High Throughput Assay Identifies Glafenine As a Corrector for the Folding Defect in Corneal Dystrophy–Causing Mutants of SLC4A

Home , Glafenine

Cornea High Throughput Assay Identiﬁes Glafenine as a Corrector for the Folding Defect in Corneal Dystrophy–Causing Mutants of SLC4A11

Anthony M. Chiu,1 Jake J. Mandziuk,1,2 Sampath K. Loganathan,1,2 Kumari Alka,1,2 and Joseph R. Casey1,2

1Department of Physiology, University of Alberta, Edmonton, Alberta, Canada 2Department of Biochemistry, University of Alberta, Edmonton, Alberta, Canada

Correspondence: Joseph R. Casey, PURPOSE. Protein misfolding, causing retention of nascent protein in the endoplasmic Department of Biochemistry, Uni- reticulum (ER), is the most common molecular phenotype for disease alleles of membrane versity of Alberta, Edmonton, AB, proteins. Strategies are needed to identify therapeutics able to correct such folding/trafficking Canada T6G 2H7; defects. Mutations of SLC4A11, a plasma membrane transport protein of the human corneal [email protected]. endothelial cell layer, cause cases of congenital hereditary endothelial dystrophy, Harboyan Submitted: July 27, 2015 syndrome, and Fuchs’ endothelial corneal dystrophy. Most SLC4A11 mutations induce Accepted: October 30, 2015 SLC4A11 misfolding and retention in the ER. Citation: Chiu AM, Mandziuk JJ, Loga- METHODS. An assay amenable to high-throughput screening was developed to quantify nathan SK, Alka K, Casey JR. High SLC4A11 at the plasma membrane, enabling a search for potential traffic-correcting small throughput assay identifies glafenine as a corrector for the folding defect in molecules. The assay was validated by comparing cell surface abundance of SLC4A11 mutants corneal dystrophy–causing mutants of measured in the assay to observations from confocal immunofluorescence and values from SLC4A11. Invest Ophthalmol Vis Sci. cell surface biotinylation. Functionality of mutant proteins was assessed, using a confocal 2015;56:7739–7753. DOI:10.1167/ microscopic green fluorescent protein (GFP) water flux assay where relative rates of cell iovs.15-17802 swelling are compared.

RESULTS. A small-scale screen revealed that the nonsteroidal anti-inflammatory drugs (NSAIDs), glafenine, ibuprofen, and acetylsalicylic acid dissolved in 0.2% dimethyl sulfoxide (DMSO), partially rescued the trafficking defect in some SLC4A11 mutants, expressed in HEK293 cells. These SLC4A11 mutants retained functional activity when rescued to the plasma membrane by glafenine treatment. Glafenine was effective with an EC50 of 1.5 6 0.7 lM. CONCLUSIONS. These data suggest that glafenine, and perhaps other NSAIDs, hold potential as therapeutics for misfolded membrane proteins, like SLC4A11. The high throughput approach described here can be modified to identify correctors of other misfolded plasma membrane proteins that cause eye disease. Keywords: SLC4A11, corneal dystrophy, drug screening, CHED, Fuchs’ endothelial corneal dystrophy

mong genetic diseases of membrane proteins, the most temperature-sensitive folding defect.26 Moreover, the rescued A common phenotype is protein ER-retention, secondary to protein displayed functional activity upon rescue,27 suggesting protein misfolding. A classic example is the most common that rescue from the ER is a promising therapeutic approach. cystic fibrosis allele, CFTR F508del, which impairs the folding SLC4A11 is an attractive therapeutic target as its mutations and trafficking of CFTR protein, resulting in endoplasmic cause corneal defects leading to blindness. The relative 1,2 reticulum (ER)-retention. Potential small molecules correct- accessibility of the cornea opens the possibility to apply small ing F508del folding have been identified that rescue F508del molecule-folding correctors as eye drops, meaning that the 3–5 CFTR to the plasma membrane, including one that has treatment approach could be relatively facile and localized to entered recent clinical use.6,7 the site of disease. Small molecule-folding correctors are thus proven to be In human cornea, high solute concentration of the stromal effective therapeutics for ER-retained membrane proteins. Development of assays amenable to high throughput drug layer creates an osmotic gradient that draws water from the 28 screening is the essential first step toward identification of aqueous humor. This osmotic gradient is opposed by water folding corrector drugs. Here we have targeted for folding reabsorption into the aqueous humor by the endothelial correction an integral membrane protein, SLC4A11, whose monolayer. Posterior endothelial corneal dystrophies develop mutations cause ER-retention.8,9 Approximately 60 disease- when this reabsorption is interrupted,28 giving rise to an causing point mutations of human SLC4A11 have been accumulation of fluid in the stroma. The edematous corneas identified.8–25 Some ER-retained mutants of SLC4A11 could be develop a ground-glass appearance, leading to vision loss and rescued to the cell surface in cells cultured at 308C, suggesting a eventual blindness.

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7740

Congenital hereditary endothelial dystrophy (CHED; Men- calf serum (CS), penicillin-streptomycin-glutamine, Geneticin, delian Inheritance in Man [MIM] 217700),29 Harboyan and Amplex UltraRed Reagent were from Life Technologies syndrome (HS; MIM 217400),30 and Fuchs’ endothelial corneal (Carlsbad, CA, USA). Cell culture dishes were from Sarstedt dystrophy (FECD; MIM 613268)31 are three forms of genetic (Montreal, QC, Canada). Complete protease inhibitor tablets corneal blindness that arise in some cases from mutations in were from Roche Applied Science (Indianapolis, IN, USA). the integral membrane protein, SLC4A11.8,15,20 Harboyan Immobilized Streptavidin Sepharose resin, sulfo-NHS-SS-biotin, syndrome patients present with sensorineuronal hearing loss glass coverslips and 10% formalin in phosphate buffer were in addition to progressive blindness.28 Congenital hereditary from Thermo Fisher Scientific (Ottawa, ON, Canada). Poly-L- endothelial dystrophy and HS are recessive, whereas FECD is lysine was from Sigma-Aldrich (Oakville, ON, Canada). dominant with a 4% prevalence in North America.28 Fuchs’ Hydrogen peroxide was from Ricca Chemical Company endothelial corneal dystrophy has also been linked to (Arlington, TX, USA). Immobilon-P PVDF was from Millipore mutations of the COL8A2,32 LOXHD1,33 ZEB1,34 and the (Billerica, MA, USA). Monoclonal antibodies against HA transcriptional regulator, TCF4.35,36 epitope (clone 16B12) and Glyceraldehyde 3-phosphate SLC4A11 is a member of the SLC4 family of bicarbonate dehydrogenase (GAPDH) were from Covance (Princeton, NJ, transporters, but does not transport bicarbonate.37 Plant USA) and Santa Cruz Biotechnology (Santa Cruz, CA, USA), SLC4A11 orthologs are established borate transporters.38 respectively. Horseradish peroxidase-conjugated sheep anti- Human SLC4A11 was originally reported to be a Naþ-coupled mouse immunoglobulin was from GE Healthcare Bio-Sciences borate transporter,37 but other groups have not been able to Corp. (Piscataway, NJ, USA). Luminata TM Crescendo Western replicate this finding.39,40 Instead, SLC4A11 has been found to HRP Substrate chemiluminescence reagent was from Milli- þ 41 þ 42 facilitate Na /OH transport, NH3/H cotransport, and pore. All compounds for screening were from Sigma-Aldrich, electrogenic Hþ (OH) permeation.43 Human SLC4A11 medi- Thermo Fisher Scientific, or Cayman Chemical (Ann Arbor, MI, ates water movement when expressed in Xenopus laevis USA). oocytes and HEK293 cells,44 which makes it the first identified water transporter that is not a member of the major intrinsic DNA Constructs protein family. Depletion of SLC4A11 leads to degeneration and apoptosis The eukaryotic expression construct (pSKL1) for splicing of corneal endothelial cells.41 Mutant SLC4A11 does not induce variant 2 of human SLC4A11, encoding an 891 amino acid apoptosis in HEK293 cells on its own.27 One report found that protein (NCBI reference: NG_017072.1) with an N-terminal 27 HEK293 cells transfected with mutant SLC4A11 decrease Hemagglutinin tag (HA-tagged) was described previously. expression of antioxidant proteins, rendering the cells more Double HA-epitope tags were inserted at cDNA positions susceptible to oxidative stress.45 Finally, three independent encoding amino acid 530 or 564, using untagged pSKL1 as / mouse lines manifest varying degrees of corneal template. HA530-SLC4A11 was constructed, using the forward slc4a11 0 0 0 abnormalities,46–48 indicating that loss of SLC4A11 function primer 5 -ggtaaagtccacctgctgtc-3 and the reverse primer 5 - gctgacaagggatgaagtagcgtaatctggaacatcgtatgggtaccctccgccagcgt causes corneal dysfunction. 0 Congenital hereditary endothelial dystrophy, HS, and FECD aatctggaacatcgtatgggtacctttttgtgtgatagtcgtcc-3 , which contains differ in their genetics of inheritance and age of onset, which in the double HA-epitope tag (underlined). The resulting PCR 26 product was used as a mega-primer in conjunction with the part is explained by SLC4A11 dimerization. Congenital 0 0 hereditary endothelial dystrophy and HS show autosomal reverse primer 5 -agcagcaacagggacagg-3 and subcloned with recessive inheritance with symptom onset in the first decade pSKL1 using KpnI and BsrFI restriction sites. HA564-SLC4A11 20,28 was constructed using the same strategy but replaced the of life. SLC4A11 CHED mutant/wildtype (WT) heterodi- 0 mers traffic to the cell surface, enabling sufficient traffic of WT initial reverse primer with 5 -cctgagtgtgtggccgaagcgtaatctggaac atcgtatgggtaccctccgccagcgtaatctggaacatcgtatgggtagggcagctccg protein to the cell surface to prevent disease symptoms in 0 carriers.26 The recessive ER-retention phenotype of CHED tggggct-3 containing the double HA-epitope tag (underlined). SLC4A11 explains this disease’s inheritance. Individuals with A shortened version of HA564-SLC4A11 removing the first FECD do not experience symptoms until the fourth or fifth 35 amino acids of the protein, resulting in an expression decade of life.28 Fuchs’ endothelial corneal dystrophy construct (pAMC1) encoding an 856 amino acid protein, was SLC4A11/WT heterodimers do not traffic to the cell surface, created using the Q5 site directed mutagenesis kit. All indicating that the FECD phenotype is dominant over WT.26 subsequent modifications to pAMC1 were carried out with In this study, we developed and tested an assay amenable to the Q5 Kit. For ease of reference, numbering conventions for high throughput screening to identify small molecule correc- point mutations and HA tags are the same as in the 891 amino tors of the mutant SLC4A11 cell surface trafficking defect. The acid protein. Expression constructs for the point mutations assay approach was modified from one used to identify E143K (c.427G>A [p.Glu143Lys]), A269V (c.806>T correctors of F508del CFTR folding.49,50 To further assess the [p.Ala269Val]) and G709E (c.2126G>A [p.Gly709Glu]) were ability of the technique to identify SLC4A11 therapeutics, we created, using HA tagged pAMC1 as template. Primers are performed a small scale screen of potential correctors. One listed in Supplementary Table S1. Expression constructs were candidate compound, glafenine, was characterized and found confirmed by DNA sequencing (Institute of Biomolecular to show a promising ability to rescue SLC4A11 cell surface Design, Department of Biochemistry, University of Alberta, Edmonton, AB, Canada). functional activity. Tissue Culture MATERIALS AND METHODS HEK293 cells were grown in complete DMEM (cDMEM, DMEM Materials supplemented with 5% [vol/vol] FBS, 5% [vol/vol] CS, and 1% [vol/vol] penicillin-streptomycin-glutamine) at 378C in an air/ Oligonucleotides were from Integrated DNA Technologies 5% CO2 environment. HEK293 cells were transiently transfect- (Coralville, IA, USA). Q5 Site Directed Mutagenesis Kit was ed, using the calcium phosphate method.51 All experiments from New England Biolabs (Ipswich, MA, USA). Dulbecco’s using transiently transfected cells were carried out 48 hours modified Eagle’s medium (DMEM), fetal bovine serum (FBS), post transfection. For experiments requiring treatment of cells,

