SUPPORTING INFORMATION Cyclic di-GMP contributes to adaption and virulence of Bacillus thuringiensis through a riboswitch-regulated collagen adhesion protein Qing Tang1, Kang Yin1, Hongliang Qian1, Youwen Zhao1, Wen Wang1, Shan-Ho Chou2, Yang Fu1, Jin He1,3,* 1 State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, Hubei 430070, PR China 2 Institute of Biochemistry, and NCHU Agricultural Biotechnology Center, National Chung Hsing University, Taichung 40227, Taiwan 3Key Laboratory of Agro-Microbial Resource and Development, Ministry of Agriculture, Wuhan, Hubei 430070, PR China. *State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, Hubei 430070, PR China. Email: [email protected] 1 Supplementary Figures: Figure S1 Taxonomy of species containing Bc2 RNAs. The taxonomy of each organism containing a putative Bc2 RNA is listed. The identities of each Bc2 RNA and Cap with that in BMB171 are listed. Bc2 RNA-cap architecture in species whose genomes have been fully sequenced are demonstrated. 2 Figure S2 Mapping the TSS of cap. The predicted -10 and -35 regions were underlined. The TSS of cap was highlight by a bent arrow. White letters shaded in black denotes the sequence of Bc2 RNA. Sequence in italic represents the coding sequence of cap gene. 3 Figure S3 C-di-GMP specifically promotes Bc2 RNA transcription read-through. FL and T denote the full length transcripts and terminated transcripts of in vitro transcription termination assays, respectively. In vitro transcription was initiated by adding 0.25 U of E. coli RNA polymerase holoenzyme into transcription mixtures containing 0.1 pmol of DNA template, 5 mM ATP, CTP, GTP and UTP, 20 mM MgCl2, 0.1 mM EDTA, 1 mM dithiothreitol and 10% glycerol. Reaction mixtures were also supplemented with c-di-GMP, c-di-AMP, GTP and cGMP at indicated concentrations. The reaction mixture was incubated at room temperature for 30 min and stopped by adding heparin at a final concentration of 0.5 mg/μl. The products were examined by 2% agarose gel and imaged by Molecular Imager (Bio-Rad, USA). 4 Figure S4 Quantification of intracellular c-di-GMP concentration by LC-MS/MS. (a) LC-MS/MS chromatogram of the c-di-GMP standard detected using the m/z fragments at 135.3, 152.25 and 248.2; (b) Determination of c-di-GMP extracted from Δ3pde, BMB171, and Δ2dgc culture. 5 Figure S5 Domain organization of S. aureus Cna and collagen adhesion proteins in B. thuringiensis BMB171. The collagen binding A region is followed by B repeats. S, signal peptide; W, cell wall anchoring region containing the LPXTG motif; M, transmembrane segment; and C, choice-of-anchor A domain; TQXA, TQXA domain which occurs in surface-expressed proteins of Gram-positive bacteria; R, fimbrial isopeptide formation D2 domain. BMB171_C0765, BMB171_C2268, BMB171_C2270, BMB171_C3203, and BMB171_C4812 are encoded by BMB171_C0765 (new tag BMB171_RS04480), BMB171_C2268 (new tag BMB171_RS12455), BMB171_C2270 (new tag BMB171_RS12465), BMB171_C3203 (new tag BMB171_RS17455), and BMB171_C4812 (new tag BMB171_RS26025), respectively. Prediction of transmembrane helices in proteins was performed by TMHMM Server v. 2.0. Signal peptide/non-signal peptide prediction was performed by SignalP 4.1 Server. 