Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 926
______
Regulation of Adenovirus Alternative Pre-mRNA Splicing
Functional Characterization of Exonic and Intronic Splicing Enhancer Elements
BY
BAI-GONG YUE
ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2000 Dissertation for the Degree of Doctor of Medical Science in Medical Virology presented at Uppsala University in 2000
ABSTRACT
Yue, B-G. 2000. Regulation of adenovirus alternative pre-mRNA splicing. Functional characterization of exonic and intronic splicing enhancer elements. Acta Universitatis Upsaliensis. Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 926. 55pp. Uppsala. ISBN 91-554-4712-0
Pre-mRNA splicing and alternative pre-mRNA splicing are key regulatory steps controlling gene expression in higher eukaryotes. The work in this thesis was focused on a characterization of the significance of exonic and intronic splicing enhancer elements for pre- mRNA splicing. Previous studies have shown that removal of introns with weak and regulated splice sites require a splicing enhancer for activity. Here we extended these studies by demonstrating that two “strong” constitutively active introns, the adenovirus 52,55K and the Drosophila Ftz introns, are absolutely dependent on a downstream splicing enhancer for activity in vitro. Two types splicing enhancers were shown to perform redundant functions as activators of splicing. Thus, SR protein binding to an exonic splicing enhancer element or U1 snRNP binding to a downstream 5´splice site independently stimulated upstream intron removal. The data further showed that a 5´splice site was more effective and more versatile in activating splicing. Collectively the data suggest that a U1 enhancer is the prototypical enhancer element activating splicing of constitutively active introns. Adenovirus IIIa pre-mRNA splicing is enhanced more than 200-fold in infected extracts. The major enhancer element responsible for this activation was shown to consist of the IIIa branch site/polypyrimidne tract region. It functions as a Janus element and blocks splicing in extracts from uninfected cells while functioning as a splicing enhancer in the context of infected extracts. Phosphorylated SR proteins are essential for pre-mRNA splicing. Large amount recombinant SR proteins are needed in splicing studies. A novel expression system was developed to express phosphorylated, soluble and functionally active ASF/SF2 in E. coli.
Bai-Gong Yue, Department of Medical Biochemistry and Microbiology, Biomedical Center, Uppsala University, Box 582, SE-751 23 Uppsala, Sweden
ã Bai-Gong Yue 2000
ISSN 0282-7476 ISBN 91-554-4712-0
Printed in Sweden by University Printers, Ekonomikum, Uppsala 2000 To my parents MAIN REFERENCES
This thesis is based on the following articles, which will be referred to in the text by their Roman numbers.
I. Bai-Gong Yue, Göran Akusjärvi. 1999. A downstream splicing enhancer is essential for in vitro pre-mRNA splicing. FEBS Letters, 451 10-14
II. Oliver Muhlemann*, Bai-Gong Yue*, Svend Petersen-Mahrt and Göran Akusjärvi. 2000. A novel type of splicing enhancer regulating adenovirus pre-mRNA splicing. Molecular and Cellular Biology, 20:2317-2325 (*OM and BGY contributed equally to this work)
III. Bai-Gong Yue, Paul Ajuh, Göran Akusjärvi, Angus I. Lamond and Jan-Peter Kreivi. 2000. Functional coexpression of serine protein kinase SRPK1 and its substrate ASF/AF2 in E. coli. Nucleic Acids Research 28:E14
Reprints were made with the permission from the publishers. TABLE OF CONTENTS
1. INTRODUCTION 6
2. PRE-MRNA SPLICING 10 2.1. Different patterns of splicing: 10 2.2 The splicing machinery: 11 2.2.1 The consensus sequences required for splicing 11 2.2.2 Splicing factors and spliceosome assembly 13 2.2.2.1 U snRNPs 13 2.2.2.2 RS domain-containing proteins 16 2.2.2.2.1 SR proteins 16 2.2.2.2.2 SR–related proteins (SRrps) 19 2.2.3 The chemistry in splicing reaction 20 2.3 Regulation of alternative splicing; 5' splice site and 3' splice site selection 20 2.3.1 Positive and negative cis-regulatory elements; 21 2.3.1.1 Splicing enhancer elements 21 2.3.1.2 Splicing repressor elements 22 2.3.2 The role of SR protein phosphorylation for splicing catalysis and 23 alternative splicing
3 ADENOVIRUS—A MODEL SYSTEM FOR MECHANICSTIC STUDIES OF 24 RNA SPLICING 3.1 Background 24 3.2 The adenovirus system 24 3.2.1 The early genes 25 3.2.2 The major late transcription unit (MLTU) 28
4. PRESENT INVESTIGATION 30 4.1 A downstream splicing enhancer is essential for splicing of all types of introns 30 (paper I) 4.2 A U1 splicing enhancer is more versatile than an SR splicing enhancer in promoting 31 pre-mRNA splicing: comparison of the properties of two types of splicing enhancers (paper I) 4.3 Identification of a virus infection dependent splicing enhancer, the 3VDE (paper II) 33 4.4 U2AF binding to the IIIa polypyrimidine tract does not correlate with IIIa splicing 35 activation in Ad-NE (paper II) 4.5 Development of a new expression system for production of phosphorylated, 36 biologically active recombinant ASF/SF2 in E. coli (paper III)
5. CONCLUSION AND DISCUSSION 37 5.1 The universal role of splicing enhancers 37 5.2 The models for the 3VDE function 37 5.3 Perspective for further identification of the 3VDF 38 5.4 The significance of modification of recombinant proteins expressed in E. coli and 40 perspective for future applications 40
6. ACKNOWLEDGMENTS 42
7. REFERENCES 44 1. INTRODUCTION
Multicellular organisms have over millions of years of evolution and have developed a plethora of functions to adapt to changes in the environment. Different types of cells perform these functions. The genetic information, which is needed for cell development, is stored in the genome. Even though all cells in an organism carry the same genetic information, their shape and function are highly differentiated and specialized. This differentiation in function and shape is controlled by regulation of gene expression, which not only provides organisms with a basic structure and governs their life processes, but also supplements them with the ability to adapt to inner and outer environmental changes. Gene expression is regulated at multiple levels: ranging from transcription, pre-mRNA processing (capping, polyadenylation, splicing), RNA export, RNA stability, translation, to post-translational modifications (Fig. 1). The first step in gene expression is the synthesis of an RNA from the DNA template, a mechanism called transcription. Transcription is carried out by three distinct classes of RNA polymerases (pol I, II, and III), each enzyme responsible for the transcription of separate groups of genes. RNA polymerase I transcribes ribosomal RNA genes; RNA polymerase II transcribes protein-encoding messenger RNAs (mRNAs); and RNA polymerase III transcribes small cellular RNAs like tRNAs and the 5S RNA component of the ribosome. Transcription can be divided into five steps: formation of the pre-initiation complex, transcription initiation, promoter clearance, elongation and termination. These steps are coordinated processes, and tightly controlled according to the demand of the developmental stage, cell type or changes in the surroundings. During and after transcription, the primary transcript from pol II genes undergoes several steps of processing to produce a functional mRNA. The 5’ end of the RNA molecule is capped by the addition of a methylated inverted G nucleotide immediately after transcription initiation. The 5’ cap structure serves important functions in stimulating pre- mRNA splicing (Schwer and Shuman, 1996), mRNA transport (Hamm and Mattaj, 1990), protein translation (Sonenberg, 1993), 3’ processing (Gilmartin et al., 1988), and protection of the growing RNA transcript from degradation (Furuichi et al., 1977). Except for the cell cycle regulated histone mRNAs, the 3’ ends of all pol II transcripts carry a poly-A tail. In this modification, the growing transcript is cleaved at a specific site and
- 6 - - 7 - a poly-A tail (150-250 residues of adenylic acid) is added by the poly-A polymerase (Keller, 1995). Some genes contain alternative sites for polyadenylation. The usage of alternative poly A sites is an important mechanism to regulate gene expression in eukaryotic cells. It is believed that the poly-A tail serves important functions by increasing mRNA stability (Lewis et al., 1995), promoting translational efficiency (Sachs et al., 1997), and also having a role in the transport of the mature mRNA from the nucleus to the cytoplasm (Colgan and Manley, 1997). The protein coding sequence in a typical eukaryotic gene is interrupted by intervening sequences (introns). These introns are transcribed into the precursor RNA (the pre-mRNA), and are removed by a process called pre-mRNA splicing (Sharp, 1994). Splicing is an important level for control of gene expression, and is subjected to a dynamic regulation in cells, and during development. The work in this thesis is focused on the regulation of pre- mRNA splicing which will be discussed in the next chapter. RNA export from the nucleus to cytoplasm is also an important checkpoint in the control of gene expression. From this point of view, it is interesting to note that pre-mRNA splicing has been shown to be required for efficient mRNA export in vivo(Luo and Reed, 1999). For example, a mutation creating a defect in RNA splicing results in the retention of the pre-mRNA in the nucleus. However, there are a few cellular genes that do not contain introns and therefore are transported without splicing to the cytosol (Luo and Reed, 1999). Control of RNA export is also used by some viruses to subvert the host cell gene expression machinery to enhance virus multiplication. Thus, viruses like adenovirus and HIV have evolved mechanisms resulting in the selective export of viral mRNAs to the cytoplasm, meanwhile, blocking cellular mRNAs for export (Pilder et al., 1986). After translation, the proteins produced are not always ready to carry out their function. The activity of many proteins is regulated through post-translational modification, such as phosphorylation, glycosylation, methylation or acetylation (Krishna and Wold, 1993). Of particular interests for this thesis is the phosphorylation of a group of splicing factors, the so called SR proteins. The properties and functions of SR protein will be discussed in the following sections. Recent studies have shown that regulation of gene expression is a highly integrated process. For example, RNA pol II transcription has been shown to be tightly coupled to pre- mRNA processing: capping, splicing and cleavage / polyadenylation. This functional coupling is achieved by means of physical contacts between the protein machinery that performs transcription and mRNA processing (Proudfoot, 2000). The capping enzymes have been
- 8 - shown to bind to the phosphorylated pol II CTD (carboxyl-terminal domain). The association of capping enzyme with phosphorylated pol II serves to recruit capping enzymes to the site of RNA synthesis (Cho et al., 1997; McCracken et al., 1997). Thus, when the nascent pre- mRNA is about 25 bases long, it is modified by capping. Subsequently, the cap is recognized by the cap binding complex (CBC), which enhances the subsequent splicing and 3’-end processing reactions (Coppola et al., 1983; Visa et al., 1996). Like capping, cleavage and polyadenylation are also dependent on the RNA pol II CTD (McCracken et al., 1997). Polyadenylation factors bind to pol II via the CTD, and enhance the cleavage reaction. The three subunits of CPSF (cleavage polyadenylation specificity factor) have been shown to first bind to the TATA-box binding protein (TBP) and are therefore part of the basal transcription factor TFIID (Dantonel et al., 1997). After initiation of transcription CPSF can be co-immunoprecipitated with RNA pol II, which implies that it is transferred from TFIID to the CTD early during transcription initiation (Dantonel et al., 1997). It has been proposed that CPSF remains stabely associated with the transcribing polymerase and deposited at the site of polyadenylation.
Pol II Pol II Pol II p p
SR SR bp
Figure 2. A model of the coupling between RNA processing factors and the transcription apparatus. After transcription initiation, the CTD is phosphorylated and associates with capping enzymes, splicing factors (SR proteins), cleavage and polyadenylation factors (CPSF and CstF). These associations target the processing machinery to the site of RNA synthesis, and regulate their activities.
Transcription and splicing are highly coordinated processes both at the functional and structural level (Corden and Patturajan, 1997; Kim et al., 1997). It has been reported that truncation of the CTD inhibits splicing (McCracken et al., 1997). In vitro splicing is also inhibited either by an antibody directed against the CTD or by wild-type but not mutant CTD
- 9 - peptides (Yuryev et al., 1996), demonstrating that CTD is relevant for mRNA splicing. A coupling between transcription and splicing has also been shown at the promoter level. Thus dependent on the RNA pol II promoter which drives the transcription of the reporter gene, the SR proteins ASF/SF2 and 9G8 were shown to differently activate an exonic splicing enhancer, consequently controlling the alternative splicing of the enhancer dependent EDI exon in the fibronectin gene (Cramer et al., 1999; Cramer et al., 1997). Collectively, all the results from these reports suggest that the CTD may function as a liner platform that recruits the factors required for capping, splicing, cleavage and polyadenylation of a pre-mRNA (Fig. 2).
2. PRE-mRNA SPLICING In 1977 two research groups working at the Cold Spring Harbor Laboratory and MIT independently discovered that adenovirus mRNAs were encoded by discontinuous segments on the viral genome (Berget et al., 1977; Chow et al., 1977). This finding of split genes opened up a new era of research in biological sciences. A result that suddenly explained inconsistencies in the data obtained by many research groups. Within half a year after the description of split genes and RNA splicing in the adenovirus system, cellular genes were similarly shown to be encoded by discontinuous gene segments (exons) (Rabbitts and Forster, 1978). The number of introns in eukaryotic genes differs much, ranging from zero to more than 70. But the majority of the genes contain several introns. During the process of RNA synthesis, both exons and introns are transcribed from the DNA template. Before the mature mRNA is formed and exported from the nucleus to the cytoplasm, the intron must be excised from the primary transcript and the flanking exon sequences joined together in the process of pre-mRNA splicing.
2.1 Different patterns of splicing The basic type of pre-mRNA splicing is called constitutive splicing, in which each exon in a pre-mRNA is spliced with the most adjacent flanking exons. Only one mature mRNA is formed from a given pre-mRNA in constitutive splicing. The majority of pre- mRNA splicing in eukaryotes belongs to this category (65%). In alternative splicing, the exons from a pre-mRNA can be ligated in different combinations, resulting in the production of multiple mature mRNAs with different sequence compositions (Fig. 3). It has been estimated that approximately 35% of eukaryotic genes
- 10 - produce alternatively spliced mRNAs (Mironov et al., 1999), implicating its significant role in the control of gene expression in higher eukaryotic cells.
1. Intron retention;
2. Alternative 3' splice site;
3. Alternative 5' splice site;
4. Exon skipping/inclusion;
5. Mutually exclusive exons
6. Alternative promoters/ alternative 5' splice site
AA 7. Alternative poly (A)/ A AAA alternative 3' splice site
Figure 3. Different patterns of alternative splicing.
