYPRO Orange was added and resistant (BaF3-P210-T315I and SFO2), and imatinib-sensitive (K562, the protein stability was assessed by observing the melting curve shifts, KCL22, and BaF3-P210) CML cell lines were treated with different with peaks at 91.5C, 94.3C, and 95.8C for 0, 5, and 10 mmol/L of concentrations (0–10 mmol/L) of BBR (Fig. 3B). The cell growth, in all BBR, respectively. As the BBR concentration increased, the melting cell lines, was signiﬁcantly arrested by treatment with 5 mmol/L BBR temperature (Tm) of PTK increased. The results further conﬁrmed for 48 hours (Fig. 3B). Imatinib plus BBR was more effective than that BBR directly binds to PTK (Fig. 2D) imatinib alone (Fig. 3D and E). The results clearly demonstrate that

AACRJournals.org Clin Cancer Res; 26(15) August 1, 2020 4045

Yin et al.

A SFO2 B C CML-like mouse bone marrow 110 K562 120 Imatinib 100 KCL22 120 Imatinib 90 Berberine 100 Berberine BaF3-P210 100 80 Imatinib + berberine (5 mmol/L) 80 70 BaF3-P210-T315I 80 60 60 50 60 40 40 30 40 20 20 20 10

0 viability (%) Relative 0 0 Relative viability (%) Relative 0246810 0246810 viability (%) Relative 02468101214161820 Concentrations (mmol/L) BBR Concentrations (mmol/L) Concentrations (mmol/L)

D BaF3-P210-T315I E BaF3-P210 F CML sample bone marrow 150 120 Imatinib 120 Imatinib Imatinib Imatinib + berberine (5 mmol/L) 100 120 100 Imatinib + berberine (5 mmol/L) Berberine 80 m 90 80 Imatinib + berberine (5 mol/L) 60 60 60 40 40 30 20 20 Relative viability (%) Relative Relative viability (%) Relative 0 0 viability (%) Relative 0 02 4 6 810 0.00 0.05 0.10 0.15 0.20 02468101214161820 Imatinib concentrations (mmol/L) Imatinib concentrations (mmol/L) Concentrations (mmol/L)

G BaF3-P210 H BaF3-P210 150 Blank Berberine Imatinib

100

50 (% of blank) Colony number Colony

Blank Imatinib Berberine J BaF3-P210-T315I I BaF3-P210-T315I 150 Blank Imatinib Berberine

100

50 (% of blank) Colony number Colony

Blank Imatinib Berberine

K K562 L KCL22 M BaF3-P210 N BaF3-P210-T315I

800 800 600 400 600 600 300 400 400 200 400

200 100 200 200 (OD = 450) (OD = 450) (OD = 450) (OD = 450) (OD PTK Activity PTK Activity PTK Activity PTK Activity 0 0 0 0 0122448 0 12 24 48 0 12 24 48 0 12 24 48 Hours Hours Hours Hours

Figure 3. Growth inhibition of CML cell lines, CML-like mouse cells, and human CML BM cells by BBR. Cell viability was determined using MTT assays after treatment with imatinib and/or BBR for 48 hours in SFO2 (A) and K562, KCL22, Baf3-P210, and Baf3-P210-T315I cells (B). BBR increased the sensitivity to imatinib in CML-like mouse BM (C), BaF3-P210-T315I (D), BaF3-P210 (E), and human CML BM cells (F). Histograms and images showing the number of cell colonies after treatment with imatinib or BBR for 7 days in BaF3-P210 cells (G and H) and BaF3-P210-T315I cells (I and J). PTK activity based on ELISAs after BBR treatment (5 mmol/L for 12, 24, and 48 hours) in CML cell lines: K562 (K), KCL-22 (L), BaF3-P210 (M), and BaF3-P210-T315I cells (N).

