DOCSLIB.ORG

SUPPORTING INFORMATION Cyclic Di-GMP Contributes to Adaption And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SUPPORTING INFORMATION Cyclic Di-GMP Contributes to Adaption And SUPPORTING INFORMATION Cyclic di-GMP contributes to adaption and virulence of Bacillus thuringiensis through a riboswitch-regulated collagen adhesion protein Qing Tang1, Kang Yin1, Hongliang Qian1, Youwen Zhao1, Wen Wang1, Shan-Ho Chou2, Yang Fu1, Jin He1,3,* 1 State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, Hubei 430070, PR China 2 Institute of Biochemistry, and NCHU Agricultural Biotechnology Center, National Chung Hsing University, Taichung 40227, Taiwan 3Key Laboratory of Agro-Microbial Resource and Development, Ministry of Agriculture, Wuhan, Hubei 430070, PR China. *State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, Hubei 430070, PR China. Email: [email protected] 1 Supplementary Figures: Figure S1 Taxonomy of species containing Bc2 RNAs. The taxonomy of each organism containing a putative Bc2 RNA is listed. The identities of each Bc2 RNA and Cap with that in BMB171 are listed. Bc2 RNA-cap architecture in species whose genomes have been fully sequenced are demonstrated. 2 Figure S2 Mapping the TSS of cap. The predicted -10 and -35 regions were underlined. The TSS of cap was highlight by a bent arrow. White letters shaded in black denotes the sequence of Bc2 RNA. Sequence in italic represents the coding sequence of cap gene. 3 Figure S3 C-di-GMP specifically promotes Bc2 RNA transcription read-through. FL and T denote the full length transcripts and terminated transcripts of in vitro transcription termination assays, respectively. In vitro transcription was initiated by adding 0.25 U of E. coli RNA polymerase holoenzyme into transcription mixtures containing 0.1 pmol of DNA template, 5 mM ATP, CTP, GTP and UTP, 20 mM MgCl2, 0.1 mM EDTA, 1 mM dithiothreitol and 10% glycerol. Reaction mixtures were also supplemented with c-di-GMP, c-di-AMP, GTP and cGMP at indicated concentrations. The reaction mixture was incubated at room temperature for 30 min and stopped by adding heparin at a final concentration of 0.5 mg/μl. The products were examined by 2% agarose gel and imaged by Molecular Imager (Bio-Rad, USA). 4 Figure S4 Quantification of intracellular c-di-GMP concentration by LC-MS/MS. (a) LC-MS/MS chromatogram of the c-di-GMP standard detected using the m/z fragments at 135.3, 152.25 and 248.2; (b) Determination of c-di-GMP extracted from Δ3pde, BMB171, and Δ2dgc culture. 5 Figure S5 Domain organization of S. aureus Cna and collagen adhesion proteins in B. thuringiensis BMB171. The collagen binding A region is followed by B repeats. S, signal peptide; W, cell wall anchoring region containing the LPXTG motif; M, transmembrane segment; and C, choice-of-anchor A domain; TQXA, TQXA domain which occurs in surface-expressed proteins of Gram-positive bacteria; R, fimbrial isopeptide formation D2 domain. BMB171_C0765, BMB171_C2268, BMB171_C2270, BMB171_C3203, and BMB171_C4812 are encoded by BMB171_C0765 (new tag BMB171_RS04480), BMB171_C2268 (new tag BMB171_RS12455), BMB171_C2270 (new tag BMB171_RS12465), BMB171_C3203 (new tag BMB171_RS17455), and BMB171_C4812 (new tag BMB171_RS26025), respectively. Prediction of transmembrane helices in proteins was performed by TMHMM Server v. 2.0. Signal peptide/non-signal peptide prediction was performed by SignalP 4.1 Server. 