Soon after the discovery of splicing and alternative splicing in the adenovirus system, a further advance was demonstrated that the accumulation of alternatively spliced adenovirus mRNAs was a regulated process (Imperiale et al., 1995). Different mRNAs were shown to accumulate at different stages of the infectious cycle in a reaction requiring late viral protein synthesis. This finding added a new dimension to gene regulation. Thus, the regulation of gene expression was not confined only to on / off switches of transcription, but also extended to accumulation of multiple mRNAs, with the capacity to produce alternative proteins, from a transcription unit. In a single step of control, several mRNAs can be produced in a regulated, competitive manner, such that the reduced accumulation of one group of mRNAs can be compensated by the increased accumulation of another set of mRNAs, according to the demand of the cell type, or developmental stage of the organism.
2.2 The splicing machinery 2.2.1 The consensus sequences required for splicing
- 11 - The accuracy in splicing is vital for gene expression in all eukaryotic cells. This requires precise recognition of the 5' splice site and the 3' splice site at the intron-exon boundaries. Based on consensus sequences (Fig. 4), introns can be sorted into two different groups: the vast majority of pre-mRNA introns possess invariant GU and AG dinucleotides at their 5’ and 3’ termini and are removed by the so called major spliceosome; the minor class of introns with the non-canonical terminal dinucleotides AU and AC at their 5’ and 3’ splice sites are spliced by the minor spliceosome. The major and minor spliceosomes vary by using different sets of U snRNPs. The consensus sequences at introns are highly conserved in yeast, but much more degenerate in higher eukaryotes.
5' 3' splice splice site site
« (M) AGGU RAGU UNCUR ACY(Y6-11) AGG Major introns « (Y) AGGU AUGU UACUA AC CAGG
« AT-AC intron AUAU CCUU UCCUU AAC YCCAC
Figure 4. Conserved sequence elements in pre-mRNAs. Nucleotides with 90% or higher conservation are shown in bold, the branchpoint is marked with an asterisk. Mammalian introns (M) usually contain a polypyrimidine tract near the 3' splice site, whereas yeast (Y) introns may lack such a sequence. (R, purines ; Y, pyrimidines ; Y6-11, polypyrimidines ; N, variable nucleotides).
The 3' splice site region consists of three sequence elements: the branch site, the polypyrimidine tract, and the AG dinucleotides at the 3' splice site boundary (AC dinucleotides in the case of the minor class of introns). These three sequence elements together provide a tight control for 3' splice site recognition. At the same time the diversity in the sequence composition of the branch site and the polypyrimidine tract in different pre-
- 12 - mRNAs provide abundant resources for the regulation of 3' splice site selection in alternative splicing.
2.2.2 Splicing factors and spliceosome assembly Pre-mRNA splicing occurs in a macromolecular complex known as the spliceosome, which consists of the five small nuclear ribonucleoprotein particles (snRNPs), designated U1, U2, U4/U6 and U5 snRNPs, and a large number of non-snRNP protein splicing factors.
2.2.2.1 U snRNPs The snRNPs are major structural and functional components of the splicing machinery. In tandem with the assistance of other splicing factors, snRNP complexes can precisely recognize and define the consensus sequences at intron-exon boundaries in part by base pairing. This provides a basis for the accuracy of splicing. Each of these snRNPs are composed of small nuclear, U-rich RNA (U snRNA), as well as 8 to 15 different polypeptides. Of the polypeptides present in snRNPs, eight proteins are common to all snRNPs; the rest are specific for individual U snRNP. The eight common polypeptides, called Sm proteins, are recognized by antibodies produced in SLE (systemic lupus erythematosus) patients. The Sm proteins form a ring structure and bind to the conserved Sm binding site in each U snRNA. With the exception of U6 snRNA (transcripted by RNA polymerase III), all U snRNAs involved in splicing (U1, U2, U4, and U5 snRNA) are transcribed by RNA polymerase II. Their secondary structures are highly conserved between species, although the primary sequence may vary. Of the five spliceosomal snRNAs only three (U2, U5 and U6) are thought to contribute functionally during the two transesterification reactions of splicing. The U snRNAs play diverse roles in spliceosome assembly and splicing catalysis. One of these functions is to recognize and bind to the short consensus sequences at the 5’ and 3’ boundaries of the intron. U1 snRNP is composed of the U1 snRNA and 11 polypeptides. Three of these polypeptides A, C, and 70K are U1 snRNP specific (Klein Gunnewiek et al., 1997). The U1 70K protein is an RS domain containing protein important for U1 snRNP recruitment to the 5' splice site. U1 snRNP is the first snRNP that bind to the pre-mRNA during the early stage of spliceosome assembly, generating the so-called E-complex, or commitment complex. (Black et al., 1985; Rossi et al., 1996). With the assistance of SR proteins which interact both with the 5' splice site and the U1 70K protein, U1 snRNP form a stable interaction with nucleotides
- 13 - +1 to +6 of the intron at the 5' splice site, this results in the selection of this splice site for spliceosome assembly (Staknis and Reed, 1994). It is believed that formation of the E complex irreversibly defines the exon-intron boundaries and commits the pre-mRNA for spliceosome assembly and splicing (Fu, 1993). Thus, formation of the E complex is likely to be a key step at which alternative splicing is regulated. Two protein splicing factors, U2AF and SF1, have also been found in the E complex. Another function of U1 snRNP is to target U2AF to the polypyrimidine tract (Hoffman and Grabowski, 1992), and promote the association of the U2 snRNP complex with the branch site region (Barabino et al., 1990). Although U2 snRNP will specifically bind a pre-mRNA in the absence of U1 snRNP, for most pre-mRNAs this reaction is not efficient (Query et al., 1997). So the assistance of U1 snRNP is important for the efficient recruitment of U2 snRNP during spliceosome assembly. U2 snRNP interacts with the branch site at the 3' splice site by a short base pairing, which results in the selection of the 3' splice site during spliceosome formation. This step is ATP-dependent, and enhanced by U2AF (Ruskin et al., 1988), SF1 (Arning et al., 1996) and U1 snRNP interaction with the pre-mRNA. SF3a and SF3b, which are part of U2 snRNP, bind upstream of the branch site, to the so-called anchoring sequence, and stabilizes U2 snRNP binding (Brosi et al., 1993; Gozani et al., 1994). The binding of U2 snRNP to the branch site sequence generates the so called A complex (the pre-spliceosome). U5 snRNP joins the spliceosomal complex in the form of the U4/U6-U5 tri-snRNP particle (Konarska and Sharp, 1987). The interaction between U5 snRNP and pre-mRNA is not only essential for the first step of the reaction, but is also required for the second step of splicing. An invariant loop sequence in U5 snRNA makes contact with the nucleotide at position -1 of the first exon, before and after 5' splice site cleavage. This same loop will also interact with the nucleotide at the position +1 of the second exon, within the lariat intron-exon 2 intermediate. Most likely, U5 snRNP serves as the factor that holds the free exon 1 and the intermediate in the spliceosome, and aligns it with the 3' splice site for the second catalytic reaction (Sontheimer and Steitz, 1993; Teigelkamp et al., 1995; Wyatt et al., 1992). U4 and U6 snRNAs are present in a single snRNP, associated with one another through extensive base pairing (Black and Steitz, 1986). U4/U6 snRNP bind U5 snRNP to form the 17S tri-snRNPs particle before they join the A complex. Incorporation of the tri- snRNP particle converts the A complex to the B complex (the spliceosome).
- 14 - 5' 3' splice splice site site
5'- exon 1 GU A (Yn) AG exon 2 -3' pre-mRNA
SR U2AF
-5' SR SR SR complex E A U2AFAG exon 2 -3' U2 ATP
exon 1 -5' SR SR complex A U2 SR U2AFAG exon 2 -3' ATP U6 A
U5
U2AF -5' n 1 U6 exo complex B U2 U5 SR ATP A(Yn)AG exon 2 -3'
-5' on 1 U6 ex U5 SR U2 complex C A(Yn)AG exon 2 -3'
SR
U6 U5 U2 5'- exon 1 exon 2 -3' mRNA A(Yn)AG
Figure 5. The spliceosome assembly pathway and splicing process. For detail, see text.
- 15 - Through conformational changes the B complex is converted to the C complex, the active spliceosome. Thus, the 5' splice site-U1 snRNP base pairing is disrupted and replaced by a U6 base pairing with the 5' splice site (Kandels-Lewis and Seraphin, 1993; Konforti et al., 1993; Lesser and Guthrie, 1993; Sontheimer and Steitz, 1993). Simultaneously base pairing between U4 and U6 is disrupted and U6 now interacts with U2 via base pairing (Madhani and Guthrie, 1994). U5 and U6 snRNAs collaborate during these reactions and align the two splice sites for the final exon-exon ligation reaction (Kandels-Lewis and Seraphin, 1993; Lesser and Guthrie, 1993; Newman and Norman, 1992; Sontheimer and Steitz, 1993). It is believed, that U6 snRNP catalyses the splicing reaction (Newman, 1994).(Fig. 5)
2.2.2.2. RS domain-containing proteins In addition to snRNPs, the splicing process requires a large number of non-snRNP splicing factors, containing domains rich in alternating arginine and serine residues (RS domains). These include members of the SR protein family of splicing factors and SR-related proteins (SRrp) that are structurally and functionally distinct from the SR family of splicing factors.
2.2.2.2.1 SR proteins The SR family of splicing factors are highly conserved in metazoan (Zahler et al., 1993). The members of the family share the following properties: (1), they contain one or two N-terminal RNA recognition motifs (RRMs), and a C-terminal RS domain; (2), they are capable of activating splicing in splicing-defective cytoplasmic S100 extracts; (3), they precipitate in the presence of 20 mM MgCl2; (4), they are recognized by the phospho-epitope specific monoclonal antibody mAb 104. The classical SR proteins consist of six members, SRp20, ASF/SF2, SC35, SRp40, SRp55, and SRp75 ranging in size from 20—75 kDa (Fig. 6). However, the family is growing and now also includes SRp30c , and 9G8. The RRMs in SR proteins recognize and bind consensus sequences in the pre-mRNA, such as the 5' splice site and splicing enhancer elements (Moras and Poterszman, 1995). The observation that two SR proteins, ASF/SF2 and SC35, differ significantly in their ability to commit specific pre-mRNAs to the splicing pathway provided the initial evidence for divergent RNA binding specificities among SR proteins (Fu, 1993). Subsequent studies have shown that each SR protein binds to a distinct RNA sequence element (Cavaloc et al., 1999;
- 16 - Coulter et al., 1997; Tacke and Manley, 1995). Typically the consensus binding sites are purine rich, 6—10 nucleotides long without obvious secondary structure (Tacke and Manley, 1999). The SELEX (Systemic Evolution of Ligands by EXponential enrichment) protocol has been widely used to identify the consensus sequences mediating SR protein binding. In functional SELEX (Liu et al., 1998; Schaal and Maniatis, 1999), a short random sequence (about 20 nucleotides long) is inserted into a splicing enhancer dependent pre-mRNA to replace the original enhancer sequence. A library of pre-mRNAs constructed in this way is spliced in the presence of one type of SR proteins. The spliced product is isolated, and the sequence corresponding to the random region amplified and rebuilt into pre-mRNA template molecules for a new round of selection. An alternative SELEX approach is to isolate RNA sequences showing the highest affinity for an SR protein (Tacke and Manley, 1995). It is obvious that the sequences selected by functional SELEX are based on their capacity to activate splicing rather than only RNA binding affinity. RRM1 RS SRP20 164 aa
SC 35 221aa
9G8 238aa RRM1 RRM2 RS SRp30c 221 aa
ASF/ SF2 248aa
SRp40 273 aa
SRp55 344 aa
SRp75 494 aa
Figure 6. The SR protein family comprises eight major polypeptides conserved between all higher eukaryotes, containing one or two RNA recognition motifs at the N-terminus and an RS domain of variable length and sequence composition at the C-terminus.
- 17 - The RS domain in SR proteins differs in their length, number of arginine-serine dipeptides and the content of other amino acids. This region mediates protein-protein interaction with RS domains in other SR proteins or in SR-related proteins. These protein- protein interactions function in at least three steps in spliceosome assembly: (i) recruitment of U1 snRNP to the 5' splice site; (ii) bridging the 5' splice site and 3' splice site by simultaneously interacting with U1-70K and the U2AF35 component of U2AF; (iii) regulating alternative splicing by interacting with splicing enhancer elements or splicing repressor elements (Amrein et al., 1994; Kohtz et al., 1994; Wu and Maniatis, 1993; Xiao and Manley, 1997). The RS domain is also required for proper subcellular (Colwill et al., 1996; Koizumi et al., 1999) and subnuclear localization of SR proteins (Caceres et al., 1997; Hedley et al., 1995). SR proteins accumulate predominately in nuclear structures referred to as speckles, which serves as storage and /or recycling sites for splicing factors (Misteli and Spector, 1998; Singer and Green, 1997). Early work suggested that SR proteins might be functionally redundant. However, a number of subsequent studies have suggested that each protein probably perform at least some non-redundant functions. For example, one SR protein, SRp55/B52, is essential for proper development of Drosophila, and ASF/SF2, is essential for viability of a chicken B-cell line (Tacke and Manley, 1999) and C. elegans development (Longman et al., 2000). The RS domains of SR proteins are highly phosphorylated in vivo. Phosphorylation of SR proteins increases their RNA binding affinity, reduces their unspecific binding (Misteli, 1999), and also affects their interactions with other proteins (Xiao and Manley, 1997). Dephosphorylation of SR proteins occurs during the later stage of spliceosome assembly, which appears to facilitate the configurational changes occurring during the spliceosome maturation. Therefore both phosphorylation and dephosphorylation are vital for the function of SR proteins in splicing (Cao et al., 1997). Through control of the phosphorylation status of SR proteins, splicing and alternative splicing can be regulated (Kanopka et al., 1998; Xiao and Manley, 1998), this has proven to be an important mechanism employed by both cells and viruses. Several protein kinases and protein phosphatases are involved in this regulation; examples include SRPK1, SRPK2, Clk/Sty, DNA topoisomerase I, cdc2, PP1, PP2A, PP2C (Colwill et al., 1996; Gui et al., 1994; Mermoud et al., 1992; Okamoto et al., 1998; Rossi et al., 1996) (Murray et al., 1999). SR protein specific kinases have also been shown to regulate the subcellular localization of SR proteins (Colwill et al., 1996; Koizumi et al., 1999). This might be an
- 18 - alternative pathway for kinases to regulate the functions of SR proteins in splicing, e.g. to control the activity of SR proteins by influencing their local concentration and availability, instead of their behavior in protein-protein and protein-RNA interactions (Misteli and Spector, 1997).