4046 Clin Cancer Res; 26(15) August 1, 2020 CLINICAL CANCER RESEARCH

Berberine Induces Autophagic BCR-ABL T315I Degradation

BBR can overcome resistance to imatinib in CML cell lines. Resistance promising drug for the treatment of CML with the T315I mutation. to imatinib remains a challenge in patients with CML. Therefore, in However, preclinical and clinical testing of BBR in CML will be this study, we focused on the function of BBR in imatinib-resistant required to confirm this hypothesis. CML. We employed a human BCR-ABL gene-driven CML mouse model to evaluate the in vivo effect of BBR on CML. CML mice BBR inhibited the survival of human primary CML BM cells and were randomized into three groups to be treated with either vehicle, CML-like mouse BM cells in vitro BBR, or imatinib for 14 days (Fig. 4G). BBR or imatinib alone To assess the effect of BBR on human primary CML BM cells and prolonged the survival of the mice (Fig. 4H). We found that BCR- CML-like mouse BM cells, these cells were treated with different ABL-T315I protein was inhibited by BBR in vivo in the T315I concentrations (0–20 mmol/L) of BBR, which significantly inhibited xenograft models (Supplementary Fig. S1C and S1D), indicates the both human and mouse cell survival in vitro (Fig. 3C and F). Imatinib different mechanism underlying the effect of BBR in the treatment plus BBR markedly decreased the human CML BM cell viability of imatinib-resistant CML compared with the mechanism under- relative to imatinib alone, showing that BBR increased the sensitivity lying the effect of imatinib. to imatinib (Fig. 3F). BBR was not cytotoxic for human PBMCs and þ normal CD34 cells, indicating that BBR specifically inhibited CML BBR reduced BCR-ABL protein expression in imatinib-sensitive cell growth (Supplementary Fig. S6B). and -resistant cell lines Levels of BCR-ABL protein in cell lines were determined after BBR inhibited the colony formation of imatinib-sensitive and BBR treatment. BBR reduced BCR-ABL protein expression in both -resistant cell lines imatinib-sensitive and -resistant CML cells in a time- and concen- Cell colony formation is closely associated with neoplastic capacity, tration-dependent manner (Fig. 5A–F and Supplementary so we investigated the effects of BBR and/or imatinib on colony Fig. S4A–S4F). In contrast, levels of BCR-ABL mRNA remained formation in imatinib-sensitive and -resistant cell lines. Both BBR unchanged (Supplementary Fig. S2). These results indicate that BBR and imatinib significantly reduced the colony formation of imatinib- may directly affect the level of BCR-ABL protein. sensitive cell lines (Fig. 3G and H). Importantly, only BBR inhibited the colony formation ability of imatinib-resistant cell lines (Fig. 3I BBR reduced BCR-ABL protein expression in human primary and J). CML BM cells and CML-like mouse BM cells in vitro To investigate the effect of BBR on BCR-ABL in primary CML BM BBR inhibited PTK activity in CML cells cells, we treated CML BM mononuclear cells and CML-like mouse BM The effect of BBR on PTK activity was evaluated by treating CML mononuclear cells with BBR (5 mmol/L) for 48 hours, which decreased cells with 5 mmol/L BBR for 12, 24, and 48 hours and analyzing the PTK the BCR-ABL expression in vitro in these cells (Fig. 5G and H; activity by ELISA. As shown in Fig. 3K–N, BBR significantly inhibited Supplementary Fig. S4G and S4H). PTK activity in CML cells. BBR induced autophagy in CML cells BBR inhibited ABL1 activity in vitro kinase assay To investigate the mechanism of BBR-induced degradation of BCR- To explore whether BBR directly inhibit ABL kinase activity, 1 mg ABL, we examined autophagy at the cellular level by assessing the levels recombinant ABL1 kinase proteins were mixed with different of the autophagic lysosome-related proteins LC3II, BECN1, and P62 in concentrationsofBBR(0,2,4,8,10mmol/L), and kinase assays BBR-treated cells using Western blotting. BBR treatment of K562 and were performed as described in Materials and Methods. As shown BaF3-P210-T315I cells induced autophagy, which was confirmed by in Supplementary Fig. S8A, BBR directly inhibited ABL1 activity the upregulation of LC3II and BECN1 and downregulation of P62 in vitro. (Fig. 6B and C; Supplementary Fig. S5A–S5F). Furthermore, we assessed whether BCR-ABL interacted with the autophagic lyso- BBR therapeutic in CML mouse model some-associated protein P62. As expected, BBR induced this interac- To investigate the therapeutic potential of BBR, we intravenously tion (Fig. 6A). injected BALB/c nude mice with BaF3 cells harboring the T315I- luciferase BCR-ABL mutation, which express a mutant form of the Degradation of BCR-ABL by BBR can be reversed by autophagy BCR-ABL protein that is resistant to imatinib. Prior to injection, the inhibition mice were irradiated with 2.5 Gy X-rays. After the BaF3-P210- Pretreatment with the autophagy inhibitors CQ and 3-MA counter- T315I cells migrated to the BM, the mice were treated daily with acted the BBR-mediated degradation of BCR-ABL (Fig. 6D–G; Sup- 15 mg/kg BBR or 50 mg/kg imatinib alone for 7 days. Imatinib plementary Fig. S7A–S7D). BBR mediated BCR-ABL protein degra- resulted in no significant inhibition of BaF3-P210-T315I cell growth dation by autophagy, and inhibition of autophagy by CQ and 3-MA and did not affect the mouse survival rates (Fig. 4A and B). In significantly counteracted this degradation. Thus, autophagy inhibi- contrast, BBR led to significant inhibition of BaF3-P210-T315I cell tion rescued CML cells from the cytotoxic effects of BBR (Supple- growth and improved the mouse survival rates (Fig. 4C and D). mentary Fig. S7). BBR-induced inhibition of BCR-ABL and tumor growth was also evaluated in mice T315I xenografts. BALB/c nude mice were inocu- LRSAM1 was associated with BCR-ABL in a multiprotein lated subcutaneously with BaF3-P210-T315I cells and treated intra- complex peritoneally with BBR (15 mg/kg), imatinib (50 mg/kg), or BBR We used immunoprecipitation-2D and nano-HPLC-MS/MS on plus imatinib daily for 15 days. Thereafter, tumors were extracted K562 cells and 293T cells transfected with a FLAG-BCR-ABL and BCR-ABL expression was examined by IHC (Supplementary construct to identify proteins that are potentially associated with Fig. S1C and S1D). BBR inhibited the growth of T315I tumors BBR-mediated BCR-ABL degradation. A number of autophagic (Supplementary Fig. S1A and S1B), indicating that it may be a lysosome–related proteins were identified in the purified