6 Figure S6 Scheme of the I-SceI mediated markless gene knockout procedure. Step I, the upstream and downstream of Bc2 RNA was fused together by overlap-PCR and cloned into pRP1028 to create recombinant plasmid pRP1028-Bc2UD. Then the recombinant plasmid was electroporated into BMB171 strain. Integration of plasmid pRP1028-Bc2UD into the chromosome through homologous recombination was induced by high temperature (37°C). Step II, plasmid pSS4332 was electroporated into the recombinant strain. I-SceI restriction enzyme synthesised by pSS4332 cleaved the recombination genome at I-SceI cutting site. Step III, homologous recombination was induced by the break DNA. Step VI, the redundant pSS4332 plasmid was removed using continuous passage at 28°C in LB broth, resulting in a markerless Bc2 RNA deletion strain. 7 Figure S7 Schematic representation of the DNA templates used in in vitro transcription termination assays. Nucleotides in red denote T7 promoter, nucleotides in light blue denote Bc2 RNA sequence, and nucleotides in blue denote the coding region of cap. The TSS of cap was highlight by bent arrow. 8 Figure S8 Schematic representation of the Pcap-lacZ, PcapΔ-lacZ and Pnull-lacZ transcriptional reporter vectors. Pcap-lacZ, pHT1K plasmid contains the 5´-UTR DNA region of cap gene encompassing Bc2 RNA sequence (-64—+249) which is fused with lacZ; PcapΔ-lacZ, pHT1K contains the 5´-UTR DNA region of cap gene lacking the Bc2 RNA sequence (-64—+76; +198—+249) which is fused with lacZ; PcapA11T-lacZ, PcapC37T-lacZ and PcapA38T-lacZ are pHT1Ks carrying 5´-UTR DNA region of cap with site mutants; Pnull-lacZ, pHT1K contains the promoterless lacZ. 9 Supplementary Tables： Table S1 Primers used in this study primers Primer sequences (5´-3´) Purposes Origins cap gene cap-U-F ACATGGTACCTCAGAGAGGAAAGGGAGATGGGTT This work knockout cap gene cap-U-R ATTCGGATCCAGTTCCCTCCTATTTTTTATATT This work knockout cap gene cap-D-F ATACTCTAGATAAAGGTGAAAAGGTATCCTCAAAG This work knockout cap gene cap-D-R AGATAAGCTTAAACGATGATTCTCTTCCTCTTG This work knockout 5´-RACE cap-specific outer primer GCATATCAATTGTGAATTGATCTCC This work analysis 5´-RACE cap-specific inner primer GGCTTGATACGGTTCAGATGTCGTG This work analysis 5´-RACE 5´-RACE Outer Primer CATGGCTACATGCTGACAGCCTA This work analysis 5´-RACE 5´-RACE Inner Primer CGCGGATCC ACAGCCTACTGATGATCAGTCGATG This work analysis Pcap-F CATGCCATGGACCATTGCTTCTTTAATGTAGTG β-gal assays This work Pcap-R ACCGGATCCTTTAGTACTTTTCATTTGCATAGTTCCCTC β-gal assays This work Bc2-Overlap-F GAAACAAAAAAAGAATAAAGTTATATAAATATAAAAAATAGGAG Overlap PCR This work Bc2-Overlap-R TTTTATATTTATATAACTTTATTCTTTTTTTGTTTCATTTTCCTC Overlap PCR This work RTgap-F TTTTGCTAGCGCTTTCGCAG qPCR assays This work RTgap-R TAGCGCCTGTTGTGAAGGTG qPCR assays This work RTcap-F GACAGAGAGACCGAAGCCAC qPCR assays This work RTcap-R ACTCATGCCCAGGTCCTAATG qPCR assays This work RTBc2-F CGTCCAGACGGTATAGTAATATTTG qPCR assays This work RTBc2-R AGCTTTGCGGCCTATCCTTT qPCR assays This work Bc2-U-F CGACGCGTCTAAATTAACCTTAGAAGCAGTG Bc2 knockout This work Bc2-D-R CGGGATCCATTTACATATACAAGCCAATCAGC Bc2 knockout This work 10 A11T-b CTTTCGAATAGTGTGCAAAAAATATCT Site mutation This work A11T-c AGATATTTTTTGCACACTATTCGAAAG Site mutation This work C38T-b CGAAAGGATAGGCCGTAAAGCTTAGAGTCTA Site mutation This work C38T-c TAGACTCTAAGCTTTACGGCCTATCCTTTCG Site mutation This work A38T-b CGTAGACTCTAAGCTTAGCGGCCTATC Site mutation This work A38T-c GTATGGCCGCTAAGCTTAGAGTCTACG Site mutation This work 11 Table S2 c-di-GMP-I riboswitch Samples Genome Location Sequence* [Cellvibrio] gilvus ATCC CP002665.1 3443557-3443482 TCAGCGAAACGGCAAACCCTCCGCGAGGAGGGGACGCAAAGCCACGGGACCCACGACGGTCAGCCGGGCTACCGAA 13127 [Cellvibrio] gilvus ATCC CP002665.1 1473921-1473997 CAGCGACAACGGCAAACCCTCCGCAAGGAGGGGACGCAAAGCCAACGGGACCCACGCAGGTCAGCCGAGCTACCGAA 13127 Acaryochloris marina CP000828.1 4797700-4797614 TCCTCGAAACGGCAACTTGTCTCGAAAGAGCAAGACGCAAATTAACGAGTCTAACCCTTTATAGGCATGATGGTCGTTAATACCGAA MBIC11017 Acaryochloris marina CP000828.1 1721607-1721514 