DOCSLIB.ORG

Mouse Mrps24 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Mrps24 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Mrps24 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Mrps24 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Mrps24 gene (NCBI Reference Sequence: NM_026080 ; Ensembl: ENSMUSG00000020477 ) is located on Mouse chromosome 11. 4 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 4 (Transcript: ENSMUST00000154330). Exon 4 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Mrps24 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-387E5 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 4 covers 56.09% of the coding region. Start codon is in exon 1, and stop codon is in exon 4. The size of intron 3 for 5'-loxP site insertion: 2565 bp. The size of effective cKO region: ~1500 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 4 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Mrps24 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. It may be difficult to construct this targeting vector. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(6781bp) | A(24.48% 1660) | C(22.7% 1539) | T(27.62% 1873) | G(25.2% 1709) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. Significant high GC-content regions are found. It may be difficult to construct this targeting vector. Page 3 of 7 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr11 - 5704983 5707982 3000 browser details YourSeq 160 2301 2579 3000 87.3% chr16 - 14093161 14093369 209 browser details YourSeq 160 2379 2580 3000 93.6% chr19 + 7248820 7249104 285 browser details YourSeq 159 2388 2579 3000 93.6% chr13 + 58367231 58367426 196 browser details YourSeq 157 2395 2579 3000 92.7% chr5 - 102731253 102731435 183 browser details YourSeq 157 2411 2581 3000 96.0% chr2 - 164511712 164511882 171 browser details YourSeq 157 2392 2571 3000 96.0% chr3 + 88963176 88963366 191 browser details YourSeq 153 2408 2579 3000 95.3% chr2 + 103905309 103905681 373 browser details YourSeq 150 2380 2573 3000 87.8% chr13 - 112861665 112861835 171 browser details YourSeq 145 2417 2579 3000 94.5% chr9 + 115830737 115830899 163 browser details YourSeq 142 2417 2579 3000 93.9% chr5 - 90203584 90203751 168 browser details YourSeq 136 2417 2579 3000 92.0% chrX + 101446819 101446981 163 browser details YourSeq 134 2439 2579 3000 97.9% chr15 - 73500057 73500323 267 browser details YourSeq 129 2417 2570 3000 93.3% chr18 + 11669704 11669865 162 browser details YourSeq 122 2431 2570 3000 93.6% chr12 - 110720852 110720991 140 browser details YourSeq 122 2445 2580 3000 94.9% chr11 + 84061078 84061213 136 browser details YourSeq 119 2416 2544 3000 96.2% chr9 - 113925906 113926034 129 browser details YourSeq 96 1 103 3000 99.0% chr7 + 82624741 82624846 106 browser details YourSeq 96 1 107 3000 91.0% chr2 + 122542403 122542501 99 browser details YourSeq 96 1 108 3000 97.1% chr12 + 87490032 87490141 110 Note: The 3000 bp section upstream of Exon 4 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr11 - 5701452 5704451 3000 browser details YourSeq 643 1303 2212 3000 89.1% chr6 - 141916054 142141636 225583 browser details YourSeq 628 1341 2203 3000 90.8% chr6 + 103156720 103157632 913 browser details YourSeq 623 1412 2204 3000 91.6% chr19 - 55169258 55170112 855 browser details YourSeq 611 1397 2204 3000 90.2% chr3 - 103071634 103072509 876 browser details YourSeq 604 1312 2146 3000 88.9% chr1 - 41844901 41845779 879 browser details YourSeq 601 1370 2204 3000 88.8% chr16 + 66128936 66129849 914 browser details YourSeq 593 1383 2206 3000 88.9% chr8 - 72059737 72060622 886 browser details YourSeq 593 1428 2205 3000 90.5% chr6 - 10900926 10901749 824 browser details YourSeq 588 1364 2204 3000 89.1% chr9 + 119857357 119858246 890 browser details