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7741

compounds made up in cDMEM and dimethyl sulfoxide well PBS. Amplex UltraRed stock solution was made to 10 mM (DMSO) solution were added 16 to 24 hours before cell in DMSO and frozen at 208C. Amplex Red working solution harvesting. To make stably transfected cell lines, HEK293 cells (200 lL/well 50 lM Amplex UltraRed, 0.0068% H2O2 in PBS) were transfected and grown in cDMEM/G (cDMEM, containing was added. Plates were placed on ice and covered with 0.75 mg/mL geneticin). Cell lines were monoclonally selected. aluminum foil for 10 minutes after which, 150 lL of the resulting solution was collected and dispensed into black Cell Lysis opaque 96 well plates (Greiner CELLSTAR; Sigma-Aldrich). After a 5-second shaking step, fluorescence of the solution was HEK293 cells were solubilized in immunoprecipitation buffer read in a SynergyMX Plate Reader (BioTek, Winooski, VT, USA) (IPB; 1% [vol/vol] IGEPAL CA-630, 5 mM EDTA, 150 mM NaCl, with excitation wavelength 530 nm and emission wavelength 0.5% sodium deoxycholate [wt/vol], 10 mM Tris-HCl, pH 7.5; 590 nm. Roche Applied Science, Laval, QC, Canada), containing complete, EDTA-free, protease inhibitors (Roche Applied Immunoblotting Science) and incubated for 20 minutes on ice. Samples were centrifuged at 13,400g for 10 minutes and the resulting Cell lysates were prepared in 32 SDS-PAGE sample buffer (10% supernatant was stored at 208C. [vol/vol] glycerol, 2% [wt/vol] SDS, 0.5% [wt/vol] bromophe- nol blue, 75 mM Tris, pH 6.8). Before electrophoresis, lysates Poly-L-Lysine Coating of Culture Dishes and were made to 1% (vol/vol) 2-mercaptoethanol and heated for 5 Coverslips minutes at 658C. Samples were resolved by SDS-PAGE on 7.5% (wt/vol) acrylamide gels.52 Proteins were electrotransferred Ninety-six well plates or 25-mm round glass coverslips onto Immobilon-P PVDF membranes (Millipore). Mouse anti- (Thermo Fisher Scientific) in a 100-mm dish were coated with HA, or mouse anti-GAPDH were used at 1:2000 or 1:4000 poly-L-lysine, using sterile solutions in a cell-culture hood. dilution, respectively, in TBS-TM (5% skim milk powder in TBS- NaOH (150 lL per well of 5 M) was added to 96-well plates, T: 0.1% [vol/vol] Tween-20, 0.15 M NaCl, 50 mM Tris, pH 7.5). which were incubated for 15 minutes. NaOH was then After incubation for one hour at 228C with sheep anti-mouse removed and wells were washed with H2O. Ethanol (150 lL HRP-conjugated secondary antibody at 1:4000 dilution in per well of 95%) was added for 5 minutes. Ethanol was TBSTM, immunoblots were developed, using Luminata TM removed and wells were rinsed with H2O. Wells were washed Crescendo Western HRP Substrate chemiluminescence reagent twice with PBS (140 mM NaCl, 3 mM KCl, 6.5 mM Na2HPO4, and visualized, using an ImageQuant LAS 4000 (GE Healthcare 1.5 mM KH2PO4, pH 7.4) and 100 lL per well of 1 mg/mL poly- Life Sciences, purchased from Cedarlane Corporation, Burling- L-lysine in PBS was added for 15 minutes. Plates with poly-L- ton, ON, Canada). Densitometry was performed, using Image- lysine solution remaining in wells were left overnight under Quant TL 1D software, v8.1 (GE Healthcare Life Sciences). ultraviolet light. Remaining solution was removed the next day and the plates were stored at 228C. Before use, plates were Cell Surface Biotinylation Assay rinsed with PBS to remove dried salt. Cells were rinsed with PBS and washed with 48C borate buffer Amplex Red High Throughput Assay (154 mM NaCl, 7.2 mM KCl, 1.8 mM CaCl2, 10 mM boric acid, pH 9.0). Cells were then incubated with Sulpho-NHS-SS biotin This assay is a modified version of one previously de- (0.5 mg/mL in borate buffer) for 30 minutes on ice. Cells were scribed.49,50 Stably transfected cells were grown in T75 flasks incubated with quenching buffer (192 mM glycine, 25 mM to a confluence of approximately 90%. Growth medium was Tris, pH 8.3) three times for 5 minutes. Cells were solubilized removed and the cells were rinsed with PBS. Cells were in 500 lL IPB buffer, containing protease inhibitors for 20 removed from the flask using 5 mL of 0.5 mM EDTA in PBS per minutes on ice. Samples were centrifuged at 13,400g for 10 flask and transferred to a 15-mL conical tube. Cells were minutes at 228C. Supernatant was recovered and split into two centrifuged at 1000g for 5 minutes. Supernatant was removed equal fractions. One fraction was reserved for later SDS-PAGE and the cell pellet resuspended in 5 mL cDMEM/G. Cells were analysis (total protein, T). Immobilized streptavidin-Sepharose counted with a hemocytometer and plated onto a poly-L-lysine (100 lL of 50% suspension) was added to the other fraction of coated 96 well plate at a cell density of 2.2 3 105 cells per well lysate and placed on a rotator and left to incubate at 48C in 150 lL with cDMEM/G/well and the cells were placed in a overnight. After incubation, the sample was centrifuged at 378C incubator for 3 hours to allow the cells to settle on the 9800g for 2 minutes and the supernatant collected (unbound plate. After 3 hours, cells were treated with compounds for protein, U). U and T fractions were subjected to SDS-PAGE, screening and returned to the 378C incubator for 18 to 24 immunoblotting, and densitometry as described. Most mem- hours. Concentrated stocks of compounds for testing were branes proteins, including SLC4A11, are very vulnerable to added to each well of the plate in 50 lL cDMEM/G, aggregation when heated above 658C. As a consequence, we containing 0.4 or 0.8% (vol/vol) DMSO, to yield appropriate avoid the process of elution from streptavidin Sepharose by final compound concentrations in 0.1 or 0.2% DMSO. measuring the difference between total and unbound. The Using a multichannel pipetter, cells were rinsed with 200 formula (U-T)/T 3 100% was used to determine percentage of lL/well of PBSCM (PBS, containing 0.1 mM CaCl2 and 1 mM protein biotinylated. MgCl2). Cells were then fixed with 10% formalin in phosphate buffer for 10 minutes at 228C and then quenched with 150 lL/ Confocal Immunofluorescence well of 50 mM NH4Cl in PBS for 10 minutes at 228C. Cells were blocked with 150 lL/well of PBS-B (1% [wt/vol] BSA in PBS) for HEK293 cells, grown on poly-L-lysine coated 18-mm circular 5 minutes at 228C and then incubated with monoclonal mouse glass cover slips placed at the bottom of a 100-mm tissue anti-HA antibody (16B12) at 1:1000 dilution in PBS-B for 1 hour culture dish, were transiently transfected with cDNA encoding at 228C. Cells were rinsed three times with 200 lL/well PBS SLC4A11 WT (N-terminally HA- tagged or HA 564-SLC4A11), and incubated with sheep anti-mouse IgG conjugated to indicated mutants (in HA 564-SLC4A11 background), or horseradish peroxidase (NXA931) at 1:1500 dilution in PBS-B pcDNA 3.1(). Glafenine treatment was carried out 24 hours for 1 hour at 228C. Cells were rinsed three times with 200 lL/ post transfection, as described earlier. Forty-eight hours later,