AACRJournals.org Clin Cancer Res; 26(15) August 1, 2020 4047

Yin et al.

A D P = 0.04 120 Control (n = 5) 100 IM (n = 5) 80 BBR (n = 5) 60 40 20 Percent survival Percent 0 0102030 Days after cell injection B E 0.20 P = 0.014

0.15

0.10 *

0.05

Liver/body weight Liver/body 0.00 C

Control Imatinib F Berberine 0.03 P = 0.004

0.02 * 0.01

Spleen/body weight 0.00 G

Treat with IM, Control Imatinib MSCV-BCR-ABL Berberine IRES-EGFP BBR

Donor mice, Transduction 5-FU (200 mg/kg) Survival analysis IL3 2 weeks IL6 SCF BM cells Recipient CML mice

H Control (n = 10) 100 IM (n = 10)

BBR (n = 10)

50 Percent survival Percent

0 0102030405060 Days after transplantation

Figure 4. Efﬁcacy of BBR in a CML mouse model. BaF3 cells (106) harboring the T315I-luciferase BCR-ABL mutation were injected into the tail vein of female BALB/c nude mice (ﬁve mice per group, 6 weeks of age) and the mice were treated once daily (i.p.) for 7 days with BBR (15 mg/kg) or imatinib (50 mg/kg). Images showing the tumor burden of the mice after treatment with saline control (A), imatinib (B), and BBR (C). D, Survival analysis of mice. E, Liver/body weight ratios of mice. F, Spleen/body weight ratios of mice. G, Schematic diagram of BCR-ABL-driven CML mouse model and drug treatment. H, Kaplan–Meier survival curves of mice treated with BBR or imatinib (P < 0.01; P < 0.001, log-rank test).

4048 Clin Cancer Res; 26(15) August 1, 2020 CLINICAL CANCER RESEARCH

Berberine Induces Autophagic BCR-ABL T315I Degradation

A K562 B KCL22 (h) 0122448 (h) 0 12 24 48

BCR-ABL (210 kDa) ABL1 (145 kDa)

b-Actin (42 kDa)

C BaF3-P210 D BaF3-P210-T315I (h) 0 12 24 48 (h) 0 12 24 48 BCR-ABL (210 kDa) ABL1 (145 kDa)

b-Actin (42 kDa)

E K562 F BaF3-P210-T315I BBR BBR (mmol/L) 0135(mmol/L) 0 13 5 BCR-ABL (210 kDa)

b-Actin (42 kDa)

G CML Patients sample bone marrow H CML-Like mouse bone marrow BBR BBR (mmol/L) 05(mmol/L) 05

BCR-ABL (210 kDa)

b-Actin (42 kDa)