6 Figure S6 Scheme of the I-SceI mediated markless gene knockout procedure. Step I, the upstream and downstream of Bc2 RNA was fused together by overlap-PCR and cloned into pRP1028 to create recombinant plasmid pRP1028-Bc2UD. Then the recombinant plasmid was electroporated into BMB171 strain. Integration of plasmid pRP1028-Bc2UD into the chromosome through homologous recombination was induced by high temperature (37°C). Step II, plasmid pSS4332 was electroporated into the recombinant strain. I-SceI restriction enzyme synthesised by pSS4332 cleaved the recombination genome at I-SceI cutting site. Step III, homologous recombination was induced by the break DNA. Step VI, the redundant pSS4332 plasmid was removed using continuous passage at 28°C in LB broth, resulting in a markerless Bc2 RNA deletion strain. 7 Figure S7 Schematic representation of the DNA templates used in in vitro transcription termination assays. Nucleotides in red denote T7 promoter, nucleotides in light blue denote Bc2 RNA sequence, and nucleotides in blue denote the coding region of cap. The TSS of cap was highlight by bent arrow. 8 Figure S8 Schematic representation of the Pcap-lacZ, PcapΔ-lacZ and Pnull-lacZ transcriptional reporter vectors. Pcap-lacZ, pHT1K plasmid contains the 5´-UTR DNA region of cap gene encompassing Bc2 RNA sequence (-64—+249) which is fused with lacZ; PcapΔ-lacZ, pHT1K contains the 5´-UTR DNA region of cap gene lacking the Bc2 RNA sequence (-64—+76; +198—+249) which is fused with lacZ; PcapA11T-lacZ, PcapC37T-lacZ and PcapA38T-lacZ are pHT1Ks carrying 5´-UTR DNA region of cap with site mutants; Pnull-lacZ, pHT1K contains the promoterless lacZ. 9 Supplementary Tables： Table S1 Primers used in this study primers Primer sequences (5´-3´) Purposes Origins cap gene cap-U-F ACATGGTACCTCAGAGAGGAAAGGGAGATGGGTT This work knockout cap gene cap-U-R ATTCGGATCCAGTTCCCTCCTATTTTTTATATT This work knockout cap gene cap-D-F ATACTCTAGATAAAGGTGAAAAGGTATCCTCAAAG This work knockout cap gene cap-D-R AGATAAGCTTAAACGATGATTCTCTTCCTCTTG This work knockout 5´-RACE cap-specific outer primer GCATATCAATTGTGAATTGATCTCC This work analysis 5´-RACE cap-specific inner primer GGCTTGATACGGTTCAGATGTCGTG This work analysis 5´-RACE 5´-RACE Outer Primer CATGGCTACATGCTGACAGCCTA This work analysis 5´-RACE 5´-RACE Inner Primer CGCGGATCC ACAGCCTACTGATGATCAGTCGATG This work analysis Pcap-F CATGCCATGGACCATTGCTTCTTTAATGTAGTG β-gal assays This work Pcap-R ACCGGATCCTTTAGTACTTTTCATTTGCATAGTTCCCTC β-gal assays This work Bc2-Overlap-F GAAACAAAAAAAGAATAAAGTTATATAAATATAAAAAATAGGAG Overlap PCR This work Bc2-Overlap-R TTTTATATTTATATAACTTTATTCTTTTTTTGTTTCATTTTCCTC Overlap PCR This work RTgap-F TTTTGCTAGCGCTTTCGCAG qPCR assays This work RTgap-R TAGCGCCTGTTGTGAAGGTG qPCR assays This work RTcap-F GACAGAGAGACCGAAGCCAC qPCR assays This work RTcap-R ACTCATGCCCAGGTCCTAATG qPCR assays This work RTBc2-F CGTCCAGACGGTATAGTAATATTTG qPCR assays This work RTBc2-R AGCTTTGCGGCCTATCCTTT qPCR assays This work Bc2-U-F CGACGCGTCTAAATTAACCTTAGAAGCAGTG Bc2 knockout This work Bc2-D-R CGGGATCCATTTACATATACAAGCCAATCAGC