2.2.2.2.2 SR –related proteins (SRrps) In addition to the SR family of splicing factors, some other proteins involved in splicing also contain RS domains (SR-related proteins), for example snRNP-associated splicing factor U1-70K, non-snRNP associated splicing factor U2AF, splicing regulators Tra, Tra-2, SRm160 and SRm300 (Blencowe et al., 2000). These proteins also play important roles in spliceosome assembly or in splicing catalysis. Similar to SR-SR protein interactions, they interact with SR proteins through their RS domains. SRrps are structurally and functionally distinct from SR proteins. They can not complement splicing defective S100 extracts, which is the main characteristic of the classical SR proteins. They contain one or two RS domains, but may lack an RNA recognition motif. Some SRrps, like U2AF65, U1-70K, SRm160, and Sip1 are essential splicing factors (Blencowe et al., 1998; Tazi et al., 1993; Zamore and Green, 1991; Zhang and Wu, 1998). Antibody depletion of these proteins from nuclear extracts abolishes splicing. However, other SRrps may be non-essential (at least for some pre-mRNAs), or only play regulatory roles in pre-mRNA splicing, like U2AF35, Tra, and Tra2 (Guth et al., 1999; Tacke et al., 1998; Wu et al., 1999). U2AF is an essential splicing factor composed of a heterodimer of a 65 kDa (U2AF65) and a 35kDa (U2AF35) subuint, which are present in approximately equimolar amounts (Zamore and Green, 1989). U2AF is conserved between Drosophila and humans. U2AF binds to the polypyrimidine tract at the 3' splice site and helps to recruit U2 snRNP to the branch site during spliceosome assembly. The binding of U2 snRNP to the branch site is the first ATP dependent step in spliceosome assembly. Purified U2 snRNP alone can not stabely interact with the branch site sequence on the pre-mRNA (Ruskin et al., 1988). Instead, stable binding of U2 snRNP requires assistance from U1 snRNP interacting with the 5' splice site and at least three other protein factors SF1, SF3 and U2AF (Krämer and Utans, 1991; Ruskin et al., 1988; Zamore and Green, 1989). U2AF65 contains two functional domains: a sequence specific RNA-binding region composed of three central RRMs, and an N-terminal RS domain (Zamore et al., 1992). All three RRMs in U2AF65 are necessary for high affinity and sequence specific RNA binding
- 19 - but are not sufficient for its in vitro splicing activity, which additionally requires the RS domain (Zamore et al., 1992). After binding to the polypyrimidine tract, U2AF65 directs its RS domain to contact the branch site, the positively charged surface of the RS domain stabilizes base paring between U2 snRNP and the branch site (Gaur et al., 1995; Valcarcel et al., 1996). U2AF35 does not have an RRM but contains a C-terminal RS domain (Zhang et al., 1992). Early work indicated that U2AF35 was dispensable for splicing. Thus, it was reported that recombinant U2AF65 was sufficient to activate splicing of two constitutively active pre- mRNAs in extracts that were chromatographically depleted of U2AF (Guth et al., 1999). However, more recent data has been shown that U2AF35 is required for splicing of pre- mRNAs containing introns with weak polypyrimidine tracts. These studies have demonstrated a substract-specific requirement for U2AF35, and assigned this subunit a regulatory role in alternative pre-mRNA splicing (Merendino et al., 1999; Wu et al., 1999; Zorio and Blumenthal, 1999).
2.2.3 The chemistry of the splicing reaction The splicing reaction consists of two transesterifications. The first step is initiated by the 2’ hydroxyl group of the branch point adenosine attacking the 3'-5' phosphodiester bond at the 5' splice site. This results in the cleavage at the 5’ intron-exon junction, generating two splicing intermediates, a 5' exon with a free hydroxyl group at its 3’ terminus, and the so- called lariat intermediate, in which the 5’ end of the intron is joined to the branch site adenosine via a 5’-2’ phosphodiester bond (Adams et al., 1996; Newman, 1994). In the second step, the free hydroxyl group of the 5’ exon attacks the 3’-5’ phosphodiester bond at the 3' splice site, resulting in the release of the intron as a lariat, and the ligation of the 3’ end of the 5’ exon to the 5’ end of the 3’ exon via a 5’-3’ phosphodiester bond, yielding the spliced product.
2.3 Regulation of alternative splicing: 5' splice site and 3' splice site selection Splicing factors and their binding sequences control alternative splice site selection. SR proteins appear to play a central role in this regulation. SR proteins modulate the selection of alternative splice sites in a concentration–dependent manner. In model pre-mRNAs containing alternative 5' splice sites, higher concentrations of ASF/SF2 or SC35 promote proximal 5' splice site usage (Ge and Manley, 1990; Krainer et al., 1990; Wang and Manley, 1995). Mechanistically this has been explained by a splice site occupancy model. Thus, at
- 20 - high ASF/SF2 levels all competing 5' splice sites will be occupied by U1 snRNP. Under such conditions the proximal splice site will be used due to its closeness to the 3’ splice site (Eperon et al., 1993). ASF/SF2 has also been found to promote proximal 3' splice site usage in vitro and in vivo (Bai et al., 1999; Fu et al., 1992). While other SR proteins, like SRp40 and SRp55 have been found to promote distal 5' splice sites usage on some model transcripts (Zahler et al., 1993; Zahler and Roth, 1995). SR proteins function as both enhancer and repressor proteins of splicing (Kanopka et al., 1996). Depending on where in the pre-mRNA they bind, SR proteins either stimulate or interfere with the recruitment of other essential splicing factors to the adjacent splice site, and to a large extent, decide whether or not the particular splice site will be selected by the splicing machinery. Other protein factors which can influence the binding of essential splicing factors to the pre-mRNA also regulate splice site selection. For example, hnRNP A1 can modulate splice site choice in a manner opposite to ASF/SF2, promoting selection of distal 5’ or 3' splice sites (Bai et al., 1999; Caceres et al., 1994). The polypyrimidine tract binding protein (PTB) and the Drosophila Sxl protein can compete with U2AF binding to a polypyrimidine tract. Thereby, inhibiting 3' splice site selection by reducing U2 snRNP recruitment (Chan and Black, 1997; Valcarcel et al., 1993).
2.3.1 Positive and negative cis-regulatory elements; Splicing enhancer and splicing repressor elements mediate the interaction between splicing factors and splice sites during spliceosome assembly. They are major cis-acting elements determining splice site selection in alternative pre-mRNA splicing.
2.3.1.1 Splicing enhancer elements Splicing enhancers are typically SR protein binding sequence elements that promote the use of adjacent splice sites. Most of these sequences are composed of purine-rich sequences embedded within exons, so called exonic splicing enhancers (ESEs). They are often found downstream of introns that are considered to be weak (typically by a 5' or 3' splice site that is a poor match to the consensus) (Manley and Tacke, 1996), and that are subjected to alternative splicing. Members of the SR family of splicing factors have been directly implicated in ESE function. By specifically interacting with SR proteins, ESEs aid in the recruitment of other splicing factors to the nearby splice sites through protein-protein interactions. This stabilized binding of splicing factors in turn promotes assembly of
- 21 - spliceosomal complexes (Hoffman and Grabowski, 1992; Staknis and Reed, 1994; Wang and Manley, 1995), and results in the selection of a relevant splice site by the splicing machinery. Some ESEs appear also to act late during the splicing reaction, together with appropriate SR proteins, to enhance the second catalytic step of splicing (Chew et al., 1999) Different members of the SR protein family bind to distinct RNA sequence elements and vary in their ability to commit specific pre-mRNAs to splicing. The effectiveness of individual RNA binding sequences in promoting splice site activation correlate with their binding affinity for SR proteins. A considerable amount of data supports the conclusion that RNA sequences that form both specific, high- affinity binding sites and degenerate, lower-affinity binding sites are sufficient to function as exonic SR protein splicing enhancers (Sun et al., 1993; Watakabe et al., 1993). Thus SR proteins binding to splicing enhancer sequences generally promote usage of the adjacent splice sites in alternative splicing.
2.3.1.2 Splicing repressor elements Splicing repressor, or silencer, elements are another type of regulatory elements present in some pre-mRNAs. They inhibit splicing by interfering with recruitment of key factors required for spliceosome assembly. One well-studied example is the regulation of alternative splicing of the α-actinin gene. The polypyrimidine tract upstream of the SM exon in the α-actinin gene functions as a repressor element by specifically binding PTB. Binding of PTB to this repressor sequence excludes U2AF interaction with the polypyrimidine tract, and thus represses 3' splice site usage. PTB has also been shown to repress α-tropomyosin and β- tropomyosin pre-mRNA splicing (Gooding et al., 1998; Mulligan et al., 1992; Southby et al., 1999). The Drosophila Sxl protein represents another example of a polypyrimidine tract binding protein, similar to PTB, it inhibits splicing by competing with U2AF65 for binding to the polypyrimidine tract on some pre-mRNAs involved in the maintain of sex in the fruit fly (Granadino et al., 1997).
The abnormal positioning of snRNP binding sequences in pre-mRNAs can also result in splicing repression. Thus, it has been shown that a sequence element upstream of the branch point of the gag gene of Rous sarcoma virus (RSV) interacts with U11, U12, U1, U2 snRNPs and represses splicing (Gontarek et al., 1993; McNally and Beemon, 1992; McNally et al., 1991). A proposed mechanism for this repression is that recruitment of snRNPs to the wrong position in the pre-mRNA interferes with the normal spliceosome assembly process, and prevents the flanking splice sites being selected by the splicing machinery.
- 22 - Furthermore, the results from our group have shown that a purine-rich sequence element located just upstream of the branch site of adenovirus IIIa pre-mRNA represses IIIa splicing in HeLa nuclear extracts, hence the name “the IIIa repressor element (3RE)” (Kanopka et al., 1996). The 3RE binds all of the classical SR proteins found in HeLa cells. By associating with SR proteins, the 3RE inhibits IIIa 3' splice site usage by interfering with recruitment of U2 snRNP to the branch site, at least in part through steric hindrance. Interestingly, substituting the 3RE with other SR protein binding sequences like ASF/SF2 consensus binding sites (Tacke and Manley, 1995), which function as splicing enhancer elements when positioned in the downstream exon, results in ASF/SF2 dependent splicing repression (Kanopka et al., 1996). Conversely, 3RE functions as a splicing enhancer when moved to the downstream exon (Kanopka et al., 1996). These findings indicate that, not only can SR protein binding sites enhance pre-mRNA splicing, but they can also inhibit splicing, depending on where they are located in the pre-mRNA. Some exons contain exonic splicing silencers. Their activities are usually balanced by that of splicing enhancers. This double control mechanism ensures correct relative levels to be reached for alternatively spliced mRNAs. HIV-1 tat exon 2 and K-SAM exon in human fibroblast growth factor receptor 2 have been shown to contain hnRNP A1 binding sequences, which function as splicing silencers. These silencers repress splicing by recruiting hnRNP A1 to the pre-mRNAs, and interfere with spliceosome assembly (Del Gatto-Konczak et al., 1999). In general, inappropriately positioned binding sites for essential splicing factors or sequences binding specific inhibitory proteins function as splicing repressors.
2.3.2 The role of SR protein phosphorylation for splicing catalysis and alternative splicing Reversible phosphorylation of SR proteins is crucial in constitutive splicing, and also plays an important role in alternative splice site selection. Phosphorylation significantly increases the RNA binding specificity and affinity of SR proteins. At the early stage of spliceosome assembly, this increased affinity enables SR proteins to bind to the 5' splice site and facilitates U1 snRNP recruitment. During the transition of the early spliceosome to the mature spliceosome, dephosphorylation of SR proteins may contribute to the release of U1 snRNP from 5' splice site, and facilitates the dynamic rearrangements of snRNPs pairing with pre-mRNA inside the spliceosome (Cao et al., 1997; Misteli, 1999; Xiao and Manley, 1998).
- 23 - Protein phosphorylation also increases the affinity of SR proteins for splicing enhancer and repressor elements. This strategy turns out to be an important mechanism involved in the regulation of alternative splice site selection in the adenovirus system. Thus, late during an adenovirus infection SR proteins become functionally inactivated by a virus- mediated dephosphorylation (Kanopka et al., 1998), resulting in the loss of their activities as enhancer or repressor on splicing. In adenovirus L1 splicing, dephosphorylation of SR proteins reduces their binding affinity for the 3RE, alleviating their repressive effect on IIIa pre-mRNA splicing. As a result, IIIa splicing is dramatically enhanced.
3. ADENOVIRUS—A MODEL SYSTEM FOR MECHANICSTIC STUDIES OF RNA SPLICING
3.1 Background In this study, I have used adenovirus as a model system to investigate mechanisms regulating pre-mRNA splicing. In general, viruses provide a very good tool for the study of gene expression and its regulation. Thus, viruses are small, easy to manipulate and rely to a large extent on the biosynthetic machinery provided by the host cell. Viral genomes are adapted to be recognized and processed by the cellular machinery. Viruses encode for a few regulatory proteins that interfere with key cellular factors regulating the cell cycle. Over the years the significance of many cellular proteins have been discovered through their interaction with viral proteins. For example, p53 was originally discovered because of its association with the SV40 large T antigen (Lane and Crawford, 1979; Linzer and Levine, 1979). Similarly, the function of the retinoblastoma tumor suppresser protein as a cell cycle regulator was discovered through its interaction with the adenovirus E1A protein (Whyte et al., 1988). It is likely that future studies will unravel additional mechanisms. In essence viruses have been, and probably will continue to be valuable tools in genetic research.
3.2 The adenovirus system Human adenovirus was first isolated from adenoid cell cultures in 1953 (Rowe et al., 1953). Up to now, about 50 human adenovirus serotypes have been isolated (Horwitz, 1996). They are divided into six subgroups (group A to F) based on hemagglutination, oncogenicity in rodents and DNA sequence homology. Among them, Ad2 and Ad5 have been most extensively studied. The whole genome sequence of several serotypes have been determined,
- 24 - like type 2, 5, and 12 (Chroboczek et al., 1992; Roberts et al., 1986; Sprengler et al., 1995). Adenoviruses are common pathogens, and cause primarily respiratory, ocular and gastrointestinal diseases in humans, mostly in children. The adenoviral virion is a non-enveloped, icosahedral particle, 70-100 nm in diameter. It contains a liner, double-stranded DNA genome varying in length from 30,000 to 46,000 base pairs, depending on the serotype.(Fig. 7) The capsid is composed of 252 capsomers: 240 hexons and 12 pentons, which are buikt up by the penton base and the fiber. By attaching, via the fibers, to the CAR receptor at the surface of the host cell, the virus enters the cell through endocytosis. The capsid dissociates during passage from the endosome to the nuclear pore and the viral DNA is injected into the cell nucleus. The lytic infection is divided into two phases, the early and the late phase, which are separated by the onset of viral DNA replication which start around 6-8 hours post infection. The virus life cycle lasts for 32-36 hours, and approximately 10,000—100,000 progeny virions are released from each infected cell.