YourSeq 574 1368 2205 3000 89.6% chr6 + 41330755 41331670 916 browser details YourSeq 573 1367 2205 3000 89.8% chr12 + 111522142 111523054 913 browser details YourSeq 570 1383 2204 3000 89.0% chr19 - 17543981 17544863 883 browser details YourSeq 567 1382 2142 3000 90.0% chr6 - 11678596 11679412 817 browser details YourSeq 563 1318 2145 3000 86.9% chr1 + 100806468 100807347 880 browser details YourSeq 562 1412 2204 3000 90.4% chr3 - 21747304 21748177 874 browser details YourSeq 559 1303 2205 3000 90.9% chr13 - 13842728 13843660 933 browser details YourSeq 558 1410 2202 3000 90.9% chr19 - 30219459 30220494 1036 browser details YourSeq 554 1422 2204 3000 89.1% chr1 + 44328951 44329770 820 browser details YourSeq 552 1423 2192 3000 89.9% chr3 - 42523330 42524160 831 Note: The 3000 bp section downstream of Exon 4 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 https://www.alphaknockout.com Gene and protein information: Mrps24 mitochondrial ribosomal protein S24 [ Mus musculus (house mouse) ] Gene ID: 64660, updated on 12-Aug-2019 Gene summary Official Symbol Mrps24 provided by MGI Official Full Name mitochondrial ribosomal protein S24 provided by MGI Primary source MGI:MGI:1928142 See related Ensembl:ENSMUSG00000020477 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as S24mt; Rpms24; MRP-S24; AI414579; 3110030K20Rik Expression Ubiquitous expression in adrenal adult (RPKM 188.3), stomach adult (RPKM 152.2) and 27 other tissues See more Orthologs human all Genomic context Location: 11; 11 A1 See Mrps24 in Genome Data Viewer Exon count: 4 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 11 NC_000077.6 (5703982..5707701, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 11 NC_000077.5 (5603986..5607702, complement) Chromosome 11 - NC_000077.6 Page 5 of 7 https://www.alphaknockout.com Transcript information: This gene has 5 transcripts Gene: Mrps24 ENSMUSG00000020477 Description mitochondrial ribosomal protein S24 [Source:MGI Symbol;Acc:MGI:1928142] Gene Synonyms 3110030K20Rik, Rpms24 Location Chromosome 11: 5,703,983-5,715,680 reverse strand. GRCm38:CM001004.2 About this gene This gene has 5 transcripts (splice variants), 200 orthologues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Mrps24-205 ENSMUST00000154330.1 995 167aa ENSMUSP00000119535.1 Protein coding CCDS24402 Q9CQV5 TSL:1 GENCODE basic APPRIS P1 Mrps24-201 ENSMUST00000020770.10 700 No protein - Retained intron - - TSL:2 Mrps24-203 ENSMUST00000132874.1 503 No protein - Retained intron - - TSL:3 Mrps24-202 ENSMUST00000123697.1 418 No protein - Retained intron - - TSL:2 Mrps24-204 ENSMUST00000149980.1 714 No protein - lncRNA - - TSL:3 31.70 kb Forward strand 5.70Mb 5.71Mb 5.72Mb Contigs AL627069.10 > Genes (Comprehensive set... < Mrps24-205protein coding < Urgcp-201protein coding < Mrps24-201retained intron < Urgcp-206protein coding < Mrps24-204lncRNA < Urgcp-205protein coding < Mrps24-203retained intron < Urgcp-202protein coding < Mrps24-202retained intron < Urgcp-204protein coding < Urgcp-203protein coding Regulatory Build 5.70Mb 5.71Mb 5.72Mb Reverse strand 31.70 kb Regulation Legend CTCF Open Chromatin Promoter Promoter Flank Gene Legend Protein Coding Ensembl protein coding merged Ensembl/Havana Non-Protein Coding RNA gene processed transcript Page 6 of 7 https://www.alphaknockout.com Transcript: ENSMUST00000154330 < Mrps24-205protein coding Reverse strand 3.71 kb ENSMUSP00000119... Low complexity (Seg) Pfam 28S ribosomal protein S24, mitochondrial PANTHER 28S ribosomal protein S24, mitochondrial All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend stop gained frameshift variant missense variant splice region variant synonymous variant Scale bar 0 20 40 60 80 100 120 140 167 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 7 of 7.