TCCCCGAAATGGCAACTTGCACCGAAAGGGTAAGGCGCAAATTAGCAGGCCTAAAATCCAAGCATTACGGGGTATGGATGCTGCTAGTGTCGAA MBIC11017 Acaryochloris sp. CCMEE AFEJ01000324.1 22061-21975 TCCTCGAAACGGCAACTTGTCTCGAAAGAGCAAGACGCAAATTAACGAGTCTAACCCTTTATAGGCATGATGGTCGTTAATACCGAA 5410 contig00482 Acaryochloris sp. CCMEE AFEJ01000341.1 4160-4067 TCCCCGAAATGGCAACTTGCACCGAAAGGGTAAGACGCAGATTAGCAGACCTAAAGTCCAAGCATTACGGGGTATGGATGCTGCTAGTGTCGAA 5410 contig00499 Acetivibrio cellulolyticus AEDB01000015.1 21591-21687 TATGAAACAGGGCAAAGTCGTTGAAAGACGGCGACGCAAAGCTGTGGGTCTAACGTTTGGGGAAGATGCCTTGAACTACGATTGCCAAGCTGCCATT CD2 ctg00137 Acetivibrio cellulolyticus AEDB01000040.1 12119-12214 TATGAAACAGGGCAAAATCATTGAAAAATGATGACGCAAAGCTATGGGTCTAAGTTAAGGATTATATATCCTTGATATGATCGCCAAGTTGCCATT CD2 ctg00142 Acetivibrio cellulolyticus AEDB01000011.1 99531-99625 TATGAAACAGGGCAAAGTTGTCGAAAGGCAATGACGCAAAGCCTTGGGTCTAAAGCTGAGACGAAAGTCAAAGCTAAGATAGCCGGGTTGCCATT CD2 ctg00148 Acetivibrio cellulolyticus AEDB01000061.1 5161-5244 CATTTGAAATGGTAAACCTGGTGAAAACCAGTGACACAAAGCTACGGGTCTAAGGTCTTTGACTAAGACAGCCGAGTTGCCGAA CD2 ctg00149 12 Acetivibrio cellulolyticus AEDB01000070.1 14624-14708 ATTTGTAAAAGGCAAATCTATCGAAAGATAGAGACGCAAAACTACGGGTCTACGGTCGCTTGACTACGACAGCCGGGTTGCCAAG CD2 ctg00157 Acetivibrio cellulolyticus AEDB01000070.1 14797-14882 TTTCGAAAATGGCAAACTCAATGAAAATTGAGGACGCAAAACTACAGGTCTACGGGTTTCATTACTATGATGGCTGAGTTACCGAA CD2 ctg00157 Acetohalobium arabaticum CP002105.1 239557-239640 CCTCAAAAAAGGCACACTTGCTGAAAAGTAAGGTCGCAAAGTCTTGAGTCTAAAGCATAAAGCCATGACTGTCGGACTGCTGAA DSM 5501 Acetohalobium arabaticum CP002105.1 1744836-1744745 AACTAGAAAGGGCACACTTATCGAAAGGTAAGGCCGCAAAGCTTCAAATCTACAGTGCAGTATAAAGGCACTATGATAGTTGGGCTACCACA DSM 5501 Acetonema longum DSM AFGF01000098.1 31377-31462 TAATAAACACGGCAAACTTATTGAAAAATAAGGACGCAAAGCTATGGGTCTACGTACTTTAAGTATATGGCTGCCAGGTTGCAAAA 6540 Contig00098 Acholeplasma laidlawii CP000896.1 1183288-1183213 ATTAATATTTGGCAAACTATATGAAAATATAGGGCGCAAAACTATAGGGCCTTGAAAATGGTAGCCAGCTGCATAA PG-8A Acholeplasma laidlawii CP000896.1 1029409-1029330 AAGATTAAAAGGCAAACTTAAGGTAACTTAAGGACGCAAAACTAAAGGGTCTAATTAGTAATAGACAGCCAGTTGCATCG PG-8A Acholeplasma laidlawii CP000896.1 1036967-1036891 TAAAGTTTTTGGCAAAATTAGGGTAACCTAATGACGCAAAACTATAGGGCCTATATATTAGGCAGCCAGTTGCACTT
Load more

Recommended publications
  • Next Generation Microbiology for the Future
    Next Generation Microbiology for the Future www.msk.or.kr | 1 2014 INTERNATIONAL MEETING of the MICROBIOLOGICAL SOCIETY of KOREA 2 | 2014 International Meeting of the Microbiological Society of Korea 2014 INTERNATIONAL MEETING of Next Generationthe MICROBIOLOGICAL Microbiology for the Future SOCIETY of KOREA Contents • Timetable ············································································································································ 4 • Floor Plan ··········································································································································· 5 • Scientific Programs ···························································································································· 6 • Plenary Lectures······························································································································· 23 PL1 ······································································································································· 24 PL2 ······································································································································· 25 PL3 ······································································································································· 26 PL4 ······································································································································· 27 • Symposia ··········································································································································