3.2.1 The early genes The viral genome is organized into 9 transcription units, 5 early and 4 late. The early region 1 (E1) is located at the 5’ end of the viral genome. E1A is the first region to be transcribed during an adenovirus infection. The proteins encoded by E1A are multifunctional, and in general encode for transcriptional regulatory proteins necessary for activation of other viral transcription units. They stimulate and repress transcription of viral and cellular genes, induce cell cycle progression, suppress differentiation, and mediate cellular transformation. The proteins expressed from the E1B region inhibit p53-induced apoptosis (Debbas and White, 1993). E1B proteins are also involved in the shut-off of host cell protein synthesis, primarily by enhancing transport of viral mRNAs and blocking transport of host mRNAs during a lytic viral infection (Pilder et al., 1986). The E2 region encodes for the viral proteins required for viral DNA replication. Transcription from this region is temporally regulated during the infection at the level of promoter usage. At the early stage of infection, transcription initiates from an early promoter and at late times of infection a second, late specific promoter is used. Furthermore, two alternative poly-A sites are used to produce E2 mRNAs: thus, generating the E2A and E2B mRNA families. E2A encodes for the single-stranded DNA binding protein (DBP) whereas E2B encodes for the virus specific DNA polymerase, and the preterminal protein (pTP) which functions as a primer protein for viral DNA replication (Chen et al., 1990).
- 25 - Figure 7. Schematic presentation of transcription units and mRNAs encoded by the adenovirus -2 genome. The physical locations of the early (dark thick arrows) and late (light thick arrows) mRNA species and encoded proteins are indicated. This figure was kindly provided by Dr. Göran Akusjarvi.
- 26 - The proteins encoded by the E3 region antagonizes the host cell immune response (Gooding et al., 1990; Wold et al., 1995). For example, the E3-19K protein prevents newly synthesized major histocompatibility complex (MHC) class I antigen from being transported to the cell surface, and this in turn help the infected cells escape cytotoxic T-cell recognition (Wold et al., 1995). Through alternative splicing and alternative poly (A) site usage, at least nine different mRNAs are expressed from E3. This region is dispensable for virus growth in tissue culture cells. The proteins expressed from the E4 region regulate transcription and RNA splicing. Twenty-four alternatively spliced mRNAs are produced from this region. These mRNAs encode at least seven different proteins (Freyer et al., 1984; Tigges and Raskas, 1984; Virtanen et al., 1984). The proteins expressed from E4 are required for stable nuclear accumulation of mRNAs derived from the major late transcription unit (Imperiale et al., 1995). Two proteins encoded by this region, E4-ORF3 and E4-ORF6, are essential for efficient virus growth. A virus lacking both proteins show defects in viral DNA synthesis, late viral mRNA accumulation and late viral protein synthesis, and a failure to shut-off host cell protein synthesis (Bridge and Ketner, 1989; Halbert et al., 1985; Weinberg and Ketner, 1986). Interestingly, E4-ORF3 and E4-ORF6 appear to perform redundant functions. Thus, mutant viruses expressing either E4-ORF3 or E4-ORF6 can establish an essential wild-type virus infection (Bridge and Ketner, 1989; Hemström et al., 1988; Huang and Hearing, 1989; Ketner et al., 1989). The E4-ORF3 and E4-ORF6 proteins are viral splicing factors. They regulate major late tripartite leader assembly, and have opposite effects on accumulation of alternatively spliced mRNAs (Nordqvist et al., 1994; Ohman et al., 1993). In transient transfection assays, E4-ORF3 facilitates i-leader exon inclusion, whereas E4-ORF6 functions as an exon skipping activity, enhancing the tripartite leader assembly. Furthermore, the E4-ORF6 protein also stimulates i-leader exon skipping during lytic virus growth. The activities of these proteins are not limited to mRNAs expressed from the major late transcription unit, since they show the same effect on non-viral chimeric β-globin transcripts (Nordqvist et al., 1994), and similar effects on transcripts from the early E1B transcription unit. These results suggest that E4- ORF3 and E4-ORF6 proteins may be of global importance for the accumulation of alternatively spliced mRNA from both the early and late viral transcription units (Ohman, 1995).
- 27 - In addition, the E4ORF4 protein has been shown to regulate both transcription and splicing. It binds to the cellular protein phosphatase 2A (PP2A). This complex is believed to down regulate transcription through dephosphorylation of some transcription factors (Bondesson et al., 1996; Kleinberger and Shenk, 1993; Mannervik et al., 1999; Muller et al., 1992), and to regulate adenovirus alternative splicing by dephosphorylation of SR proteins (Kanopka et al., 1998).
3.2.2 The major late transcription unit (MLTU) The major late transcription unit generates a primary transcript of approximately 28,000 nucleotides that is processed into about 20 cytoplasmic mRNAs. These mRNAs are grouped into five families (L1-L5, Fig. 7), where each family consists of multiple, alternatively spliced species with co-terminal 3' ends. All mRNAs expressed from the MLTU have a common 201-nucleotide tripartite leader sequence at their 5' end. A variant form of this leader contains the 440-nucleotide i-leader exon. Splicing of the i-leader is temporally regulated during infection. Thus, splicing of major late mRNA at early times of infection usually leads to the inclusion of the i-leader exon (leader 1-2-i-3), but it is excluded at the late times of infection in the majority of mRNAs (leader 1-2-3). The biological significance of the i-leader exon inclusion/exclusion reaction is not clear. However, it has been shown that the i- leader encodes for a 16 kDa protein (Virtanen et al., 1982), of unknown function. In general, genes expressed from the MLTU encode for proteins necessary for viral progeny formation. The expression of the mRNAs from MLTU is regulated at multiple levels during the virus life cycle. Early after infection the major late promoter is active at a level comparable to the early transcription units (Nevins and Wilson, 1981). But the majority of RNA polymerases initiating at the major late promoter are prematurely terminated prior to the L2 poly(A) site. Only mRNAs from region L1 accumulate at this stage (Larsson et al., 1992). After the onset of the late phase, the level of the mRNAs from MLTU increases dramatically. One reason is probably the dramatic increase in template concentration caused by viral DNA replication. At this stage, the transcription termination block is alleviated, and RNA polymerase transcription extend through the entire late region to the end of the genome, resulting in the production of the L1 to L5 family of mRNAs. The accumulation of MLTU mRNAs is also regulated at the level of efficiency of poly (A) site selection and alternative splicing of mRNAs within each late family (Akusjärvi and Persson, 1981; Falck and Logan, 1989). This work has focused on the L1 region (Fig. 8), which is the only part of the MLTU
- 28 - that is expressed at both early and late times of infection (Nevins and Wilson, 1981). The L1 unit encodes for two major alternatively spliced mRNAs: the 52,55K, and the IIIa mRNAs. The 52,55K mRNA encodes two related proteins of size 52 kDa and 55 kDa, which represent differentially phosphorylated forms of a single 48-kDa polypeptide. The 52,55K protein is required for viral DNA encapsidation, and also stimulates viral DNA replication, late protein synthesis and virion assembly (Gustin and Imperiale, 1998; Hasson et al., 1992). The IIIa mRNA encodes for a phosphoprotein, with an estimated molecular weight of 66 kDa. IIIa is a structural protein, located in the vertex region of the capsid (Lemay et al., 1980). Splicing of the 52,55K, and the IIIa mRNAs uses a common 5' splice site and two different 3' splice sites. The 3' splice site of IIIa is located at 1266 nucleotides downstream of the 52,55K 3' splice site.
Early splicing pattern 5' ss 3' ss 3' ss 1 2 352,55K IIIa
Late splicing pattern
bp 3' ss «« GOGTG GAGGA ATATGAC GAGGA CGATGAGTACGAGCCA GAGGA CGGCGAGTACT AAGCGGTGATGTTTCTGATCAG EXON2 3RE 3VDE
Figure 8. The L1 region sequence feature and splicing pattern in the early and late phase. The lower panel shows the sequence of the IIIa 3' splice site containing two regulatory elements required for IIIa splicing, the 3RE and the 3VDE.
L1 alternative splicing is strictly regulated during the infectious cycle, such that the 52,55K mRNA is spliced at all times of infection, whereas IIIa mRNA splicing is confined to the late phase of infection. The study in this thesis has focused on the temporal regulation of L1 alternative splicing. Previous work in our group had shown that: (1), the order of 3' splice site presentation is important for the outcome of alternative L1 pre-mRNA splicing (Kreivi et al., 1991); (2), Viral DNA replication and late protein synthesis play important roles in the control of L1 alternative splicing (Larsson et al., 1991); (3), the IIIa repressor element, (3RE), an SR protein binding sequence, located upstream of IIIa branch site inhibits IIIa splicing at
- 29 - the early stage of infection (Kanopka et al., 1996); (4), during virus infection SR proteins become functionally inactivated as IIIa splicing repressor proteins through a virus induced dephosphorylation, hence an increase in IIIa splicing (Kanopka et al., 1998).
4. PRESENT INVESTIGATION
4.1 A downstream splicing enhancer is essential for splicing of all types of introns (paper I) Splicing enhancers are known to be required for the removal of introns with weak and regulated splice sites. This type of introns contain short, frequently interrupted polypyrimidine tracts, which are generally not consistent with the consensus sequence, and therefore binds U2AF with a low affinity. In this context, SR proteins function as splicing enhancer proteins by binding to the downstream exon and stabilizing the interaction of U2AF with the polypyrimidine tract. Consequently the splicing machinery is able to select the weak 3’ splice site for spliceosome assembly. In the first part of paper I, we addressed the question whether a splicing enhancer is necessary for splicing of introns with strong 3' splice sites. In this experiment, two constitutively active pre-mRNAs, the adenovirus 52,55K and Drosophila fushi tarazu (Ftz) were chosen as model pre-mRNAs. The introns in these two pre-mRNAs contain so called “strong” 3' splice sites. To study the significance of a downstream splicing enhancer for 52,55K splicing, three different sequences were used to replace the second exon of the 52,55K pre-mRNA. These sequences were: (i,) the 49 nucleotide 3RE, which binds all the classical SR proteins; (ii,) a 28 nucleotide duplicated ASF/SF2 binding splicing enhancer (2ASF); (iii,) a 49 nucleotide sequence from rabbit β- globin gene that does not bind any SR proteins, we refer to this as an enhancer minus sequence (E-). Three kinds of 52,55K pre-mRNA variants were created by this approach: the 52,55K(3RE), 52,55K(2ASF) and the 52,55K(E-). Their splicing properties were compared to the wild-type 52,55K pre-mRNA by in vitro splicing in HeLa-NE (see paper I Fig.2). To our surprise, replacing the second exon of 52,55K with the enhancer minus sequence completely abolished splicing. At the same time 52,55K(3RE), 52,55K(2ASF) transcripts were spliced as efficiently as the wild type 52,55K pre-mRNA. Based on this finding we concluded that the downstream exon of 52,55K pre-mRNA must contain a splicing enhancer element, which is required for 52,55K splicing. Since the 52,55K second exon can be substituted by SR protein binding sequences, we speculated that the 52,55K second exon
- 30 - might function through a similar mechanism, i.e. by binding SR proteins, and promoting U2AF recruitment to polypyrimidine tract of 52,55K pre-mRNA. Collectively, these results indicated that even a constitutively active intron with a strong 3' splice site like 52,55K was absolutely dependent on a downstream splicing enhancer element for activity. To determine whether the requirement of a downstream splicing enhancer was unique to the adenovirus 52,55K pre-mRNA, we selected a second constitutively active pre-mRNA, the Drosophila Ftz pre-mRNA to test its splicing enhancer dependency. The splicing of the wild-type Ftz intron is very efficient with a conversion of almost 50% of input pre-mRNA to spliced product after 90 minutes incubation under standard splicing conditions. Replacing the - downstream exon of the Ftz pre-mRNA with the ß-globin enhancer minus sequence (Ftz(E )), resulted in a complete loss of Ftz pre-mRNA splicing in vitro. This result further confirmed our hypothesis that a downstream splicing enhancer element is essential for splicing of “strong” contitutively active introns under in vitro splicing conditions. To test if the rabbit β-globin enhancer minus sequence was inhibitory for splicing in - - vitro, we attached an U1 splicing enhancer to the 3' end of 52,55K(E ), and Ftz(E ) - - transcripts. The splicing activity of the resulting pre-mRNAs, 52,55K(E )-U1, and Ftz(E )- U1, was restored to the same level as their wild-type counterparts. These results demonstrate that the rabbit β-globin enhancer minus sequence functions as a neutral sequence and was not - inhibitory for splicing. Thus, the loss of splicing activity in transcripts of 52,55K(E ), and - Ftz(E ) was due to the absence of a downstream splicing enhancer element in these transcripts. Collectively our results extended previous observations by demonstrating that the requirement of a downstream splicing enhancer is not restricted to splicing of weak and regulated introns, but also essential for the splicing of strong and constitutively active introns.
4.2 A U1 splicing enhancer is more versatile than an SR splicing enhancer in promoting pre-mRNA splicing: comparison of the properties of two types of splicing enhancers (paper I) In the second part of paper I, we studied the properties of two different types of splicing enhancers for their ability to promote removal of an upstream intron. In order to characterize the factors required for activation of IIIa-U1 splicing, we separated HeLa-NE into three fractions of 40, 60, 90 ASP (the pellet precipitated from 40%,
- 31 - 60%, and 90% ammonium sulfate saturation) by stepwise precipitation with increasing amounts of ammonium sulfate as described (Zahler et al., 1992). In a splicing assay, none of these fractions were sufficient to activate IIIa pre-mRNA splicing. However, addition of 40 ASP, but not 60 ASP or 90 ASP, activated III-U1 splicing when supplemented with splicing deficient S100 extracts. Since most SR proteins are enriched in the 90 ASP fraction, the result excludes the possibility that SR proteins are the factors stimulating IIIa-U1 splicing. This result is consistent with our previous finding that SR proteins function as repressor, not activator proteins of IIIa pre-mRNA splicing (Kanopka et al., 1996). By Western blot analysis, we demonstrated that U1 snRNP was selectively enriched in 40 ASP. To further test whether U1-snRNP was the enhancer factor in 40 ASP, required for IIIa-U1 splicing, we functionally inactivated U1 snRNA by oligonucleotide-directed RNase H depletion. The oligonucleotide used in this experiment was designed to hybridize to the 5' end of U1 snRNA, which is the region that pairs with the 5' splice site of the pre-mRNA during 5' splice site recognition (Black et al., 1985). RNase H cleavage in the presence of the U1 oligonucleotide resulted in the functional depletion of U1 snRNPs from the 40 ASP fraction. The result further showed that incubation of 40 ASP with increasing amount of an U1 oligonucleotide during the RNase H treatment abolished the stimulatory activity of 40 ASP on IIIa-U1 splicing, while pre-treatment of 40 ASP with an U2 snRNA specific oligonucleotide had no effect on 40 ASP activation of IIIa-U1 splicing. From these results, we concluded that U1 snRNP was the critical factor in 40 ASP stimulating III-U1 splicing. Cytoplasmic S-100 extracts prepared from HeLa cells are inactive in splicing, either in the presence of an U1 enhancer or an SR enhancer, suggesting that S-100 extracts contain - sub-optimal concentrations of both SR proteins and U1 snRNP. We found that 52,55K(E )-U1 is activated in S-100 extracts supplemented either with 40 ASP or with purified HeLa SR proteins. In contrast, 52,55K(3RE), the variant of 52,55K pre-mRNA with a second exon SR enhancer was only activated in S-100 supplemented with SR proteins. This result implies that two types of factors, U1 snRNPs or SR proteins can activate the U1 enhancer, while the SR enhancer is only activated by SR proteins (Fig. 8). Most likely, this difference in activation capacity results from the fact that an U1 enhancer can bind both U1 snRNP and SR proteins (Crispino et al., 1994; Jamison et al., 1995) , while an SR enhancer can only bind SR proteins, not U1 snRNP. The binding of either of these factors stabilize U2AF interaction with the polypyrimidine tract, thus increasing splice site recognition and spliceosome assembly. In
- 32 - other words, the U1 enhancer is more versatile than the SR enhancer in stimulating pre- mRNA splicing.(Fig. 9)
U2AF U2AF SR
« « Yn Yn ESE
A. Unstable U2AF binding to B. ESE binds SR proteins. The interaction polypyrimidine tract ( Yn) . between SR proetins and U2AF stabilises U2AF binding to the polypyrimidine tract.