Load more

Recommended publications
  • Role of Mitochondrial Ribosomal Protein S18-2 in Cancerogenesis and in Regulation of Stemness and Differentiation
    From THE DEPARTMENT OF MICROBIOLOGY TUMOR AND CELL BIOLOGY (MTC) Karolinska Institutet, Stockholm, Sweden ROLE OF MITOCHONDRIAL RIBOSOMAL PROTEIN S18-2 IN CANCEROGENESIS AND IN REGULATION OF STEMNESS AND DIFFERENTIATION Muhammad Mushtaq Stockholm 2017 All previously published papers were reproduced with permission from the publisher. Published by Karolinska Institutet. Printed by E-Print AB 2017 © Muhammad Mushtaq, 2017 ISBN 978-91-7676-697-2 Role of Mitochondrial Ribosomal Protein S18-2 in Cancerogenesis and in Regulation of Stemness and Differentiation THESIS FOR DOCTORAL DEGREE (Ph.D.) By Muhammad Mushtaq Principal Supervisor: Faculty Opponent: Associate Professor Elena Kashuba Professor Pramod Kumar Srivastava Karolinska Institutet University of Connecticut Department of Microbiology Tumor and Cell Center for Immunotherapy of Cancer and Biology (MTC) Infectious Diseases Co-supervisor(s): Examination Board: Professor Sonia Lain Professor Ola Söderberg Karolinska Institutet Uppsala University Department of Microbiology Tumor and Cell Department of Immunology, Genetics and Biology (MTC) Pathology (IGP) Professor George Klein Professor Boris Zhivotovsky Karolinska Institutet Karolinska Institutet Department of Microbiology Tumor and Cell Institute of Environmental Medicine (IMM) Biology (MTC) Professor Lars-Gunnar Larsson Karolinska Institutet Department of Microbiology Tumor and Cell Biology (MTC) Dedicated to my parents ABSTRACT Mitochondria carry their own ribosomes (mitoribosomes) for the translation of mRNA encoded by mitochondrial DNA. The architecture of mitoribosomes is mainly composed of mitochondrial ribosomal proteins (MRPs), which are encoded by nuclear genomic DNA. Emerging experimental evidences reveal that several MRPs are multifunctional and they exhibit important extra-mitochondrial functions, such as involvement in apoptosis, protein biosynthesis and signal transduction. Dysregulations of the MRPs are associated with severe pathological conditions, including cancer.
    [Show full text]
  • 1 AGING Supplementary Table 2
    SUPPLEMENTARY TABLES Supplementary Table 1. Details of the eight domain chains of KIAA0101. Serial IDENTITY MAX IN COMP- INTERFACE ID POSITION RESOLUTION EXPERIMENT TYPE number START STOP SCORE IDENTITY LEX WITH CAVITY A 4D2G_D 52 - 69 52 69 100 100 2.65 Å PCNA X-RAY DIFFRACTION √ B 4D2G_E 52 - 69 52 69 100 100 2.65 Å PCNA X-RAY DIFFRACTION √ C 6EHT_D 52 - 71 52 71 100 100 3.2Å PCNA X-RAY DIFFRACTION √ D 6EHT_E 52 - 71 52 71 100 100 3.2Å PCNA X-RAY DIFFRACTION √ E 6GWS_D 41-72 41 72 100 100 3.2Å PCNA X-RAY DIFFRACTION √ F 6GWS_E 41-72 41 72 100 100 2.9Å PCNA X-RAY DIFFRACTION √ G 6GWS_F 41-72 41 72 100 100 2.9Å PCNA X-RAY DIFFRACTION √ H 6IIW_B 2-11 2 11 100 100 1.699Å UHRF1 X-RAY DIFFRACTION √ www.aging-us.com 1 AGING Supplementary Table 2. Significantly enriched gene ontology (GO) annotations (cellular components) of KIAA0101 in lung adenocarcinoma (LinkedOmics). Leading Description FDR Leading Edge Gene EdgeNum RAD51, SPC25, CCNB1, BIRC5, NCAPG, ZWINT, MAD2L1, SKA3, NUF2, BUB1B, CENPA, SKA1, AURKB, NEK2, CENPW, HJURP, NDC80, CDCA5, NCAPH, BUB1, ZWILCH, CENPK, KIF2C, AURKA, CENPN, TOP2A, CENPM, PLK1, ERCC6L, CDT1, CHEK1, SPAG5, CENPH, condensed 66 0 SPC24, NUP37, BLM, CENPE, BUB3, CDK2, FANCD2, CENPO, CENPF, BRCA1, DSN1, chromosome MKI67, NCAPG2, H2AFX, HMGB2, SUV39H1, CBX3, TUBG1, KNTC1, PPP1CC, SMC2, BANF1, NCAPD2, SKA2, NUP107, BRCA2, NUP85, ITGB3BP, SYCE2, TOPBP1, DMC1, SMC4, INCENP. RAD51, OIP5, CDK1, SPC25, CCNB1, BIRC5, NCAPG, ZWINT, MAD2L1, SKA3, NUF2, BUB1B, CENPA, SKA1, AURKB, NEK2, ESCO2, CENPW, HJURP, TTK, NDC80, CDCA5, BUB1, ZWILCH, CENPK, KIF2C, AURKA, DSCC1, CENPN, CDCA8, CENPM, PLK1, MCM6, ERCC6L, CDT1, HELLS, CHEK1, SPAG5, CENPH, PCNA, SPC24, CENPI, NUP37, FEN1, chromosomal 94 0 CENPL, BLM, KIF18A, CENPE, MCM4, BUB3, SUV39H2, MCM2, CDK2, PIF1, DNA2, region CENPO, CENPF, CHEK2, DSN1, H2AFX, MCM7, SUV39H1, MTBP, CBX3, RECQL4, KNTC1, PPP1CC, CENPP, CENPQ, PTGES3, NCAPD2, DYNLL1, SKA2, HAT1, NUP107, MCM5, MCM3, MSH2, BRCA2, NUP85, SSB, ITGB3BP, DMC1, INCENP, THOC3, XPO1, APEX1, XRCC5, KIF22, DCLRE1A, SEH1L, XRCC3, NSMCE2, RAD21.
