This Is a Pre-Copyedited, Author-Produced Version of an Article Accepted for Publication, Following Peer Review
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Comparative Phylogeny of the Genus Bordetella Using Sequence Analysis of 16S Rrna and Ompa Genes
J Med Bacteriol. Vol. 6, No. 3, 4 (2017): pp.1-13 jmb.tums.ac.ir Comparative Phylogeny of the Genus Bordetella Using Sequence Analysis of 16S rRNA and ompA Genes Ali Badamchi 1, Moslem Papizadeh 2* 1 Children's Medical Center Hospital, Tehran University of Medical Sciences, Tehran, Iran. 2 Department of Microbiology, Pasteur Institute of Iran (IPI), Tehran, Iran. ARTICLE INFO ABSTRACT Article type: Background: The genus Bordetella harbors 16 species; three of them are well-known for their high Original Article medical importance. The phylogenetic diversity of the genus is currently not very well investigated. Methods: In this study, 16S rRNA gene sequence of 16 type strains of the Bordetella species were Article history: analyzed. Also, phylogenies conducted on the same gene of 247 isolates of Bordetella species, Received: 19 Jan 2017 comprising a wide physiological as well as ecological diversity and encompassing ex-type Revised: Jun Mar 2017 representatives of the 16 Bordetella species, were analyzed. Accepted: 11 Sep 2017 Results: It was found that the phylogenetic diversity of the genus may be very different from that is Published: 15 Oct 2017 currently assumed. Interestingly, the 16S rRNA gene signals could not resolve some species with Keywords: promising bootstrap and posterior probability values as our phylogenies, using maximum likelihood Alcaligenaceae, and Bayesian inference methods, showed. Biogeography, Bordetella Conclusion: Our results indicate a probable need for additional phylogenetic signals which can be species, Ecological provided by coding genes. Therefore, sequence data of ompA gene of Bordetella species, a critically distribution, Phylogenetic significant genomic region in pathogenesis, was here analyzed, phylogenetically. -
The Syntrophy Hypothesis for the Origin of Eukaryotes Revisited Purificación López-García, David Moreira
The Syntrophy hypothesis for the origin of eukaryotes revisited Purificación López-García, David Moreira To cite this version: Purificación López-García, David Moreira. The Syntrophy hypothesis for the origin of eukaryotes revisited. Nature Microbiology, Nature Publishing Group, 2020, 5 (5), pp.655-667. 10.1038/s41564- 020-0710-4. hal-02988531 HAL Id: hal-02988531 https://hal.archives-ouvertes.fr/hal-02988531 Submitted on 3 Dec 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 2 Perspectives 3 4 5 6 The Syntrophy hypothesis for the origin of eukaryotes revisited 7 8 Purificación López-García1 and David Moreira1 9 10 1 Ecologie Systématique Evolution, CNRS, Université Paris-Saclay, AgroParisTech, Orsay, France 11 12 13 14 *Correspondence to: [email protected] 15 16 17 18 19 1 20 The discovery of Asgard archaea, phylogenetically closer to eukaryotes than other archaea, together with 21 improved knowledge of microbial ecology impose new constraints on emerging models for the origin of the 22 eukaryotic cell (eukaryogenesis). Long-held views are metamorphosing in favor of symbiogenetic models 23 based on metabolic interactions between archaea and bacteria. These include the classical Searcy’s and 24 hydrogen hypothesis, and the more recent Reverse Flow and Entangle-Engulf-Enslave (E3) models. -
Genome-Resolved Meta-Analysis of the Microbiome in Oil Reservoirs Worldwide
microorganisms Article Genome-Resolved Meta-Analysis of the Microbiome in Oil Reservoirs Worldwide Kelly J. Hidalgo 1,2,* , Isabel N. Sierra-Garcia 3 , German Zafra 4 and Valéria M. de Oliveira 1 1 Microbial Resources Division, Research Center for Chemistry, Biology and Agriculture (CPQBA), University of Campinas–UNICAMP, Av. Alexandre Cazellato 999, 13148-218 Paulínia, Brazil; [email protected] 2 Graduate Program in Genetics and Molecular Biology, Institute of Biology, University of Campinas (UNICAMP), Rua Monteiro Lobato 255, Cidade Universitária, 13083-862 Campinas, Brazil 3 Biology Department & CESAM, University of Aveiro, Aveiro, Portugal, Campus de Santiago, Avenida João Jacinto de Magalhães, 3810-193 Aveiro, Portugal; [email