SR
U1 U2AF 70K snRNP U2AF SR ?
« « Yn U1 Yn U1
C. U1 enhancer binds U1 snRNP, D. U1 enhancer can also bind SR which helps stabilize U2AF binding proteins, which helps stabilise U2AF to the polypyrimidine tract. binding to the polypyrimidine tract.
Figure 9. Schematic representation of possible mechanisms by which an SR enhancer and a U1 enhancer promote splicing. 3' splice site usage is triggered by U2AF binding to the polypyrimidine tract.
4.3 Identification of a virus infection dependent splicing enhancer, the 3VDE (paper II) The adenovirus IIIa pre-mRNA is spliced inefficiently in HeLa-NE. In contrast, IIIa splicing is activated more than 200-fold in nuclear extract prepared from late adenovirus – infected cells (Ad-NE). This finding implies that the IIIa pre-mRNA per se, contains an endogenous splicing enhancer, which has evolved to function only in the context of an adenovirus infection. We named this splicing enhancer the IIIa virus infection-dependent splicing enhancer (3VDE). In paper II, we report the identification and functional characterization of this novel type of splicing enhancer. The rabbit ß-globin pre-mRNA is a constitutively active pre-mRNA. It is spliced efficiently in HeLa-NE, but is slightly inhibited in Ad-NE; i.e. its splicing tendency is
- 33 - opposite to that of the IIIa pre-mRNA. In our effort to identify the IIIa sequence elements responsible for activated splicing in Ad-NE, we made chimeric transcripts by exchanging sequence elements between the IIIa and the ß-globin transcripts. The splicing properties of these hybrid pre-mRNAs were tested in standard in vitro splicing reactions in HeLa-NE and Ad-NE. In the first set of experiments, we replaced short sequences in the rabbit ß-globin pre- mRNA with the corresponding sequences from IIIa, and tried to identify the minimal IIIa element conferring an enhanced splicing phenotype to ß-globin in Ad-NE. Transferring the 3RE to the ß-globin transcript resulted in a 5-fold reduction in the splicing efficiency in HeLa-NE. This result is consistent with our previous work demonstrating that the 3RE functions as a repressor element of IIIa splicing (Kanopka et al., 1996). Interestingly, splicing of this pre-mRNA was still inhibited in Ad-NE, suggesting that inactivation of SR protein binding to the 3RE is not sufficient to explain the enhanced splicing phenotype of the IIIa pre-mRNA in Ad-NE. Next we analyzed the splicing phenotype of a ß-globin transcript containing the 28 nt encoding the IIIa branch site and polypyrimidine tract. In HeLa-NE, this sequence reduced ß- globin splicing more than the 3RE. However, splicing of this transcript was enhanced about 5- fold in Ad-NE compared to HeLa-NE, reaching approximately 70% of the splicing efficiency of the wild type IIIa pre-mRNA. This result strongly suggested that the last 28 nt sequence of IIIa intron encodes the critical IIIa sequence element, which when transferred to the ß-globin transcript, was sufficient to confer an enhanced splicing phenotype to this pre-mRNA in Ad- NE. We designated this 28 nt sequence the 3VDE (IIIa virus infection-dependent splicing enhancer). In order to test the contribution of the 3RE and the 3VDE on enhanced IIIa pre-mRNA splicing in Ad-NE, we substituted sequence elements in the IIIa pre-mRNA with the corresponding sequences from ß-globin (paper II fig. 6A). The results from in vitro splicing assays showed that the basal level of IIIa(-3VDE) splicing in HeLa-NE was significantly increased compared to the wild-type IIIa transcript, but that splicing activation was moderate in Ad-NE (Paper II fig 6B). The small residual activation could be attributed to the reduced binding of SR protein to the 3RE in Ad-NE. Collectively, our results show that the 3VDE is the key element controlling IIIa 3' splice site activity, with the 3RE making a smaller, but important contribution. In an attempt to dissect further the 3VDE, we replaced the ß-globin branch site and polypyrimidine tract with the corresponding sequences from IIIa; this resulted in transcripts of
- 34 - glob(IIIa-bp) and glob(IIIa-py), respectively. As shown in paper II Figure. 3, splicing of glob(IIIa-bp) in Ad-NE was not enhanced compared to HeLa-NE, indicating that the IIIa branch site is not the critical element conferring an enhanced splicing phenotype to the IIIa pre-mRNA in Ad-NE. The splicing of glob(IIIa-py) transcript was not detectable in HeLa-NE, whereas a weak signal was consistently observed in Ad-NE. However, formation of the pre- spliceosome (the A complex) was dramatically increased in Ad-NE compared to HeLa-NE, suggesting that the IIIa polypyrimidine tract is, indeed, the primary element responsible for enhanced IIIa 3' splice site recognition in Ad-NE, but that steps subsequent to A complex formation are very inefficient with the glob(IIIa-py) transcript. Collectively, our results suggest that: (i,) The splicing activity of transcripts in HeLa-NE is controlled by the polypyrimidine tract strength; (ii,) The suboptimal IIIa polypyrimidine tract plays a central role in enhanced splicing in Ad-NE by promoting efficient initiation of spliceosome assembly; and (iii,) The integrity of the 3VDE (i.e. the native IIIa branch site and IIIa polypyrimidine tract) is required for efficient splicing catalysis.
4.4 U2AF binding to the IIIa polypyrimidine tract does not correlate with IIIa splicing activation in Ad-NE (paper II) As discussed above, U2AF binding to the polypyrimidine tract is critical for 3' splice site activation. U2AF shows a strong binding affinity for polypyrimidines, the longer the better. Increase in U2AF binding leads to higher splicing efficiency in HeLa-NE. However, the results in Ad-NE is just opposite. Thus, using a recombinant Gst-U2AF65 protein it was previously shown that pre-mRNAs which bind U2AF efficiently are repressed in Ad-NE, while pre-mRNAs with atypical polypyrimidine tracts and lower U2AF binding efficiency, like IIIa, are enhanced in Ad-NE (Mühlemann et al., 1995). In paper II, we used UV cross- linking combined with immunoprecipitation (using an anti U2AF65 antibody) to study the binding affinity of endogenous U2AF65 in HeLa-NE and Ad-NE to the IIIa and β-globin polypyrimidine tracts. As seen in the paper II, Figure 7B, U2AF65 binds the IIIa polypyrimidine tract weakly in HeLa-NE, which is consistent with the low splicing activity of the IIIa pre-mRNA. In contrast, the binding of U2AF65 to the IIIa polypyrimidine tract is not enhanced in Ad-NE, even though the IIIa splicing efficiency is dramatically increased. This unexpected result suggests that the binding of U2AF65 to 3VDE is not the key factor, which contributes to the enhanced splicing phenotype of the IIIa pre-mRNA in Ad-NE.
- 35 - 4.5 Development of a new expression system for production of phosphorylated, biologically active recombinant ASF/SF2 in E. coli (paper III) The mammalian SR family of splicing factors is highly phosphorylated predominately within the RS domain at physiological conditions in cells. This phosphorylation is essential for spliceosome assembly by promoting protein-protein interactions between different SR proteins, and SR proteins and other splicing factors. Furthermore, control of the phosphorylated status of SR proteins has been suggested to be a key mechanism in the regulation of alternative splicing. Functional studies of SR proteins require large amounts of pure protein. Typically recombinant proteins are expressed in E. coli since this system provides an easy and economical way to obtain large amounts of protein. However, expression in E. coli of an SR protein usually results in the production of a protein with a low biological activity since bacteria lack protein kinases capable of phosphorylating SR proteins. To overcome this problem, we established a new expression system where the SR protein was co-expressed with a protein kinase capable of phosphorylating SR proteins, in our case SRPK1 (SR proteins kinase 1). We selected ASF/SF2 as a model SR protein in this study. To co-express ASF/SF2 and SRPK1 in the same bacteria, we used two expression vectors encoding different antibiotic resistant markers. The full-length SRPK1 was cloned into pLysS (chloramphenicol resistance) generating plasmid pLysS-SRPK1, and ASF/SF2 was cloned into pQE-60 and pRSET A (ampicillin resistance) generating plasmids pQE- ASF(-HIS) and pRSET A-ASF, respectively. By electroporation, the two plasmids expressing ASF/SF2 and SRPK1 respectively were transformed into E. coli BL21 (DE3). Double transformants were selected by growing cells in the presence of ampicillin and chloramphenicol. ASF/SF2, without the SRPK1 plasmid, was also transformed and expressed in E. coli in parallel. ASF/SF2, with or without SRPK1 co-transformation, were expressed and purified by Ni-agarose chromatography, or by the conventional two-step high salt precipitation procedure used to purify SR proteins from mammalian cells. The phosphorylated status was determined by SDS-PAGE and Western blot analysis. As shown in paper III (fig. 2), ASF/SF2 co- expressed with SRPK1 (designated as ASF-P) migrated slower than ASF/SF2 expressed without SRPK1. Treatment of ASF-P with calf intestinal alkaline phosphotase (CIP) shifted the migration of ASF-P to the same level as ASF/SF2, demonstrating that ASF-P, indeed, was successfully phosphorylated in E. coli.
- 36 - Previous studies have shown that the monoclonal antibody 104 (mAb104) specifically recognizes phosphorylated epitopes in the RS domain of SR proteins. In a Western blot analysis, ASF-P was recognized by mAb104, whereas ASF/SF2 was not. This finding further supports the conclusion that ASF-P was not only phosphorylated, but also phosphorylated at the proper region within the RS domain. More importantly, in vitro splicing assays demonstrated that ASF-P was more effective, compared to ASF/SF2, in complementing 52,55K pre-mRNA splicing in S100 extracts, indicating ASF-P is functionally active in committing the pre-mRNA to the spliceosome assembly pathway. Proteins expressed in E. coli are typically insoluble. The expressed proteins form inclusion bodies, which are easy to purify, but difficult to refold to their native conformation. Interestingly, coexpression of SRPK1 and ASF/SF2 makes the SR protein more soluble in E. coli. This simplifies the purification procedure, and as a bonus, generates a more biologically active protein. We conclude that coexpression of a protein kinase with its substrate in E. coli is an efficient approach to obtain the phosphorylated version of a mammalian protein. In our model system, the expressed ASF/SF2 protein is phosphorylated, soluble, and more biologically active compared to its un-phosphorylated counterpart.
5. CONCLUSIONS AND DISCUSSION 5.1 The universal role of splicing enhancers It has long been noticed that splicing enhancers are required for the removal of introns containing weak, degenerate splicing signals in alternative splicing. However, a similar mechanism could also be utilized by cells to ensure accurate splice site recognition in constitutively active pre-mRNAs. For example, exons from constitutively spliced pre-mRNAs have been shown to associate with SR proteins (Chiara et al., 1996), which have been shown to promote 5’ and 3’ splice site activity (Wang et al., 1995). The result from the paper I demonstrates, for the first time, that two constitutively active introns also require a splicing enhancer for activity. In agreement with our hypothesis that splicing of constitutively active pre-mRNAs requires a splicing enhancer for activity, multiple splicing enhancer sequences were recently found to be embedded within the protein- coding sequences of the constitutively spliced human β-globin pre-mRNA (Schaal and Maniatis, 1999). These enhancers were shown to be capable of activating the splicing of a heterologous enhancer-dependent pre-mRNA in vitro. Collectively, available data suggests
- 37 - that splicing enhancers may be required for splicing all types of introns. Our data further suggests that a downstream 5’ splice site is the main type of splicing enhancer stimulating upstream intron removal. Thus, SR splicing enhancers probably play a minor role in constitutive splicing of internal exons. From previous data, it is known that splicing enhancers are the main cis-acting elements regulating alternative splicing. Because alternatively spliced introns usually have weak splicing signals, this leaves a large room for splicing enhancers to function, such that splicing or not splicing, to a large extent, is decided by the type of splicing enhancer present and the activity of the factors interacting with the enhancer.
