KINETIC and SPECTROSCOPIC STUDIES of L1, the METALLO-Β- LACTAMASE from Stenotrophomonas Maltophilia

MIAMI UNIVERSITY

The Graduate School

Certificate for Approving the Dissertation

We hereby approve the Dissertation

Zhenxin Hu

Candidate for the Degree:

Doctor of Philosophy

______

Director

Dr. Michael Crowder

______

Reader

Dr. Chris Makaroff

______

Reader

Dr. Michael Kennedy

______

Reader

Dr. John Hawes

______

Graduate School Representative

Dr. Eileen Bridge

ABSTRACT

KINETIC AND SPECTROSCOPIC STUDIES OF L1, THE METALLO-β- LACTAMASE FROM Stenotrophomonas maltophilia

by Zhenxin Hu

Metallo-β-lactamase L1 (mβl L1), originally from Stenotrophomonas maltophilia, can hydrolyze all β-lactam containing antibiotics. Previous crystal structures showed that mβl L1binds two Zn(II) ions in the active site, and there is a long flexible loop above the metal center. To better understand the function of the Zn(II) ions in mβl L1, several metal-substituted and heterobimetallic analogs of L1 were generated and characterized using spectroscopic and kinetic studies. The metal binding sites in L1 can accommodate a number of different metal ions to afford catalytically-active analogs. Pre-steady state kinetic studies using nitrocefin as substrate showed that both Zn(II) ions were required for the formation of intermediate and that an analog of L1 containing only one equivalent

of Zn(II) is slightly active. Different metal ions in the Zn2 metal binding site modulated

mβl L1’s substrate preference, and L1 analogs containing Ni(II) or Fe in the Zn2 site were unable to hydrolyze penicillins but could hydrolyze cephalosporins and carbapenems. Rapid freeze quench (RFQ) EPR and 1H NMR spectra confirmed the catalytic function of both metal sites. Based on the kinetic and spectroscopic studies, a reaction mechanism of mβl L1 was proposed when nitrocefin is the substrate. In an effort to understand the function of the loop above the active site, fluorescence resonance energy transfer (FRET) and double electron electron resonance (DEER) studies were proposed. The preparation of double FRET labeled L1 analogs was unsuccessful; however, a double spin-labeled analog was made. Preliminary RFQ-DEER data show that this technique can be used to probe intramolecular motions during catalysis. The data from this dissertation can be used to guide future rational inhibitor design efforts.

KINETIC AND SPECTROSCOPIC STUDIES OF L1, THE METALLO-β- LACTAMASE FROM Stenotrophomonas maltophilia

A DISSERTATION

Submitted to the Faculty of

Miami University in partial

fulfillment of the requirements

for the degree of

Doctor of Philosophy

Department of Chemistry and Biochemistry

Zhenxin Hu

Miami University

Oxford, Ohio

2008

Dissertation Director: Dr. Michael Crowder

TABLE OF CONTENTS

Chapter 1: Introduction 1. β-Lactam containing antibiotics and β-lactam resistance 2 1.1 Discovery of penicillin 2 1.2 Different generations of penicillins 1.3 The outbreak of β-lactam resistance 5 1.4 General mechanisms for antibiotic resistance 5 2. Classification of β-lactamases 5 2.1. Ambler scheme 5 2.2 Metallo-β-lactamases 8 2.3 Previous studies on metallo-β-lactamases 8 2.3.1 X-ray crystallographic studies 8 2.3.2 Kinetic studies 11 2.3.3 Spectroscopic studies 12 2.3.4 Computational studies 12 3. Metallo-β-lactamase L1(Mβl L1) 13 3.1 Discovery of a metallo-β-lactamase in Xanthomonas (Pseudomonas) maltophilia. 13 3.2 Recombinant Mβl L1 13 3.3 Metal content of Mβl L1 13 3.4 Kinetic studies of Mβl L1 14 3.5 Crystal structure of Mβl L1 15 3.6 Mutational studies on Mβl L1 16 3.7 Metal substitution and spectroscopic studies on Mβl L1 20 4. Introduction to dissertation 21 5. References 23

Chapter 2: Folding strategy to prepare Co(II)-substituted metallo-β-lactamase L1

2.1 Introduction 32 2.2 Materials and Methods 34 2.3 Results 37 2.4 Discussion 47 2.5 Acknowledgement 49 2.6 References 50

Chapter 3: Metal content of metallo-β-lactamase L1 is determined by the bioavailability of metal ions 3.1 Introduction 59 3.2 Materials and Methods 61 3.3 Results 63 3.4 Discussion 73 3.5 References 76

Chapter 4: Role of the Zn1 and Zn2 sites in metallo-β-lactamase L1 4.1 Introduction 85 4.2 Materials and Methods 86 4.3 Results 90 4.4 Discussion 109 4.5 Acknowledgement 115 4.6 References 116

Chapter 5: Structure and mechanism of Cu- and Ni-substituted analogs of metallo-β- lactamase L1 5.1 Introduction 124 5.2 Materials and Methods 127 5.3 Results 128 5.4 Discussion 139

iii

5.5 References 143 Chapter 6: Probing the function of the flexible loop in metallo-β-lactamase L1 6.1 Introduction 150 6.2 Materials and Methods 153 6.3 Results 161 6.4 Discussion 172 6.5 Acknowledgement 180 6.6 References 181 Chapter 7 Conclusions 185

LIST OF TABLES

Table 1.1: Classification scheme for metallo-β-lactamases. 9 Table 2.1: Characterization of Co(II)-substituted L1 analogs. 41 Table 2.2: Metal content and steady-state kinetic constants of Zn(II)-containing L1 analogs. 45 Table 3.1: Steady-state kinetic and metal content data for FL-L1. 66 Table 3.2: Steady-state kinetic and metal content data for L1 folded in the cytoplasm (M-L1). 68 Table 3.3: Characterization of L1 refolded in the presence of Fe(II), Zn(II), and Mn(II). 70 Table 4.1: Steady state kinetic parameters and metal content of HXXC mutants of L1. 91 Table 4.2: Steady state kinetics of different metal bound analogs of L1. 93 Table 4.3: Exponential fits to the stopped-flow kinetic data and kinetic simulations. 102 Table 5.1: Steady-state kinetic studies and metal analyses on Cu- and Ni-containing analogs of L1. 131 Table 5.2: Steady state kinetics of different L1 analogs with different substrates. 132 Table 6.1: Steady-state kinetics and metal analyses of L1 mutants. 163 Table 6.2: Steady state kinetic data with spin-labeled analogs of L1. 167 Table 6.3: Possible dipolar couplings in the T163/T265 double mutant of tetrameric L1. 178

LIST OF FIGURES

Figure 1.1: Representative β-lactam containing antibiotics. 3-4 Figure 1.2: Nitrocefin hydrolysis by β-lactamase. 6 Figure 1.3: Inhibition of serine β-lactamase by clavulanic acid. 7 Figure 1.4: Crystal structures of different metallo-β-lactamases. 10 Figure 1.5: The active site of Mβl L1 with hydrolyzed moxalactam. 17 Figure 1.6: Function of Asp120 in the active site of L1. 18 Figure 2.1: Active site of L1. 33 Figure 2.2: UV-Vis spectra of cobalt-containing analogs of L1. 38 Figure 2.3: Fluorescence emission spectra of L1 samples. 43 Figure 2.4: Stopped-flow kinetic studies of Co(II)-substituted L1. 46 Figure 3.1: Localization of L1 produced in cells that contain the L1 gene and the leader sequence (FL-L1) and the L1 gene without the leader sequence (M-L1). 65 Figure 3.2: EPR of of Fe-containing L1. 71 Figure 4.1: UV-Vis and NMR spectra of 1Co-L1. 95 Figure 4.2: EPR spectra from metal-containing species of L1. 97 Figure 4.3: Stopped-flow traces of reaction of Zn(II)-containing L1 analogs and nitrocefin. 98 Figure 4.4: Stopped-flow traces of the reaction of Co(II)-containing L1 analogs with nitrocefin. 100 Figure 4.5: Intermediate formation by L1 analogs. 103 Figure 4.6: RFQ-EPR of ZnCo-L1 with nitrocefin. 104 Figure 4.7: Stopped-flow traces of Fe-containing L1 analogs reacted with nitrocefin. 107 Figure 4.8: RFQ-EPR of ZnFe-L1 with nitrocefin. 108 Figure 4.9: Proposed reaction mechanism of L1 for the hydrolysis of nitrocefin. 114 Figure 5.1: Structures of β-lactam antibiotics used as substrates in these studies. 125 Figure 5.2: Active site of Mβl L1. 126 Figure 5.3: The EPR spectrum of 670 μM Cu-L1. 133 Figure 5.4: 1H NMR spectra of Ni-L1. 135 Figure 5.5. Stopped-flow kinetic studies on Cu-L1. 136