    [Show full text]
  • Genomic Analysis of Caldalkalibacillus Thermarum TA2
    Delft University of Technology Genomic analysis of Caldalkalibacillus thermarum TA2.A1 reveals aerobic alkaliphilic metabolism and evolutionary hallmarks linking alkaliphilic bacteria and plant life de Jong, Samuel I.; van den Broek, Marcel A.; Merkel, Alexander Y.; de la Torre Cortes, Pilar; Kalamorz, Falk; Cook, Gregory M.; van Loosdrecht, Mark C.M.; McMillan, Duncan G.G. DOI 10.1007/s00792-020-01205-w Publication date 2020 Document Version Final published version Published in Extremophiles Citation (APA) de Jong, S. I., van den Broek, M. A., Merkel, A. Y., de la Torre Cortes, P., Kalamorz, F., Cook, G. M., van Loosdrecht, M. C. M., & McMillan, D. G. G. (2020). Genomic analysis of Caldalkalibacillus thermarum TA2.A1 reveals aerobic alkaliphilic metabolism and evolutionary hallmarks linking alkaliphilic bacteria and plant life. Extremophiles, 24(6), 923-935. https://doi.org/10.1007/s00792-020-01205-w Important note To cite this publication, please use the final published version (if applicable). Please check the document version above. Copyright Other than for strictly personal use, it is not permitted to download, forward or distribute the text or part of it, without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license such as Creative Commons. Takedown policy Please contact us and provide details if you believe this document breaches copyrights. We will remove access to the work immediately and investigate your claim. This work is downloaded from Delft University of Technology. For technical reasons the number of authors shown on this cover page is limited to a maximum of 10.
    [Show full text]
  • An Astrobiological Study of an Alkaline-Saline Hydrothermal Environment, Relevant to Understanding the Habitability of Mars
    An astrobiological study of an alkaline-saline hydrothermal environment, relevant to understanding the habitability of Mars A thesis submitted for the Degree of Doctor of Philosophy By Lottie Elizabeth Davis Department of Earth Sciences University College London March 2012 1 I, Lottie Elizabeth Davis confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Declaration Abstract The on going exploration of planets such as Mars is producing a wealth of data which is being used to shape a better understanding of potentially habitable environments beyond the Earth. On Mars, the relatively recent identification of minerals which indicate the presence of neutral/alkaline aqueous activity has increased the number of potentially habitable environments which require characterisation and exploration. The study of terrestrial analogue environments enables us to develop a better understanding of where life can exist, what types of organisms can exist and what evidence of that life may be preserved. The study of analogue environments is necessary not only in relation to the possibility of identifying extinct/extant indigenous life on Mars, but also for understanding the potential for contamination. As well as gaining an insight into the habitability of an environment, it is also essential to understand how to identify such environments using the instruments available to missions to Mars. It is important to be aware of instrument limitations to ensure that evidence of a particular environment is not overlooked. This work focuses upon studying the bacterial and archaeal diversity of Lake Magadi, a hypersaline and alkaline soda lake, and its associated hydrothermal springs.