5.2 Models for the 3VDE function The 3VDE is a unique element controlling 3' splice site activity. It functions as a ”Janus” element, and inhibits pre-mRNA splicing in HeLa-NE, while enhancing pre-mRNA splicing selectively in Ad-NE. It comprises of the 3' splice site region of the IIIa pre-mRNA; the core enhancer element consists of the IIIa polypyrimidine tract. Current data suggests that the 3VDE functions without efficient U2AF recruitment, i.e. it binds U2AF65 poorly in HeLa-NE, and even worse in Ad-NE. The steady–state levels of U2AF in HeLa-NE and Ad- NE is essentially the same, while available U2AF for each pre-mRNA in Ad-NE may be lower than in HeLa-NE due to the large amount of viral pre-mRNA produced late in infection. However, it appears that U2AF is not the critical factor required for enhanced IIIa splicing in Ad-NE. The work to isolate the key factor, the 3VDF (IIIa virus infection dependent splicing factor) involved in 3VDE function is still ongoing. The results so far does not allow us to discriminate between the possibilities that the 3VDF behaves as a positive or a negative regulator. Therefore, I propose two working models to explain the possible mechanisms for the 3VDE function. In model A, the 3VDF is a cellular negative regulator (potentially an hnRNP, like hnRNP A1). In HeLa-NE, the 3VDF specifically binds to the 3VDE and prevents U2 snRNP recruitment. In Ad-NE, the 3VDF may be modified by viral factor, or sequestrated by the large amount of viral RNA expressed late in infection. This would be predicted to cause a release of 3VDF repression, and as a consequence lead to enhanced IIIa pre-mRNA splicing. Since the IIIa branch point shows a close match to the branch site consensus sequence, the IIIa pre-mRNA may not require U2AF for U2 snRNP recruitment. Therefore, splicing can be dramatically enhanced as long as repression is released. (Fig. 10A)
- 38 - A Early Late
U2 U2 bp py bp py 3RE 3VDE 3RE 3VDE
U2AF U2AF
B Early Late
SR U2 U2 U2AF bp py bp py
3RE 3VDE 3RE 3VDE
U2AF U2AF
Figure 10. Two models for 3VDE function. Both of them work by influencing U2 snRNP recruitment to the branch site. In model A, the 3VDF works as a negative regulator. It inhibits IIIa pre-mRNA splicing in HeLa-NE by blocking U2 snRNP binding to the branch site. In model B, U2 snRNP recruitment is low because the IIIa polypyrimidine tract binds U2AF inefficiently in HeLa-NE. U2 snRNP recruitment is enhanced in Ad-NE by 3VDF. The contribution of 3RE to IIIa splicing is omitted. See the text for detail.
In model B, the 3VDF functions as a positive factor. The 3VDE represses IIIa pre- mRNA splicing in HeLa-NE due to its low affinity for U2AF. In Ad-NE the 3VDF (a viral factor or viral modified cellular factor) binds to 3VDE, and helps to recruit U2 snRNP into spliceosome. Consequently, IIIa pre-mRNA splicing is enhanced. (Fig. 10B)
- 39 - 5.3 Perspective for further identification of the 3VDF Since IIIa pre-mRNA splicing is controlled by the interaction between the 3VDE and the 3VDF, the purification and characterization of the 3VDF is a key step towards our understanding of how IIIa pre-mRNA splicing is regulated. Besides UV-crosslinking using site specifically labeled 3VDE RNA and nuclear extracts (virus infected and uninfected), the following experiments should also be considered: Large scale RNA affinity chromatography. If the 3VDE is the sequence for specific 3VDF binding, this factor could be isolated by incubating the factor containing extracts with gel immobilized 3VDE RNA under binding conditions, and then washed and eluted by changes of pH or salt strength. Using modified stable RNA oligos complementary to parts of 3VDE and flanking sequences, to stepwise block 3VDF binding may provide further insight for 3VDE and 3VDF interactions and help to identify the consensus sequence for 3VDF binding. Similarly, point mutations of 3VDE may also produce useful information concerning its binding specificity. Our previous data show that mutating pyrimidines to purines in the core part of 3VDE abolish IIIa splicing. This implies that U2AF may be required, since such mutations reduces U2AF binding. A better experiment to exclude the requirement of U2AF would be to mutate purines to pyrimidines. If such mutations also abolish or reduce IIIa pre-mRNA splicing, the requirement for U2AF becomes less likely. To test the requirement for U2AF for IIIa pre-mRNA splicing, the use of U2AF depleted HeLa-NE and Ad-NE may also produce valuable data. The depleted extract can be used in splicing complex assembly, in virto splicing assays, or to check U2 snRNP binding. Even though 3VDF has some unique features, it should be tested whether 3VDF is PTB or a homologue of PTB or Sxl. Experimentally this could be done by using antibodies, depletion or addition of purified protein in splicing assays in HeLa-NE or Ad-NE. If the 3VDF is a cellular negative regulator, the reason for IIIa enhanced splicing in Ad-NE is sequestration of 3VDF by viral RNA or DNA. This process could be simulated in vitro by addition of purifyed viral RNA or DNA to HeLa-NE before splicing assay.
5.4 The significance of modification of recombinant proteins expressed in E. coli and perspective for future applications Recombinant protein produced in bacteria is used in many areas of basic research as well as in the clinic. The first reason for this situation is that the natural resources of proteins
- 40 - are often limited and therefore difficult to purify in sufficient quantities, for example hormones, various growth factors, antibodies etc. Another important reason is the high risk of contamination when proteins are purified from their natural sources, like the contamination of trace amount of HIV or HBV / HCV (hepatitis B and C virus) in blood products. Problems of this type make researchers and medical companies interested in using heterologous systems for recombinant protein production. E. coli has proven to be a valuable production host for these purposes. As an expression system, E. coli has many advantages. It grows fast in inexpensive media, the expression procedure is easy to set up, and to scale up. Since expression vectors designed for E. coli are commercially available with various tags, the production and purification of recombinant proteins has become routine in many laboratories. Most importantly, the risk of contamination of other mammalian proteins or human viruses is eliminated by using a bacteria for production of a recombinant protein. A disadvantage with protein expression in E. coli is that this bacteria lack many of the posttranslational modifications used by higher eukaryotic cells, such as the mammalian enzymes required for phosphorylation, glycosylation, methylation or acetylation etc. This results sometimes in production of nonfunctional proteins when they are expressed in E. coli. This problem seriously restricts the use of E. coli as an expression system. Here we use a co-expression strategy to produce phosphorylated ASF/SF2 in E. coli. It is likely that the same strategy may be used for expression of proteins with other post-translational modifications, such as methylation, acetylation etc. In the paper III we used two plasmids to co-express an SR protein kinase and its substrate. A further advance of our technique would be to reconstruct a plasmid encoding both the modifying enzyme and its substrate either from two independent promoters, or an expression cassette where expression of the two proteins are controlled by a bicistronic transcription unit. These modifications may solve the plasmid incompatibility problem, which is a major problem restricting the successful co-expression of proteins in E. coli. In theory, our co-expression strategy may be used to more precisely define the significance of different protein modifications for function. For example, several protein kinases have been shown to phosphorylate SR proteins. By co-expressing an SR protein with the different SR protein kinases, the significance for the individual enzymes for spliceosome assembly may be tested. Similarly, the same strategy may be adapted to studies of other biosynthetic machinery’s in the cell, like transcription and translation
- 41 - 6. ACKNOWLEDGEMENT
This thesis is based on the studies started from the Department of Cellular and Molecular Biology, at the Karolinska Institute in Stockholm, finished at the Department of Medical Biochemistry and Microbiology, Uppsala University, Sweden.
I would like to take this opportunity to express my sincere gratitude to all the people who have helped, and supported me in this work. In particular, I would like to thank:
Professor Göran Akusjärvi, my supervisor, for introducing me to the RNA world, for your stimulating training, encouragement, enthusiasm and patience, for creating the enjoyable lab atmosphere.
Professor Göran Magnusson, my examiner, and people in your group for help and scientific discussion.
Professor Jerker Porath, my former supervisor in the Department of Biochemistry, for accepting me to study in your lab when I first came to Sweden, for sharing your knowledge and ideas. And people in your Lab.
Professor Qian Lin-Fa, my mentor, at Medical Science Institute, Nanjing Railway Medical College, China, for your help and generous support.
All the members in Professor Stefan Schwartz’s group and in Dr. Lars Hellman’s group.
The present and former members in our group: Jan-Peter Kreivi, Oliver Muhlemann, Arvydas Kanopka, Maria Bondesson, Catharina Svensson, Karin Öhman-Forslund, Kerstin Sollerbrant, Petra Olsson, Mattias Mannervik, Neil Portwood, Svend Petersen-Mahrt, Christina Öhrmalm, Ann-Christine Ström, Camilla Estmer Nilsson, Edyta Bajak, Vita Dauksaite, Dan Eholm, Shao-an Fan, David Huang, Cecilia Johnsson, Anette Lindberg, Magnus Molin, Tanel Punga, Jodef Seibt, Anders Sundqvist, Saideh Berenjian, Martin Luezelberger, for excellent collaboration and sharing the good and bad times.
- 42 - Among those, special thanks to: -Catharina, for your help, and encouragement. -Peter for your collaboration, guidance and patience in the phosphorylation project. -Oliver for introducing me to the splicing area, for stimulating discussion in work. -Christina and John, for introducing me a lot knowledge about Sweden, for always being ready to help. -Shao-an for sharing the same language and culture.
Brian Collier for correcting my English (not for this sentence).
My Chinese friends: Wang Shu and Zhou Yinghua, for sharing opinions, experiences, and Rome holiday. Li Jinping and Zhang Xiao for help in those years; Wei Tao, Liu Aijie and Huang Jinfang, for passing the God’s blessing. Zhang Hongxue for help and care during the early stage of this work.
I thank my parents for their endless understanding, encouragement, support and love; think my sister Baili and her family, for their support and help, taking care of our parents when I am working on this thesis; my daughter Yue Kun, for giving me so much happiness.
- 43 - 7. REFERENCES Adams, M. D., Rudner, D. Z., and Rio, D. C. (1996). Biochemistry and regulation of pre- mRNA splicing. Curr Opin Cell Biol 8, 331-9.
Akusjärvi, G., and Persson, H. (1981). Controls of RNA splicing and termination in the major late adenovirus transcription unit. Nature 292, 420-6.
Amrein, H., Hedley, M. L., and Maniatis, T. (1994). The role of specific protein-RNA and protein-protein interactions in positive and negative control of pre-mRNA splicing by Transformer 2. Cell 76, 735-46.
Arning, S., Gruter, P., Bilbe, G., and Krämer, A. (1996). Mammalian splicing factor SF1 is encoded by variant cDNAs and binds to RNA. RNA 2, 794-810.
Bai, Y., Lee, D., Yu, T., and Chasin, L. A. (1999). Control of 3' splice site choice in vivo by ASF/SF2 and hnRNP A1. Nucleic Acids Res 27, 1126-34.
Barabino, S. M., Blencowe, B. J., Ryder, U., Sproat, B. S., and Lamond, A. I. (1990). Targeted snRNP depletion reveals an additional role for mammalian U1 snRNP in spliceosome assembly. Cell 63, 293-302.
Berget, S. M., Moore, C., and Sharp, P. A. (1977). Spliced segments at the 5' terminus of adenovirus 2 late mRNA. Proc Natl Acad Sci U S A 74, 3171-5.
Black, D. L., Chabot, B., and Steitz, J. A. (1985). U2 as well as U1 small nuclear ribonucleoproteins are involved in premessenger RNA splicing. Cell 42, 737-50.
Black, D. L., and Steitz, J. A. (1986). Pre-mRNA splicing in vitro requires intact U4/U6 small nuclear ribonucleoprotein. Cell 46, 697-704.
Blencowe, B. J., Bauren, G., Eldridge, A. G., Issner, R., Nickerson, J. A., Rosonina, E., and Sharp, P. A. (2000). The SRm160/300 splicing coactivator subunits. RNA 6, 111-20.
Blencowe, B. J., Issner, R., Nickerson, J. A., and Sharp, P. A. (1998). A coactivator of pre- mRNA splicing. Genes Dev 12, 996-1009.
Bondesson, M., Öhman, K., Manervik, M., Fan, S., and Akusjärvi, G. (1996). Adenovirus E4 open reading frame 4 protein autoregulates E4 transcription by inhibiting E1A transactivation of the E4 promoter. J Virol 70, 3844-51.
Bridge, E., and Ketner, G. (1989). Redundant control of adenovirus late gene expression by early region 4. J Virol 63, 631-8.
Brosi, R., Groning, K., Behrens, S. E., Luhrmann, R., and Krämer, A. (1993). Interaction of mammalian splicing factor SF3a with U2 snRNP and relation of its 60-kD subunit to yeast PRP9. Science 262, 102-5.
Caceres, J. F., Misteli, T., Screaton, G. R., Spector, D. L., and Krainer, A. R. (1997). Role of the modular domains of SR proteins in subnuclear localization and alternative splicing specificity. J Cell Biol 138, 225-38.
- 44 - Caceres, J. F., Stamm, S., Helfman, D. M., and Krainer, A. R. (1994). Regulation of alternative splicing in vivo by overexpression of antagonistic splicing factors. Science 265, 1706-9.
Cao, W., Jamison, S. F., and Garcia-Blanco, M. A. (1997). Both phosphorylation and dephosphorylation of ASF/SF2 are required for pre-mRNA splicing in vitro. RNA 3, 1456-67.
Cavaloc, Y., Bourgeois, C. F., Kister, L., and Stevenin, J. (1999). The splicing factors 9G8 and SRp20 transactivate splicing through different and specific enhancers. RNA 5, 468-83.
Chan, R. C., and Black, D. L. (1997). The polypyrimidine tract binding protein binds upstream of neural cell-specific c-src exon N1 to repress the splicing of the intron downstream. Mol Cell Biol 17, 4667-76.
Chen, M., Mermod, N., and Horwitz, M. S. (1990). Protein-protein interactions between adenovirus DNA polymerase and nuclear factor I mediate formation of the DNA replication preinitiation complex. J Biol Chem 265, 18634-42.
Chew, S. L., Liu, H. X., Mayeda, A., and Krainer, A. R. (1999). Evidence for the function of an exonic splicing enhancer after the first catalytic step of pre-mRNA splicing. Proc Natl Acad Sci U S A 96, 10655-60.
Chiara, M. D., Gozani, O., Bennett, M., Champion-Arnaud, P., Palandjian, L., and Reed, R. (1996). Identification of proteins that interact with exon sequences, splice sites, and the branchpoint sequence during each stage of spliceosome assembly. Mol Cell Biol 16, 3317-26.
Cho, E. J., Takagi, T., Moore, C. R., and Buratowski, S. (1997). mRNA capping enzyme is recruited to the transcription complex by phosphorylation of the RNA polymerase II carboxy- terminal domain. Genes Dev 11, 3319-26.
Chow, L. T., Gelinas, R. E., Broker, T. R., and Roberts, R. J. (1977). An amazing sequence arrangement at the 5' ends of adenovirus 2 messenger RNA. Cell 12, 1-8.
Chroboczek, J., Bieber, F., and Jacrot, B. (1992). The sequence of the genome of adenovirus type-5 and its comparison with the genome of adenovirus type-2. Virology 186, 280-285.
Colgan, D. F., and Manley, J. L. (1997). Mechanism and regulation of mRNA polyadenylation. Genes Dev 11, 2755-66.
Colwill, K., Feng, L. L., Yeakley, J. M., Gish, G. D., Caceres, J. F., Pawson, T., and Fu, X. D. (1996). SRPK1 and Clk/Sty protein kinases show distinct substrate specificities for serine/arginine-rich splicing factors. J Biol Chem 271, 24569-75.
Colwill, K., Pawson, T., Andrews, B., Prasad, J., Manley, J. L., Bell, J. C., and Duncan, P. I. (1996). The Clk/Sty protein kinase phosphorylates SR splicing factors and regulates their intranuclear distribution. EMBO J 15, 265-75.