Figure 5.6: Stopped-flow kinetic studies on Ni-containing L1. 138 Figure 6.1: Crystal structure of Mβl L1. 152 Figure 6.2: Structures of Cy3 (top) and Cy5 (bottom). 154 Figure 6.3: Scheme of spin labeling reaction of MTSSL and protein. 155 Figure 6.4: Scheme of four pulse DEER. 160 Figure 6.5: Fluorescence spectra of mutants. 164 Figure 6.6: MALDI-TOF MS of double spin labeled T163C/T265C. 167 Figure 6.7: EPR spectrum of (A) free MTSSL and (B) MTSSL-labeled T163C/T265C. 169 Figure 6.8: DEER spectra of resting double spin-labeled L1 mutant. 170 Figure 6.9: DEER spectra of T163C/T265C rapid freeze quenched with nitrocefin. 171 Figure 6.10: Sites on L1 where labels were attached. 174 Figure 6.11: Thr163 in tetrameric L1. 176 Figure 6.12: Structure of spin-labeled penicillin (SLPEN). 180 Figure 7.1: (Left) Carboxylate group (in red) in β-lactam containing compounds. (Right) 17O-labeled substrate. 189 Figure 7.2: Chimeric tetramer of L1. 190 Figure 7.3: 15N-labeled substrate. 191 Figure 7.4: Thiono analog of substrate. 191 Figure 7.5: Potential inhibitor for mβl L1. 192

Figure 7.6: (Left) Structure of first compound tested. (Right) IC50 plot of first compound reacted with L1 193

Figure 7.7: (Left) Structure of second compound tested. (Right) IC50 plot of second compound reacted with L1. 193

vii

Acknowledgements

I would like to sincerely thank my advisor, Dr. Crowder. It is my honor and privilege to do research under his guidance. His continuous encouragement, assistance, and support are indispensable for the completion of this effort. More importantly, he helps me find the interest of research.

I would like to thank my committee member: Drs. Eileen Bridge, John Hawes, Gary Lorigan, and Chris Makaroff for their support during my studies in Miami University. Specially, I would like to thank Dr. Kennedy for substituting on my committee for my final defense.

I would also thank Crowder’s group members: Tara Sigdel, Gopal Periyannan, Frank Golich, Narayan Sharma, Allen Easton, Patrick Hensley, Pattraranee Limphong, Thusitha Gunasekera, Megan Hawk, Sraven Katragadda, Dionne Griffin, Karen Anderson, Jessica Bennett, Lauren Spadafora, and Christine Hajdin, and friends in Chemistry department.

Additionally, I would thank Drs. Kewu Yang and Shuisong Ni for their generous training and suggestion for my research.

Finally, I would thank my wife, Hongli Yao, for her unconditional love; my parents, who taught me that unless I try, I will never know whether I will success or not; and my sister and brother.

viii

Chapter 1

Introduction

1. β-Lactam containing antibiotics and β-lactam resistance 1.1 Discovery of penicillin. Alexander Fleming discovered a compound secreted by Penicillium notatum could inhibit the growth of several bacteria in 1928 (1). He named the compound penicillin and showed that was most effective against Gram-positive bacteria but not against Gram-negative bacteria or fungi. Compared to other antiseptics used in hospitals during the early 1930’s, penicillin was less toxic and highly potent. With further study, Fleming realized that penicillin would not last long enough in the human body to function as an effective antibiotic agent and stopped the research 1931(2). Despite Fleming’s termination of research on penicillin, more and more researchers attempted to treat patients with penicillin. The initial trials were not completely successful because of low effective dosage in targeted areas. However, the first successful clinical trial was conducted by John Bumstead and Orvan Hess in 1942. At that time, the mass production of penicillin was an enormous challenge. However, efforts to find a mold that produced large amounts of penicillin and improvements in fermentation techniques lead to the production of a million doses of the drug by the 1940’s. In World War II, penicillin was widely used to treat wounded soldiers and save millions of lives, making it the most widely used antibiotic (3).

1.2 Different generations of penicillins In order to increase the solubility, improve uptake, and to reduce the side effects of penicillin, derivatives of penicillin were designed and synthesized, such as ampicillin, amoxycillin, and methicillin. The penicillins share the four- membered, β-lactam ring fused to a five-membered, thiazolidine ring, and the diversity of these antibiotics are found in the substituents connected to the rings. Second generation β-lactam containing antibiotics, called the cephalosporins, differ from the penicillins in that the five- membered, thiazolidine ring is replaced by a six-membered, dihydrothiazine ring, and diversity is introduced into the cephalosporins by changing the substituients attached to the fused ring system. Examples of cephalosporins are cefaclor, cephalothin, and nitrocefin(3). The third generation of β-lactam containing antibiotics, carbapenems, are similar to the penicillins in that the basic core is the four-membered, β-lactam ring fused to a five-membered ring; however in the carbapenems, the sulfur in the thiazolidine ring is replaced by a carbon. Examples of carbapenems are imipenem, meropenem, and biapenem. The structures of some representative β-lactam containing antibiotics are shown in Figure 1.1.

H N S

O N O

O OH Penicillin G

NH2 H N S

O N O Cl

OOH

Cefaclor

N S

NO2 S O N O

COO-

NO2

Nitrocefin NH OH HN

S N O

OOH

Imipenem Figure 1.1: Representative β-lactam containing antibiotics.

1.3 The outbreak of β-lactam resistance. β-Lactam compounds target the transpeptidase of bacteria, which play a key role for the integrity for the membrane of microbe. Because of its effectiveness in the clinic, β-lactam containing antibiotics were used for agricultural purposes after the 1950’s, primarily as a feed additive to reduce possible bacterial infections(4). In ten years, high level resistance towards β-lactam containing antibiotics was evident in the clinic. Second and third generation compounds and derivatives of these compounds were introduced to combat bacterial resistance; however, the new and improved drugs were effective only for a short period of time, prompting drug companies to discover new antibiotics.

1.4 General mechanisms for antibiotic resistance. Bacteria have developed two general strategies to resist antibiotics, and both require the acquisition of DNA from another organism that is already resistant to the specific antibiotic. The first strategy involves the expression of an efflux pump that pumps the antibiotic out of the cytoplasm so that the drug cannot interact with its target. The efflux pump(s) are encoded by multi-drug resistance (MDR) genes(5). The second strategy involves the production of enzymes that reduce/oxidize, hydrolyze, or add groups to the antibiotics to alter the activity of the drug. For β-lactam resistance, bacteria utilize the second strategy. β-Lactam resistant bacteria produce β-lactamases, which cleave the C-N bond in the conserved β-lactam ring (Figure 1.2), and the resulting hydrolyzed product is no longer antimicrobial(6, 7).

2. Classification of β-lactamases 2.1 Ambler scheme. There are over 500 distinct β-lactamases that have been identified to date, and there have been a number of classification schemes reported. The most commonly referenced scheme was initially proposed by Ambler and was extended by Bush et al. (8). This classification scheme contains four distinct classes of β-lactamases: A, B, C, and D. While exhibiting significant differences in substrate specificities and inhibitor sensitivities, class A, C, and D enzymes are similar in the fact that they utilize an active site serine as nucleophile during catalysis. One common inhibitor used to differentiate between β-lactamases is clavulanic acid, which is secreted by Streptomyces clavuligerus and serves as a suicide inhibitor of many Class A

Figure 1.2: Nitrocefin hydrolysis by β-lactamase.

Figure 1.3: Inhibition of serine β-lactamase by clavulanic acid.

and C enzymes (Figure 1.3). Clavulanic acid is used clinically in the drug/inhibitor combinations Augmentin (amoxicillin + clavulanic acid) and Timentin (ticarcillin + clavulanic acid) (9). Unfortunately, there are no clinical inhibitors effective against the group B enzymes, metallo-β- lactamases (mβl’s), which utilize one or two Zn(II) ions to perform the hydrolytic reaction. Unlike the serine-β-lactamases, the mβl’s do not utilize a serine residue for the hydrolysis reaction.