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7742

cells were washed in PBS, fixed with 4% paraformaldehyde in software (Graphpad v5; San Diego, CA, USA). Groups were PBS for 10 minutes, followed by a quenching step with 100 compared with 1-way ANOVA and unpaired t-test with P < mM glycine in PBS for 5 minutes at 208C. Where indicated, 0.05 considered significant. cells were permeabilized with 0.2% Triton X-100 in PBS (15 minutes at 208C). After three 5 minutes washes with PBS, nonspecific sites were blocked with 1% BSA in PBS for 30 RESULTS minutes. Cells were incubated with polyclonal rabbit anti-HA (1:500; sc-805; Santa Cruz Biotechnology) or monoclonal Amplex Red High Throughput Assay of Cell mouse anti-GAPDH (1:500; sc-47724; Santa Cruz Biotechnolo- Surface SLC4A11 Abundance gy) for 1 hour at 208C, washed with PBS (three times, 5 minutes) and, thereafter, incubated with donkey anti-rabbit IgG A chemical therapy to treat corneal endothelial dystrophies conjugated with Alexa Fluor 488 (1:500; 711-545-152; Jackson associated with missense mutations of SLC4A11 requires Immuno Research Laboratories, Inc., West Grove, PA, USA) or rescue of the ER-retained, mutant SLC4A11 protein to the chicken anti-mouse IgG conjugated with Alexa 594 (1:500; plasma membrane. Accurate, high throughput measurement of A21201; Invitrogen) for 1 hour at 208C. Final staining with the level of SLC4A11 at the cell surface is needed to identify suitable chemical correctors. Existing techniques such as cell DAPI was carried in the dark, followed by a washing step with 53 PBS. Coverslips were mounted on a glass microscope slide, surface biotinylation can measure the level of protein at the using Dako fluorescence mounting medium (Mississauga, ON, plasma membrane, but are time and material intensive. We Canada), containing antifading agent and then visualized on developed a high throughput method to identify HA-tagged Zeiss LSM 510 laser scanning confocal microscope, using 603 SLC4A11 at the plasma membrane, which can be applied to objective lens (Toronto, ON, Canada). any epitope-tagged plasma membrane protein. This assay was inspired by an assay to measure movement of CFTR-F508del to the cell surface.50 Osmotically-Driven Water Flux Assay The first step was to insert an epitope tag into an HEK293 cells were grown on poly-L-lysine-coated 25-mm extracellular position, allowing detection of protein at the cell round glass coverslips and cotransfected with cDNA encoding surface in intact cells. Positions for epitope insertion were enhanced green fluorescent protein (GFP; peGFP-C1 vector; selected on the basis of proteolytic accessibility of the Clontech, purchased from Cedarlane Corporation) and pcDNA extracellular loops.54 Double hemagglutinin epitope (HA) tags 3.1 (empty vector) or the indicated SLC4A11 plasmid were inserted into extracellular loop 3, following amino acid constructs in a 1:8 molar ratio. Twenty-four hours post R530 or P564 (Fig. 1A). transfection, cells were treated with 800 lL 67.5 lM glafenine To assess functional activity of the epitope insertion in 2.7% DMSO (vol/vol), resulting in a final concentration of 5 mutants, HEK293 cells were cotransfected with cDNA lM glafenine in 0.2% DMSO (vol/vol). Untreated cells received encoding GFP and cDNA encoding SLC4A11 constructs. Cells DMSO to a final concentration of 0.2%. Forty-eight hours later, were perfused with iso-osmotic medium and then hypo- coverslips were mounted in a 35-mm diameter Attofluor Cell osmotic medium. Green fluorescent protein fluorescence in Chamber (Molecular Probes, Ottawa, ON, Canada) and washed a small region of interest in each cell was monitored as a with PBS. During experiments, the chamber was perfused with measure of cytosolic GFP concentration.44 The rate of isotonic MBSS buffer (90 mM NaCl, 5.4 mM KCl, 0.4 mM fluorescence change, which is a surrogate for cell volume MgCl2, 0.4 mM MgSO4, 3.3 mM NaHCO3, 2 mM CaCl2, 5.5 mM change, was measured and corrected for the rate found in glucose, 100 mM D-mannitol, and 10 mM HEPES, pH7.4, 300 vector-transfected cells (Fig. 1B).44 Water fluxes of cells mOsm/kg) and then with hypotonic (200 mOsm/kg) MOPS expressing WT and the two extracellular loop 3 HA-tagged buffered saline solution (MBSS) buffer, pH 7.4 (same compo- SLC4A11 variants were not significantly different (Fig. 1B, sition as previous but lacking D-mannitol). Solution osmolarity Supplementary Fig. S1). These data reveal that the insertion of was measured using an osmometer (Advance Instruments, Inc., a double HA-tag in the extracellular loop does not alter Norwood, MA, USA). The chamber was mounted on the stage functional activity of the two mutants, indicating that their of a Wave FX spinning disc confocal microscope (Quorum folding is not compromised by epitope tag insertion (WT Technologies, Guelph, ON, Canada), with a Yokogawa CSU10 versus HA530; P ¼ 0.31, WT versus HA564; P ¼ 0.24). Because scanning head (Tokyo, Japan). The microscope has a motorized functional activity was not significantly different in the HA- XY stage with Piezo Focus Drive (MS-4000 XYZ Automated epitope insertion mutants, we arbitrarily chose to perform Stage; ASI, Eugene, OR, USA) and a live cell environment subsequent experiments with HA564-SLC4A11. chamber (Chamlide, Seoul, Korea), set to 248C during the To assess the cellular localization and HA-epitope accessi- duration of the experiment. Acquisition was performed with a bility of HA-tagged SLC4A11, we performed confocal immuno- Hamamatsu C9100–13 Digital Camera (EM-CCD; Chamlide) fluorescence microscopy of transfected HEK293 cells. Cells and a 320 objective during excitation with a laser (Spectral were either permeabilized with Triton X-100, or left intact. N- Applied Research, Richmond Hill, ON, Canada) at 491 nm. terminally HA-tagged SLC4A11 (N-HA-WT) showed a strong Green fluorescent protein fluorescence, collected though a signal in permeabilized, but not in nonpermeabilized cells (Fig. dichroic cube (Quorum Technologies) at wavelengths 520 to 2). This indicates that the SLC4A11 N-terminus and its epitope 540 nm, was acquired at 1 point s1 for 4 minutes. Quantitative tag are cytosolic and inaccessible to antibodies unless cells are image analysis was performed by selecting a region of interest permeabilized. In contrast, cells expressing HA 564-SLC4A11, a for each HEK293 cell with Volocity 6.0 software (PerkinElmer, protein with an HA epitope insertion in extracellular loop 3 Waltham, MA, USA). Following the switch to hypotonic MBSS (Fig.1A),showedstrongsignalwithandwithoutcell buffer, the rate of fluorescence change was determined from permeabilization. This indicates that the HA-epitope is readily the initial 15 seconds of linear fluorescence change. accessible to extracellular antibodies in intact cells. Under permeabilized conditions the level of signal is not appreciably Statistical Analysis higher than without permeabilization, indicating that HA564- SLC4A11 predominantly targets to the cell surface. Finally, as a Values are expressed as mean 6 standard error of measure- control for specificity of the immunolocalization data, un- ment. Statistical analyses were performed, using Prism transfected HEK293 cells were probed with anti-HA and anti-