- 45 - Coppola, J. A., Field, A. S., and Luse, D. S. (1983). Promoter-proximal pausing by RNA polymerase II in vitro: transcripts shorter than 20 nucleotides are not capped. Proc Natl Acad Sci U S A 80, 1251-5.
Corden, J. L., and Patturajan, M. (1997). A CTD function linking transcription to splicing. Trends Biochem Sci 22, 413-6.
Coulter, L. R., Landree, M. A., and Cooper, T. A. (1997). Identification of a new class of exonic splicing enhancers by in vivo selection. Mol Cell Biol 17, 2143-50.
Cramer, P., Caceres, J. F., Cazalla, D., Kadener, S., Muro, A. F., Baralle, F. E., and Kornblihtt, A. R. (1999). Coupling of transcription with alternative splicing: RNA pol II promoters modulate SF2/ASF and 9G8 effects on an exonic splicing enhancer. Mol Cell 4, 251-8.
Cramer, P., Pesce, C. G., Baralle, F. E., and Kornblihtt, A. R. (1997). Functional association between promoter structure and transcript alternative splicing. Proc Natl Acad Sci U S A 94, 11456-60.
Crispino, J. D., Blencowe, B. J., and Sharp, P. A. (1994). Complementation by SR proteins of pre-mRNA splicing reactions depleted of U1 snRNP. Science 265, 1866-9.
Dantonel, J. C., Murthy, K. G., Manley, J. L., and Tora, L. (1997). Transcription factor TFIID recruits factor CPSF for formation of 3' end of mRNA. Nature 389, 399-402.
Debbas, M., and White, E. (1993). Wild-type p53 mediates apoptosis by E1A, which is inhibited by E1B. Genes Dev 7, 546-54.
Del Gatto-Konczak, F., Olive, M., Gesnel, M. C., and Breathnach, R. (1999). hnRNP A1 recruited to an exon in vivo can function as an exon splicing silencer. Mol Cell Biol 19, 251- 60.
Eperon, I. C., Ireland, D. C., Smith, R. A., Mayeda, A., and Krainer, A. R. (1993). Pathways for selection of 5' splice sites by U1 snRNPs and SF2/ASF. EMBO J 12, 3607-17.
Falck, P. E., and Logan, J. (1989). Regulation of poly(A) site selection in adenovirus. J Virol 63, 532-41.
Freyer, G. A., Katoh, Y., and Roberts, R. J. (1984). Characterization of the major mRNAs from adenovirus 2 early region 4 by cDNA cloning and sequencing. Nucleic Acids Res 12, 3503-19.
Frilander, M.J. and Steitz, J. A. (1999). Initial recognition of U12-dependent introns requires both U11/5' splice-site and U/12 branchpoint interactions. Genes Dev 13, 851-63.
- 46 - Fu, X. D. (1993). Specific commitment of different pre-mRNAs to splicing by single SR proteins. Nature 365, 82-5.
Fu, X. D., Mayeda, A., Maniatis, T., and Krainer, A. R. (1992). General splicing factors SF2 and SC35 have equivalent activities in vitro, and both affect alternative 5' and 3' splice site selection. Proc Natl Acad Sci U S A 89, 11224-8.
Furuichi, Y., LaFiandra, A., and Shatkin, A. J. (1977). 5'-Terminal structure and mRNA stability. Nature 266, 235-9.
Gaur, R. K., Valcarcel, J., and Green, M. R. (1995). Sequential recognition of the pre- mRNA branch point by U2AF65 and a novel spliceosome-associated 28-kDa protein. RNA 1, 407-17.
Ge, H., and Manley, J. L. (1990). A protein factor, ASF, controls cell-specific alternative splicing of SV40 early pre-mRNA in vitro. Cell 62, 25-34.
Gilmartin, G. M., McDevitt, M. A., and Nevins, J. R. (1988). Multiple factors are required for specific RNA cleavage at a poly(A) addition site. Genes Dev 2, 578-87.
Gontarek, R. R., McNally, M. T., and Beemon, K. (1993). Mutation of an RSV intronic element abolishes both U11/U12 snRNP binding and negative regulation of splicing. Genes Dev 7, 1926-36.
Gooding, C., Roberts, G. C., and Smith, C. W. (1998). Role of an inhibitory pyrimidine element and polypyrimidine tract binding protein in repression of a regulated alpha- tropomyosin exon. RNA 4, 85-100.
Gooding, L. R., Sofola, I. O., Tollefson, A. E., Duerksen, H. P., and Wold, W. S. (1990). The adenovirus E3-14.7K protein is a general inhibitor of tumor necrosis factor-mediated cytolysis. J Immunol 145, 3080-6.
Gozani, O., Patton, J. G., and Reed, R. (1994). A novel set of spliceosome-associated proteins and the essential splicing factor PSF bind stably to pre-mRNA prior to catalytic step II of the splicing reaction. EMBO J 13, 3356-67.
Granadino, B., Penalva, L. O. F., Green, M. R., Valcarcel, J., and Sanchez, L. (1997). Distinct mechanisms of splicing regulation in vivo by the Drosophila protein Sex-lethal. Proc Natl Acad Sci U S A 94, 7343-8.
Gui, J. F., Tronchere, H., Chandler, S. D., and Fu, X. D. (1994). Purification and characterization of a kinase specific for the serine- and arginine-rich pre-mRNA splicing factors. Proc Natl Acad Sci U S A 91, 10824-8.
Gustin, K. E., and Imperiale, M. J. (1998). Encapsidation of viral DNA requires the adenovirus L1 52/55-kilodalton protein. J Virol 72, 7860-70.
Guth, S., Martinez, C., Gaur, R. K., and Valcarcel, J. (1999). Evidence for substrate- specific requirement of the splicing factor U2AF(35) and for its function after polypyrimidine tract recognition by U2AF(65). Mol Cell Biol 19, 8263-71.
- 47 - Halbert, D. N., Cutt, J. R., and Shenk, T. (1985). Adenovirus early region 4 encodes functions required for efficient DNA replication, late gene expression, and host cell shutoff. J Virol 56, 250-7.
Hamm, J., and Mattaj, I. W. (1990). Monomethylated cap structures facilitate RNA export from the nucleus. Cell 63, 109-18.
Hasson, T. B., Ornelles, D. A., and Shenk, T. (1992). Adenovirus l1 52-Kilodalton and 55- Kilodalton proteins are present within assembling virions and colocalize with nuclear structures distinct from replication centers. J Virol 66, 6133-6142.
Hedley, M. L., Amrein, H., and Maniatis, T. (1995). An amino acid sequence motif sufficient for subnuclear localization of an arginine/serine-rich splicing factor. Proc Natl Acad Sci U S A 92, 11524-8.
Hemström, C., Nordqvist, K., Pettersson, U., and Virtanen, A. (1988). Gene product of region E4 of adenovirus type 5 modulates accumulation of certain viral polypeptides. J Virol 62, 3258-64.
Hoffman, B. E., and Grabowski, P. J. (1992). U1 snRNP targets an essential splicing factor, U2AF65, to the 3' splice site by a network of interactions spanning the exon. Genes Dev 6, 2554-68.
Horwitz, M. S. (1996). Adenoviruses. In Fields Virology, B. N. Fields, D. M. Knipe, P. M. Howley and e. al, eds. (Philadelphia: Raven Press), pp. 2149-2172.
Huang, M. M., and Hearing, P. (1989). Adenovirus early region 4 encodes two gene products with redundant effects in lytic infection. J Virol 63, 2605-15.
Imperiale, M., Akusjärvi, G., and Leppard, K. (1995). Post-transcriptional control of adenovirus gene expression. In The Molecular Repertoire of Adenoviruses. Current Topics in Microbiology and Immunology, vol. 199/II, W. Doerfler and P. Böhm, eds.: Springer-Verlag, Berlin.), pp. 139-171.
Jamison, S. F., Pasman, Z., Wang, J., Will, C., Luhrmann, R., Manley, J. L., and Garcia-Blanco, M. A. (1995). U1 snRNP-ASF/SF2 interaction and 5' splice site recognition: characterization of required elements. Nucleic Acids Res 23, 3260-7.
Kandels-Lewis, S., and Seraphin, B. (1993). Involvement of U6 snRNA in 5' splice site selection. Science 262, 2035-9.
Kanopka, A., Mühlemann, O., and Akusjärvi, G. (1996). Inhibition by SR proteins of splicing of a regulated adenovirus pre-mRNA. Nature 381, 535-538.
- 48 - Kanopka, A., Mühlemann, O., Petersen-Mahrt, S., Estmer, C., Öhrmalm, C., and Akusjärvi, G. (1998). Regulation of adenovirus alternative RNA splicing by dephosphorylation of SR proteins. Nature 393, 185-7.
Keller, W. (1995). No end yet to messenger RNA 3' processing! Cell 81, 829-32.
Ketner, G., Bridge, E., Virtanen, A., Hemström, C., and Pettersson, U. (1989). Complementation of adenovirus E4 mutants by transient expression of E4 cDNA and deletion plasmids. Nucleic Acids Res 17, 3037-48.
Kim, E., Du, L., Bregman, D. B., and Warren, S. L. (1997). Splicing factors associate with hyperphosphorylated RNA polymerase II in the absence of pre-mRNA. J Cell Biol 136, 19- 28.
Klein Gunnewiek, J. M., van de Putte, L. B., and van Venrooij, W. J. (1997). The U1 snRNP complex: an autoantigen in connective tissue diseases. An update. Clin Exp Rheumatol 15, 549-60.
Kleinberger, T., and Shenk, T. (1993). Adenovirus E4orf4 protein binds to protein phosphatase 2A, and the complex down regulates E1A-enhanced junB transcription. J Virol 67, 7556-7560.
Kohtz, J. D., Jamison, S. F., Will, C. L., Zuo, P., Luhrmann, R., Garcia-Blanco, M. A., and Manley, J. L. (1994). Protein-protein interactions and 5'-splice-site recognition in mammalian mRNA precursors. Nature 368, 119-24.
Koizumi, J., Okamoto, Y., Onogi, H., Mayeda, A., Krainer, A. R., and Hagiwara, M. (1999). The subcellular localization of SF2/ASF is regulated by direct interaction with SR protein kinases (SRPKs). J Biol Chem 274, 11125-31.
Konarska, M. M., and Sharp, P. A. (1987). Interactions between small nuclear ribonucleoprotein particles in formation of spliceosomes. Cell 49, 763-74.
Konforti, B. B., Koziolkiewicz, M. J., and Konarska, M. M. (1993). Disruption of base pairing between the 5' splice site and the 5' end of U1 snRNA is required for spliceosome assembly. Cell 75, 863-73. Krainer, A. R., Conway, G. C., and Kozak, D. (1990). The essential pre-mRNA splicing factor SF2 influences 5' splice site selection by activating proximal sites. Cell 62, 35-42. Kreivi, J. P., Zerivitz, K., and Akusjärvi, G. (1991). Sequences involved in the control of adenovirus L1 alternative RNA splicing. Nucleic Acids Res 19, 2379-2386. Krishna, R. G., and Wold, F. (1993). Post-translational modification of proteins. Adv Enzymol Relat Areas Mol Biol 67, 265-98. Krämer, A., and Utans, U. (1991). Three protein factors (SF1, SF3 and U2AF) function in pre-splicing complex formation in addition to snRNPs. EMBO J 10, 1503-9.
Lane, D. P., and Crawford, L. V. (1979). T antigen is bound to a host protein in SV40- transformed cells. Nature 278, 261-3.
- 49 - Larsson, S., Kreivi, J. P., and Akusjärvi, G. (1991). Control of adenovirus alternative RNA splicing: effect of viral DNA replication on RNA splice site choice. Gene 107, 219-27.
Larsson, S., Svensson, C., and Akusjärvi, G. (1992). Control of Adenovirus Major Late Gene Expression at Multiple Levels. J Mol Biol 225, 287-298.
Lemay, P., Boudin, M. L., Milleville, M., and Boulanger, P. (1980). Human adenovirus type 2 protein IIIa. I. Purification and characterization. Virology 101, 131-43.
Lesser, C. F., and Guthrie, C. (1993). Mutations in U6 snRNA that alter splice site specificity: implications for the active site. Science 262, 1982-8.
Lewis, J. D., Gunderson, S. I., and Mattaj, I. W. (1995). The influence of 5' and 3' end structures on pre-mRNA metabolism. J Cell Sci Suppl 19, 13-9.
Linzer, D. I., and Levine, A. J. (1979). Characterization of a 54K dalton cellular SV40 tumor antigen present in SV40-transformed cells and uninfected embryonal carcinoma cells. Cell 17, 43-52.
Liu, H. X., Zhang, M., and Krainer, A. R. (1998). Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins. Genes Dev 12, 1998-2012.
Longman, D., Johnstone, I. L., and Caceres, J. F. (2000). Functional characterization of SR and SR-related genes in Caenorhabditis elegans. EMBO J 19, 1625-37.
Luo, M. J., and Reed, R. (1999). Splicing is required for rapid and efficient mRNA export in metazoans. Proc Natl Acad Sci U S A 96, 14937-42.
Madhani, H. D., and Guthrie, C. (1994). Dynamic RNA-RNA interactions in the spliceosome. Annu Rev Genet 28, 1-26.
Manley, J. L., and Tacke, R. (1996). SR proteins and splicing control. Genes Dev 10, 1569- 79.
Mannervik, M., Fan, S., Ström, A. C., Helin, K., and Akusjärvi, G. (1999). Adenovirus E4 open reading frame 4-induced dephosphorylation inhibits E1A activation of the E2 promoter and E2F-1-mediated transactivation independently of the retinoblastoma tumor suppressor protein. Virology 256, 313-21.
McCracken, S., Fong, N., Rosonina, E., Yankulov, K., Brothers, G., Siderovski, D., Hessel, A., Foster, S., Shuman, S., and Bentley, D. L. (1997). 5'-Capping enzymes are targeted to pre-mRNA by binding to the phosphorylated carboxy-terminal domain of RNA polymerase II. Genes Dev 11, 3306-18.
McCracken, S., Fong, N., Yankulov, K., Ballantyne, S., Pan, G., Greenblatt, J., Patterson, S. D., Wickens, M., and Bentley, D. L. (1997). The C-terminal domain of RNA polymerase II couples mRNA processing to transcription. Nature 385, 357-61.
McNally, M. T., and Beemon, K. (1992). Intronic sequences and 3' splice sites control Rous sarcoma virus RNA splicing. J Virol 66, 6-11.
- 50 - McNally, M. T., Gontarek, R. R., and Beemon, K. (1991). Characterization of Rous sarcoma virus intronic sequences that negatively regulate splicing. Virology 185, 99-108.