2.2. Metallo-β-lactamases. There have been at least 40 distinct mβl’s identified, and these enzymes have been categorized into three different subgroups(10), according to amino acid sequence homology, number of Zn(II) ions required for maximal activity, the ligands that coordinate Zn(II), and substrate specificities (Table 1.1). All the metallo-β-lactamases share a αβ/βα fold, which is now known as the metallo-β-lactamase fold, and the Zn(II) ion(s) are located in the cleft between the two β sheets, as showed in Figure 1.4. 2.3. Previous studies on metallo-β-lactamases. Extensive research has been carried out on metallo-β-lactamases by several groups. Hundreds of papers have described newly discovered enzymes, the structures or mechanisms of the different mβl’s, inhibition studies, and computational studies. In addition, several review articles have been published in the last 3 years on these enzymes. In this section, I will focus on studies that were done before my research started. 2.3.1. X-ray crystallographic studies. The first crystal structure of a mβl was on BcII, which is from non-pathogenic Bacillus cereus and was the first identified metallo- β-lactamase(11). This structure showed a single Zn(II) ion bound to the enzyme. In a subsequent structure of BcII that was purified and crystallized using different conditions, the enzyme was shown to bind 2 equivalents of Zn(II). The different metal content in these two structures raised the question of how many Zn(II) ions does the enzyme bind physiologically, particularly when the bioavailability of Zn(II) is limited. When the crystal structures of CcrA from Bacteroides fragilis, CphA from Aeromonas hydrophila, L1 from Stenotrophomonas maltophilia, and SPM from Pseudomonas aeruginosa were reported(12-15), it was shown that all of these enzymes, including BcII, shared the same folding motif despite the enzymes exhibiting different metal content and amino acid

Table 1.1: Classification scheme for metallo-β-lactamases.

Subgroup Examples Characteristics

1 or 2 Zn(II), cephalosporins preferred substrates

B1 CcrA, Bla2 Zn1 site: 3 His

Zn2 site: His, Asp, Cys 1 Zn(II), carbapenems preferred substrates B2 ImiS, CphA Zn2 site: His, Asp, Cys 1 or 2 Zn(II), penicillins preferred substrates

B3 L1, GOB-18 Zn1 site: 3His

Zn2 site: 2His, Asp

BcII CphA L1 Figure 1.4: Crystal structures of different metallo-β-lactamases. Figure was rendered using Rasmol v. 2.6. The coordinates were obtained from the Protein Data Bank using the accession number 1SML for L1, 2BC2 for BcII, and 1X8G for CphA.

sequence homologies of less than 20%. The folding motif, an αβ/βα sandwich fold, is a common motif found in all mβl’s and in other proteins including the glyoxalase 2’s, rubredoxin oxidoreductase, phosphotriesterase, arylsulfatase, and tRNA maturase(16, 17). The crystal structures of several mβl’s complexed with inhibitors have been reported, and recently, the structures of L1 with hydrolyzed moxolactam and CphA with a biapenem product have been reported by Spencer’s and Garau’s groups(13, 18), respectively. Unfortunately despite much effort, a structure of a mβl complexed with substrate has not been reported, and important details about enzyme:substrate interactions and intermediate structure(s) are not known.

2.3.2 Kinetic studies. Many of the metallo-β-lactamases, like L1, CcrA, ImiS from Aeromonas sobria, BcII, IMP from Pseudomonas aeruginosa, and Bla2 from Bacillus anthracis, have been used in substrate specificity studies with substrates from all three generations of β-lactam compounds(19-22), and these enzymes showed broad substrate preferences. As early as the late 1980’s, Bicknell and Waley used cryoenzymological and stopped-flow kinetic studies to suggest a branched kinetic mechanism for BcII, and these researchers were able to spectroscopically characterize some of the postulated reaction intermediates(23, 24). Unfortunately, it is not known which form of BcII was used in these studies (1Zn-BcII, 2Zn-BcII, or a mixture). Recently, kinetic studies by Vila and Page have called into question these early results, and new, conflicting kinetic mechanisms have been offered for BcII(25). With CcrA, Wang and co-workers identified a kinetically-competent intermediate by using stopped-flow kinetics(26). This same intermediate was found in studies with L1 by McManus- Munoz et al., and subsequent studies have suggested that this intermediate is only found in studies with nitrocefin as substrate (27). Spencer and coworkers showed that L1 utilizes a different kinetic mechanism when other, clinically-relevant substrates are used (28). Sharma et al. recently reported the kinetic mechanism of 1 Zn(II)-containing ImiS, and this enzyme utilizes a kinetic mechanism similar to that of L1 with the clinically-relevant substrates(29). Proton inventory, pH

dependence, and mutagenesis studies have been conducted and allowed many groups to propose reaction mechanisms of several of the mβl’s.

2.3.3 Spectroscopic studies The naturally-occuring metal ion in mβl’s is Zn(II), and Zn(II) is invisible to most of spectroscopic techniques. Fortunately, Zn(II) can be replaced by other paramagnetic metal ions such as Mn(II), Fe, and Co(II) to allow for spectroscopic studies. In addition, the substitution of Zn(II) with Co(II) results in catalytically-active analogs and metal centers that are most often identical to those in the native enzyme(30). Co(II), which has an electron configuration of [Ar]3d7 and a spin of 3/2, can be interrogated by a number of readily available spectroscopic techniques such as 1H NMR, EPR, and UV-Vis spectroscopies. These techniques provide a wealth of information about the identity of the ligands, the coordination geometry of the metal ions, and the electronic properties of the metal ions (31). UV-Vis (or electronic absorbance) studies are used extensively on Co(II)-substituted mβl’s since the extinction coefficient of d-d bands (500-600 nm) can be correlated to the geometry of Co(II), and ligand to metal charge transfer (LMCT) bands, which exhibit strong absorbances (ε = 1,000-2,000 M-1cm-1) at 300-320 nm, are direct evidence of a cysteine ligand. Paramagnetic 1H NMR spectroscopy can be used to probe the ligands of Co(II), especially when histidine residue(s) is/are coordinated. Axial and rhombic strains (E and D) of low temperature (10 K) EPR spectra offer electronic and structural information about Co(II) bound to a protein.

2.3.4 Computational studies. Based on the crystal structures of free enzyme, enzyme/inhibitor, or enzyme/product, computational models were used to understand the structure and mechanism of the mβl’s. The computational studies focused on the following questions: (1) how substrate binds to the enzyme, (2) what is the function of the Zn(II) ions, or (3) what is the rate-limiting step (32- 35). Molecular dynamics have provided another way to understand catalysis in the mβl’s; however due to the stability of long time calculations and small size of those models compared with that of the macromolecule, the reliability of the

computational studies is questionable.

3. Metallo-β-lactamase L1(Mβl L1) 3.1 Discovery of a metallo-β-lactamase in Xanthomonas (Pseudomonas) maltophilia. Metallo-β-lactamase L1 is secreted by S. maltophilia, which is an opportunistic, pathogenic bacterium. S. maltophilia infections are prominent in immunocompromised patients suffering from cancer, cystic fibrosis, drug addiction, and AIDS, and in patients with organ transplants and on dialysis. S. maltophilia is inherently resistant to most antibiotics due to its lower outer membrane permeability and to all β- lactam containing antibiotics due to the production of chromosomally-expressed serine β- lactamase (L2) and metallo-β-lactamase L1(36, 37).

3.2 Recombinant Mβl L1. Since Crowder et al. published the recombinant expression of Mβl L1 in E. coli, which allowed for large amounts of purified enzyme to be available (19), the structure and function of Mβl L1 have been extensively studied. Among all of the studied Mβls, L1 is arguably the best characterized by kinetic (steady state kinetic and transient state), crystallographic, and spectroscopic studies (NMR, EPR, UV-Vis, and EXAFS), mainly by Crowder’s and Spencer’s labs (14, 18, 19, 27, 28, 38- 43). In addition, Spencer used computational studies to predict a model for substrate binding, and Guo reported molecular dynamic studies that tested the reaction mechanism of Mβl L1(14, 33).