    [Show full text]
  • Distribution of Long Linear and Branched Polyamines in the Thermophiles Belonging to the Domain Bacteria
    Journal of Japanese Society for Extremophiles (2008) Vol.7 (1) Journal of Japanese Society for Extremophiles (2008), Vol. 7, 10-20 ORIGINAL PAPER Hamana Ka,b,e, Hosoya Ra, Yokota Ac, Niitsu Md, Hayashi He and Itoh Tb Distribution of long linear and branched polyamines in the thermophiles belonging to the domain Bacteria a Gunma University School of Health Sciences, Maebashi, Gunma 371-8514, Japan. bJapan Collection of Microorganisms, RIKEN, BioResource Center, Wako, Saitama 351-0198, Japan. c Institute of Molecular and Cellular Biosciences, The University of Tokyo, Tokyo 113-0032, Japan. d Faculty of Pharmaceutical Sciences, Josai University, Sakado, Saitama 350-0290, Japan. e Faculty of Engineering, Maebashi Institute of Technology, Maebashi, Gunma 371-0816, Japan. Corresponding author : Koei Hamana, [email protected] Phone : +81-27-220-8916, FAX : +81-27-220-8999 Received: April 3, 2008/ Reviced:May 26, 2008/ Acepted:June 3, 2008 Abstract Cellular polyamines of 44 newly validated have been published in eubacteria 15, 16). However, the eubacterial thermophiles growing at 45-80℃, belonging degree of thermophily is roughly estimated and not to eight orders (six phyla) of the domain Bacteria, were defined exactly. The cellular occurrence of long linear analyzed by HPLC and GC. A quaternary branched and/or branched polyamines in extremely thermophilic penta-amine, N4-bis(aminopropyl)norspermidine, was (or hyperthermophilic) eubacteria suggested that the found in Hydrogenivirga and Sulfurihydrogenibium extreme thermophiles (or hyperthermophiles) may have belonging to the order of Aquificales. Another some novel polyamine synthetic abilities possibly quaternary branched penta-amine, N4-bis(aminopropyl) associated with their thermophily 8-11, 13-15, 18, 23, 24).
    [Show full text]
  • Thermolongibacillus Cihan Et Al
    Genus Firmicutes/Bacilli/Bacillales/Bacillaceae/ Thermolongibacillus Cihan et al. (2014)VP .......................................................................................................................................................................................... Arzu Coleri Cihan, Department of Biology, Faculty of Science, Ankara University, Ankara, Turkey Kivanc Bilecen and Cumhur Cokmus, Department of Molecular Biology & Genetics, Faculty of Agriculture & Natural Sciences, Konya Food & Agriculture University, Konya, Turkey Ther.mo.lon.gi.ba.cil’lus. Gr. adj. thermos hot; L. adj. Type species: Thermolongibacillus altinsuensis E265T, longus long; L. dim. n. bacillus small rod; N.L. masc. n. DSM 24979T, NCIMB 14850T Cihan et al. (2014)VP. .................................................................................. Thermolongibacillus long thermophilic rod. Thermolongibacillus is a genus in the phylum Fir- Gram-positive, motile rods, occurring singly, in pairs, or micutes,classBacilli, order Bacillales, and the family in long straight or slightly curved chains. Moderate alka- Bacillaceae. There are two species in the genus Thermo- lophile, growing in a pH range of 5.0–11.0; thermophile, longibacillus, T. altinsuensis and T. kozakliensis, isolated growing in a temperature range of 40–70∘C; halophile, from sediment and soil samples in different ther- tolerating up to 5.0% (w/v) NaCl. Catalase-weakly positive, mal hot springs, respectively. Members of this genus chemoorganotroph, grow aerobically, but not under anaer- are thermophilic (40–70∘C), halophilic (0–5.0% obic conditions. Young cells are 0.6–1.1 μm in width and NaCl), alkalophilic (pH 5.0–11.0), endospore form- 3.0–8.0 μm in length; cells in stationary and death phases ing, Gram-positive, aerobic, motile, straight rods. are 0.6–1.2 μm in width and 9.0–35.0 μm in length.