    [Show full text]
  • Using Edsurvey to Analyze NCES Data: an Illustration of Analyzing NAEP Primer
    Using EdSurvey to Analyze NCES Data: An Illustration of Analyzing NAEP Primer Developed by Michael Lee, Paul Bailey, Ahmad Emad, Ting Zhang, Trang Nguyen, and Jiao Yu*† February 21, 2020 Overview of the EdSurvey Package National Assessment of Educational Progress (NAEP) datasets from the National Center for Education Statistics (NCES) require special statistical methods to analyze. Because of their scope and complexity, the EdSurvey package gives users functions to perform analyses that account for both complex sample survey designs and the use of plausible values. The EdSurvey package also seamlessly takes advantage of the LaF package to read in data only when required for an analysis. Users with computers that have insuÿcient memory to read in entire NAEP datasets can still do analyses without having to write special code to read in just the appropriate variables. This situation is addressed directly in the EdSurvey package—behind the scenes and without any special tuning by the user. Vignette Outline This vignette will describe the basics of using the EdSurvey package for analyzing NAEP data as follows. • Notes – Additional resources – Vignette notation – Software requirements • Setting up the environment for analyzing NCES data – Installing and loading EdSurvey – Philosophy of Conducting Analyses Using the EdSurvey Package – Downloading data – Reading in data – Getting to know the data format – Removing special values • Explore Variable Distributions with summary2 • Subsetting the data • Retrieving data for further manipulation with getData *This publication was prepared for NCES under Contract No. ED-IES-12-D-0002 with the American Institutes for Research. Mention of trade names, commercial products, or organizations does not imply endorsement by the U.S.
    [Show full text]
  • Supplementary Table S1. ATM Alterations in the 1,661-Patient MSK-TMB Study
    Supplementary Table S1. ATM alterations in the 1,661-patient MSK-TMB study Cancer Type Total Mutation Fusion Bladder Cancer 215 23 0 Colorectal Cancer 110 11 0 Melanoma 320 26 0 Cancer of Unknown Primary 88 7 0 Non-Small Cell Lung Cancer 350 23 0 Esophagogastric Carcinoma 126 6 1 Breast Cancer 44 2 0 Glioma 117 3 0 Renal Cell Carcinoma 151 2 0 Head and Neck Cancer 139 1 0 Supplementary Table S2. ATM alternations in the 10,945-patient MSK-IMPACT study Cancer Type Total Mutation Deep deletion Amplification Multi-alterations Fusion Small Bowl Cancer 35 7 0 0 0 0 Skin Cancer, Non-Melaoma 148 19 1 0 0 0 Bladder Cancer 423 45 2 0 0 0 Endometrial Cancer 218 24 0 0 0 0 Hepatobiliary Cancer 355 27 0 0 0 0 Colorectal Cancer 1007 75 0 0 0 1 Mature B-Cell Neoplasms 134 8 0 0 2 0 Non-Small Cell Lung Cancer 1668 120 0 2 1 0 Melanoma 365 23 0 0 0 0 Appendiceal Cancer 79 4 0 0 0 0 Small Cell Lung Cancer 82 4 0 0 0 0 Prostate Cancer 717 25 7 1 0 0 Histiocytosis 22 1 0 0 0 0 Salivary Gland Cancer 114 5 0 0 0 0 Thyroid Cancer 231 10 0 0 0 0 Cancer of Unknown Primary 186 8 0 0 0 0 Breast Cancer 1324 48 3 2 0 0 Adrenocortical Carcinoma 25 1 0 0 0 0 Mature T and NK Neoplasms 29 1 0 0 0 0 Renal Cell Carcinoma 361 12 0 0 0 0 Head and Neck Cancer 186 14 0 0 0 1 Pancreatic Cancer 502 69 7 2 0 0 Glioma 553 14 1 0 0 0 Soft Tissue Sarcoma 443 13 1 0 0 0 Esophagogastric Cancer 341 8 1 0 0 0 Peripheral Nervous System 80 0 2 0 0 0 Germ Cell Tumor 288 2 0 1 0 1 Ovarian Can 244 2 1 0 0 0 Uterine Sarcoma 93 1 0 0 0 0 Mesothelioma 107 1 0 0 0 0 Bone Cancer 134 1 0 0 0 0 Gastrointestinal Stromal Ca 137 0 0 0 0 1 Supplementary Table S3.