3.3 Metal content of Mβl L1. Recombinant Mβl L1 has been shown to tightly bind two equivalents of Zn(II), which is similar to the results on CcrA from the B1 subgroup yet different from those on BcII, which is another member of the B1 subgroup. Previously, it was reported that the inducible Mβl L1 from pathogenic bacteria S. maltophilia binds two equivalents of Zn(II) (44); therefore, it was assumed that 2Zn-Mβl L1 (L1 with 2 equivalents of Zn(II)) is the physiologically-relevant form of the enzyme. However, Wommer and coworkers utilized in vitro metal binding studies in which metal- free analogs of recombinant L1 were titrated with Zn(II) to determine metal binding

dissociation constants(45). Given the calculated values for these binding constants and the concentration of bioavailable Zn(II) in the cytoplasm of E. coli, they hypothesized that Mβl L1 is metal-free in vivo and that the presence of substrate induced the enzyme to bind only 1 equivalent of Zn(II). They further argued that the LB medium used for E. coli cultures to over-express recombinant Mβl L1 and S. maltophilia cultures to prepare non- recombinant Mβl L1 contained so much Zn(II) that the resulting Mβl L1 samples contained artificially high amounts of Zn(II). As mentioned above, Wommer et al. based their hypotheses on the amount of bioavailable Zn(II) in the cytoplasm of E. coli, and they assumed that L1, and other Mβl’s, are folded in the cytoplasm of bacteria. Our recent work (Chapter 3) conclusively demonstrates that Mβl L1 folds in the periplasm, in which the concentration of bioavailable Zn(II) is expected to be significantly higher than in the cytoplasm of the bacterial cell. It should also be noted that the binding constants that were calculated by Wommer and coworkers involved competition studies between apo-Mβl L1 and EDTA. The authors ignored the possibility that their experimental conditions might result in the formation of an EDTA-Zn(II)-Mβl L1 ternary complex that might change the active site of Mβl L1(46). Subsequently, Periyannan et al. reported that Mβl L1 binds less than 0.1 equivalent of Zn(II) when it was over-expressed in minimal medium containing no added Zn(II) (41). Mβl L1 over-expressed in minimal medium containing no added Zn(II) was shown to be folded incorrectly and exhibit very low catalytic activity towards nitrocefin. These results were interpreted as evidence that the correct physiological folding of Mβl L1 requires the presence of Zn(II). However, it is not clear from the studies discussed above how many Zn(II) ions are in the physiologically-relevant form of Mβl L1. In this dissertation, a procedure is described in Chapter 3 that allows for the preparation of Mβl L1 that contains only 1 equivalent of Zn(II) (1Zn-Mβl L1). This analog is catalytically-active and allowed for us to ascertain

the role of Zn(II) in the Zn1 site.

3.4 Kinetic studies of Mβl L1. All of the early kinetic studies on Mβl L1 were steady-state kinetics. In the 1980’s, steady-state kinetic studies were used to probe substrate specificity on the enzyme isolated directly from S. maltophilia . The

recombinant enzyme was also utilized in steady-state kinetic studies to demonstrate that the recombinant enzyme exhibits similar kinetic constants as the enzyme isolated directly from S. maltophilia (19). Steady-state kinetics with different β-lactams showed that Mβl

L1 exhibits a broad substrate spectrum, but the enzyme exhibits the highest kcat/Km values with penicillins. Crowder and coworkers used stopped-flow kinetic studies and nitrocefin as substrate to probe the mechanism of L1 (27). These studies showed that Mβl L1 utilizes a reaction mechanism similar to that of CcrA, in which a reaction intermediate with a UV-Vis absorbance maximum at 665 nm is formed (26). The decay of this intermediate was shown to be rate-limiting, and this result was supported by subsequent studies by Spencer and coworkers (28). However when using clinically-relevant substrates such as penicillin G, meropenem, and cefaclor, no intermediate was detected, suggesting that Mβl L1 utilizes a different reaction mechanism to hydrolyze these substrates (28). The rate-limiting step exhibited by Mβl L1 when reacted with these clinically-relevant substrates was C-N bond cleavage. In the same paper, Spencer and coworkers utilized stopped-flow fluorescence studies to probe substrate binding to Mβl L1 (28). In these studies, the intrinsic tryptophan fluorescence of the enzyme was quenched upon substrate binding, and when the substrate was completely hydrolyzed, the fluorescence of the enzyme returned to its initial value. Garrity et al. then used site-directed mutagenesis studies to show that the fluorescence behavior of Mβl L1 was due to Trp38, which is 5 Ǻ away from His263, a metal binding ligand in the Zn2 site (40).

3.5 Crystal structure of Mβl L1. Ullah et al. solved the X-ray crystal structure of Mβl L1 in 1998(14). The enzyme exists as a homotetramer in the crystalline state and in solution, and the quaternary structure is stabilized by non-covalent interactions. Each monomer has the αβ/βα metallo-β-lactamase fold. The two Zn(II) ions bind in the cleft between two β-sheets. The first Zn(II) ion (the Zn1 site) was tetrahedrally-coordinated by 3 histidine residues (His116, His118, and His160) and a bridging solvent molecule, presumably a hydroxide, and the second Zn(II) ion (the Zn2 site) was penta-coordinated by three amino acid residuesHis121, His263, and Asp120), one terminally-bound water,

and the bridging hydroxide. The structure showed a large flexible loop containing 13 amino acid residues (position 152 to 164). The function of this loop was not clear though a similar loop in CcrA was speculated to be involved in catalysis (47). Garrity et al. generated a D120W/W38F double mutant of Mβl L1, and this mutant was used in stopped-flow fluorescence studies to show that the loop moves during catalysis (40). Later, Spencer and coworkers successfully reported the structure of Mβl L1 complexed with the hydrolysis product of moxalactam (Figure 1.5) (28). The structure showed that

the Zn1 interacts with the β-lactam carbonyl and that Zn2 coordinates the β-lactam nitrogen and one of the oxygens of the invariant carboxylate on substrate. This information was the first to show the orientation of substrate in relation to the dinuclear Zn(II) center, and this structure supported previous computational studies on Mβl L1 by the same authors (14).

3.6 Mutational studies on Mβl L1. The crystal structures of Mβl L1 clearly show the metal binding ligands, which are essential for holding Zn(II) in the active site of the enzyme. The crystal structures also showed several amino acid residues near the active site, and after computational studies (33), some of these residues were predicted to be important for substrate binding and/or catalysis. In order to verify the importance of these residues, Carenbauer et al. prepared and characterized a number of site-directed mutants of Mβl L1 to probe the function of the residues(43). However, none of the computationally-identified residues were shown to be essential for catalysis or metal or substrate binding. On the other hand, the mutation of metal binding Asp120 by Garrity et al. provided information about the reaction mechanism of Mβl L1(39). Three mutants were prepared and characterized. The D120C, D120N, and D120S mutants were shown to bind 2, 2, and 1 equivalents of Zn(II), respectively, and each species showed poor activity towards all tested substrates. No nitrocefin-based reaction intermediate was observed with any of the mutants. pH Dependence and solvent isotope studies strongly indicated that the role of Asp120 is to orient the bridging hydroxide for nucleophilic attack on substrate and to orient the acidic proton on an incoming water for protonation of the reaction intermediate (in studies with nitrocefin) or substrate during the presumed

Figure 1.5: The active site of Mβl L1 with hydrolyzed moxalactam. The figure showed the hydrolyzed moxalactam was coordinated by Zn1 and Zn2, represented by green balls. Figure was rendered using Rasmol v. 2.6. The coordinates were obtained from the Protein Data Bank using the accession number 2AIO.

H2O HisO His Zn Zn His 2 H 1 His O O His Asp 120 Figure 1.6: Function of Asp120 in the active site of L1. Asp120 functions as monodentate to Zn2 site, and positions the bridging hydroxide.

concerted ring opening/product protonation step. Recently, the crystal structures of D120C and D120N were reported by Spencer and coworkers (48). The structure showed that the bridging hydroxide exists in the D120N mutant that binds 2 Zn(II) ions; however, Asn120 was turned away from the active site and it did not bind Zn(II). In addition, Asn120 did not position the bridging hydroxide, supporting the hypothesized role of Asp120. In the structure of the D120C mutant, Cys120 was coordinated to Zn(II) in the

Zn2 site; however, there was no evidence of a bridging hydroxide in this mutant. Since the D120C mutant is 105-fold less active than wild-type Mβl L1, the lack of the bridging hydroxide supports the hypothesis that the bridging hydroxide is the reactive nucleophile during catalysis. Mβl L1 is unique among all of the reported mβl’s because it exists as tetramer in solution. In the first crystallography paper, Ullah et al. proposed that the tetramer is held together by Met140 in one subunit inserting into a hydrophobic pocket on another subunit (14). These authors also predicted that Leu5 and Leu8 in one subunit form hydrophobic interactions with other subunits, further stabilizing the tetrameric structure of the enzyme. In order to test these hypotheses, the M140D mutant and an amino terminal deleted mutant of L1 (with Leu5 and Leu8 removed) were prepared and characterized (49). The resulting M140D mutant was shown to be monomeric in solution, while the N-truncated mutant was tetrameric. A number of conclusions were reported based on the characterization of these mutants: (1) the interactions between N-termini of the subunits

affect both kcat and Km and (2) the interaction of Met140 with a hydrophobic pocket on an adjacent subunit is the major stabilizer of the tetramer. Studies in this dissertation call into question the conclusions on the N-truncated mutant. Our current work shows that the N-terminus of L1 directs L1 into the periplasm of E. coli, and the resulting enzyme binds 2 equivalents of Zn(II). The removal of the N-terminus results in Mβl L1 being folded in the cytoplasm and bound to iron and Zn(II). The different kinetic constants exhibited by the N-truncated mutant were probably due to the different metal content of this mutant, as compared to those of the wild-type and M140D enzymes. Our studies are described in Chapter 4 of this dissertation.