    [Show full text]
  • Plastid-Localized Amino Acid Biosynthetic Pathways of Plantae Are Predominantly Composed of Non-Cyanobacterial Enzymes
    Plastid-localized amino acid biosynthetic pathways of Plantae are predominantly SUBJECT AREAS: MOLECULAR EVOLUTION composed of non-cyanobacterial PHYLOGENETICS PLANT EVOLUTION enzymes PHYLOGENY Adrian Reyes-Prieto1* & Ahmed Moustafa2* Received 1 26 September 2012 Canadian Institute for Advanced Research and Department of Biology, University of New Brunswick, Fredericton, Canada, 2Department of Biology and Biotechnology Graduate Program, American University in Cairo, Egypt. Accepted 27 November 2012 Studies of photosynthetic eukaryotes have revealed that the evolution of plastids from cyanobacteria Published involved the recruitment of non-cyanobacterial proteins. Our phylogenetic survey of .100 Arabidopsis 11 December 2012 nuclear-encoded plastid enzymes involved in amino acid biosynthesis identified only 21 unambiguous cyanobacterial-derived proteins. Some of the several non-cyanobacterial plastid enzymes have a shared phylogenetic origin in the three Plantae lineages. We hypothesize that during the evolution of plastids some enzymes encoded in the host nuclear genome were mistargeted into the plastid. Then, the activity of those Correspondence and foreign enzymes was sustained by both the plastid metabolites and interactions with the native requests for materials cyanobacterial enzymes. Some of the novel enzymatic activities were favored by selective compartmentation should be addressed to of additional complementary enzymes. The mosaic phylogenetic composition of the plastid amino acid A.R.-P. ([email protected]) biosynthetic pathways and the reduced number of plastid-encoded proteins of non-cyanobacterial origin suggest that enzyme recruitment underlies the recompartmentation of metabolic routes during the evolution of plastids. * Equal contribution made by these authors. rimary plastids of plants and algae are the evolutionary outcome of an endosymbiotic association between eukaryotes and cyanobacteria1.
    [Show full text]
  • Chapter 1 Reviews Studies in Geochemistry and Microbiology of Studied Area
    DIVERSITY AND POTENTIAL GEOCHEMICAL FUNCTIONS OF PROKARYOTES IN HOT SPRINGS OF THE UZON CALDERA, KAMCHATKA by WEIDONG ZHAO (Under the Direction of Chuanlun L Zhang and Christopher S Romanek) ABSTRACT Hot springs are modern analogs of ancient hydrothermal systems where life may have emerged and evolved. Autotrophic microorganisms play a key role in regulating the structure of microbial assemblage and associated biochemical processes in hot springs. This dissertation aims to elucidate the diversity, abundance and ecological functions of multiple groups of chemoautotrophs that use diverse energy sources including CO, NH3, and H2 in terrestrial hot springs of the Uzon Caldera, Kamchatka (Far East Russia). This dissertation consists of seven chapters. Chapter 1 reviews studies in geochemistry and microbiology of studied area. 13 Chapter 2 reports H2, CO2, CH4 and CO contents and the δ C values in vent gas samples. The gases were determined to be thermogenic with small temporal but large spatial variations among the springs investigated. Chemical and partial isotope equilibria between CO2 and CH4 may be attained in the subsurface at elevated temperature. Chapter 3 shows the distribution of bacteria was spatially heterogeneous whereas that of archaea was related to geographic features. Cluster analyses group bacterial and archaeal communities according to their similarities of lipid compositions. Hydrogen-utilizing Aquificales appeared to be dominant in two of the four bacterial groups, but was outnumbered by presumably Cyanobacteria-Thermotogae or Proteobacteria-Desulfurobacterium types in the other two groups. The lipid data also suggest the existence of possibly three types of archaea with each type producing one of GDGT-0, GDGT-1, and GDGT-4 as the main membrane lipids, respectively.
    [Show full text]
  • Isolation and Diversity of Sediment Bacteria in The
    bioRxiv preprint doi: https://doi.org/10.1101/638304; this version posted May 14, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Isolation and Diversity of Sediment Bacteria in the 2 Hypersaline Aiding Lake, China 3 4 Tong-Wei Guan, Yi-Jin Lin, Meng-Ying Ou, Ke-Bao Chen 5 6 7 Institute of Microbiology, Xihua University, Chengdu 610039, P. R. China. 8 9 Author for correspondence: 10 Tong-Wei Guan 11 Tel/Fax: +86 028 87720552 12 E-mail: [email protected] 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 bioRxiv preprint doi: https://doi.org/10.1101/638304; this version posted May 14, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 29 Abstract A total of 343 bacteria from sediment samples of Aiding Lake, China, were isolated using 30 nine different media with 5% or 15% (w/v) NaCl. The number of species and genera of bacteria recovered 31 from the different media significantly varied, indicating the need to optimize the isolation conditions. 32 The results showed an unexpected level of bacterial diversity, with four phyla (Firmicutes, 33 Actinobacteria, Proteobacteria, and Rhodothermaeota), fourteen orders (Actinopolysporales, 34 Alteromonadales, Bacillales, Balneolales, Chromatiales, Glycomycetales, Jiangellales, Micrococcales, 35 Micromonosporales, Oceanospirillales, Pseudonocardiales, Rhizobiales, Streptomycetales, and 36 Streptosporangiales), including 17 families, 41 genera, and 71 species.