    [Show full text]
  • The Pennsylvania State University the Graduate School Eberly
    The Pennsylvania State University The Graduate School Eberly College of Science REGULATION OF MITOCHONDRIAL TRANSLATION AND OXIDATIVE PHOSPHORYLATION THROUGH REVERSIBLE ACETYLATION A Dissertation in Biochemistry, Microbiology and Molecular Biology by Hüseyin Çimen 2012 Hüseyin Çimen Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2012 The Dissertation of Hüseyin Çimen was reviewed and approved* by the following: Emine C. Koc Assistant Professor of Biochemistry and Molecular Biology Dissertation Co-adviser Co-chair of Committee Hasan Koc Assistant Professor of Natural Sciences Dissertation Co-adviser Co-chair of Committee Craig E. Cameron Paul Berg Professor of Biochemistry and Molecular Biology Associate Department Head for Research and Graduate Education Joseph C. Reese Professor of Biochemistry and Molecular Biology Teh-hui Kao Professor of Biochemistry and Molecular Biology Tae-Hee Lee Assistant Professor of Chemistry and the Huck Institute of the Life Sciences Craig E. Cameron Paul Berg Professor of Biochemistry and Molecular Biology Associate Department Head of the Department of Biochemistry and Molecular Biology iii ABSTRACT In a eukaryotic cell, mitochondria provide energy in the form of ATP through oxidative phosphorylation (OXPHOS), which consists of five electron transport chain complexes embedded in the inner membrane of mitochondria. Human mitochondria have their own genome and transcription/translation system to synthesize mitochondrially encoded thirteen proteins of respiratory chain complexes. We investigated how acetylation of ribosomal proteins regulates translation and energy production in mitochondria since reversible acetylation of mitochondrial proteins was found to be critical for maintaining energy homeostasis. We identified mitochondrial ribosomal protein L10 (MRPL10) as the major acetylated ribosomal protein in mammalian mitochondria with two-dimensional gel electrophoresis followed by tandem mass spectrometry and immunoblotting analyses.
    [Show full text]
  • C6orf203 Controls OXPHOS Function Through Modulation of Mitochondrial Protein Biosynthesis
    bioRxiv preprint doi: https://doi.org/10.1101/704403; this version posted July 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. C6orf203 controls OXPHOS function through modulation of mitochondrial protein biosynthesis number of characters excluding Materials and Methods: 40,651 Sara Palacios-Zambrano1,2, Luis Vázquez-Fonseca1,2, Cristina González-Páramos1,2, Laura Mamblona1,2, Laura Sánchez-Caballero3, Leo Nijtmans3, Rafael Garesse1,2 and Miguel Angel Fernández-Moreno1,2,* 1 Departamento de Bioquímica, Instituto de Investigaciones Biomédicas “Alberto Sols” UAM CSIC and Centro de Investigación Biomédica en Red en Enfermedades Raras (CIBERER). Facultad de Medicina, Universidad Autónoma de Madrid. Madrid 28029, Spain. 2 Instituto de Investigación Sanitaria Hospital 12 de Octubre (imas12), Madrid 28041, Spain. 3 Department of Pediatrics, Radboud Center for Mitochondrial Medicine, Radboud University Medical Center, Nijmegen, The Netherlands. * To whom correspondence should be addressed. Tel:+34 91 497 31 29; Email: [email protected] Running title “C6orf203 controls mt-proteins synthesis” bioRxiv preprint doi: https://doi.org/10.1101/704403; this version posted July 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Mitochondria are essential organelles present in the vast majority of eukaryotic cells. Their central function is to produce cellular energy through the OXPHOS system, and functional alterations provoke so-called mitochondrial OXPHOS diseases. It is estimated that several hundred mitochondrial proteins have unknown functions. Very recently, C6orf203 was described to participate in mitochondrial transcription under induced mitochondrial DNA depletion stress conditions.
