High Throughput Assay Identifies Glafenine As a Corrector for the Folding Defect in Corneal Dystrophy–Causing Mutants of SLC4A
Total Page：16
File Type：pdf, Size：1020Kb
Cornea High Throughput Assay Identifies Glafenine as a Corrector for the Folding Defect in Corneal Dystrophy–Causing Mutants of SLC4A11 Anthony M. Chiu,1 Jake J. Mandziuk,1,2 Sampath K. Loganathan,1,2 Kumari Alka,1,2 and Joseph R. Casey1,2 1Department of Physiology, University of Alberta, Edmonton, Alberta, Canada 2Department of Biochemistry, University of Alberta, Edmonton, Alberta, Canada Correspondence: Joseph R. Casey, PURPOSE. Protein misfolding, causing retention of nascent protein in the endoplasmic Department of Biochemistry, Uni- reticulum (ER), is the most common molecular phenotype for disease alleles of membrane versity of Alberta, Edmonton, AB, proteins. Strategies are needed to identify therapeutics able to correct such folding/trafficking Canada T6G 2H7; defects. Mutations of SLC4A11, a plasma membrane transport protein of the human corneal [email protected]. endothelial cell layer, cause cases of congenital hereditary endothelial dystrophy, Harboyan Submitted: July 27, 2015 syndrome, and Fuchs’ endothelial corneal dystrophy. Most SLC4A11 mutations induce Accepted: October 30, 2015 SLC4A11 misfolding and retention in the ER. Citation: Chiu AM, Mandziuk JJ, Loga- METHODS. An assay amenable to high-throughput screening was developed to quantify nathan SK, Alka K, Casey JR. High SLC4A11 at the plasma membrane, enabling a search for potential traffic-correcting small throughput assay identifies glafenine as a corrector for the folding defect in molecules. The assay was validated by comparing cell surface abundance of SLC4A11 mutants corneal dystrophy–causing mutants of measured in the assay to observations from confocal immunofluorescence and values from SLC4A11. Invest Ophthalmol Vis Sci. cell surface biotinylation. Functionality of mutant proteins was assessed, using a confocal 2015;56:7739–7753. DOI:10.1167/ microscopic green fluorescent protein (GFP) water flux assay where relative rates of cell iovs.15-17802 swelling are compared. RESULTS. A small-scale screen revealed that the nonsteroidal anti-inflammatory drugs (NSAIDs), glafenine, ibuprofen, and acetylsalicylic acid dissolved in 0.2% dimethyl sulfoxide (DMSO), partially rescued the trafficking defect in some SLC4A11 mutants, expressed in HEK293 cells. These SLC4A11 mutants retained functional activity when rescued to the plasma membrane by glafenine treatment. Glafenine was effective with an EC50 of 1.5 6 0.7 lM. CONCLUSIONS. These data suggest that glafenine, and perhaps other NSAIDs, hold potential as therapeutics for misfolded membrane proteins, like SLC4A11. The high throughput approach described here can be modified to identify correctors of other misfolded plasma membrane proteins that cause eye disease. Keywords: SLC4A11, corneal dystrophy, drug screening, CHED, Fuchs’ endothelial corneal dystrophy mong genetic diseases of membrane proteins, the most temperature-sensitive folding defect.26 Moreover, the rescued A common phenotype is protein ER-retention, secondary to protein displayed functional activity upon rescue,27 suggesting protein misfolding. A classic example is the most common that rescue from the ER is a promising therapeutic approach. cystic fibrosis allele, CFTR F508del, which impairs the folding SLC4A11 is an attractive therapeutic target as its mutations and trafficking of CFTR protein, resulting in endoplasmic cause corneal defects leading to blindness. The relative 1,2 reticulum (ER)-retention. Potential small molecules correct- accessibility of the cornea opens the possibility to apply small ing F508del folding have been identified that rescue F508del molecule-folding correctors as eye drops, meaning that the 3–5 CFTR to the plasma membrane, including one that has treatment approach could be relatively facile and localized to entered recent clinical use.6,7 the site of disease. Small molecule-folding correctors are thus proven to be In human cornea, high solute concentration of the stromal effective therapeutics for ER-retained membrane proteins. Development of assays amenable to high throughput drug layer creates an osmotic gradient that draws water from the 28 screening is the essential first step toward identification of aqueous humor. This osmotic gradient is opposed by water folding corrector drugs. Here we have targeted for folding reabsorption into the aqueous humor by the endothelial correction an integral membrane protein, SLC4A11, whose monolayer. Posterior endothelial corneal dystrophies develop mutations cause ER-retention.8,9 Approximately 60 disease- when this reabsorption is interrupted,28 giving rise to an causing point mutations of human SLC4A11 have been accumulation of fluid in the stroma. The