3.7 Metal substitution and spectroscopic studies on Mβl L1. The essential role of Zn(II) in L1 was first verified by observing that EDTA could inhibit enzyme activity (48). Saino et al. also reported that 1 mM Fe or Cu inhibited Mβl L1’s hydrolytic activity towards penicillin G, presumably by replacing Zn(II) in the active site of the enzyme (44). Periyannan reported that Zn(II) was required for the production of Zn(II)- containing, catalytically-active Mβl L1 in vivo (41), which contradicted Wommer et al. who predicted that Mβl L1 exists as an apoprotein (45). Since transcription and translation require a number of Zn(II)-metalloproteins, it is impossible to determine if Periyannan’s work unambiguously indicates that Zn(II) must be present for Mβl L1 to fold properly. It is not clear what is the physiologically-relevant form of Mβl L1. The electronic configuration of Zn(II) is [Ar]d10, and Zn(II) is silent to most of the common spectroscopic techniques, such as paramagnetic 1H NMR, EPR, and electronic spectroscopies, that are used to characterize metalloproteins. However, Zn(II) is often substituted with Co(II) to obtain catalytically-active surrogates that can be interrogated with the techniques listed above. The resulting Co(II)-substituted proteins can be used in spectroscopic studies to obtain structural information, without the requirement of crystals or synchrotrons (EXAFS), and in rapid-freeze quench/spectroscopic studies to obtain mechanistic information. The three most common ways to prepare Co-substituted protein are: (1) direct exchange in which the Zn(II)-containing protein is dialyzed against high concentrations of Co(II), (2) direct addition in which Co(II) is added to apo-protein, and (3) biological incorporation in which the metalloprotein is over-expressed in growth medium containing high concentrations of Co(II). All three methods have been used in an effort to prepare Co(II)-substituted L1. The first method involved dialyzing Mβl L1 against 1 mM Co(II); however, the resulting protein was shown to bind greater than 1.5 equivalents of Zn(II) (Periyannan and Crowder, unpublished results). Periyannan et al. utilized the second method; however, the resulting protein immediately turned yellow, suggesting that Co(II) oxidized to Co(III) (38). The oxidation was thought to be caused by the solvent- exposable disulfide in L1. To overcome this problem, the disulfide bond was first reduced with TCEP (tris(2-carboxyethyl)phosphine) before the addition of Co(II). The resulting enzyme remained pink, indicating the presence of Co(II); however, the enzyme

required 3 equivalents of Co(II) to fully saturate the enzyme. Lastly, Periyannan et al. attempted the biological incorporation method by over-expressing Mβl L1 in minimal medium containing 100 μM Co(II). The resulting protein was shown to bind only one equivalent of Co(III) (38). A novel method to prepare Co(II)-substituted L1, which contains only 2 equivalents of metal, is described in Chapter 2 of this dissertation. Co(II)-substituted L1, which was prepared by addition of Co(II) to apo-L1 that was preincubated with TCEP, was reacted with nitrocefin, penicillin G, meropenem, and cephalothin, and the reactions were analyzed with by rapid freeze quench EPR studies (50). The EPR spectra of trapped enzyme-substrate complexes at different reaction times of 10 ms, 39 ms and 60 s were compared with the EPR spectrum of resting Mβl L1. The results showed that substrate, intermediate, and product bind to the metal center; however since this form of the enzyme contained only 2 equivalents of Co(II), all of the metal

binding sites were not saturated. In addition, the Zn1 and Zn2 sites contained the same metal ion, and it is impossible to deconvolute the contribution of each metal ion to binding/catalysis. This goal can only be realized with a heterobimetallic analog of Mβl L1, which has Co(II) bound to one site and Zn(II) bound to the other. Chapter 4 in this dissertation describes the preparation of such an analog and RFQ-EPR studies on this analog.

4. Introduction to dissertation Despite a large number of papers on Mβl L1, there remain significant questions about the enzyme, including: (1) What is the function of Zn(II) during the folding of Mβl L1? (2) What is the physiologically-relevant form of Mβl L1? What is the reaction mechanism of this form of the enzyme?

(3) What is the function of the metal ions in the Zn1 and Zn2 sites? (4) What role does the conserved, flexible loop that covers the active site of Mβl L1 play? This dissertation provides answers to these questions as indicated below: Chapter 2 describes the preparation of Co(II)-substituted L1 that requires only 2 equivalents of Co(II) to fully saturate the metal binding site. A novel method involving a

biological incorporation strategy was developed to prepare this analog. This chapter has been published in Anal. Biochem. Chapter 3 shows that the metallation of Mβl L1 depends on the bioavailability of metal and that the active site of Mβl L1 is very flexible and can bind Zn, Fe and Mn. This chapter has been published in Biochemistry.

Chapter 4 describes the preparation of the Zn1Co2- and Zn1Fe2-analogs of L1 and kinetic and spectroscopic characterization of these heterobimetallic analogs. The chapter

demonstrates the function of the Zn1 and Zn2 sites during catalysis. This chapter has been submitted to J.Am.Chem.Soc. and we are currently making corrections to the manuscript.

Chapter 5 describes the preparation and characterization of CuCu- and Zn1Ni2- analogs of L1. This chapter will be submitted soon to J.Biol.Inorg.Chem. Chapter 6 describes the preparation of double spin-labeled L1 and preliminary DEER and RFQ-DEER spectra on this analog. Chapter 7 summarizes the work in this dissertation and offers some suggestions for novel, rationally-designed inhibitors.

References: 1. Vellar, I. D. (2002) "Howard Florey, Alexander Fleming and the fairy tale of penicillin," Med. J. Aust. 177, 52-52. 2. Rodriguez-Saiz, M., Diez, B., and Barredo, J. L. (2005) "Why did the Fleming strain fail in penicillin industry?," Fungal Genet. Biol. 42, 464-470. 3. Jacobs, F. (1985) Breakthrough: The True Story of Penicillin, Dodd, Mead & Company, New York. 4. Knowles, J. R. (1985) "Penicillin Resistance: The Chemistry of β-Lactamase Inhibition," Acc. Chem. Res. 18, 97-104. 5. Dong, H. K., Dore, M. P., Kim, J. J., Kato, M., Lee, M., Wu, J. Y., and Graham, D. Y. (2003) "High-Level ß-Lactam Resistance Associated with Acquired Multidrug Resistance in Helicobacter pylori," Antimicro. Agents Chemo. 47, 2169-2178. 6. Crowder, M. W., and Walsh, T. R. (1999) "Metallo-β-Lactamases: Structure and Function," Res. Signpost 3, 105-132. 7. Walsh, T. R., Toleman, M. A., Poirel, L., and Nordmann, P. (2005) "Metallo-β- lactamases: the quiet before the storm?," Clin. Microbiol. Rev. 18, 306-325. 8. Bush, K., Jacoby, G. A., and Medeiros, A. A. (1995) "A Functional Classification Scheme for β-lactmases and Its Correlation with Molecular Structure," Antimicro. Agents Chemo. 39, 1211-1233. 9. Williams, J. D. (1999) "β-Lactamases and β-Lactamase Inhibitors," Int. J. Antimicro. Agents Suppl., S3-S7. 10. Crowder, M. W., Spencer, J., and Vila, A. J. (2006) "Metallo-β-lactamases: Novel weaponry for antibiotic resistance in bacteria," Acc. Chem. Res. 39, 721-728. 11. Carfi, A., Duee, E., Galleni, M., Frere, J. M., and Dideberg, O. (1998) "1.85 A Resolution Structure of the ZincII β-Lactamase II from Bacillus cereus," Acta Crystallogr. D 54, 313-323. 12. Yang, Y., Keeney, D., Tang, X. J., Canfield, N., and Rasmussen, B. A. (1999) "Kinetic Properties and Metal Content of the Metallo-β-Lactamase CcrA Harboring Selective Amino Acid Substitutions," J. Biol. Chem.274, 15706-15711.