Figure 5. BBR-mediated downregulation of BCR-ABL protein in CML cell lines, human CML BM cells, and CML-like mouse BM cells. CML cells were treated with BBR (5 mmol/L) for 12, 24, and 48 hours, which downregulated BCR-ABL protein levels, based on Western blotting, in K562 (A), KCL-22 (B), BaF3-P210 (C), and BaF3-P210-T315I cells (D). CML cells were treated with different concentrations of BBR (0, 1, 3, and 5 mmol/L) and BCR-ABL protein levels were determined by Western blotting in K562 (E) and BaF3-P210-T315I cells (F). Primary CML cells were treated with BBR (5 mmol/L) for 48 hours and the BCR-ABL protein levels were determined by Western blotting in human CML BM mononuclear cells (G) and CML-like mouse BM mononuclear cells (H). immunoprecipitates (Supplementary Tables S1 and S2). Of these assessed the levels of LC3II, BECN1, and P62 autophagic lyso- molecules, LRSAM1 attracted our attention because it is upregu- some-related proteins in LRSAM1-overexpressing K562 cells, and lated by BBR (Fig. 7C) and related to autophagy. The interaction we found that the autophagic pathway was activated by LRSAM1 between LRSAM1 and BCR-ABL was confirmed in K562 cells (Fig. 7E).TheautophagicinhibitorCQpreventedBCR-ABLdeg- (Fig. 7A and B). This observation prompted us to speculate that radation mediated by LRSAM1 (Fig. 7F). LRSAM1 might be recruited by BCR-ABL and might be involved in the degradation induced by BBR. To confirm the presumption that LRSAM1 mediates BBR- Discussion induced degradation of BCR-ABL, we overexpressed LRSAM1 in BBR is an active agent in the treatment of various diseases, K562 cells, and BCR-ABL downregulation was observed (Fig. 7D, such as cardiovascular and metabolic diseases, depression, and left). We then designed siRNA sequences to establish LRSAM1- cancer (5, 19–22). There is also emerging evidence that BBR is a knockdown K562 cell lines, which resulted in increased BCR-ABL promising leukemia treatment (8). The identification of druggable (Fig. 7D, right), indicating the involvement of LRSAM1 in the targetsisextremelyimportantforidentifyingtherapeuticdrugs(23,24). regulation of BCR-ABL turnover. To assess whether LRSAM1 was To explore the direct cell target of BBR, we designed an SPR-HPLC-MS indeed involved in autophagic degradation of BCR-ABL, we assay and found that it selectively targets ABL1. ABL1 contains a

AACRJournals.org Clin Cancer Res; 26(15) August 1, 2020 4049

Yin et al.

A Lysosome BCR-ABL P62 Merge

Control

BBR

C B K562 BaF3-P210-T315I BBR BBR (mmol/L) 01 35(mmol/L) 01 35 LC3-I (16 kDa)

LC3-II (14 kDa)

BECN1 (60 kDa)

P62 (62 kDa)

b-Actin (42 kDa)

D K562 E BaF3-P210-T315I BBR − + − + BBR − − + + CQ − − + + CQ − + − + BCR-ABL (210 kDa)

b-Actin (42 kDa)

F K562 G BaF3-P210-T315I BBR − − + + BBR − − + + 3-MA − + − + 3-MA − + − +

BCR-ABL (210 kDa)

b-Actin (42 kDa)

Figure 6. Autophagic degradation of BCR-ABL induced by BBR in CML cells. A, Lysosomal colocalization of BCR-ABL and P62. K562 cells were treated with control or BBR (5 mmol/L) for 24 hours. Before collection, cells were stained with lysosome probe, and after collection they were stained with either anti-ABL (green) or anti-P62 (red) antibodies and signals were detected by confocal microscopy. Merged panels indicate overlapping images of the three ﬂuorescent signals. In addition, the overall levels of autophagy at the cellular level were assessed by using Western blotting to assess the protein levels of LC3II, BECN1, and P62 after treatment with different concentrations of BBR (1, 3, and 5 mmol/L) in K562 (B) and BaF3-P210-T315I cells (C). b-Actin served as a loading control. Next, K562 (D) and BaF3-P210- T315I cells (E) were treated with the autophagy inhibitor CQ (10 mmol/L) or BBR for 48 hours, or preexposed to CQ (10 mmol/L) for 4 hours and then treated with BBR for 48 hours, and BCR-ABL protein levels were determined by Western blotting, which showed that CQ inhibited the BBR-induced degradation of BCR-ABL. Finally, K562 (F) and BaF3-P210-T315I cells (G) were treated with the autophagy inhibitor 3-MA (25 mmol/L) or BBR for 48 hours, or preexposed to 3-MA (25 mmol/L) for 4 hours and then treated with BBR (5 mmol/L) for 48 hours, and BCR-ABL protein levels were determined by Western blotting, which showed that 3-MA inhibited the BBR-induced degradation of BCR-ABL.