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7743

FIGURE 1. SLC4A11 topology model and characterization of epitope-tagged SLC4A11. (A) SLC4A11 topology model established by homology to AE1 (SLC4A1), in situ limited proteolysis and immunolocalization of the C-terminus.58 Mutations associated with FECD (blue), CHED2 (red), and HS (orange) are highlighted. Positions of extracellular double HA epitope tag and cytosolic N-terminal HA tags are indicated by arrows at P564 and the N-terminus, respectively. Structures at amino acids 545 and 553 mark glycosylation sites. (B) Osmotically driven water influx activity of HEK293 cells transiently cotransfected with cDNA encoding GFP and WT SLC4A11 and SLC4A11 with double HA tag insertion following H530, or H564, or vector. Green fluorescent protein fluorescence was monitored in a region of interest in cells subjected to a shift to hypo-osmotic medium. The initial rate of fluorescence decrease following shift to hypo-osmotic medium (a surrogate for cell swelling) was measured as the rate of cell swelling. Data were corrected for the rate in vector transfected cells (41% 6 3% relative to noncorrected WT) and normalized to WT SLC4A11. Data represent the mean 6 SEM water flux of three to six independent experiments of 10 to 20 cells per coverslip. N.S., not significant. Unpaired t-test results: WT versus HA 530, P ¼ 0.31; WT versus HA 564, P ¼ 0.24; HA 530 versus HA 564, P ¼ 0.80.

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7744

FIGURE 2. Localization of SLC4A11 variants by confocal immunoﬂuorescence microscopy. Confocal microscopy images of HEK293 cells expressing SLC4A11 tagged with HA at the cytosolic N-terminus (N-HA), or externally double HA tagged (HA 564). SLC4A11 was either WT, or indicated mutants. Nonpermeabilized (left) and permeabilized (right) cells were probed for SLC4A11, using polyclonal rabbit anti-HA antibody. Donkey anti- rabbit IgG conjugated with Alexa Fluor 488 (green) was used as secondary antibody, while nuclei were counterstained with DAPI (blue). Scale bars: 17 lm. Exposure time and gain were constant for all images.

GAPDH antibodies (Supplementary Fig. S2). No signal for anti- permeabilization protocol is effective in revealing cytosolic HA antibody was observed, whereas GAPDH signal was seen protein. Together these data indicate that HA564-SLC4A11 only following cell permeabilization. Thus, the anti-HA provides an appropriate background in which to study antibody speciﬁcally detects HA-tagged SLC4A11 and the SLC4A11 trafﬁcking, using an anti-HA antibody.

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7745

In this high throughput assay (HTA) cells stably expressing SLC4A11 variants are cultured in 96-well dishes. Incubation with anti-HA antibody allows binding of cell surface HA epitopes. The primary antibody is detected by a secondary antibody, conjugated to horse radish peroxidase (HRP). Amplex red reagent in the presence of H2O2 is cleaved by HRP to produce resorufin, a highly fluorescent red compound (Supplementary Fig. S2).55 Red fluorescence is then quantified on a 96-well plate fluorescence reader. We first assessed whether the HTA can differentiate between cell surface and ER-retained SLC4A11. The maximum resorufin fluorescence was found for cells expressing WT SLC4A11 with extracellular HA tag (HA 564), a value that was used to normalize the fluorescence level for the other variants (Fig. 3A). Cells expressing N-terminally HA-tagged WT SLC4A11 had a fluorescence signal of 19% 6 3% of the externally HA-tagged WT (Fig. 3A). Because the HA tag of the N-terminally tagged WT is not present at the cell surface, this represents nonspecific background of the assay. Cells expressing A269V SLC4A11 had fluorescence 62% 6 13% relative to WT. A269V SLC4A11 partially traffics to the plasma membrane at levels approximately 50% of WT.54 Cell expressing E143K and G709E SLC4A11 both had fluorescence 24% 6 3% of WT level, which is indistinguishable from N-terminal HA tag WT, consistent with earlier reports that these mutants are nearly completely ER-retained.9,26,54 To assess the validity of the cell surface processing measurements determined by the HTA, we also quantified the level of cell surface protein, using cell surface biotinylation. In these assays, cells were treated with membrane-impermeant FIGURE 3. Comparison of cell surface SLC4A11 level as measured by biotinylating reagent, and the fraction of biotinylated protein high throughput assay (HTA) and cell surface biotinylation. (A) In the (extracellular-accessible) was determined (Supplementary Fig. HTA protocol, HEK293 cells stably expressing the indicated SLC4A11 S4, Fig. 3B). Cytosolic GAPDH served as a negative control for variants (with an N-terminal cytosolic HA tag (N-HA), or with an the assay and its level of biotinylation was subtracted from the external double HA tag [HA 564]) and processed through the HTA. values for SLC4A11 variants. Relative to externally tagged WT Cells were incubated with amplex red reagent, which in the presence SLC4A11, 190% 6 2%, 54% 6 3%, 0% 6 8%, and 0% 6 7% of HRP/H2O2, is converted to the fluorescent red product, resorufin. Red fluorescence in each well was quantified on a 96-well plate protein was biotinylated for N-terminal tagged WT, A269V, fluorescence reader. Data were normalized to HA 564 WT. *Significant E143K, and G709E SLC4A11, respectively. difference (P < 0.05). Data represent the mean 6 SEM of fluorescence To compare the measurements of surface SLC4A11 deter- relative to HA 564 WT (n ¼ 8 wells). Dashed line indicates the mined by the HTA and cell surface biotinylation, background fluorescence level of cells expressing N-terminally tagged SLC4A11, values were subtracted from the data in each assay. That is, in representing the background level of the assay. (B) Cell surface the HTA (Fig. 3A) fluorescence observed for cells expressing N- biotinylation assay of cells stably expressing the indicated SLC4A11 terminally HA-tagged WT SLC4A11 was subtracted and in cell variants. HEK293 cells were incubated with membrane-impermeant biotinylating reagent. Cell lysates were incubated with streptavidin- surface biotinylation (Fig. 2B), the level of biotinylation of Sepharose to remove the biotinylated proteins. The fraction of cytosolic GAPDH was subtracted. Relative cell surface pro- biotinylated protein, representing cell surface protein, was quantified. cessing values (Figs. 3A, 3B) were compared for the two The level of biotinylation of GAPDH (6% 6 11%), representing the techniques. In each case (each of the extracellular tagged WT, background of the assay, was subtracted from all values. Data represent A269V, E143K, and G709E SLC4A11) the relative cell surface the mean 6 SEM of % total protein biotinylated (n ¼ 3). level obtained for each variant was not significantly different when data from the two methods were compared (not shown). SLC4A11 in the N-terminal HA-tagged WT stable cell line had HEK293 cell lines, stably expressing HA-tagged SLC4A11 significantly higher biotinylation compared with HA 564 WT variants, were established for the amplex red high throughput SLC4A11, suggesting that the extracellular tag affected assay. The first had an N-terminal HA tag (on the cytoplasmic processing efficiency (Fig. 2B). domain), allowing it to be used as a control for detection of As an additional way to assess the validity of the amplex red accessible cytosolic epitopes (Fig. 1A). The second had the high throughput assay data, we performed confocal immuno- double HA-tag following H564, to detect cell surface protein. fluorescence of SLC4A11 mutants, tagged with HA564. The remaining three cell lines express the SLC4A11 disease Confocal immunofluorescence detected G709E-SLC4A11 only alleles A269V (CHED), E143K (CHED), and G709E after cell permeabilization (Fig. 2). This indicates that the (FECD),9,12,14 along with a double HA tag after H564. A269V protein does not process to the cell surface, but rather is was chosen because culture of this mutant in cells at 308C retained intracellularly. In contrast, pericellular (plasma mem- induced partial rescue to the cell surface.54 E143K was chosen brane) A269V-SLC4A11 was detected in nonpermeabilized because dimerization with monomers that traffic to the plasma cells, with additional intracellular signal upon cell permeabi- membrane resulted in a heterodimer at the plasma mem- lization (Fig. 2). This indicates that A269V partially processes to brane.27 These strategies suggest that these proteins have the the cell surface. Interestingly, the confocal immunofluores- potential to be cell-surface rescued by small molecules. G709E cence data align well with results from the amplex red high was chosen as a representative mutation for FECD. throughput assay and cell surface biotinylation (Figs. 3A, 3B).

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7746

FIGURE 4. A small-scale screen of potential SLC4A11 folding corrector compounds. In the HTA assay protocol, cells stably expressing the indicated SLC4A11 mutants were treated with compounds at indicated concentrations for a period of 18 to 24 hours. Assays were carried out in the presence of (A) 0.1% DMSO (except TMAO, 4-PBA, and glycerol, which were screened in the absence of DMSO) or (B) 0.2% DMSO. Red fluorescence arising from amplex red conversion to resorufin, was measured on a 96-well plate reader. Data represent the mean 6 SEM of fluorescence relative to the level found for each untreated variant, (n ¼ 4). *Significant difference (P < 0.05) by 2-tailed unpaired t-tests against the relevant control. ASA, acetylsalicylic acid; Carb, carbamazepine; Geld, geldanamycin.