edematous corneas identified.8–25 Some ER-retained mutants of SLC4A11 could be develop a ground-glass appearance, leading to vision loss and rescued to the cell surface in cells cultured at 308C, suggesting a eventual blindness. Copyright 2015 The Association for Research in Vision and Ophthalmology, Inc. iovs.arvojournals.org j ISSN: 1552-5783 7739 Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7740 Congenital hereditary endothelial dystrophy (CHED; Men- calf serum (CS), penicillin-streptomycin-glutamine, Geneticin, delian Inheritance in Man [MIM] 217700),29 Harboyan and Amplex UltraRed Reagent were from Life Technologies syndrome (HS; MIM 217400),30 and Fuchs’ endothelial corneal (Carlsbad, CA, USA). Cell culture dishes were from Sarstedt dystrophy (FECD; MIM 613268)31 are three forms of genetic (Montreal, QC, Canada). Complete protease inhibitor tablets corneal blindness that arise in some cases from mutations in were from Roche Applied Science (Indianapolis, IN, USA). the integral membrane protein, SLC4A11.8,15,20 Harboyan Immobilized Streptavidin Sepharose resin, sulfo-NHS-SS-biotin, syndrome patients present with sensorineuronal hearing loss glass coverslips and 10% formalin in phosphate buffer were in addition to progressive blindness.28 Congenital hereditary from Thermo Fisher Scientific (Ottawa, ON, Canada). Poly-L- endothelial dystrophy and HS are recessive, whereas FECD is lysine was from Sigma-Aldrich (Oakville, ON, Canada). dominant with a 4% prevalence in North America.28 Fuchs’ Hydrogen peroxide was from Ricca Chemical Company endothelial corneal dystrophy has also been linked to (Arlington, TX, USA). Immobilon-P PVDF was from Millipore mutations of the COL8A2,32 LOXHD1,33 ZEB1,34 and the (Billerica, MA, USA). Monoclonal antibodies against HA transcriptional regulator, TCF4.35,36 epitope (clone 16B12) and Glyceraldehyde 3-phosphate SLC4A11 is a member of the SLC4 family of bicarbonate dehydrogenase (GAPDH) were from Covance (Princeton, NJ, transporters, but does not transport bicarbonate.37 Plant USA) and Santa Cruz Biotechnology (Santa Cruz, CA, USA), SLC4A11 orthologs are established borate transporters.38 respectively. Horseradish peroxidase-conjugated sheep anti- Human SLC4A11 was originally reported to be a Naþ-coupled mouse immunoglobulin was from GE Healthcare Bio-Sciences borate transporter,37 but other groups have not been able to Corp. (Piscataway, NJ, USA). Luminata TM Crescendo Western replicate this finding.39,40 Instead, SLC4A11 has been found to HRP Substrate chemiluminescence reagent was from Milli- þ À 41 þ 42 facilitate Na /OH transport, NH3/H cotransport, and pore. All compounds for screening were from Sigma-Aldrich, electrogenic Hþ (OHÀ) permeation.43 Human SLC4A11 medi- Thermo Fisher Scientific, or Cayman Chemical (Ann Arbor, MI, ates water movement when expressed in Xenopus laevis USA). oocytes and HEK293 cells,44 which makes it the first identified water transporter that is not a member of the major intrinsic DNA Constructs protein family. Depletion of SLC4A11 leads to degeneration and apoptosis The eukaryotic expression construct (pSKL1) for splicing of corneal endothelial cells.41 Mutant SLC4A11 does not induce variant 2 of human SLC4A11, encoding an 891 amino acid apoptosis in HEK293 cells on its own.27 One report found that protein (NCBI reference: NG_017072.1) with an N-terminal 27 HEK293 cells transfected with mutant SLC4A11 decrease Hemagglutinin tag (HA-tagged) was described previously. expression of antioxidant proteins, rendering the cells more Double HA-epitope tags were inserted at cDNA positions susceptible to oxidative stress.45 Finally, three independent encoding amino acid 530 or 564, using untagged pSKL1 as À/À mouse lines manifest varying degrees of corneal template. HA530-SLC4A11 was constructed, using the forward slc4a11 0 0 0 abnormalities,46–48 indicating that loss of SLC4A11 function primer 5 -ggtaaagtccacctgctgtc-3 and the reverse primer 5 - gctgacaagggatgaagtagcgtaatctggaacatcgtatgggtaccctccgccagcgt causes corneal dysfunction. 0 Congenital hereditary endothelial dystrophy, HS, and FECD aatctggaacatcgtatgggtacctttttgtgtgatagtcgtcc-3 , which contains differ in their genetics of inheritance and age of onset, which in the double HA-epitope tag (underlined). The resulting PCR 26 product was used as a mega-primer in conjunction with the part is explained by SLC4A11 dimerization. Congenital 0 0 hereditary endothelial dystrophy and HS show autosomal reverse primer 5 -agcagcaacagggacagg-3 and subcloned with recessive inheritance with symptom onset in the first decade pSKL1 using KpnI and BsrFI restriction sites. HA564-SLC4A11 20,28 was constructed using the same strategy but replaced the of life. SLC4A11 CHED mutant/wildtype (WT) heterodi- 0 mers traffic to the cell surface, enabling sufficient traffic