4050 Clin Cancer Res; 26(15) August 1, 2020 CLINICAL CANCER RESEARCH

Berberine Induces Autophagic BCR-ABL T315I Degradation

ABBCR-ABL LRSAM1 Merge IP: BCR K562+ Input IgG K562 BBR

BCR-ABL Control (210 kDa)

LRSAM1 83 (kDa) BBR

C D K562 NC LRSAM1 BBR NC siLRSAM1

(h) 0122448 BCR-ABL

LRSAM1 LRSAM1

GAPDH GAPDH

E F LRSAM1+ NC LRSAM1 K562 LRSAM1 CQ LC3-I (16 kDa) LC3-II (14 kDa) BCR-ABL BECN1 (60 kDa) LRSAM1 P62 (62 kDa) GAPDH GAPDH (36 kDa)

Figure 7. BBR-induced autophagic degradation of BCR-ABL via LRSAM1 recruitment in CML cells. A, K562 cells were treated with BBR (5 mmol/L) for 24 hours and immunoprecipitation was performed using anti-BCR antibodies. To detect the proteins in the immunoprecipitates, SDS-PAGE followed by Western blotting with anti-ABL1 and anti-LRSAM1 antibodies was conducted. B, After BBR treatment, LRSAM1 protein was recruited by BCR-ABL in K562 cells treated with BBR (5 mmol/L) for 24 hours. After collection, cells were stained with either anti-ABL (green) or anti-LRSAM1 (red) antibodies and signals were detected by confocal microscopy. Merged panels indicate overlapping images of the two ﬂuorescent signals. C, K562 cells were treated with BBR (5 mmol/L) for 12, 24, and 48 hours and the protein level of LRSAM1 was measured by Western blotting, showing that LRSAM1 protein was upregulated by BBR. D, Left, LRSAM1 was upregulated (using an LRSAM1 plasmid) in K562 cells and the level of BCR-ABL was assessed by Western blotting. Right, LRSAM1 was downregulated (using LRSAM1 siRNA) in K562 cells and the level of BCR-ABL was assessed by Western blotting. There were negative correlations between LRSAM1 and BCR-ABL in both experiments. E, LRSAM1 was upregulated (using an LRSAM1 plasmid) in K562 cells and the levels of autophagy signaling-related proteins were assessed by Western blotting. F, LRSAM1 was upregulated (using an LRSAM1 plasmid) and the lysosome inhibitor CQ (10 mmol/L) was added, and the level of BCR-ABL was assessed by Western blotting.

critical PTK domain, which plays an important role in its tyrosine and BBR induces degradation of BCR-ABL via the autophagic lyso- kinase activity, and there has been a concerted effort to identify some pathway. small-molecule inhibitors of ABL1, such as imatinib and dasatinib. According to our results, autophagy plays an important role in the However, drug resistance is an important barrier in CML treatment. BBR-mediated degradation of BCR-ABL (Fig. 6). There are two The molecular docking results showed that BBR binds with the PTK mechanisms of cellular protein degradation: the ubiquitin proteasome domain of ABL1, which was conﬁrmed by the SPRi, NMR, and DSF and autophagy-lysosome systems. The major method for removal of assays.WeassumethatBBRmayhavesomeeffectinCML bulky cellular material, including organelles and protein complexes, is treatment. autophagy. This process involves the sequestration of cytosolic mate- The role of autophagic lysosomes in the speciﬁc BBR-dependent rial in membrane-bound vesicles, which eventually fuse with lyso- targeting mechanisms in malignant cells was unclear. Notably, autop- somes, enabling the degradation and recycling of components (25). hagy-modulating agents have recently become the focus of clinical Autophagy is required for the degradation of the promyelocytic translational efforts to treat cancer (9), but the underlying mechanisms leukemia (PML)/retinoic acid receptor alpha (RAR) oncogenic connecting autophagy and cancer remained unclear. In this study, we fusion protein (26, 27), and arsenic trioxide-induced autophagy demonstrated that BBR can target the BCR-ABL oncoprotein in CML leads to BCR-ABL degradation (28). Imatinib not only inhibits the

AACRJournals.org Clin Cancer Res; 26(15) August 1, 2020 4051

Yin et al.