13. Garau, G., Bebrone, C., Anne, C., Galleni, M., Frere, J. M., and Dideberg, O. (2005) "A metallo-β-lactamase enzyme in action: crystal structure of the monozinc carbapenemase CphA and its complex with biapenem," J. Mol. Biol. 345, 785-795. 14. Ullah, J. H., Walsh, T. R., Taylor, I. A., Emery, D. C., Verma, C. S., Gamblin, S. J., and Spencer, J. (1998) "The crystal structure of the L1 metallo-β-lactamase from Stenotrophomonas maltophilia at 1.7 Å resolution," J. Mol. Biol. 284, 125- 136. 15. Murphy, A., Catto, L., Halford, S. E., Hadfield, A. T., Minor, W., Walsh, T., and Spencer, J. (2006) "Crystal Structure of Pseudomonas aeruginosa SPM-1 Provides Insights into Variable Zinc Affinity of Metallo-β-lactamases," J. Mol. Biol. 357, 890-903. 16. Daiyasu, H., Osaka, K., Ishino, Y., and Toh, H. (2001) "Expansion of the zinc metallo-hydrolase family of the β- lactamase fold," FEBS Lett. 503, 1-6. 17. de la Sierra-Gallay, I. L., Pellegrini, O., and Condon, C. (2005) "Structural basis for substrate binding, cleavage and allostery in the tRNA maturase RNaseZ," Nature 433, 657-661. 18. Spencer, J., Read, J., Sessions, R. B., Howell, S., Blackburn, G. M., and Gamblin, S. J. (2005) "Antibiotic recognition by binuclear metallo-β-lactamases revealed by X-ray crystallography," J. Am. Chem. Soc. 127, 14439-14444. 19. Crowder, M. W., Walsh, T. R., Banovic, L., Pettit, M., and Spencer, J. (1998) "Overexpression, Purification, and Characterization of the Cloned Metallo-β- Lactamase L1 from Stenotrophomonas maltophilia," Antimicro. Agents Chemo. 42, 921-926. 20. Yang, Y., Rasmussen, B. A., and Bush, K. (1992) "Biochemical Characterization of the Metallo-β-lactamase CcrA from Bacteroides fragilis TAL3636," Antimicro. Agents Chemo. 36, 1155-1157. 21. Crawford, P. A., Sharma, N., Chandrasekar, S., Sigdel, T., Walsh, T. R., Spencer, J., and Crowder, M. W. (2004) "Over-expression, purification, and characterization of metallo-β-lactamase ImiS from Aeromonas veronii bv. sobria," Prot. Express. Purif. 36, 272-279.

22. Materon, I. C., Queenan, A. M., Koehler, T. M., Bush, K., and Palzkill, T. (2003) "Biochemical characterization of β-lactamases Bla1 and Bla2 from Bacillus anthrasis," Antimicro. Agents Chemo. 47, 2040-2042. 23. Bicknell, R., and Waley, S. G. (1985) "Cryoenzymology of Bacillus cereus β- Lactamase II," Biochemistry 24, 6876-6887. 23. Bicknell, R., and Waley, S. G. (1985) "Cryoenzymology of Bacillus cereus β- Lactamase II," Biochemistry 24, 6876-6887. 24. Bicknell, R., Schaffer, A., Waley, S. G., and Auld, D. S. (1986) "Changes in the Coordination Geometry of the Active Site Metal during Catalysis of Benzylpenicillin Hydrolysis by Bacillus cereus β-Lactamase II," Biochemistry 25, 7208-7215. 25. Badarau, A., and Page, M. (2008) "Loss of enzyme activity during turnover of the Bacillus cereus β-lactamase catalysed hydrolysis of β-lactams due to loss of zinc ion," J. Biol. Inorg. Chem. 26. Wang, Z., Fast, W., and Benkovic, S. J. (1998) "Direct Observation of an Enzyme-Bound Intermediate in the Catalytic Cycle of the Metallo-β-Lactamase from Bacteroides fragilis," J. Am. Chem. Soc.120, 10788. 27. McMannus-Munoz, S., and Crowder, M. W. (1999) "Kinetic Mechanism of Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia," Biochemistry 38, 1547-1553. 28. Spencer, J., Clark, A. R., and Walsh, T. R. (2001) "Novel Mechanism of Hydrolysis of Therapeutic β-Lactams by Stenotrophomonas maltophilia L1 Metallo-β-Lactamase," J. Biol. Chem. 276, 33638-33644. 29. Sharma, N. P., Hajdin, C., Chandrasekar, S., Bennett, B., Yang, K. W., and Crowder, M. W. (2006) "Mechanistic studies on the mononuclear Zn(II)- containing metallo-β-lactamase ImiS from Aeromonas sobria," Biochemistry 45, 10729-10738. 30. Bennett, B. (2002) "EPR of Co(II) as a Structural and Mechanistic Probe of Metalloprotein Active Sites: Characterization of an Aminopeptidase," Curr. Topics Biophys. 26, 49-57.

31. Bertini, I., and Luchinat, C. (1984) "High-Spin Cobalt(II) as a Probe for the Investigation of Metalloproteins," Adv. Inorg. Biochem. 6, 72-111. 32. Xu, D., Zhou, Y., Xie, D., and Guo, H. (2005) "Antibiotic binding to monozinc CphA β-lactamase from Aeromonas hydrophila: quantum mechanical/molecular mechanical and density functional theory studies.," J. Med. Chem. 48, 6679-6689. 33. Xu, D., Guo, H., and Cui, Q. (2007) "Antibiotic deactivation by dizinc β- lactamase: Mechanistic insights from QM/MM and DFT studies," J. Am. Chem. Soc. 129, 10814-10822. 34. Wang, C., and Guo, H. (2007) "Quantum mechanical/ molecular mechanical simulations of inhibitor binding by metallo-β-lactamase IMP-1 from Pseudomonas aeruginosa.," J. Phys. Chem. B. 111, 9986-9992. 35. Dal Peraro, M., Vila, A. J., Carloni, P., and Klein, M. (2007) "Role of zinc content on the catalytic efficiency of B1 metallo-β-lactamases.," J. Am. Chem. Soc. 129, 2808-2816. 36. Walsh, T. R., Hall, L., Assinder, S. J., Nichols, W. W., Cartwright, S. J., MacGowan, A. P., and Bennett, P. M. (1994) "Sequence Analysis of the L1 Metallo-β-Lactamase from Xanthomonas maltophilia," Biochim. Biophy. Acta. 1218, 199-201. 36. Walsh, T. R., Hall, L., Assinder, S. J., Nichols, W. W., Cartwright, S. J., MacGowan, A. P., and Bennett, P. M. (1994) "Sequence Analysis of the L1 Metallo-β-Lactamase from Xanthomonas maltophilia," Biochim. Biophy. Acta. 1218, 199-201. 37. Hawkey, P. M., Birkenhead, D., Kerr, K. G., Newton, K. E., and Hyde, W. A. (1993) "Effect of Divalent-Cations in Bacteriological Media on the Susceptibility of Xanthomonas-Maltophilia to Imipenem, with Special Reference to Zinc Ions," J. Antimicro. Chemo. 31, 47-55. 38. Crowder, M. W., Yang, K. W., Carenbauer, A. L., Periyannan, G., Seifert, M. A., Rude, N. E., and Walsh, T. R. (2001) "The Problem of a Solvent Exposable Disulfide when Preparing Co(II)-Substituted Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia," J. Biol. Inorg. Chem. 6, 91-99.

39. Garrity, J. D., Carenbauer, A. L., Herron, L. R., and Crowder, M. W. (2004) "Metal Binding Asp-120 in Metallo-β-lactamase L1 from Stenotrophomonas maltophilia Plays a Crucial Role in Catalysis," J. Biol. Chem. 279, 920-927. 40. Garrity, J. D., Pauff, J. M., and Crowder, M. W. (2004) "Probing the dynamics of a mobile loop above the active site of L1, a metallo-β-lactamase from Stenotrophomonas maltophilia, via site-directed mutagenesis and stopped-flow fluorescence spectroscopy," J. Biol. Chem. 279, 39663-39670. 41. Periyannan, G., Shaw, P. J., Sigdel, T., and Crowder, M. W. (2004) "In vivo folding of recombinant metallo-β-lactamase L1 requires the presence of Zn(II)," Prot. Sci. 13, 2236-2243. 42. Costello, A., Periyannan, G., Yang, K. W., Crowder, M. W., and Tierney, D. L. (2006) "Site-selective binding of Zn(II) to metallo-β-lactamase L1 from Stenotrophomonas maltophilia," J. Biol. Inorg. Chem. 11, 351-358. 43. Carenbauer, A. L., Garrity, J. A., Periyannan, G., Yates, R. B., and Crowder, M. W. (2002) "Probing Substrate Binding to Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia by Using Site-Directed Mutagenesis," BMC Biochemistry 3, 4-10. 44. Saino, Y., Kobayashi, F., Inoue, M., and Mitsuhashi, S. (1982) "Purification and Properties of Inducible Penicillin β-Lactamase Isolated from Pseudomonas maltophilia," Antimicro. Agents Chemo. 22, 564-570. 45. Wommer, S., Rival, S., Heinz, U., Galleni, M., Frere, J. M., Franceschini, N., Amicosante, G., Rasmussen, B., Bauer, R., and Adolph, H. W. (2002) "Substrate- activated zinc binding of metallo-β-lactamases - Physiological importance of the mononuclear enzymes," J. Biol. Chem. 277, 24142-24147. 46. Yang, K. W., and Crowder, M. W. (2004) "Method for removing EDTA from Apo-proteins," Anal. Biochem. 329, 342-344. 47. Scrofani, S. D. B., Chung, J., Huntley, J. J. A., Benkovic, S. J., Wright, P. E., and Dyson, H. J. (1999) "NMR Characterization of the Metallo-β-lactamase from Bacteroides fragilis and Its Interaction with a Tight-Binding Inhibitor: Role of an Active-Site Loop," Biochemistry 38, 14507-14514.