Together these results indicate that the amplex red HTA acetylsalicylic acid because it is a nonsteroidal anti-inﬂamma- reliably quantiﬁes the fraction of SLC4A11 at the cell surface. tory drug (NSAID) and other NSAIDs rescue some ER-retained proteins to the plasma membrane.56,60,64 To emulate a large Small-Scale Screen of Folding Corrector Drugs scale screen, compounds were initially screened with four replicates on a single plate (Fig. 4). Because this was a small- We next examined the ability of the HTA to identify chemical scale screen, compounds were added manually, using a correctors of mutant SLC4A11 misfolding. We thus carried out multichannel pipetter, whereas a large screen would make a small screen, focused on compounds effective in rescue of use of robotic plating. A269V, E143K, and G709E mutant stable ER-retained CFTR mutants.56–64 Concentrations of each of the cells were treated with each of 11 different small molecules, compounds screened were selected on the basis of the and with solvent carrier (0.1% or 0.2% DMSO; Fig. 3). Dimethyl effective concentrations for CFTR rescue. We chose to test sulfoxide was used at two concentrations because high

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7747

concentrations of DMSO act to assist folding of some misfolded significant difference of biotinylation was found between the proteins.65 We wanted to determine whether there might be a untreated and treated cohorts (Fig. 7, Supplementary Fig. S6). synergistic effect of low concentration DMSO and other small Interestingly, 5 lM glafenine did not significantly alter WT molecules. DMSO at 0.1% and 0.2% did not significantly affect SLC4A11 cell-surface processing. Additionally, E143K and cell surface levels of SLC4A11 mutants, as assessed by the HTA G709E SLC4A11 had respective cell-surface processing of (Figs. 4A, 4B). Similarly, DMSO had no effect on surface 58% 6 11% and 46% 6 14% relative to WT SLC4A11. This is abundance of WT-SLC4A11 at either 0.1 or 0.2% (Supplemen- similar to the cell-surface processing values determined in the tary Fig. S5). HTA in the presence of 10 lM glafenine (39% 6 3% and 34% 6 In this initial screen, results for most compounds clustered 2%, respectively relative to WT; Fig. 5). These data confirm that around 100% of untreated cell surface expression (Fig. 3). Two glafenine in the presence of 0.2% DMSO increased the level of compounds, 4-phenylbutyric acid and glycerol, reduced cell surface processing of three ER-retained SLC4A11 mutants. fluorescent signal developed in the HTA, possibly because of To test further the effect of glafenine on mutant SLC4A11 cytotoxic effects. These compounds were not subjected to cell-surface trafficking, we performed confocal immunofluo- further analysis. Three compounds, glafenine, acetylsalicylic rescence microscopy (Fig. 8). SLC4A11 mutants E143K, A269V acid, and ibuprofen, stood out as leading to mutant SLC4A11 and G709E were all tagged with the HA564 extracellular cell surface abundance approximately 1.5-fold higher than in epitope tag and expressed in HEK293 cells. Without glafenine untreated cells. Reflecting the limitations of this HTA, these treatment, SLC4A11 G709E was not found at the cell surface, compounds did not show significant difference from untreated whereas some A269V and E143K were at the cell surface. controls for each mutant when subjected to screening on a Without glafenine, all three mutants revealed additional single plate. These three compounds were subjected to intracellular-retained SLC4A11 upon permeabilization. The additional intensive screening to determine whether their effect of glafenine was striking in comparing nonpermeabilized effect on cell surface processing was significant (Fig. 5). cells with or without glafenine. Glafenine treatment led to a As measured by the HTA, glafenine (10 lM) in the presence marked increase in cell surface SLC4A11 for cells expressing of 0.2% DMSO significantly increased cell surface abundance of E143K and G709E. The effect was less pronounced for A269V, all three mutants tested, compared with 0.2% DMSO treatment which traffics significantly to the cell surface without (Fig. 5B). Ibuprofen (10 lM) in 0.2% DMSO had a significant glafenine. These confocal immunofluorescence data indicate effect on cell surface abundance only of A269V and E143K that glafenine increases cell surface trafficking of intracellular- SLC4A11. Acetylsalicylic acid (10 lM) in 0.2% DMSO only had a retained SLC4A11 mutants. significant effect on A269V SLC4A11 cell surface level. Most compounds screened had no significant effect on HTA- measured cell surface abundance for any of the mutants (Figs. Glafenine-Rescued Mutant SLC4A11 Retains 4, 5). P values of compound treatments leading to significantly Transport Function different mean fluorescence are listed in Supplementary Tables Glafenine rescued SLC4A11 to the plasma membrane, but the S2 and S3. These results show that the HTA discriminates results have little therapeutic significance unless the rescued between compounds that affect the cell surface level of protein is functional. We thus assessed the effect of glafenine SLC4A11 mutants from those that do not. Because glafenine on osmotically-driven water flux in HEK293 cells expressing treatment gives rise to an increase in relative fluorescence for the three mutants (Fig. 9, Supplementary Fig. S7). A269V, all three of the mutants, we subjected glafenine to additional E143K, and G709E SLC4A11 mutants without glafenine tests. treatment showed a low water flux activity, 16% 6 1%, 13% 6 1%, and 12% 6 1%, relative to WT SLC4A11 respectively. Dose-Response to Glafenine of G709E-SLC4A11 Glafenine treatment induced a significant increase in water Trafficking flux activity for all three mutants (67% 6 8%, 87% 6 6%, and 114% 6 11%, relative to WT SLC4A11, respectively). Glafenine To further probe the effect of glafenine on mutant SLC4A11, did not affect water flux in cells expressing WT SLC4A11, we established the relationship for the compound’s effects. We consistent with the findings of the cell surface biotinylation tested G709E SLC4A11 as this mutant is profoundly affected, assay (Fig. 7), where glafenine treatment did not significantly showing nearly complete ER-retention (Fig. 3). Stable cells affect WT SLC4A11. Furthermore, cells expressing the mutants expressing the G709E mutant were treated with 0-20 lM had their water flux increase to a level not significantly glafenine, and the amount of fluorescence produced in the different to WT SLC4A11. These data indicate that SLC4A11 HTA was measured. The dose-response curve displayed mutants retain functional activity and, if rescued to the plasma classical saturating kinetics, revealing that G709E-SLC4A11 membrane, are as effective as WT SLC4A11 in terms of was rescued with an EC50 of 1.5 6 0.7 lM (Fig. 6). functional activity. Glafenine treatment may represent a feasible pharmacologic therapeutic for some mutations of Effect of Glafenine on SLC4A11 Cell Surface SLC4A11. Trafficking

To assess further the effect of glafenine on mutant SLC4A11, DISCUSSION we measured cell surface processing, using the cell surface biotinylation assay (Fig. 7, Supplementary Fig. S6). For this The goal of this study was to develop a high throughput assay experiment, we used transiently transfected cells rather than (HTA) able to screen for compounds that increase the stable cell lines, to provide an assessment in a different cell processing of ER-retained SLC4A11 mutants to the cell surface. context. Because the effect of glafenine reaches a maximum at The assay, working in a 96-well format, provided reliable approximately 5 lM (Fig. 6), we used this as a ﬁxed measurements of surface abundance of SLC4A11. An initial concentration in subsequent investigations. Transfected cells small screen with potential correcting molecules identiﬁed were treated with or without 5 lM glafenine with 0.2% DMSO glafenine as increasing the level of mutant SLC4A11 at the 24 hours prior to biotinylation. Data were corrected for the plasma membrane. Independent assessment by cell surface background level of biotinylation, represented by the level of biotinylation revealed that glafenine does increase mutant cytosolic GAPDH biotinylation. For all three mutants, a processing to the cell surface. Glafenine increased the water

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7748

FIGURE 5. High-repetition screening of compounds identified in preliminary screen. High throughput assay was used to assess the level of SLC4A11 cell surface abundance in the presence of (A) 0.1% or (B) 0.2% DMSO. Data represent the mean 6 SEM of fluorescence relative to the level found for each untreated variant, (n ¼ 12). *Significant difference (P < 0.05) by t-tests against the relevant control.

flux activity of cells expressing SLC4A11 mutants to levels surface abundance of SLC4A11 variants. We found a similar found in cells expressing WT-SLC4A11. The efficacy of protein biotinylation pattern across the mutant types com- glafenine suggests that corrector drugs with potential efficacy pared with the relative fluorescence from the HTA. Cells that in treating corneal dystrophies caused by SLC4A11 mutants express an extracellularly inaccessible, cytosolic HA tag (N- can be identified, using the HTA described here. Terminal HA Tag WT), or that express extracellularly tagged The data indicate that the HTA provides reliable data, HA-SLC4A11 that is ER-retained (E143K and G709E) produce reflecting the relative cell surface abundance of SLC4A11 approximately 20% fluorescence relative to the external HA variants. Cell surface biotinylation data correlated well with Tag WT. This background fluorescence may arise from non- HTA data, indicating that the HTA represents the relative cell HRP catalyzed amplex red conversion, or reflect some degree