    [Show full text]
  • Human MRPS24 ORF Mammalian Expression Plasmid, N-Myc Tag
    Human MRPS24 ORF mammalian expression plasmid, N-Myc tag Catalog Number: HG16377-NM General Information Plasmid Resuspension protocol Gene : mitochondrial ribosomal protein S24 1. Centrifuge at 5,000×g for 5 min. Official Symbol : MRPS24 2. Carefully open the tube and add 100 l of sterile water to Synonym : S24mt, bMRP47, HSPC335, MRP-S24, dissolve the DNA. bMRP-47 3. Close the tube and incubate for 10 minutes at room Source : Human temperature. cDNA Size: 504bp 4. Briefly vortex the tube and then do a quick spin to RefSeq : NM_032014.2 concentrate the liquid at the bottom. Speed is less than Description 5000×g. Lot : Please refer to the label on the tube 5. Store the plasmid at -20 ℃. Vector : pCMV3-N-Myc Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. The plasmid is ready for: Storage : • Restriction enzyme digestion The lyophilized plasmid can be stored at ambient temperature • PCR amplification for three months. • E. coli transformation Quality control : • DNA sequencing The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. E.coli strains for transformation (recommended Sequencing primer list : but not limited) pCMV3-F： 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R ： 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 ： 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH ： 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS.
    [Show full text]
  • Transcriptomic and Proteomic Landscape of Mitochondrial
    TOOLS AND RESOURCES Transcriptomic and proteomic landscape of mitochondrial dysfunction reveals secondary coenzyme Q deficiency in mammals Inge Ku¨ hl1,2†*, Maria Miranda1†, Ilian Atanassov3, Irina Kuznetsova4,5, Yvonne Hinze3, Arnaud Mourier6, Aleksandra Filipovska4,5, Nils-Go¨ ran Larsson1,7* 1Department of Mitochondrial Biology, Max Planck Institute for Biology of Ageing, Cologne, Germany; 2Department of Cell Biology, Institute of Integrative Biology of the Cell (I2BC) UMR9198, CEA, CNRS, Univ. Paris-Sud, Universite´ Paris-Saclay, Gif- sur-Yvette, France; 3Proteomics Core Facility, Max Planck Institute for Biology of Ageing, Cologne, Germany; 4Harry Perkins Institute of Medical Research, The University of Western Australia, Nedlands, Australia; 5School of Molecular Sciences, The University of Western Australia, Crawley, Australia; 6The Centre National de la Recherche Scientifique, Institut de Biochimie et Ge´ne´tique Cellulaires, Universite´ de Bordeaux, Bordeaux, France; 7Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden Abstract Dysfunction of the oxidative phosphorylation (OXPHOS) system is a major cause of human disease and the cellular consequences are highly complex. Here, we present comparative *For correspondence: analyses of mitochondrial proteomes, cellular transcriptomes and targeted metabolomics of five [email protected] knockout mouse strains deficient in essential factors required for mitochondrial DNA gene (IKu¨ ); expression, leading to OXPHOS dysfunction. Moreover,
    [Show full text]
  • Additional Tables.Xlsx