protected] 4 Grupo de Investigación en Bioquímica y Microbiología (GIBIM), Escuela de Microbiología, Universidad Industrial de Santander, Cra 27 calle 9, 680002 Bucaramanga, Colombia; [email protected] * Correspondence: [email protected]; Tel.: +55-19981721510 Abstract: Microorganisms inhabiting subsurface petroleum reservoirs are key players in biochemical transformations. The interactions of microbial communities in these environments are highly complex and still poorly understood. This work aimed to assess publicly available metagenomes from oil reservoirs and implement a robust pipeline of genome-resolved metagenomics to decipher metabolic and taxonomic profiles of petroleum reservoirs worldwide. Analysis of 301.2 Gb of metagenomic information derived from heavily flooded petroleum reservoirs in China and Alaska to non-flooded petroleum reservoirs in Brazil enabled us to reconstruct 148 metagenome-assembled genomes (MAGs) of high and medium quality. At the phylum level, 74% of MAGs belonged to bacteria and 26% to archaea. The profiles of these MAGs were related to the physicochemical parameters and recovery management applied. -
Phylogenomics Provides Robust Support for a Two-Domains Tree of Life
ARTICLES https://doi.org/10.1038/s41559-019-1040-x Phylogenomics provides robust support for a two-domains tree of life Tom A. Williams! !1*, Cymon J. Cox! !2, Peter G. Foster3, Gergely J. Szöllősi4,5,6 and T. Martin Embley7* Hypotheses about the origin of eukaryotic cells are classically framed within the context of a universal ‘tree of life’ based on conserved core genes. Vigorous ongoing debate about eukaryote origins is based on assertions that the topology of the tree of life depends on the taxa included and the choice and quality of genomic data analysed. Here we have reanalysed the evidence underpinning those claims and apply more data to the question by using supertree and coalescent methods to interrogate >3,000 gene families in archaea and eukaryotes. We find that eukaryotes consistently originate from within the archaea in a two-domains tree when due consideration is given to the fit between model and data. Our analyses support a close relation- ship between eukaryotes and Asgard archaea and identify the Heimdallarchaeota as the current best candidate for the closest archaeal relatives of the eukaryotic nuclear lineage. urrent hypotheses about eukaryotic origins generally pro- Indeed, it has previously been suggested that it is the 3D tree, rather pose at least two partners in that process: a bacterial endo- than the 2D tree, that is an artefact of long-branch attraction5,9–11, symbiont that became the mitochondrion and a host cell for both because analyses under better-fitting models have recovered C 1–4 that endosymbiosis . The identity of the host has been informed a 2D tree but also because the 3D topology is one in which the two by analyses of conserved genes for the transcription and transla- longest branches in the tree of life—the stems leading to bacteria and tion machinery that are considered essential for cellular life5. -
Phylogenetics of Archaeal Lipids Amy Kelly 9/27/2006 Outline
Phylogenetics of Archaeal Lipids Amy Kelly 9/27/2006 Outline • Phlogenetics of Archaea • Phlogenetics of archaeal lipids • Papers Phyla • Two? main phyla – Euryarchaeota • Methanogens • Extreme halophiles • Extreme thermophiles • Sulfate-reducing – Crenarchaeota • Extreme thermophiles – Korarchaeota? • Hyperthermophiles • indicated only by environmental DNA sequences – Nanoarchaeum? • N. equitans a fast evolving euryarchaeal lineage, not novel, early diverging archaeal phylum – Ancient archael group? • In deepest brances of Crenarchaea? Euryarchaea? Archaeal Lipids • Methanogens – Di- and tetra-ethers of glycerol and isoprenoid alcohols – Core mostly archaeol or caldarchaeol – Core sometimes sn-2- or Images removed due to sn-3-hydroxyarchaeol or copyright considerations. macrocyclic archaeol –PMI • Halophiles – Similar to methanogens – Exclusively synthesize bacterioruberin • Marine Crenarchaea Depositional Archaeal Lipids Biological Origin Environment Crocetane methanotrophs? methane seeps? methanogens, PMI (2,6,10,15,19-pentamethylicosane) methanotrophs hypersaline, anoxic Squalane hypersaline? C31-C40 head-to-head isoprenoids Smit & Mushegian • “Lost” enzymes of MVA pathway must exist – Phosphomevalonate kinase (PMK) – Diphosphomevalonate decarboxylase – Isopentenyl diphosphate isomerase (IPPI) Kaneda et al. 2001 Rohdich et al. 2001 Boucher et al. • Isoprenoid biosynthesis of archaea evolved through a combination of processes – Co-option of ancestral enzymes – Modification of enzymatic specificity – Orthologous and non-orthologous gene -