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7749

methods to measure protein abundance at the plasma membrane, including cell surface biotinylation, flow cytometry, or confocal microscopy based immunofluorescence, these are relatively time and material intensive. We developed a simpler assay, including elements of an assay developed to assess F508del CFTR cell-surface processing.49,50 We modified that assay, moving from a 24 well format to 96 wells, enabling higher throughput. To promote cell adhesion during the assay we introduced three modifications: (1) culture to almost 100% confluency, (2) coating plates with poly-L-lysine to promote cell adhesion, and (3) cell fixation, using formalin. We also found that deplating the stable cell lines with trypsin adversely affected our results because of the proteolytic sites located on 54 FIGURE 6. Correction of G709E-SLC4A11 trafficking by glafenine. Cells the extracellular loop where the HA epitope is located. stably expressing G709E-SLC411 were subjected to the HTA protocol Instead, we deplated cells, using 0.5 mM EDTA in PBS. Finally, on 96-well plates in the presence of indicated concentrations of we used a 1% BSA in PBS instead of DMEM-HEPES in immune glafenine and 0.2% DMSO. Red fluorescence arising from amplex red steps of the protocol. Together these modifications provide an conversion to resorufin, was measured in each well. Fluorescence assay amenable to high throughput screening of SLC4A11 values of cells treated with 0 lM glafenine were subtracted from each folding correctors. value and data were normalized to the maximum red fluorescence Assay capacity is a significant issue as we look ahead to observed. Data represent the mean 6 SEM fluorescence (n ¼ 8). EC50 was calculated to be 1.5 6 0.7 lM glafenine. screens of larger compound libraries. We found that at least four replicates in a single dish were needed to produce a reliable result. In a 96-well format, this could translate to 22 of cell lysis, allowing antibody access to intracellular HA- unique conditions per plate, with the positive and negative epitopes. Finally, confocal immunofluorescence data provided controls also performed in four replicates. Although we could additional support for the validity of the HTA: (1) intracellu- detect a difference in fluorescence for cells treated with larly-HA-tagged SLC4A11 was inaccessible to anti-HA antibody, compounds in four replicates, further replicates were needed (2) extracellularly-tagged SLC4A11 (HA 564) was present at the to lessen standard error to produce statistically significant plasma membrane, and (3) the level of immunofluorescence at results. The assay could be further refined by use of larger the surface of cells correlated well with the degree of surface format (e.g., 128 or 256 well) plates. One major limitation of trafficking found in the HTA. the HTA is the skill and reproducibility of the person We were concerned that the epitope insertion required for performing the assay. This limitation could be overcome with the assay might affect SLC4A11 folding. Transport function was robotic automation, especially if larger format plates are used. unaffected by the epitope insertion, as measured in water flux Currently, the only permanent treatment strategy for assays in transiently-transfected cells indicating no effect on corneal endothelial dystrophies is corneal transplant. Corneal cell-surface processing and folding. In contrast, cell surface transplant is complicated by tissue availability, graft rejection, biotinylation of stably-transfected cells suggested a reduced and the high amount of skill and resources required to perform cell-surface processing of the H564 HA insertion mutant, the transplant. Results from the HTA, cell surface biotinylation relative to the N-terminally tagged protein. While this suggests and confocal immunofluorescence were consistent in reveal- that the epitope insertion had an effect, we were reassured ing that glafenine with 0.2% DMSO is a pharmacologic that cell surface biotinylation of H564 HA tagged proteins (Fig. corrector for the trafficking defect of SLC4A11 A269V, 2B) was not different from that reported for untagged E143K, and G709E. Ibuprofen and acetylsalicylic acid also versions.26,54 corrected surface targeting of some SLC4A11 mutants. It Other high throughput assays to detect protein at the cell remains to be determined if other mutations of SLC4A11 will surface have been developed.66–69 Although there are other respond in a similar fashion to these drugs.

FIGURE 7. Effect of glafenine on mutant SLC4A11 cell surface processing efﬁciency. Cells were transiently transfected with vector or cDNA encoding the indicated SLC4A11 type. Twenty-four hours post transfection, cells were treated with 0.2% DMSO ()or5lM glafenine and 0.2% DMSO (þ). Cells were subjected to cell surface biotinylation assays 48 hours post transfection. Samples have been corrected for GAPDH biotinylation which represents the background of the assay. *Signiﬁcant difference (P < 0.05, n ¼ 3–4).

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7750

FIGURE 8. Confocal immunoﬂuorescence microscopic assessment of the effect of glafenine on cell surface trafﬁcking of SLC4A11 mutants. HEK293 cells were transiently transfected with cDNA encoding externally double HA-tagged (HA 564) SLC4A11 mutants (indicated) in a 100-mm dish, containing 18-mm round coverslips. Cells were treated with 5 lM glafenine in 0.2% DMSO 24 hours post transfection, or were untreated. Cells were either permeabilized with Triton X-100, or not, as indicated. Cells were probed for SLC4A11, using polyclonal rabbit anti-HA. Donkey anti-rabbit IgG conjugated with Alexa Fluor 488 (green) was secondary antibody, while nuclei were counterstained with DAPI (blue). Scale bars:17lm. Exposure time and gain were constant for all images.

We decided to further characterize glafenine as it was the only compound effective in rescuing all three SLC4A11 mutants. Glafenine is NSAID, used as an analgesic mainly in Europe in the 1970s. Its use was discontinued because it was implicated in anaphylaxis, gastrointestinal injury and kidney failure.70,71 Glafenine rescued the F508del mutation of CFTR and the G601S mutation of the hERG Kþ channel to the plasma membrane.56,60 While the mechanism of rescue by glafenine is unclear, most NSAIDs act by inhibition of one or both of the cyclooxygenase (COX) isoforms.72,73 Both COX-1 and COX-2 are integral membrane proteins,74 but the role of COX inhibition in the rescue of mutant membrane proteins is unclear. We determined that the EC50 of glafenine in SLC4A11 rescue was 1.5 lM (Fig. 5), but could not find literature identifying the EC50 of glafenine as a COX inhibitor. Clinically, glafenine can achieve plasma concentrations up to 10 lM,60,75 suggesting that the effective concentration we found is in the range that targets COX. FIGURE 9. Effect of glafenine on osmotically-driven water flux by ER- retained mutant SLC4A11. HEK293 cells were transiently cotransfected The initial HTA screen of compounds included the NSAIDs with cDNA encoding external HA 564 epitope-tagged SLC4A11, either acetylsalicylic acid and ibuprofen. When used with 0.2% WT, A269V, E143K, G709E, or vector, along with GFP cDNA. The level DMSO, acetylsalicylic acid had a significant effect on A269V of green florescence was quantified in regions of interest in cells as SLC4A11 (Fig. 4). Ibuprofen with 0.2% DMSO had a significant medium was changed from iso-osmotic to hypo-osmotic. The rate of effect on A269V and E143K mutants (Fig. 4). Ibuprofen is fluorescence change upon switching to hypo-osmotic medium was effective in rescuing F508del CFTR and is proposed to do so measured as a surrogate for the rate of cell swelling. Data were through inhibition of COX-1.64 Knockdown of COX-1 in corrected for rates observed in vector transfected cells and normalized HEK293 cells expressing F508del CFTR rescued the mutant to WT SLC4A11. Data represent the mean 6 SEM of three to five 64 independent experiments of 10 to 20 cells per coverslip. *Significant protein, but COX-2 knockdown did not. Rescue of mutant difference in water flux (P < 0.05). No significant difference compared CFTR, and now SLC4A11, with the use of NSAIDs suggests that with WT SLC4A11 without glafenine treatment. prostaglandin synthesis may play a role in ER-retention of