Bc2 knockout This work 10 A11T-b CTTTCGAATAGTGTGCAAAAAATATCT Site mutation This work A11T-c AGATATTTTTTGCACACTATTCGAAAG Site mutation This work C38T-b CGAAAGGATAGGCCGTAAAGCTTAGAGTCTA Site mutation This work C38T-c TAGACTCTAAGCTTTACGGCCTATCCTTTCG Site mutation This work A38T-b CGTAGACTCTAAGCTTAGCGGCCTATC Site mutation This work A38T-c GTATGGCCGCTAAGCTTAGAGTCTACG Site mutation This work 11 Table S2 c-di-GMP-I riboswitch Samples Genome Location Sequence* [Cellvibrio] gilvus ATCC CP002665.1 3443557-3443482 TCAGCGAAACGGCAAACCCTCCGCGAGGAGGGGACGCAAAGCCACGGGACCCACGACGGTCAGCCGGGCTACCGAA 13127 [Cellvibrio] gilvus ATCC CP002665.1 1473921-1473997 CAGCGACAACGGCAAACCCTCCGCAAGGAGGGGACGCAAAGCCAACGGGACCCACGCAGGTCAGCCGAGCTACCGAA 13127 Acaryochloris marina CP000828.1 4797700-4797614 TCCTCGAAACGGCAACTTGTCTCGAAAGAGCAAGACGCAAATTAACGAGTCTAACCCTTTATAGGCATGATGGTCGTTAATACCGAA MBIC11017 Acaryochloris marina CP000828.1 1721607-1721514 TCCCCGAAATGGCAACTTGCACCGAAAGGGTAAGGCGCAAATTAGCAGGCCTAAAATCCAAGCATTACGGGGTATGGATGCTGCTAGTGTCGAA MBIC11017 Acaryochloris sp. CCMEE AFEJ01000324.1 22061-21975 TCCTCGAAACGGCAACTTGTCTCGAAAGAGCAAGACGCAAATTAACGAGTCTAACCCTTTATAGGCATGATGGTCGTTAATACCGAA 5410 contig00482 Acaryochloris sp. CCMEE AFEJ01000341.1 4160-4067 TCCCCGAAATGGCAACTTGCACCGAAAGGGTAAGACGCAGATTAGCAGACCTAAAGTCCAAGCATTACGGGGTATGGATGCTGCTAGTGTCGAA 5410 contig00499 Acetivibrio cellulolyticus AEDB01000015.1 21591-21687 TATGAAACAGGGCAAAGTCGTTGAAAGACGGCGACGCAAAGCTGTGGGTCTAACGTTTGGGGAAGATGCCTTGAACTACGATTGCCAAGCTGCCATT CD2 ctg00137 Acetivibrio cellulolyticus AEDB01000040.1 12119-12214 TATGAAACAGGGCAAAATCATTGAAAAATGATGACGCAAAGCTATGGGTCTAAGTTAAGGATTATATATCCTTGATATGATCGCCAAGTTGCCATT CD2 ctg00142 Acetivibrio cellulolyticus AEDB01000011.1 99531-99625 TATGAAACAGGGCAAAGTTGTCGAAAGGCAATGACGCAAAGCCTTGGGTCTAAAGCTGAGACGAAAGTCAAAGCTAAGATAGCCGGGTTGCCATT CD2 ctg00148 Acetivibrio cellulolyticus AEDB01000061.1 5161-5244 CATTTGAAATGGTAAACCTGGTGAAAACCAGTGACACAAAGCTACGGGTCTAAGGTCTTTGACTAAGACAGCCGAGTTGCCGAA CD2 ctg00149 12 Acetivibrio cellulolyticus AEDB01000070.1 14624-14708 ATTTGTAAAAGGCAAATCTATCGAAAGATAGAGACGCAAAACTACGGGTCTACGGTCGCTTGACTACGACAGCCGGGTTGCCAAG CD2 ctg00157 Acetivibrio cellulolyticus AEDB01000070.1 14797-14882 TTTCGAAAATGGCAAACTCAATGAAAATTGAGGACGCAAAACTACAGGTCTACGGGTTTCATTACTATGATGGCTGAGTTACCGAA CD2 ctg00157 Acetohalobium arabaticum CP002105.1 239557-239640 CCTCAAAAAAGGCACACTTGCTGAAAAGTAAGGTCGCAAAGTCTTGAGTCTAAAGCATAAAGCCATGACTGTCGGACTGCTGAA DSM 5501 Acetohalobium arabaticum CP002105.1 1744836-1744745 AACTAGAAAGGGCACACTTATCGAAAGGTAAGGCCGCAAAGCTTCAAATCTACAGTGCAGTATAAAGGCACTATGATAGTTGGGCTACCACA DSM 5501 Acetonema longum DSM AFGF01000098.1 31377-31462 TAATAAACACGGCAAACTTATTGAAAAATAAGGACGCAAAGCTATGGGTCTACGTACTTTAAGTATATGGCTGCCAGGTTGCAAAA 6540 Contig00098 Acholeplasma laidlawii CP000896.1 1183288-1183213 ATTAATATTTGGCAAACTATATGAAAATATAGGGCGCAAAACTATAGGGCCTTGAAAATGGTAGCCAGCTGCATAA PG-8A Acholeplasma laidlawii CP000896.1 1029409-1029330 AAGATTAAAAGGCAAACTTAAGGTAACTTAAGGACGCAAAACTAAAGGGTCTAATTAGTAATAGACAGCCAGTTGCATCG PG-8A Acholeplasma laidlawii CP000896.1 1036967-1036891 TAAAGTTTTTGGCAAAATTAGGGTAACCTAATGACGCAAAACTATAGGGCCTATATATTAGGCAGCCAGTTGCACTT