    Additional Table 5 Enriched pathways of upregulated DEGs after spinal cord injury in WT (P < 0.05, q < 0.05) Database Description Ratio of DEGs Ratio of P -value P adjust q value gene name GO ribosomal subunit 87/755 214/12262 1.03E-49 4.61E-47 4.20E-47 Gm6576/Gm10036/Gm5786/Mrps28/Gm9493/Rpl13- ps3/Rpl7l1/Mrpl10/Mrpl44/Rps20/Mrpl51/Mrps11/Mpv17l2/Mrps7/Gm10020/Gm10073 /Mrpl2/Mrpl52/Rpl22/Mrpl4/Mrps24/Zcchc17/Rpl28/Mrpl34/Rpl29/Mrps36/Rpl9- ps6/Hba-a2/Hba-a1/Rpl23a- ps3/Rpl15/Rack1/Mrps18a/Mrpl28/Rpl10a/Mrpl12/Rpl18/Rpl35a/Mrpl41/Mrps12/Rpl36 a/Rps9/Rps18/Rps5/Rps27a/Rps24/Rplp2/Rpl14/Mrpl30/Rps6/Rpl6/Rps3/Rps4x/Rpsa/R pl7/Rpl27a/Rps23/Rps10/Mrps21/Rpl36/Rpl30/Rps17/Mrpl42/Rpl35/Rpl27/Rplp0/Rps28 /Rpl31/Rpl39/Rps13/Rpl13/Rps11/Rpl8/Rps3a1/Fau/Rpl9/Rpl3/Rpl26/Rps15/Rpl13a/Uba 52/Rpl24/Rpl19/Rps14/Rpl4/Rps27/Rplp1 GO ribosome 93/755 248/12262 1.67E-49 4.61E-47 4.20E-47 Gm6576/Pnpt1/Gm10036/Gm5786/Mrps28/Gm9493/Rpl13- ps3/Rpl7l1/Mrpl10/Mrpl44/Rps20/Mrpl51/Mrps11/Mpv17l2/Mrps7/Gm10020/Gm10073 /Mrpl2/Mrpl52/Rpl22/Mrpl4/Mrps24/Zcchc17/Rpl28/Mrpl34/Rpl29/Mrps36/Rpl9- ps6/Hba-a2/Hba-a1/Rpl23a- ps3/Rpl15/Rack1/Eif3h/Mrps18a/Mrpl28/Mrps33/Rpl10a/Mrpl12/Rpl18/Rpl35a/Btf3/Mrp l41/Mrps12/Rpl36a/Rps9/Rps18/Rps5/Rps27a/Rps24/Rplp2/Rpl14/Mrpl30/Rps6/Rpl6/R ps3/Rps4x/Rpsa/Rpl7/Rpl27a/Rps23/Rps10/Mrps21/Rpl36/Rpl30/Rps17/Mrpl42/Rpl35/R pl27/Rplp0/Rps28/Rpl31/Rpl39/Rps13/Rpl13/Rps11/Rpl8/Rps3a1/Fau/Rpl9/Rpl3/Rpl26/ Rps15/Rpl13a/Uba52/Rpl41/Rpl24/Rpl19/Rps14/Rpl4/Ndufa7/Rps27/Rplp1 GO structural constituent of 76/733 169/11958 1.65E-47 1.16E-44 1.12E-44 Gm6576/Gm10036/Gm5786/Rpl7l1/Mrpl10/Rps20/Mrpl51/Mrps11/Mrps7/Gm10020/G
    [Show full text]
  • Supplementary Table S1. Relative Change in Proteins Associated with Heme Biosynthesis and Degradation
    Supplementary Table S1. Relative change in proteins associated with heme biosynthesis and degradation. hPXR mPxr–/– Protein Gene RIF/INH INH RIF RIF/INH p Value 5-aminolevulinate synthase Alas1 1.90 2.61 1.05 1.41 0.28 5-aminolevulinate synthase Alas2 0.86 1.38 0.73 1.18 0.018 Delta-aminolevulinic acid Alad 0.96 1.00 1.02 0.95 0.75 dehydratase Porphobilinogen deaminase Hmbs 1.04 0.99 1.10 1.05 0.67 Uroporphyrinogen-III synthase Uros 1.19 1.09 1.31 1.38 0.012 Uroporphyrinogen decarboxylase Urod 0.92 1.03 0.94 0.92 0.33 Oxygen-dependent Cpox 1.13 1.04 1.18 1.15 0.20 coproporphyrinogen-III oxidase, Protoporphyrinogen oxidase Ppox 0.69 0.81 0.85 0.83 0.013 Ferrochelatase, Fech 0.39 0.50 0.88 0.43 0.000002 Heme oxygenase 1 Hmox1 1.15 0.86 0.91 1.11 0.34 Heme oxygenase 2 Hmox2 0.96 0.98 0.89 0.88 0.22 Biliverdin reductase A Blvra 0.84 0.92 0.82 0.92 0.032 UDP-glucuronosyltransferase 1-6 Ugt1a6 1.22 0.96 1.10 1.13 0.30 NADPH--cytochrome P450 Por 1.28 0.92 1.18 1.12 0.019 reductase INH, isoniazid; RIF, rifampicin; RIF/INH, rifampicin and isoniazid. Supplementary Table S2. Relative change in protein nuclear receptors. hPXR mPxr–/– Protein Gene RIF/INH INH RIF RIF/INH p Value Aryl hydrocarbon receptor Ahr 1.09 0.91 1.00 1.26 0.092 Hepatocyte nuclear factor Hnf1a 0.87 0.97 0.82 0.79 0.027 1-alpha Hepatocyte nuclear factor Hnf4a 0.95 1.05 0.97 1.08 0.20 4-alpha Oxysterols receptor LXR- Nr1h3 0.94 1.16 1.03 1.02 0.42 alpha Bile acid receptor Nr1h4 1.05 1.17 0.98 1.19 0.12 Retinoic acid receptor Rxra 0.88 1.03 0.83 0.95 0.12 RXR-alpha Peroxisome proliferator-