48. Crisp, J., Conners, R., Garrity, J. D., Carenbauer, A. L., Crowder, M. W., and Spencer, J. (2007) "Structural basis for the role of Asp-120 in metallo-β- lactamases," Biochemistry 46, 10664-10674. 49. Simm, A. M., Higgins, C. S., Carenbauer, A. L., Crowder, M. W., Bateson, J. H., Bennett, P. M., Clarke, A. R., Halford, S. E., and Walsh, T. R. (2002) "Characterization of Monomeric L1 Metallo-β-lactamase and the Role of the N- terminal Extension in Negative Cooperativity and Antibiotic Hydrolysis," J. Biol. Chem. 277, 24744-24752. 50. Garrity, J. D., Bennett, B., and Crowder, M. W. (2005) "Direct evidence that reaction intermediate in metallo-β-lactamase is metal bound," Biochemistry 44, 1078-1087.

Chapter 2

Folding strategy to prepare Co(II)-substituted metallo-β-lactamase L1

Zhenxin Hu, Gopal R. Periyannan, and Michael W. Crowder*

‡Department of Chemistry and Biochemistry, 160 Hughes Hall, Miami University, Oxford, OH 45056

*To whom correspondence should be addressed: M.W. Crowder e-mail: [email protected] phone: (513) 529-7274 fax: (513) 529-5715

Mailing address: Michael W. Crowder Department of Chemistry and Biochemistry Miami University 160 Hughes Hall Oxford, OH 45056

Contributions to this chapter: Gopal conducted the Co(II) titrations and L1 over- expression in minimal medium with Co(II). All of the other data were collected and analyzed by Zhenxin Hu.

ABSTRACT

In an effort to overcome previous problems with the preparation of Co(II)- substituted metallo-β-lactamase L1, two strategies were undertaken. Attempts to prepare Co(II)-substituted L1 using biological incorporation resulted in an enzyme that contained only one equivalent of cobalt and exhibited no catalytic activity. Co(II)-substituted L1 could be prepared by refolding metal-free L1 in the presence of Co(II), and the resulting enzyme contained 1.8 equivalents of cobalt, yielded a UV-Vis spectrum consistent with -1 five-coordinate Co(II), and exhibited a kcat of 63 s and Km of 20 μM when using nitrocefin as the substrate. Pre-steady state fluorescence and UV-Vis studies demonstrated that refolded, Co(II)-substituted L1 utilizes the same kinetic mechanism as Zn(II)-containing L1 in which a reaction intermediate is formed when using nitrocefin as substrate. The described refolding strategy can be used to prepare other Co(II)- substituted, Zn(II)-metalloenzymes, particularly those that contain a solvent-exposable disulfide, which often causes oxidation of Co(II) to Co(III).

Keywords: Co(II)-substitution, Zn(II)-metalloenzyme, metallo-β-lactamase, refolding

2.1 Introduction Bacterial resistance to β-lactam-containing antibiotics is most often accomplished by the production of β-lactamases, which cleave the C-N bond of the β-lactam ring and render these antibiotics ineffective as antimicrobial agents (1-4). There are nearly 500 β- lactamases that have been identified, and these enzymes have been categorized into 4 distinct groups (5, 6). Group A, C, and D β-lactamases utilize an active site serine for nucleophilic attack on the β-lactam carbonyl (7, 8). The group B enzymes require the presence of Zn(II) and are called metallo-β-lactamases (mbl’s). There are currently over 30 mbl’s, and these enzymes have been categorized into 3 distinct subgroups based on sequence homology and metal content of the fully-active enzyme (1, 5, 6). Subgroup B1 enzymes require 2 Zn(II) ions for full catalytic activity and share two conserved Zn(II)

sites: Zn1 is coordinated by 3 His and a bridging solvent molecule and Zn2 is coordinated by one histidine, one aspartate, one cysteine, the bridging solvent molecule, and a terminally-bound solvent molecule. The B1 enzymes are represented by β-lactamase II from B. cereus (9), IMP-1 from Pseudomonas aeruginosa (10), Bla2 from B. anthracis (11), and CcrA from Bacteroides fragilis (12). Subgroup B2 enzymes require 1 Zn(II), coordinated by one aspartate, one histidine, one cysteine, and one solvent molecule, for full activity, prefer carbapenems as substrates, share 11% amino acid sequence identity with the subgroup B1 enzymes, and are represented by CphA from A. hydrophila and ImiS from A. sobria (13, 14). Subgroup B3 enzymes require 2 Zn(II) ions for full

activity, contain a Zn1 site similar to that observed in the B1 enzymes, contain a Zn2 site with 2 histidines, 1 aspartate, the bridging solvent molecule, and a terminally-bound solvent molecule, prefer penicillins as substrates, share only 9 conserved residues with the B1 enzymes, and are represented by L1 and FEZ (Figure 2.1) (15, 16). The first metallo-β-lactamase was discovered in 1966 (17), and this enzyme was considered to be an oddity. However as the use of β-lactam-containing antibiotics increased, more strains of emerging pathogens that harbor a mβl appeared in the clinic. For example, mβl’s have been found in strains such as B. anthracis, P. aeruginosa, and Acinetobacter spp. (4, 11). Importantly, there are no known clinical inhibitors of any mβl.

Figure 2.1: Active site of L1. Zn1 site has His116, His118, His196, and a bridging

hydroxide as ligands. Zn2 site has Asp120, His121, His263, bridging hydroxide, and terminally-bound water (not shown) as ligands.

In an effort to discover novel inhibitors of the mβl’s, we have been characterizing an enzyme from each of the distinct mβl subgroups in hopes of uncovering a common structural or mechanistic aspect towards which an inhibitor can be designed. Unfortunately due its electron configuration of [Ar]3d10, Zn(II) is silent to all common spectroscopic techniques except EXAFS spectroscopy. However in most Zn(II)- metalloenzymes, the Zn(II) can be replaced by high-spin Co(II) (electron configuration of [Ar]3d7 and a S = 3/2) to yield a structurally-similar and catalytically-active analog (18- 23). The two most common ways to prepare Co(II)-substituted enzymes is (1) direct addition of Co(II) to metal-free, Zn(II)-metalloenzyme, which was prepared by the use of chelators and exhaustive dialysis steps, and (2) biological incorporation of Co(II) into a recombinant enzyme during over-expression (18). Our previous studies on mβl L1 demonstrated that a solvent-exposable disulfide can complicate the preparation of active, Co(II)-substituted enzyme (24). Nonetheless, we were able to prepare L1 containing Co(II) if the disulfide was reduced with TCEP (tris(2-carboxyethyl)phosphine) before addition of Co(II). The resulting enzyme was active and exhibited UV-Vis, 1H NMR, and EPR spectra consistent with the presence of Co(II). However, the protein bound 2.5 equivalents cobalt even after extensive dialyses. The 0.5 equivalents of excess Co(II) was predicted to bind the reduced cysteines, and although the cysteine-containing site is remote from the active site, the presence of extra Co(II) complicated the interpretation of subsequent spectroscopic studies. In an effort to overcome the problem with preparing Co(II)-substituted L1 using the direct addition method, we sought to test other methods. First, we attempted to prepare Co(II)-containing L1 using a biological incorporation strategy. Unfortunately, the resulting enzyme was isolated containing only 1 equivalent of cobalt and was not catalytically-active. Therefore, we attempted to prepare Co(II)-substituted L1 by unfolding apo-L1 and then refolding the enzyme in the presence of Co(II). By using this technique, we were able to prepare catalytically-active, Co(II)-substituted L1.