Table S1. Primers Used for PCR Amplification
Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv. -
Template for Taxonomic Proposal to the ICTV Executive Committee to Create a New Family
Template for Taxonomic Proposal to the ICTV Executive Committee To create a new Family Code† 2005.088B.04 To create a new family* Code† 2005.089B.04 To name the new family* Ampullaviridae † Code 2005.090B.04 To designate the following genera as part of the new family*: Ampullavirus † Assigned by ICTV officers ° Leave blank is not appropriate * repeat these lines and the corresponding arguments for each genus created in the family Author(s) with email address(es) of the Taxonomic Proposal David Prangishvili [email protected] Old Taxonomic Order Order Family Genus Ampullavirus Type Species Acidianus bottle-shaped virus Species in the Genus Acidianus bottle-shaped virus Tentative Species in the Genus none Unassigned Species in the family none New Taxonomic Order Order Family Ampullaviridae Genus Ampullavirus Type Species Acidianus bottle-shaped virus Species in the Genus Acidianus bottle-shaped virus Tentative Species in the Genus none Unassigned Species in the family none ICTV-EC comments and response of the SG Argumentation to create a new family: We propose classifying the Acidianus bottle-shaped virus as a first representative of a new family because of the unique bottle-shaped morphology of the virion which, to our knowledge, has not previously been observed in the viral world. Moreover, the complex asymmetric virion, lacking elements with icosahedral or regular helical symmetry, with two completely different structures at each end and an envelope encasing a funnel-shaped core represents, as far as we can judge, represents a principally novel type of virus particle. The funnel-shaped core of the enveloped virion consists of three distinct structural units: the “stopper”, the nucleoprotein cone, consisting of double-stranded DNA and DNA-binding proteins, and the inner core. -
Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella
ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF). -
Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4
routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella. -
Archaeoglobus Profundus Type Strain (AV18T)
Standards in Genomic Sciences (2010) 2:327-346 DOI:10.4056/sigs.942153 Complete genome sequence of Archaeoglobus profundus type strain (AV18T) Mathias von Jan1, Alla Lapidus2, Tijana Glavina Del Rio2, Alex Copeland2, Hope Tice2, Jan-Fang Cheng2, Susan Lucas2, Feng Chen2, Matt Nolan2, Lynne Goodwin2,3, Cliff Han2,3, Sam Pitluck2, Konstantinos Liolios2, Natalia Ivanova2, Konstantinos Mavromatis2, Galina Ovchinnikova2, Olga Chertkov2, Amrita Pati2, Amy Chen4, Krishna Palaniappan4, Miriam Land2,5, Loren Hauser2,5, Yun-Juan Chang2,5, Cynthia D. Jeffries2,5, Elizabeth Saunders2, Thomas Brettin2,3, John C. Detter2,3, Patrick Chain2,4, Konrad Eichinger6, Harald Huber6, Ste- fan Spring1, Manfred Rohde7, Markus Göker1, Reinhard Wirth6, Tanja Woyke2, Jim Bristow2, Jonathan A. Eisen2,8, Victor Markowitz4, Philip Hugenholtz2, Nikos C Kyrpides2, and Hans-Peter Klenk1* 1 DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany 2 DOE Joint Genome Institute, Walnut Creek, California, USA 3 Los Alamos National Laboratory, Bioscience Division, Los Alamos, New Mexico, USA 4 Biological Data Management and Technology Center, Lawrence Berkeley National Laboratory, Berkeley, California, USA 5 Oak Ridge National Laboratory, Oak Ridge, Tennessee, USA 6 University of Regensburg, Microbiology – Archaeenzentrum, Regensburg, Germany 7 HZI – Helmholtz Centre for Infection Research, Braunschweig, Germany 8 University of California Davis Genome Center, Davis, California, USA *Corresponding author: Hans-Peter Klenk Keywords: hyperthermophilic, marine, strictly anaerobic, sulfate respiration, hydrogen utili- zation, hydrothermal systems, Archaeoglobaceae, GEBA Archaeoglobus profundus (Burggraf et al. 1990) is a hyperthermophilic archaeon in the eu- ryarchaeal class Archaeoglobi, which is currently represented by the single family Archaeog- lobaceae, containing six validly named species and two strains ascribed to the genus 'Geoglobus' which is taxonomically challenged as the corresponding type species has no va- lidly published name. -