tyrosine kinase activity of BCR-ABL, but it also leads to BCR-ABL BCR-ABL-T315I mutation confers resistance to all of them (40). sequestration in autophagic vesicles (29). BCR-ABL–expressing The results of this study showed that BCR-ABL-T315I protein was cells exhibit low basal levels of autophagy, and autophagy was inhibited by BBR in vivo in the T315I xenograft models (Supple- essential in a study that suppressed BCR-ABL–mediated leukemo- mentary Fig. S1C and S1D). The fact that the BaF3-P210-T315I cells genesis (30). Autophagy also actively suppresses hematopoietic growth were inhibited in vivo indicates it maybe relay on the stem cell metabolism (31), and the promotion of autophagy may different mechanism underlying the effect of BBR in the treatment have therapeutic effects. of imatinib-resistant CML compared with the mechanism under- Selective autophagy shuttling proteins, such as P62, mediate lying the effect of imatinib. degradation as they bind to ubiquitinated substrates via their In summary, we discovered that the PTK domain of BCR-ABL is a ubiquitin-binding domains and dock on autophagosomes via the binding site of BBR. BBR can inhibit the cell viability and colony interaction of their LC3-interacting motif with LC3 (32). However, formation of CML cells and prolong survival in CML mouse models in macroautophagy, several substrates can be targeted to autopha- with imatinib sensitivity or resistance. BBR induces the degradation of gosomes independently of ubiquitination. P62 has previously been BCR-ABL and BCR-ABL-T315I via the autophagic lysosome pathway implicated in the shuttling of ubiquitinated proteins and functions by recruiting LRSAM1, as shown in Supplementary Fig. S8B. There- as a “cargo receptor” for the autophagic degradation of targeted fore, BBR is a promising new inhibitor for the treatment of CML with proteins (33); P62 is degraded by the autophagic lysosomal imatinib resistance. pathway (34). LRSAM1 encodes a multidomain RING-type E3 ubiquitin ligase Disclosure of Potential Conflicts of Interest that covalently ubiquitylates target proteins via its catalytic C-terminal No potential conflicts of interest were disclosed. zinc finger domain. Posttranslational ubiquitylation directs cellular proteins to various fates and functions, including proteasomal deg- Authors’ Contributions radation, lysosomal targeting, modulation of protein–protein inter- Conception and design: J. Fei actions, transcriptional regulation, and cell signaling (35). We found Development of methodology: J. Fei that LRSAM1 was recruited by BCR-ABL after BBR treatment (Fig. 7A Acquisition of data (provided animals, acquired and managed patients, provided and B), and LRSAM1 overexpression increased the overall level of facilities, etc.): Z. Yin, G. Huang, C. Gu, Y. Liu autophagy in CML cells. Analysis and interpretation of data (e.g., statistical analysis, biostatistics, BCR-ABL is associated with aberrant PTK activity and can computational analysis): Z. Yin, G. Huang, C. Gu, Y. Liu, J. Yang phosphorylate a large number of substrates, leading to activation Writing, review, and/or revision of the manuscript: Z. Yin, C. Gu, Y. Liu Administrative, technical, or material support (i.e., reporting or organizing data, of many downstream effectors, including some that confer anti- constructing databases): Z. Yin, Y. Liu apoptotic and growth advantages to CML cells. BCR-ABL PTK Study supervision: J. Fei activity is selectively inhibited by current CML drugs, such as imatinib (36) and dasatinib (37). We also found that the PTK Acknowledgments domain is a direct target of BBR and its activity is inhibited by BBR This work was supported by grants from the Key Program for the National (Fig. 3K, L–N). As shown in Fig. 4 and Supplementary Fig. S1, BBR Natural Science Foundation of China (no. 81830114), Research Project for significantly inhibited the growth of T315I tumors and extended the Practice Development of National TCM Clinical Research Bases (no. lifespan of the T315I xenograft models. In the treatment of CML, JDZX2015119), Science and Technology Program of Guangdong Province (no. imatinib is a safe and effective first-line therapy for most patients 2016A020226027, 2017B 030303001), Science and Technology Program of Guangzhou City (no. 201604020140), and Fundamental Research Funds for the with chronic-phase CML (38). Although most patients attain a Central Universities (no. 21617461). durable complete cytogenetic response, minimal residual disease persists in nearly all patients, and active disease recurs if treatment The costs of publication of this article were defrayed in part by the payment of page is discontinued. More importantly, discontinuation of imatinib due charges. This article must therefore be hereby marked advertisement in accordance to intolerance or resistance is necessary in up to 30% of patients with 18 U.S.C. Section 1734 solely to indicate this fact. within the first 5 years of therapy (39). All current CML drugs act as ATP competitive inhibitors. Several PTK domain mutations confer Received July 28, 2019; revised December 3, 2019; accepted February 20, 2020; high-level resistance to one or more of these therapies, and the published first February 25, 2020.