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7751

mutant membrane proteins. Further probing of this mecha- 6. Tildy BE, Rogers DF. Therapeutic options for hydrating airway nism could lead to a novel treatment strategy for diseases mucus in cystic fibrosis. Pharmacology. 2015;95:117–132. involving ER-retained membrane proteins. 7. Carter S, Kelly S, Caples E, et al. Ivacaftor as salvage therapy in Despite rescue of mutant SLC4A11 to the plasma mem- a patient with cystic fibrosis genotype F508del/R117H/IVS8- brane, these results are only clinically relevant if the mutant 5T. J Cyst Fibros. 2015;14:e4–e5. proteins remain functional once at the plasma membrane. 8. Vithana EN, Morgan P,Sundaresan P,et al. Mutations in sodium- Earlier investigations found that to delay onset of symptoms borate cotransporter SLC4A11 cause recessive congenital associated with corneal dystrophies, 27% of WT SLC4A11 hereditary endothelial dystrophy (CHED2). Nat Genet. 2006; function is required and to completely avoid symptoms, 50% of 38:755–757. WT SLC4A11 function is required.27 Our in vitro investigations 9. Vithana EN, Morgan PE, Ramprasad V, et al. SLC4A11 revealed that the 50% benchmark can be exceeded for all three mutations in Fuchs endothelial corneal dystrophy (FECD). SLC4A11 mutants treated with glafenine (Fig. 7). Treatment Hum Mol Genet. 2008;17:656–666. with glafenine may, thus, represent an effective pharmacologic 10. Desir J, Abramowicz M. Congenital hereditary endothelial therapy. dystrophy with progressive sensorineural deafness (Harboyan This study leads to three major conclusions. First, the HTA syndrome). Orphanet J Rare Dis. 2008;3:28. we developed is an effective and reliable method to determine 11. Puangsricharern V, Yeetong P, Charumalai C, Suphapeetiporn the abundance of SLC4A11 at the plasma membrane. The K, Shotelersuk V. Two novel mutations including a large approach could be modified for application to identify deletion of the SLC4A11 gene causing autosomal recessive correctors of other misfolded membrane proteins. Second, hereditary endothelial dystrophy. Br J Ophthalmol. 2014;98: glafenine in 0.2% (vol/vol) DMSO corrects the trafficking 1460–1462. defect for A269V, E143K, and G709E mutations of SLC4A11. 12. Hemadevi B, Veitia RA, Srinivasan M, et al. Identification of Third, mutant SLC4A11 remains functional once localized to mutations in the SLC4A11 gene in patients with recessive the plasma membrane and this functionality may suffice to congenital hereditary endothelial dystrophy. Arch Ophthal- prevent symptoms of corneal dystrophies. Here, we presented mol. 2008;126:700–708. a paradigm for the high throughput identification and in vitro 13. Jiao X, Sultana A, Garg P, et al. Autosomal recessive corneal testing of potential SLC4A11 folding correctors. These data endothelial dystrophy (CHED2) is associated with mutations in suggest that glafenine is a potential pharmacologic therapeutic SLC4A11. J Med Genet. 2007;44:64–68. for some corneal dystrophy-causing mutants of SLC4A11. 14. Ramprasad VL, Ebenezer ND, Aung T, et al. Novel SLC4A11 mutations in patients with recessive congenital hereditary Acknowledgments endothelial dystrophy (CHED2). Mutation in brief #958. Online. Hum Mutat. 2007;28:522–523. The authors thank Anita Quon for preliminary work on the HTA. 15. Sultana A, Garg P, Ramamurthy B, Vemuganti GK, Kannabiran They also thank Darpan Malhotra for helpful comments on the C. Mutational spectrum of the SLC4A11 gene in autosomal manuscript. recessive congenital hereditary endothelial dystrophy. Mol Vis. Supported by an operating grant from the Canadian Institutes of 2007;13:1327–1332. Health Research (Ottawa, ON, Canada). Supported by summer 16. Park SH, Jeong HJ, Kim M, Kim MS. A novel nonsense mutation studentship awards from Alberta Innovates Health Solutions and of the SLC4A11 gene in a Korean patient with autosomal Women’s and Children’s Health Research Institute (JM; Edmonton, recessive congenital hereditary endothelial dystrophy. Cornea. AB, Canada). Supported by a graduate studentship and postdoc- 2013;32:e181–e182. toral fellowship, respectively, from the International Research 17. Paliwal P, Sharma A, Tandon R, et al. Congenital hereditary Training Group in Membrane Biology funded by the National endothelial dystrophy - mutation analysis of SLC4A11 and Sciences and Engineering Research Council (SL and KA; Ottawa, genotype-phenotype correlation in a North Indian patient ON, Canada). cohort. Mol Vis. 2010;16:2955–2963. Disclosure: A.M. Chiu,None;J.J. Mandziuk,None;S.K. 18. Aldahmesh MA, Khan AO, Meyer BF, Alkuraya FS. Mutational Loganathan, None; K. Alka, None; J.R. Casey, None spectrum of SLC4A11 in autosomal recessive CHED in Saudi Arabia. Invest Ophthalmol Vis Sci. 2009;50:4142–4145. References 19. Shah SS, Al-Rajhi A, Brandt JD, et al. Mutation in the SLC4A11 gene associated with autosomal recessive congenital heredi- 1. Cheng SH, Gregory RJ, Marshall J, et al. Defective intracellular tary endothelial dystrophy in a large Saudi family. Ophthalmic transport and processing of CFTR is the molecular basis of Genet. 2008;29:41–45. most cystic fibrosis. Cell. 1990;63:827–834. 20. Aldave AJ, Yellore VS, Bourla N, et al. Autosomal recessive 2. Lukacs GL, Chang XB, Bear C, Kartner N, Mohamed A, Riordan CHED associated with novel compound heterozygous muta- JR, Grinstein S. The delta F508 mutation decreases the stability tions in SLC4A11. Cornea. 2007;26:896–900. of cystic fibrosis transmembrane conductance regulator in the 21. Kumar A, Bhattacharjee S, Prakash DR, Sadanand CS. Genetic plasma membrane. Determination of functional half-lives on analysis of two Indian families affected with congenital transfected cells. J Biol Chem. 1993;268:21592–21598. hereditary endothelial dystrophy: two novel mutations in 3. Norez C, Antigny F, Noel S, Vandebrouck C, Becq FA. CF SLC4A11. Mol Vis. 2007;13:39–46. respiratory epithelial cell chronically treated by miglustat 22. Riazuddin SA, Zaghloul NA, Al-Saif A, et al. Missense mutations acquires a non-CF like phenotype. Am J Respir Cell Mol Biol. in TCF8 cause late-onset Fuchs corneal dystrophy and interact 2009;41:217–225. with FCD4 on chromosome 9p. Am J Hum Genet. 2010;86: 4. Yu W, Kim CP, Bear CE. Probing conformational rescue 45–53. induced by a chemical corrector of F508del-cystic fibrosis 23. Soumittra N, Loganathan SK, Madhavan D, et al. Biosynthetic transmembrane conductance regulator (CFTR) mutant. J Biol and functional defects in newly identified SLC4A11 mutants Chem. 2011;286:24714–24725. and absence of COL8A2 mutations in Fuchs endothelial 5. Rafferty S, Alcolado N, Norez C, et al. Rescue of functional corneal dystrophy. J Hum Genet. 2014;59:444–453. F508del cystic fibrosis transmembrane conductance regulator 24. Minear MA, Li YJ, Rimmler J, et al. Genetic screen of African by vasoactive intestinal peptide in the human nasal epithelial Americans with Fuchs endothelial corneal dystrophy. Mol Vis. cell line JME/CF15. J Pharmacol Exp Ther. 2009;331:2–13. 2013;19:2508–2516.