    [Show full text]
  • Ribosomal Stress-Induced Senescence As a Novel Pro-Senescence Strategy for P16 Positive Basal-Like Breast Cancer
    bioRxiv preprint doi: https://doi.org/10.1101/469445; this version posted November 14, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Moore et al. Ribosomal stress-induced senescence as a novel pro-senescence strategy for p16 positive basal-like breast cancer Madeleine Moore1, Luke Gammon1, Sally Dreger2 James Koh3, James C Garbe4, Martha R Stampfer4, Michael Philpott1, Louise Jones2 Cleo L Bishop1* AFFILIATIONS 1. CBCR, The Blizard Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, 4 Newark Street, London E1 2AT, UK 2. Barts Cancer Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, 4 Newark Street, London E1 2AT, UK 3. Division of Surgical Sciences, Department of Surgery, Duke University Medical School, Durham, NC, 27710, USA. 4. Biological Systems & Engineering Division, Lawrence Berkeley National Laboratory, Berkeley, CA, 94720, USA. * Corresponding author: Cleo Bishop, [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/469445; this version posted November 14, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Moore et al. ABSTRACT Re-engaging the senescent programme represents an attractive yet underexplored strategy for cancer therapy, particularly for those tumour subtypes where targeted agents are limited or unavailable.
    [Show full text]
  • Differential Expression Gene Symbol Upregulated
    Table S1. 1658 differential expressed genes with P-value < 0.05 in myeloid dendritic cells patients with all ergies compared to healthy controls. Differential Gene Symbol Expression Upregulated KIAA1217, RP11-111M22.2, RP11-21M24.2, FAM221B, TRIM9, CNKSR3, LRIT3, (N=771) RP11-26J3.1, RP11-708J19.1, RPS3AP35, AC096574.4, RBPMS, JPH3, RASGRF1, RP11-118E18.4, TPPP, KCNJ9, ARMC12, TUBB8P7, KCND3, CTD-2083E4.4, SLCO5A1, EGLN3, NOS3, RPS3AP40, OR10A4, AC007551.2, RP11-110I1.12, ZNF732, RP4-800G7.3, RNFT2, SFXN2, SEPT5, UFSP1, KRT8P26, RP11- 634H22.1, RP11-357G3.1, CTC-487M23.5, RP11-804H8.6, ROPN1L, E2F2, RP11- 983P16.4, SOX12, KRTAP16-1, FAM188B, TTC28, CTB-66B24.1, PLS1, SHF, ESR1, SOCS2, MNS1, GPR55, RP11-1020A11.2, C4orf32, BHLHE22, RP11- 63E5.6, SIGLEC15, FGFBP3, AP000692.10, CTD-2357A8.3, RP1-102E24.6, ZC4H2, AC074367.1, WDR86-AS1, YPEL1, HOXB-AS1, RP3-522P13.2, OR7E47P, AC068039.4, NUDT8, IBA57, PPP1R3G, CACNB3, KB-1460A1.1, IQCJ-SCHIP1-AS1, CRHR2, CD27-AS1, RP11-368J22.2, MANSC4, FITM2, AC002467.7, RPS5P2, SNHG17, GCAT, C10orf91, CTB-61M7.1, ATP8A2P2, RP11-50E11.2, TFAP4, CTD-2060C23.1, MED9, RP11-583F2.1, GAPDHP62, RN7SL801P, CYB5RL, ALG14, IGLV5-52, AC106801.1, RP11-403A21.3, LAD1, EARS2, NEURL3, DUSP14, RP11-116K4.1, PKNOX1, RP11-248J23.5, ZNF730, PSMF1, PINLYP, HOXA10, PTMAP8, RNLS, NANOGP7, FOXD1, AIFM2, KCNJ14, AC114730.8, RP11-804H8.5, C1orf109, PANK1, RPL32P26, RP11- 528A10.2, KL, METTL21B, CTD-2186M15.1, UBE3D, SMARCA5-AS1, SCARF2, AC000003.2, AC013470.6, PEX10, LRP11, ACTBP14, RP11-93B14.5, MIR1182, LIMCH1, IFI27L1, FSTL3,
    [Show full text]