References 1. Nash I. Chronic myeloid leukemia. N Engl J Med 1999;341:765. 6. Fonseca R, Barlogie B, Bataille R, Bastard C, Bergsagel PL, Chesi M, et al. Genetics 2. O'Hare T, Deininger MW, Eide CA, Clackson T, Druker BJ. Targeting the BCR- and cytogenetics of multiple myeloma: a workshop report. Cancer Res 2004;64: ABL signaling pathway in therapy-resistant Philadelphia chromosome-positive 1546–58. leukemia. Clin Cancer Res 2011;17:212–21. 7.ZhangX,GuL,LiJ,ShahN,HeJ,YangL,etal.Degradationof 3. Druker BJ, Talpaz M, Resta DJ, Peng B, Buchdunger E, Ford JM, et al. Efﬁcacy MDM2 by the interaction between berberine and DAXX leads to potent and safety of a speciﬁc inhibitor of the BCR-ABL tyrosine kinase in chronic apoptosis in MDM2-overexpressing cancer cells. Cancer Res 2010;70: myeloid leukemia. N Engl J Med 2001;344:1031–7. 9895–904. 4. Baccarani M, Saglio G, Goldman J, Hochhaus A, Simonsson B, Appelbaum F, 8. Yu FS, Yang JS, Lin HJ, Yu CS, Tan TW, Lin YT, et al. Berberine inhibits WEHI-3 et al. Evolving concepts in the management of chronic myeloid leukemia: leukemia cells in vivo. In Vivo 2007;21:407–12. recommendations from an expert panel on behalf of the European LeukemiaNet. 9. Garber K. Inducing indigestion: companies embrace autophagy inhibitors. J Natl Blood 2006;108:1809–20. Cancer Inst 2011;103:708–10. 5. Kong W, Wei J, Abidi P, Lin M, Inaba S, Li C, et al. Berberine is a novel 10. Liu C, Nie D, Li J, Du X, Lu Y, Li Y, et al. Antitumor Effects of blocking protein cholesterol-lowering drug working through a unique mechanism distinct from neddylation in T315I-BCR-ABL leukemia cells and leukemia stem cells. statins. Nat Med 2004;10:1344–51. Cancer Res 2018;78:1522–36.