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7752

25. Desir J, Moya G, Reish O, et al. Borate transporter SLC4A11 cells more vulnerable to oxidative insults. Cornea. 2015;34: mutations cause both Harboyan syndrome and non-syndromic 668–674. corneal endothelial dystrophy. J Med Genet. 2007;44:322–326. 46. Han SB, Ang HP, Poh R, et al. Mice with a targeted disruption 26. Vilas GL, Loganathan S, Quon A, Sundaresan P, Vithana EN, of Slc4a11 model the progressive corneal changes of Casey JR. Oligomerization of SLC4A11 protein and the severity congenital hereditary endothelial dystrophy. Invest Ophthal- of FECD and CHED2 corneal dystrophies caused by SLC4A11 mol Vis Sci. 2013;54:6179–6189. mutations. Hum Mutat. 2012;33:419–428. 47. Groeger N, Froehlich H, Maier H, et al. Slc4a11 prevents 27. Loganathan SK, Casey JR. Corneal dystrophy-causing SLC4A11 osmotic imbalance leading to corneal endothelial dystrophy, mutants: suitability for folding-correction therapy. Hum deafness, and polyuria. J Biol Chem. 2010;285:14467–14474. Mutat. 2014;35:1082–1091. 48. Lopez IA, Rosenblatt MI, Kim C, et al. Slc4a11 gene disruption 28. Klintworth GK. Corneal dystrophies. Orphanet J Rare Dis. in mice: cellular targets of sensorineuronal abnormalities. J 2009;4:7. Biol Chem. 2009;28:26882–26896. 29. Pearce WG, Tripathi RC, Morgan G. Congenital endothelial 49. Glozman R, Okiyoneda T, Mulvihill CM, Rini JM, Barriere H, corneal dystrophy. Clinical, pathological, and genetic study. Br Lukacs GL. N-glycans are direct determinants of CFTR folding J Ophthalmol. 1969;53:577–591. and stability in secretory and endocytic membrane traffic. J 30. Harboyan G, Mamo J, Kaloustian VD, Karam F. Congenital Cell Biol. 2009;184:847–862. corneal dystrophy. Progressive sensorineural deafness in a 50. Peters KW, Okiyoneda T, Balch WE, et al. CFTR folding family. Arch Ophthalmol. 1971;85:27–32. consortium: methods available for studies of CFTR folding and 31. Fuchs E. Dystrophia epithelialis corneae. Albrecht Von Graefes correction. Methods Mol Biol. 2011;742:335–353. Arch Klin Exp Ophthalmol. 1910;76:478–508. 51. Ruetz S, Lindsey AE, Ward CL, Kopito RR. Functional 32. Biswas S, Munier FL, Yardley J, et al. Missense mutations in activation of plasma membrane anion exchangers occurs in COL8A2, the gene encoding the alpha2 chain of type VIII a pre-Golgi compartment. J Cell Biol. 1993;121:37–48. collagen, cause two forms of corneal endothelial dystrophy. 52. Laemmli UK. Cleavage of structural proteins during assembly Hum Mol Genet. 2001;10:2415–2423. of the head of bacteriophage T4. Nature. 1970;227:680–685. 33. Riazuddin SA, Parker DS, McGlumphy EJ, et al. Mutations in 53. Bayer EA, Wilchek M. The use of the avidin-biotin complex as a LOXHD1, a recessive-deafness locus, cause dominant late- tool in molecular biology. . 1980;26:1– onset Fuchs corneal dystrophy. Am J Hum Genet. 2012;90: Methods Biochem Anal 533–539. 45. 34. Iliff BW, Riazuddin SA, Gottsch JD. The genetics of Fuchs’ 54. Vilas GL, Morgan PE, Loganathan S, Quon A, Casey JR. corneal dystrophy. Expert Rev Ophthalmol. 2012;7:363–375. Biochemical framework for SLC4A11, the plasma membrane protein defective in corneal dystrophies. Biochemistry. 2011; 35. Mehta JS, Vithana EN, Tan DT, et al. Analysis of the posterior 50:2157–2169. polymorphous corneal dystrophy 3 gene, TCF8, in late-onset Fuchs endothelial corneal dystrophy. Invest Ophthalmol Vis 55. Zhou M, Diwu Z, Panchuk-Voloshina N, Haugland RP. A stable Sci. 2008;49:184–188. nonfluorescent derivative of resorufin for the fluorometric determination of trace hydrogen peroxide: applications in 36. Igo RP Jr, Kopplin LJ, Joseph P, et al. Differing roles for TCF4 detecting the activity of phagocyte NADPH oxidase and other and COL8A2 in central corneal thickness and Fuchs endothe- oxidases. Anal Biochem. 1997;253:162–168. lial corneal dystrophy. PLoS One. 2012;7:e46742. 37. Park M, Li Q, Shcheynikov N, Zeng W, Muallem S. NaBC1 is a 56. Sampson H, Lam H, Chen P, et al. Compounds that correct ubiquitous electrogenic Naþ-coupled borate transporter es- F508del-CFTR trafficking can also correct other protein sential for cellular boron homeostasis and cell growth and trafficking diseases: an in vitro study using cell lines. Orphanet proliferation. Mol Cell. 2004;16:331–341. J Rare Dis. 2013;8:11. 38. Parker MD, Ourmozdi EP, Tanner MJ. Human BTR1, a new 57. Birault V, Solari R, Hanrahan JW, Thomas DY. Correctors of the bicarbonate transporter superfamily member and human AE4 basic trafficking defect of the mutant F508del-CFTR that from kidney. Biochem Biophys Res Commun. 2001;282: causes cystic fibrosis. Curr Opin Chem Biol. 2013;17:353– 1103–1109. 360. 39. Jalimarada SS, Ogando DG, Vithana EN, Bonanno JA. Ion 58. Rubenstein R, Egan M, Zeitlin P. In vitro pharmacologic transport function of SLC4A11 in corneal endothelium. Invest restoration of CFTR-mediated chloride transport with sodium Ophthalmol Vis Sci. 2013;54:4330–4340. 4-phenylbutyrate in cystic fibrosis epithelial cells containing 40. Ogando DG, Jalimarada SS, Zhang W, Vithana EN, Bonanno JA. delta F508-CFTR. J Clin Invest. 1997;100:2457–2465. SLC4A11 is an EIPA-sensitive Naþ permeable pHi regulator. Am 59. Zhang D, Ciciriello F, Anjos S, et al. Ouabain mimics low J Physiol Cell Physiol. 2013;305:C716–C727. temperature rescue of F508del-CFTR in Cystic Fibrosis 41. Liu J, Seet LF, Koh LW, et al. Depletion of SLC4A11 causes cell epithelial cells. Front Pharmacol. 2012;3:176. death by apoptosis in an immortalized human corneal 60. Robert R, Carlile GW, Liao J, et al. Correction of the Delta endothelial cell line. Invest Ophthalmol Vis Sci. 2012;53: phe508 cystic fibrosis transmembrane conductance regulator 3270–3279. trafficking defect by the bioavailable compound glafenine. Mol 42. Zhang W, Ogando DG, Bonanno JA, Obukhov AG. Human Pharmacol. 2010;77:922–930. þ SLC4A11 is a novel NH3:H co-transporter. J Biol Chem. 2015; 61. Fischer H, Fukuda N, Barbry P, Illek B, Sartori C, Matthay MA. 290:16894–16905. Partial restoration of defective chloride conductance in 43. Kao L, Azimov R, Abuladze N, Newman D, Kurtz I. Human DeltaF508 CF mice by trimethylamine oxide. Am J Physiol SLC4A11-C functions as a DIDS-stimulatable Hþ(OH) perme- Lung Cell Mol Physiol. 2001;281:L52–L57. ation pathway: partial correction of R109H mutant transport. 62. Wilke M, Bot A, Jorna H, Scholte BJ, de Jonge HR. Rescue of Am J Physiol Cell Physiol. 2015;308:176–188. murine F508del CFTR activity in native intestine by low 44. Vilas GL, Loganathan SK, Liu J, et al. Transmembrane water- temperature and proteasome inhibitors. PLoS One. 2012;7: flux through SLC4A11: a route defective in genetic corneal e52070. diseases. Hum Mol Genet. 2013;22:4579–4590. 63. Robert R, Carlile GW, Pavel C, et al. Structural analog of 45. Roy S, Praneetha DC, Vendra VP. Mutations in the corneal sildenafil identified as a novel corrector of the F508del-CFTR endothelial dystrophy-associated gene SLC4A11 render the trafficking defect. Mol Pharmacol. 2008;73:4780489.

Downloaded from iovs.arvojournals.org on 10/01/2021 Assay for SLC4A11 Folding Correctors IOVS j December 2015 j Vol. 56 j No. 13 j 7753

64. Carlile GW, Robert R, Goepp J, et al. Ibuprofen rescues mutant 70. Stricker BHC, de Groot RRM, Wilson JHP. Glafenine-associated cystic fibrosis transmembrane conductance regulator traffick- anaphylaxis as a cause of hospital admission in the Nether- ing. J Cyst Fibros. 2015;14:16–25. lands. Eur J Clin Pharmacol. 1991;40:367–371. 65. Bebok Z, Venglarik CJ, Panczel Z, Jilling T, Kirk KL, Sorscher 71. Vermerie N, Kusielewicz D, Tod M, et al. Pharmacokinetics of EJ. Activation of DeltaF508 CFTR in an epithelial monolayer. glafenine and glafenic acid in patients with cirrhosis, Am J Physiol. 1998;275:C599–C607. compared to healthy volunteers. Fundam Clin Pharmacol. 66. Suresh V, Krishnakumar KA, Asha VV. A new fluorescent based 1992;6:197–203. screening system for high throughput screening of drugs 72. Brune K, Patrignani P. New insights into the use of currently targeting HBV-core and HBsAg interaction. Biomed Pharmac- available non-steroidal anti-inflammatory drugs. J Pain Res. other. 2015;70:305–316. 2015;8:105–118. 67. Gedye C, Hussain A, Paterson J, et al. Cell surface profiling 73. Silberstein SD, Stirpe JC. COX inhibitors for the treatment of using high-throughput flow cytometry: a platform for bio- migraine. Expert Opin Pharmacother. 2014;15:1863–1874. marker discovery and analysis of cellular heterogeneity. PLoS 74. Smith WL, DeWitt DL, Garavito RM. Cyclooxygenases: One. 2014;9:e105602. structural, cellular, and molecular biology. Annu Rev Bio- 68. Botelho H, Uliyakina I, Awatade N, et al. Protein traffic chem. 2000;69:145–182. disorders: an effective high-throughput fluorescence micros- 75. Schöber W, Tran QB, Muringaseril M, et al. Impact of glafenine copy pipeline for drug discovery. Sci Rep. 2015;5:9038. hydrochloride on human endothelial cells and human vascular 69. Lan T, Liu Q, Li C, Wu G, Lambert N. Sensitive and high smooth muscle cells: a substance reducing proliferation, resolution localization and tracking of membrane proteins in migration and extracellular matrix synthesis. Cell Biol Int. live cells with BRET. Traffic. 2012;13:1450–1456. 2003;27:987–996.

Downloaded from iovs.arvojournals.org on 10/01/2021