Merendino, L., Guth, S., Bilbao, D., Martinez, C., and Valcarcel, J. (1999). Inhibition of msl-2 splicing by Sex-lethal reveals interaction between U2AF35 and the 3' splice site AG. Nature 402, 838-41.
Mermoud, J. E., Cohen, P., and Lamond, A. I. (1992). Ser/Thr-specific protein phosphatases are required for both catalytic steps of pre-mRNA splicing. Nucleic Acids Res 20, 5263-9.
Mironov, A. A., Fickett, J. W., and Gelfand, M. S. (1999). Frequent alternative splicing of human genes. Genome Res 9, 1288-93.
Misteli, T. (1999). RNA splicing: What has phosphorylation got to do with it? Curr Biol 9, R198-200.
Misteli, T., and Spector, D. (1997). Protein phosphorylation and the nuclear organization of pre-mRNA splicing. Trends in Cell Bio. 7, 135-138.
Misteli, T., and Spector, D. L. (1998). The cellular organization of gene expression. Curr Opin Cell Biol 10, 323-31.
Moras, D., and Poterszman, A. (1995). RNA-protein interactions. Diverse modes of recognition. Curr Biol 5, 249-51.
Muller, U., Kleinberger, T., and Shenk, T. (1992). Adenovirus e4orf4 protein reduces phosphorylation of c-Fos and E1A proteins while simultaneously reducing the level of AP-1. J Virol 66, 5867-5878.
Mulligan, G. J., Guo, W., Wormsley, S., and Helfman, D. M. (1992). Polypyrimidine tract binding protein interacts with sequences involved in alternative splicing of beta-tropomyosin pre-mRNA. J Biol Chem 267, 25480-7.
Murray, M. V., Kobayashi, R., and Krainer, A. R. (1999). The type 2C Ser/Thr phosphatase PP2Cgamma is a pre-mRNA splicing factor. Genes Dev 13, 87-97.
Mühlemann, O., Kreivi, J.-P., and Akusjärvi, G. (1995). Enhanced splicing of nonconsensus 3' splice sites late during adenovirus infection. J Virol 69, 7324-7327.
Nevins, J. R., and Wilson, M. C. (1981). Regulation of adenovirus-2 gene expression at the level of transcriptional termination and RNA processing. Nature 290, 113-8.
Newman, A. (1994). RNA splicing. Activity in the spliceosome. Curr Biol 4, 462-4.
Newman, A. J., and Norman, C. (1992). U5 snRNA interacts with exon sequences at 5' and 3' splice sites. Cell 68, 743-54.
- 51 - Nordqvist, K., Öhman, K., and Akusjärvi, G. (1994). Human adenovirus encodes two proteins which have opposite effects on accumulation of alternatively spliced mRNAs. Mol Cell Biol 14, 437-45.
Ohman, K. (1995). Function of adenovirus early region 4 proteins in RNA processing and cellular transformation (Stockholm: Karolinska Institute).
Ohman, K., Nordqvist, K., and Akusjärvi, G. (1993). Two adenovirus proteins with redundant activities in virus growth facilitates tripartite leader mRNA accumulation. Virology 194, 50-8.
Okamoto, Y., Onogi, H., Honda, R., Yasuda, H., Wakabayashi, T., Nimura, Y., and Hagiwara, M. (1998). cdc2 kinase-mediated phosphorylation of splicing factor SF2/ASF. Biochem Biophys Res Commun 249, 872-8.
Pilder, S., Moore, M., Logan, J., and Shenk, T. (1986). The adenovirus E1B-55K transforming polypeptide modulates transport or cytoplasmic stabilization of viral and host cell mRNAs. Mol Cell Biol 6, 470-6.
Proudfoot, N. (2000). Connecting transcription to messenger RNA processing. Trends Biochem Sci 25, 290-3.
Query, C. C., McCaw, P. S., and Sharp, P. A. (1997). A minimal spliceosomal complex A recognizes the branch site and polypyrimidine tract. Mol Cell Biol 17, 2944-53.
Rabbitts, T. H., and Forster, A. (1978). Evidence for noncontiguous variable and constant region genes in both germ line and myeloma DNA. Cell 13, 319-27.
Roberts, R. J., Akusjärvi, G., Aleström, P., Gelinas, R. E., Gingeras, T. R., Sciaky, D., and Pettersson, U. (1986). A consensus sequence for the adenovirus-2 genome, Volume 8, W. Doerfler, ed. (Boston: Martin Nijhoff Publishing).
Rossi, F., Forne, T., Antoine, E., Tazi, J., Brunel, C., and Cathala, G. (1996). Involvement of U1 small nuclear ribonucleoproteins (snRNP) in 5' splice site-U1 snRNP interaction. J Biol Chem 271, 23985-91.
Rossi, F., Labourier, E., Forne, T., Divita, G., Derancourt, J., Riou, J. F., Antoine, E., Cathala, G., Brunel, C., and Tazi, J. (1996). Specific phosphorylation of SR proteins by mammalian DNA topoisomerase I. Nature 381, 80-2.
Rowe, w. r., r.j., H., l.k., G., r.h., P., and t.g., W. (1953). Isolation of a cytopathogenic agent from human adenpids undergoing sponataneous degenetation in tissue culture. Proc Soc Exp Biol Med 84, 570-573.
Ruskin, B., Zamore, P. D., and Green, M. R. (1988). A factor, U2AF, is required for U2 snRNP binding and splicing complex assembly. Cell 52, 207-19.
Sachs, A. B., Sarnow, P., and Hentze, M. W. (1997). Starting at the beginning, middle, and end: translation initiation in eukaryotes. Cell 89, 831-8.
- 52 - Schaal, T. D., and Maniatis, T. (1999). Multiple distinct splicing enhancers in the protein- coding sequences of a constitutively spliced pre-mRNA. Mol Cell Biol 19, 261-73.
Schaal, T. D., and Maniatis, T. (1999). Selection and characterization of pre-mRNA splicing enhancers: identification of novel SR protein-specific enhancer sequences. Mol Cell Biol 19, 1705-19.
Schwer, B., and Shuman, S. (1996). Conditional inactivation of mRNA capping enzyme affects yeast pre-mRNA splicing in vivo. RNA 2, 574-83.
Sharp, P. A. (1994). Split genes and RNA splicing. Cell 77, 805-15.
Singer, R. H., and Green, M. R. (1997). Compartmentalization of eukaryotic gene expression: causes and effects. Cell 91, 291-4.
Sonenberg, N. (1993). Remarks on the mechanism of ribosome binding to eukaryotic mRNAs. Gene Expr 3, 317-23.
Sontheimer, E. J., and Steitz, J. A. (1993). The U5 and U6 small nuclear RNAs as active site components of the spliceosome. Science 262, 1989-96.
Southby, J., Gooding, C., and Smith, C. W. (1999). Polypyrimidine tract binding protein functions as a repressor to regulate alternative splicing of alpha-actinin mutally exclusive exons. Mol Cell Biol 19, 2699-711.
Sprengler, J., Schmitz, B., Heuss-Neitzel, D., and Doerfler, W. (1995). The complete nucleotide sequence of the DNA of human adenovirus type 12. In The Molecular Repertoire of Adenoviruses. Current Topics in Microbiology and Immunology, vol. 199/II, W. Doerfler and P. Böhm, eds.: Springer-Verlag, Berlin.), pp. 189-274.
Staknis, D., and Reed, R. (1994). SR proteins promote the first specific recognition of Pre- mRNA and are present together with the U1 small nuclear ribonucleoprotein particle in a general splicing enhancer complex. Mol Cell Biol 14, 7670-82.
Sun, Q., Mayeda, A., Hampson, R. K., Krainer, A. R., and Rottman, F. M. (1993). General splicing factor SF2/ASF promotes alternative splicing by binding to an exonic splicing enhancer. Genes Dev 7, 2598-608.
Tacke, R., and Manley, J. L. (1999). Determinants of SR protein specificity. Curr Opin Cell Biol 11, 358-62.
Tacke, R., and Manley, J. L. (1995). The human splicing factors ASF/SF2 and SC35 possess distinct, functionally significant RNA binding specificities. EMBO J 14, 3540-51.
Tacke, R., Tohyama, M., Ogawa, S., and Manley, J. L. (1998). Human Tra2 proteins are sequence-specific activators of pre-mRNA splicing. Cell 93, 139-48.
Tazi, J., Kornstadt, U., Rossi, F., Jeanteur, P., Cathala, G., Brunel, C., and Luhrmann, R. (1993). Thiophosphorylation of U1-70K protein inhibits pre-mRNA splicing. Nature 363, 283-6.
- 53 - Teigelkamp, S., Newman, A. J., and Beggs, J. D. (1995). Extensive interactions of PRP8 protein with the 5' and 3' splice sites during splicing suggest a role in stabilization of exon alignment by U5 snRNA. EMBO J 14, 2602-12.
Tigges, M. A., and Raskas, H. J. (1984). Splice junctions in adenovirus 2 early region 4 mRNAs: multiple splice sites produce 18 to 24 RNAs. J Virol 50, 106-17.
Valcarcel, J., Gaur, R. K., Singh, R., and Green, M. R. (1996). Interaction of U2AF65 RS region with pre-mRNA branch point and promotion of base pairing with U2 snRNA. Science 273, 1706-9.
Valcarcel, J., Singh, R., Zamore, P. D., and Green, M. R. (1993). The protein Sex-lethal antagonizes the splicing factor U2AF to regulate alternative splicing of transformer pre- mRNA. Nature 362, 171-5.
Virtanen, A., Aleström, P., Persson, H., Katze, M. G., and Pettersson, U. (1982). An adenovirus agnogene. Nucleic Acids Res 10, 2539-48.
Virtanen, A., Gilardi, P., Näslund, A., LeMoullec, J. M., Pettersson, U., and Perricaudet, M. (1984). mRNAs from human adenovirus 2 early region 4. J Virol 51, 822-31.
Visa, N., Izaurralde, E., Ferreira, J., Daneholt, B., and Mattaj, I. W. (1996). A nuclear cap-binding complex binds Balbiani ring pre-mRNA cotranscriptionally and accompanies the ribonucleoprotein particle during nuclear export. J Cell Biol 133, 5-14.
Wang, J., and Manley, J. L. (1995). Overexpression of the SR proteins ASF/SF2 and SC35 influences alternative splicing in vivo in diverse ways. RNA 1, 335-46.
Wang, Z., Hoffmann, H. M., and Grabowski, P. J. (1995). Intrinsic U2AF binding is modulated by exon enhancer signals in parallel with changes in splicing activity. RNA 1, 21- 35.
Watakabe, A., Tanaka, K., and Shimura, Y. (1993). The role of exon sequences in splice site selection. Genes Dev 7, 407-18.
Weinberg, D. H., and Ketner, G. (1986). Adenoviral early region 4 is required for efficient viral DNA replication and for late gene expression. J Virol 57, 833-8.
Whyte, P., Buchkovich, K. J., Horowitz, J. M., Friend, S. H., Raybuck, M., Weinberg, R. A., and Harlow, E. (1988). Association between an oncogene and an anti-oncogene: the adenovirus E1A proteins bind to the retinoblastoma gene product. Nature 334, 124-9.
Wold, W. S. M., Tollefson, A. E., and Hermiston, T. W. (1995). E3 transcription unit of adenovirus. In The Molecular Repertoire of Adenoviruses. Current Topics in Microbiology and Immunology, vol. 199/I, W. Doerfler and P. Böhm, eds.: Springer-Verlag, Berlin.), pp. 237-274.
Wu, J. Y., and Maniatis, T. (1993). Specific interactions between proteins implicated in splice site selection and regulated alternative splicing. Cell 75, 1061-70.
- 54 - Wu, S., Romfo, C. M., Nilsen, T. W., and Green, M. R. (1999). Functional recognition of the 3' splice site AG by the splicing factor U2AF35. Nature 402, 832-5.
Wyatt, J. R., Sontheimer, E. J., and Steitz, J. A. (1992). Site-specific cross-linking of mammalian U5 snRNP to the 5' splice site before the first step of pre-mRNA splicing. Genes Dev 6, 2542-53.
Xiao, S. H., and Manley, J. L. (1997). Phosphorylation of the ASF/SF2 RS domain affects both protein-protein and protein-RNA interactions and is necessary for splicing. Genes Dev 11, 334-44.
Xiao, S. H., and Manley, J. L. (1998). Phosphorylation-dephosphorylation differentially affects activities of splicing factor ASF/SF2. EMBO J 17, 6359-67.
Yuryev, A., Patturajan, M., Litingtung, Y., Joshi, R. V., Gentile, C., Gebara, M., and Corden, J. L. (1996). The C-terminal domain of the largest subunit of RNA polymerase II interacts with a novel set of serine/arginine-rich proteins. Proc Natl Acad Sci U S A 93, 6975- 80.
Zahler, A. M., Lane, W. S., Stolk, J. A., and Roth, M. B. (1992). SR proteins: a conserved family of pre-mRNA splicing factors. Genes Dev 6, 837-47.
Zahler, A. M., Neugebauer, K. M., Lane, W. S., and Roth, M. B. (1993). Distinct functions of SR proteins in alternative pre-mRNA splicing. Science 260, 219-22.
Zahler, A. M., and Roth, M. B. (1995). Distinct functions of SR proteins in recruitment of U1 small nuclear ribonucleoprotein to alternative 5' splice sites. Proc Natl Acad Sci U S A 92, 2642-6.
Zamore, P. D., and Green, M. R. (1991). Biochemical characterization of U2 snRNP auxiliary factor: an essential pre-mRNA splicing factor with a novel intranuclear distribution. EMBO J 10, 207-14.
Zamore, P. D., and Green, M. R. (1989). Identification, purification, and biochemical characterization of U2 small nuclear ribonucleoprotein auxiliary factor. Proc Natl Acad Sci U S A 86, 9243-7.
Zamore, P. D., Patton, J. G., and Green, M. R. (1992). Cloning and domain structure of the mammalian splicing factor U2AF. Nature 355, 609-14.
Zhang, M., Zamore, P. D., Carmo-Fonseca, M., Lamond, A. I., and Green, M. R. (1992). Cloning and intracellular localization of the U2 small nuclear ribonucleoprotein auxiliary factor small subunit. Proc Natl Acad Sci U S A 89, 8769-73.
Zhang, W. J., and Wu, J. Y. (1998). Sip1, a novel RS domain-containing protein essential for pre-mRNA splicing. Mol Cell Biol 18, 676-84.
Zorio, D. A., and Blumenthal, T. (1999). Both subunits of U2AF recognize the 3' splice site in Caenorhabditis elegans. Nature 402, 835-8.
- 55 -