Structure and Function of Benzylsuccinate Synthase and Related Fumarate-Adding Glycyl Radical Enzymes
Review Article J Mol Microbiol Biotechnol 2016;26:29–44 Published online: March 10, 2016 DOI: 10.1159/000441656 Structure and Function of Benzylsuccinate Synthase and Related Fumarate-Adding Glycyl Radical Enzymes a d c a Johann Heider Maciej Szaleniec Berta M. Martins Deniz Seyhan a, b e Wolfgang Buckel Bernard T. Golding a Laboratory of Microbial Biochemistry, LOEWE Center for Synthetic Microbiology, Philipps University Marburg, b c and Max-Planck-Institut für terrestrische Mikrobiologie, Marburg , and Institut für Biologie, Strukturbiologie/ d Biochemie, Humboldt-Universität zu Berlin, Berlin , Germany; Jerzy Haber Institute of Catalysis and Surface e Chemistry, Polish Academy of Sciences, Kraków , Poland; School of Chemistry, Newcastle University, Newcastle upon Tyne , UK Key Words Anaerobic Toluene Degradation Benzylsuccinate synthase · Fumarate-adding enzyme · Glycyl radical · Toluene · Alkane · Anaerobic toluene Hydrocarbons were long believed to be resistant to degradation microbial degradation in the absence of oxygen. It was therefore surprising to find that many bacteria degrade these compounds anaerobically [Aeckersberg et al., 1991; Abstract Dolfing et al., 1990; Rabus et al., 1993; Vogel and Grbic- The pathway of anaerobic toluene degradation is initiated Galic, 1986; Zeyer et al., 1986]. After the initial reports by a remarkable radical-type enantiospecific addition of the dating from 1986, the degradation pathways employed chemically inert methyl group to the double bond of a fuma- by these bacteria remained enigmatic for a decade. How- rate cosubstrate to yield (R) -benzylsuccinate as the first in- ever, over the last 20 years, various oxygen-independent termediate, as catalyzed by the glycyl radical enzyme ben- reactions have been characterized for the activation of zylsuccinate synthase. -
Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma Divulgatum
microorganisms Article Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma divulgatum Rafael Bargiela 1 , Karin Lanthaler 1,2, Colin M. Potter 1,2 , Manuel Ferrer 3 , Alexander F. Yakunin 1,2, Bela Paizs 1,2, Peter N. Golyshin 1,2 and Olga V. Golyshina 1,2,* 1 School of Natural Sciences, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK; [email protected] (R.B.); [email protected] (K.L.); [email protected] (C.M.P.); [email protected] (A.F.Y.); [email protected] (B.P.); [email protected] (P.N.G.) 2 Centre for Environmental Biotechnology, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK 3 Systems Biotechnology Group, Department of Applied Biocatalysis, CSIC—Institute of Catalysis, Marie Curie 2, 28049 Madrid, Spain; [email protected] * Correspondence: [email protected]; Tel.: +44-1248-388607; Fax: +44-1248-382569 Received: 27 April 2020; Accepted: 15 May 2020; Published: 19 May 2020 Abstract: The archaeon Cuniculiplasma divulgatum is ubiquitous in acidic environments with low-to-moderate temperatures. However, molecular mechanisms underlying its ability to thrive at lower temperatures remain unexplored. Using mass spectrometry (MS)-based proteomics, we analysed the effect of short-term (3 h) exposure to cold. The C. divulgatum genome encodes 2016 protein-coding genes, from which 819 proteins were identified in the cells grown under optimal conditions. In line with the peptidolytic lifestyle of C. divulgatum, its intracellular proteome revealed the abundance of proteases, ABC transporters and cytochrome C oxidase. From 747 quantifiable polypeptides, the levels of 582 proteins showed no change after the cold shock, whereas 104 proteins were upregulated suggesting that they might be contributing to cold adaptation.