    [Show full text]
  • Importance of Rare Taxa for Bacterial Diversity in the Rhizosphere of Bt- and Conventional Maize Varieties
    The ISME Journal (2013) 7, 37–49 & 2013 International Society for Microbial Ecology All rights reserved 1751-7362/13 www.nature.com/ismej ORIGINAL ARTICLE Importance of rare taxa for bacterial diversity in the rhizosphere of Bt- and conventional maize varieties Anja B Dohrmann1, Meike Ku¨ ting1, Sebastian Ju¨ nemann2, Sebastian Jaenicke2, Andreas Schlu¨ ter3 and Christoph C Tebbe1 1Institute of Biodiversity, Johann Heinrich von Thu¨nen-Institute (vTI), Federal Research Institute for Rural Areas, Forestry and Fisheries, Braunschweig, Germany; 2Institute for Bioinformatics, Center for Biotechnology (CeBiTec), Bielefeld University, Bielefeld, Germany and 3Institute for Genome Research and Systems Biology, Center for Biotechnology (CeBiTec), Bielefeld University, Bielefeld, Germany Ribosomal 16S rRNA gene pyrosequencing was used to explore whether the genetically modified (GM) Bt-maize hybrid MON 89034 Â MON 88017, expressing three insecticidal recombinant Cry proteins of Bacillus thuringiensis, would alter the rhizosphere bacterial community. Fine roots of field cultivated Bt-maize and three conventional maize varieties were analyzed together with coarse roots of the Bt-maize. A total of 547 000 sequences were obtained. Library coverage was 100% at the phylum and 99.8% at the genus rank. Although cluster analyses based on relative abundances indicated no differences at higher taxonomic ranks, genera abundances pointed to variety specific differences. Genera-based clustering depended solely on the 49 most dominant genera while the remaining 461 rare genera followed a different selection. A total of 91 genera responded significantly to the different root environments. As a benefit of pyrosequencing, 79 responsive genera were identified that might have been overlooked with conventional cloning sequencing approaches owing to their rareness.
    [Show full text]
  • Supplemental Fig Final
    Aneurinibacillus aneurinilyticus Aneurinibacillus terranovensis LMG 22483 Aneurinibacillus terranovensis DSM 18919 Bacillus thuringiensiskurstaki Bacillus thuringiensis kurstaki HD73 Bacillus thuringiensis Bacillus thuringiensis HD 789 Bacillus thuringiensis Bt407 Geobacillus stearothermophilus 3 Bacillus thuringiensis IS5056 Bacillus thuringiensis HD771 A426 Bacillus mycoides Rock3 17 Bacillus cereus A Bacillus anthracis TCC12856 T3 YIM 70157 L ysinibacillus sphaericus C3 41 YBT Y412MC61 YBT Bacillus cereus F837/76 L 1518 ysinibacillus fusiformis H1k 1520 Bacillus pumilus MTCC B6033 Bacillus pumilus S1 Bacillus pumilus SAFR 032 A Sporolactobacillus laevolacticus L Salinibacillus aidingensis NSP7.3 AnoxybacillusBacillus flavithermus ysinibacillusgelatini LMG WK1sp 21880 GY32−1 TCC 10987 Bacillus azotoformans Alkalibacillus haloalkaliphilus C5 01 Caldibacillus debilis DSM 16016 Geobacillus sp WCH70 Ames Geobacillus sp Geobacillus kaustophilus HT Geobacillusirgibacillus sp C56 sp SK37 6 BacillusBacillus macauensis halodurans ZFHKF C 1251 V Caldalkalibacillus thermarum HA6 Bacillus amyloliquefaciens M27 Marinococcus halotolerans LPs and PKs3 count Halobacillus halophilus DSM 2266 Lysinibacillus fusiformis RB−21 Halobacillus kuroshimensis IS Hb7 1 Halobacillus karajensis DSM 14948 Halobacillus trueperi HT Halobacillus sp BAB 2008 Halobacillus dabanensis HD 02 Bacillus amyloliquefaciens IT45 Bacillus licheniformis 9945A Bacillus atrophaeus 1942 Bacillus amyloliquefaciens UCMB5036 Bacillus subtilis SMY Bacillus amyloliquefaciens W2 Paenibacillus
    [Show full text]
  • Regulation of the Thermoalkaliphilic F1-Atpase from Caldalkalibacillus Thermarum