4052 Clin Cancer Res; 26(15) August 1, 2020 CLINICAL CANCER RESEARCH

Berberine Induces Autophagic BCR-ABL T315I Degradation

11. Wang L, Cheng J, Wang S, Zhang X, Cai X. Screening of inhibitors of Taenia 26. Isakson P, Bjoras M, Boe SO, Simonsen A. Autophagy contributes to therapy- solium glycogen synthase Kinase-3 beta. Rsc Advances 2017;7:43319–26. induced degradation of the PML/RARA oncoprotein. Blood 2010;116:2324–31. 12. Gu C, Liu Y, Yin Z, Yang J, Huang G, Zhu X, et al. Discovery of the Oncogenic 27. Wang Z, Cao L, Kang R, Yang M, Liu L, Zhao Y, et al. Autophagy regulates Parp1, a target of bcr-abl and a potential therapeutic, in mir-181a/PPFIA1 myeloid cell differentiation by p62/SQSTM1-mediated degradation of PML- signaling pathway. Mol Ther Nucleic Acids 2019;16:1–14. RARalpha oncoprotein. Autophagy 2011;7:401–11. 13. Niesen FH, Berglund H, Vedadi M. The use of differential scanning fluorimetry 28. Goussetis DJ, Gounaris E, Wu EJ, Vakana E, Sharma B, Bogyo M, et al. to detect ligand interactions that promote protein stability. Nat Protoc 2007;2: Autophagic degradation of the BCR-ABL oncoprotein and generation of anti- 2212–21. leukemic responses by arsenic trioxide. Blood 2012;120:3555–62. 14. Duy C, Hurtz C, Shojaee S, Cerchietti L, Geng H, Swaminathan S, et al. BCL6 29. Elzinga BM, Nyhan MJ, Crowley LC, O'Donovan TR, Cahill MR, McKenna SL. enables Phþ acute lymphoblastic leukaemia cells to survive BCR-ABL1 kinase Induction of autophagy by Imatinib sequesters Bcr-Abl in autophagosomes and inhibition. Nature 2011;473:384–8. down-regulates Bcr-Abl protein. Am J Hematol 2013;88:455–62. 15. Wu LX, Wu Y, Chen RJ, Liu Y, Huang LS, Lou LG, et al. Curcumin derivative 30. Altman BJ, Jacobs SR, Mason EF, Michalek RD, MacIntyre AN, Coloff JL, et al. C817 inhibits proliferation of imatinib-resistant chronic myeloid leukemia Autophagy is essential to suppress cell stress and to allow BCR-Abl-mediated cells with wild-type or mutant Bcr-Abl in vitro. Acta Pharmacol Sin 2014;35: leukemogenesis. Oncogene 2011;30:1855–67. 401–9. 31. Ho TT, Warr MR, Adelman ER, Lansinger OM, Flach J, Verovskaya EV, et al. 16. Yang J, Cao D, Zhang Y, Ou R, Yin Z, Liu Y, et al. The role of phosphorylation Autophagy maintains the metabolism and function of young and old stem cells. of MLF2 at serine 24 in BCR-ABL leukemogenesis. Cancer Gene Ther 2020; Nature 2017;543:205–10. 27:98–107. 32. Kirkin V, McEwan DG, Novak I, Dikic I. A role for ubiquitin in selective 17. Li S, Ilaria RL Jr, Million RP, Daley GQ, Van Etten RA. The P190, P210, and P230 autophagy. Mol Cell 2009;34:259–69. forms of the BCR/ABL oncogene induce a similar chronic myeloid leukemia-like 33. Lamark T, Kirkin V, Dikic I, Johansen T. NBR1 and p62 as cargo receptors for syndrome in mice but have different lymphoid leukemogenic activity. J Exp Med selective autophagy of ubiquitinated targets. Cell Cycle 2009;8:1986–90. 1999;189:1399–412. 34. Komatsu M, Waguri S, Koike M, Sou YS, Ueno T, Hara T, et al. Homeostatic 18. Hurtz C, Hatzi K, Cerchietti L, Braig M, Park E, Kim YM, et al. BCL6-mediated levels of p62 control cytoplasmic inclusion body formation in autophagy- repression of p53 is critical for leukemia stem cell survival in chronic myeloid deficient mice. Cell 2007;131:1149–63. leukemia. J Exp Med 2011;208:2163–74. 35. Metzger MB, Hristova VA, Weissman AM. HECT and RING finger families of 19. Huang M, Liang Y, Liu Q, Chang X, Guo Y. Berberine attenuates Abeta25–35- E3 ubiquitin ligases at a glance. J Cell Sci 2012;125:531–7. induced apoptosis in primary cultured hippocampal neurons. Biochem Biophys 36. Schindler T, Bornmann W, Pellicena P, Miller WT, Clarkson B, Kuriyan J. Res Commun 2016. Structural mechanism for STI-571 inhibition of abelson tyrosine kinase. Science 20. Kong WJ, Zhang H, Song DQ, Xue R, Zhao W, Wei J, et al. Berberine reduces 2000;289:1938–42. insulin resistance through protein kinase C-dependent up-regulation of insulin 37. Hochhaus A. Dasatinib for the treatment of Philadelphia chromosome-positive receptor expression. Metabolism 2009;58:109–19. chronic myelogenous leukaemia after imatinib failure. Expert Opin Pharmac- 21. Fan J, Li B, Ge T, Zhang Z, Lv J, Zhao J, et al. Berberine produces antidepressant- other 2007;8:3257–64. like effects in ovariectomized mice. Sci Rep 2017;7:1310. 38. Druker BJ, Guilhot F, O'Brien SG, Gathmann I, Kantarjian H, Gattermann N, 22. Feng X, Sureda A, Jafari S, Memariani Z, Tewari D, Annunziata G, et al. Berberine et al. Five-year follow-up of patients receiving imatinib for chronic myeloid in cardiovascular and metabolic diseases: from mechanisms to therapeutics. leukemia. N Engl J Med 2006;355:2408–17. Theranostics 2019;9:1923–51. 39. O'Hare T, Shakespeare WC, Zhu X, Eide CA, Rivera VM, Wang F, et al. AP24534, 23. Fetz V, Prochnow H, Bronstrup M, Sasse F. Target identification by image a pan-BCR-ABL inhibitor for chronic myeloid leukemia, potently inhibits the analysis. Nat Prod Rep 2016;33:655–67. T315I mutant and overcomes mutation-based resistance. Cancer Cell 2009;16: 24. Wang J, Gao L, Lee YM, Kalesh KA, Ong YS, Lim J, et al. Target identification of 401–12. natural and traditional medicines with quantitative chemical proteomics 40.O'HareT,EideCA,TynerJW,CorbinAS,WongMJ,BuchananS,etal. approaches. Pharmacol Ther 2016;162:10–22. SGX393 inhibits the CML mutant Bcr-AblT315I and preempts in vitro 25. Klionsky DJ. Autophagy: from phenomenology to molecular understanding in resistance when combined with nilotinib or dasatinib. Proc Natl Acad Sci less than a decade. Nat Rev Mol Cell Biol 2007;8:931–7. U S A 2008;105:5507–12.

AACRJournals.org Clin Cancer Res; 26(15) August 1, 2020 4053

Discovery of Berberine that Targetedly Induces Autophagic Degradation of both BCR-ABL and BCR-ABL T315I through Recruiting LRSAM1 for Overcoming Imatinib Resistance

Zhao Yin, Guiping Huang, Chunming Gu, et al.

Clin Cancer Res 2020;26:4040-4053. Published OnlineFirst February 25, 2020.

Updated version Access the most recent version of this article at: doi:10.1158/1078-0432.CCR-19-2460

Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2020/02/25/1078-0432.CCR-19-2460.DC1

Cited articles This article cites 39 articles, 13 of which you can access for free at: http://clincancerres.aacrjournals.org/content/26/15/4040.full#ref-list-1

Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/26/15/4040.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/26/15/4040. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.