    Regulation of the thermoalkaliphilic F1-ATPase from Caldalkalibacillus thermarum Scott A. Fergusona, Gregory M. Cooka,b, Martin G. Montgomerya, Andrew G. W. Lesliec, and John E. Walkera,1 aMedical Research Council Mitochondrial Biology Unit, Cambridge Biomedical Campus, Cambridge CB2 0XY, United Kingdom; bDepartment of Microbiology and Immunology, University of Otago, Dunedin 9016, New Zealand; and cMedical Research Council Laboratory of Molecular Biology, Cambridge Biomedical Campus, Cambridge CB2 0QH, United Kingdom Contributed by John E. Walker, July 25, 2016 (sent for review June 19, 2016; reviewed by Thomas M. Duncan and Dale B. Wigley) e The crystal structure has been determined of the F1-catalytic domain the F1-domains from E. coli (19, 20), but the isolated -subunit of the F-ATPase from Caldalkalibacillus thermarum, which hydro- remains in a down conformation even when ATP is not bound to lyzes adenosine triphosphate (ATP) poorly. It is very similar to those it (14–16). Deletion of its five C-terminal amino acids diminished of active mitochondrial and bacterial F1-ATPases. In the F-ATPase respiratory growth (21), but deletion of the C-terminal domain from Geobacillus stearothermophilus, conformational changes in had no growth phenotype (22). the e-subunit are influenced by intracellular ATP concentration and The F-ATPases from the thermoalkaliphile Caldalkalibacillus membrane potential. When ATP is plentiful, the e-subunit assumes a thermarum (23) from mycobacterial species (24, 25) and from “down” state, with an ATP molecule bound to its two C-terminal alkaliphilic Bacilli (26, 27) exemplify classes of eubacterial enzymes α-helices; when ATP is scarce, the α-helices are proposed to inhibit with F-ATPases that can synthesize ATP but show extreme latency ATP hydrolysis by assuming an “up” state, where the α-helices, in hydrolyzing ATP, although a weak ATPase activity can be α β devoid of ATP, enter the 3 3-catalytic region.
    [Show full text]
  • Rubeoparvulum Massiliense Gen. Nov., Sp. Nov., a New Bacterial Genus Isolated from the Human Gut of a Senegalese Infant with Severe Acute Malnutrition
    TAXONOGENOMICS: GENOME OF A NEW ORGANISM Rubeoparvulum massiliense gen. nov., sp. nov., a new bacterial genus isolated from the human gut of a Senegalese infant with severe acute malnutrition M. Tidjani Alou1, J. Rathored1, J.-C. Lagier1,2,3, S. Khelaifia1, C. Michelle1, C. Sokhna2, A. Diallo2, A. B. Diallo4, P.-E. Fournier1, D. Raoult1,5 and S. Edouard1 1) Aix-Marseille Université, URMITE, UM63, CNRS7278, IRD198, INSERM 1095, Faculté de médecine, 2) Unité de Recherche sur les Maladies Infectieuses et Tropicales Emergentes IRD 198, CNRS 7278, Aix-Marseille Université, Marseille, France, 3) Campus Commun UCAD-IRD of Hann, Dakar, Senegal, 4) Laboratoire de microbiologie, département de biologie, Université Abdou Moumouni de Niamey, Niamey, Niger and 5) Special Infectious Agents Unit, King Fahd Medical Research Center, King Abdulaziz University, Jeddah, Saudi Arabia Abstract Rubeoparvulum massiliense strain mt6T was isolated from the gut microbiota of a severely malnourished boy from Senegal and consisted of facultative anaerobic, spore-forming, nonmotile and Gram-negative rods. R. massiliense showed a 92% similarity with the 16S rRNA of Bacillus mannanilyticus. The genome of strain mt6T is 2 843 796 bp long with a 43.75% G+C content. It contains 2735 protein-coding genes and 76 RNA genes, among which are nine rRNA genes. © 2016 Published by Elsevier Ltd on behalf of European Society of Clinical Microbiology and Infectious Diseases. Keywords: Culturomics, genome, gut microbiota, Rubeoparvulum massiliense, taxonogenomics Original Submission: 18 October 2016; Accepted: 9 November 2016 Article published online: 17 November 2016 irritable bowel syndrome, obesity [3,4] and severe acute Corresponding author: S.
    [Show full text]