2.2 Materials and Methods Over-expression and purification of L1. A 50 mL overnight preculture of BL21(DE3)pLysS E. coli cells containing the pET26b-based plasmid that encodes for L1

was used to innoculate 4 X 1L flasks of Luria-Bertani (LB) medium, and L1 was over- expressed and purified as described previously (25). In an effort to prepare Co(II)- substituted L1 using a biological incorporation method, the innoculum was grown in minimal medium at 37 °C with shaking until the culture reached an optical density at 600 nm of 0.6-0.8. The culture was then cooled to 15 °C for 30 minutes, was made 0.5 mM in

IPTG and 100 μM in CoCl2, and shaken overnight at 15 °C for roughly 16 hours. The culture was centrifuged for 15 minutes (8200 x g), and the resulting cell pellet was resuspended in 30-40 mL of 30 mM Tris, pH 8.5 (buffer A). The cells were lysed by passing the resuspended cells through a French Press three times at a pressure of 1000- 1500 psi. After removal of insoluble components by centrifugation (25 minutes at 23,400 x g), the supernatant was dialyzed versus 2L buffer A overnight. The dialyzed protein solution was centrifuged (25 min at 23,400 x g) to remove any precipitated proteins and subjected to FPLC as previously reported [25]. The FPLC fractions were analyzed by SDS-PAGE gels, and the fractions containing > 90% pure protein were pooled and concentrated by using an Amicon equipped with a YM-10 membrane.

Preparation of metal-free (apo) L1. A concentrated solution (< 10 mL) of L1 (~ 0.3 mM) was dialyzed against 4 X 1 L of 50 mM Hepes, pH 7.0, containing 10 mM 1,10- phenanthroline and then dialyzed against 6 X 1 L of 50 mM Hepes, pH 7.0. The metal content of the resulting sample was ascertained by ICP-AES, as previously reported (25). The sample was stored at -80 οC.

Preparation of Co(II)-substituted L1 with TCEP. Apo-L1 was incubated with 1 mM tris-(carboxyethyl)phosphine (TCEP) on ice for 30 min. This enzyme was titrated with Co(II), and the UV-Vis spectrum of each sample was obtained using an Agilent 8453 UV-Vis spectrophotometer.

In vitro unfolding and refolding of L1. Apo-L1 (2 ml, 100 µM) was diluted with 18 ml of 6 M guanidinium chloride (Gdn-HCl). The sample was incubated on ice for 1 hour and then dialyzed versus 1 L of 50 mM Hepes, pH 7.0, containing no added metal or 50 μM Zn(II) or Co(II). Refolded L1 was further dialyzed versus 5 X 1L of Chelex-treated, 50

mM HEPES, pH 7.0, to remove any unbound metals. The resulting solution was centrifuged (25 min at 23,400 x g) to remove any precipitated protein.

Metal analyses. The metal content of protein samples was determined by using a Perkin- Elmer Inductively Coupled Plasma Spectrometer with Atomic Emission detection (ICP- AES), as previously described (25).

Steady-state kinetics. Steady-state kinetic studies were performed on an Agilent 8453A UV-Vis diode array spectrophotometer at 25 oC using nitrocefin as the substrate and 50 mM cacodylate, pH 7.0, as the buffer.

Stopped-flow kinetic studies. Stopped-flow kinetic experiments were performed on an Applied Photophysics SX18MV apparatus equipped with a constant temperature circulating water bath. The pathlength of the observation cell was 0.2 cm for the fluorescence measurements, and both excitation and emission slits were maintained at 4 mm. Fluorescence data were collected using an excitation wavelength of 295 nm and a WG320 nm cut-on filter on the emission photomultiplier. The photomultiplier input was adjusted for each protein concentration to maintain a total signal change of 1V between protein in the absence of substrate and dark current readings. Data were recorded as photomultiplier output in volts. For absorbance experiments, data were recorded as absorbance units, with photomultiplier input first adjusted to give a reading of 0 for buffer only at each wavelength used. All experiments were performed in Chelexed- treated, 50 mM cacodylate, pH 7.0, at 10 ºC using nitrocefin as substrate.

Fluorescence spectra. A Perkin-Elmer LS55 Luminescence spectrometer, tuned to an excitation wavelength of 295 nm and emission wavelength of 340 nm with a slit width of 5 nm, was used to monitor fluorescence emission intensities of the proteins. A 4 mm quartz cuvette was used, and the protein concentrations were 1 μM. Chelex-treated 50 mM HEPES, pH 7.0, was used as a buffer blank.

2.3 Results Adding Co(II) to TCEP-treated apo-L1. We previously reported that adding Co(II) to apo-L1 resulted in a rapid oxidation of Co(II) to Co(III) (24). We reasoned that oxidation was due to the presence of a solvent-accessible disulfide in L1. The addition of TCEP (tris(2-carboxyethyl)phosphine) before adding Co(II) resulted in a pink colored protein that was stable for several weeks. In an effort to further probe Co(II) binding, the UV-Vis difference (spectrum of Co-L1 minus spectrum of apo-L1) spectra of TCEP-treated, apo-

L1 upon titration with CoCl2 were obtained (24) (Figure 2.2 top). Two distinct sets of absorption peaks were observed: (1) a broad band that is positioned at 325 nm when 1 equivalent of Co(II) is present but shifts to 360 nm when higher concentrations of Co(II) are present and (2) a broad peak between 450 and 700 nm comprised of at least 4 distinct features. The former peak that shifts from 325 to 360 nm exhibits an extinction

coefficient of ε = 86 M-1cm-1 (per Co(II)), and the position of this peak is consistent 340 with it being due to a cysteine S → Co(II) ligand to metal charge transfer (LMCT) transition, which has been observed in electronic spectra of other Co(II)-substituted metallo-β-lactamases (26-29). However, the peak at 340 nm in the spectrum of Co(II)- substituted L1 is much broader than those in other metallo-β-lactamases (26-29). It is possible that there may be additional peaks (for example at 400 nm) under the putative LMCT. The intensities of S → Co(II) LMCT’s in the other metallo-β-lactamases are

-1 -1 typically equal to ε320nm = 1,000 M cm , suggesting that cysteine-containing Co(II) binding site in L1 is minimally-occupied. The only two cysteines in L1 are Cys218 and Cys246 that form a disulfide bond (16). The addition of TCEP presumably reduces this disulfide bond and allows for Co(II) binding at substoichiometric levels. As a control, the UV-Vis spectra of 1 mM TCEP and 1 mM TCEP + 1 mM Co(II) were obtained, and TCEP exhibits an absorbance at 310 nm (ε = 430 M-1cm-1). There are no additional peaks in the spectrum of TCEP + Co(II) (data not shown). The absorbance due to TCEP was subtracted in the difference spectra shown in Figure 2.2 (top). As another control, a sample of 1 mM 2Zn-L1 (sample of L1 containing 2 equivalents of Zn(II)) was made 1 mM in TCEP, and 1 equivalent of Co(II) was added to this sample. A peak at 320 nm appeared that had an ε = 460 M-1cm-1, which we have assigned to a cysteinyl S to Co(II) LMCT (data not shown). The other features from 450 and 700 nm are ligand field

0.14

0.12

0.10

0.08

0.06 Absorbance

0.04

0.02

0.00 300 400 500 600 700 800 Wavelength (nm)

Figure 2.2: UV-Vis spectra of cobalt-containing analogs of L1. (top) cobalt-containing L1 prepared by addition of Co(II) to TCEP-treated apo-L1 and (bottom) refolded, cobalt- containing L1. The enzyme concentration in all samples was 1 mM, and the buffer was 50 mM cacocylate, pH 7.0.

transitions of high-spin Co(II) (22, 30). The absorbance of these transitions increased until 3 equivalents of Co(II) were added to the enzyme, suggesting that the metal binding sites in TCEP-treated L1 are saturated only after 3 equivalents of Co(II) are added. Since the extinction coefficient of Co(II) ligand field transitions is dependent on the coordination number of Co(II) (22, 30), we determined the extinction coefficients of these transitions during the Co(II) titration. The extinction coefficient of the peak at 545 nm increased from 26, 75, 120 M-1cm-1 as the Co(II)/protein stoichiometry increased from 1.0, 2.0, to 3.0 equivalents. Since our previous EXAFS studies demonstrate sequential binding of Zn(II) (31), this result suggests that the first equivalent of Co(II) is 6-coordinate and the second and third equivalents are 5-coordinate (22, 30). However, we cannot rule out the possibility that Co(II) binds differently than Zn(II) to L1, and recent work on BcII suggests a very complicated pathway for Co(II) binding to this enzyme (32). If Co(II) does not bind sequentially to L1, the coordination numbers of the first and second equivalents of Co(II) cannot be determined. The catalytic properties of TCEP-reduced L1 containing 1, 2, and 3 equivalents of Co(II) were ascertained (Table 2.1) in assays using nitrocefin as the substrate. TCEP- -1 reduced L1 containing 1 equivalent of Co(II) (1 CoL1) exhibited a kcat of 14 s and a Km of 10 + 3 μM. A second Co(II) resulted in an enzyme (2 CoL1) with a similar Km value (8

+ 1 μM) but a kcat that is roughly twice that of enzyme containing 1 equivalent of Co(II) -1 (kcat = 27 + 1 s ). The third equivalent of Co(II) resulted in an enzyme (3 CoL1) that -1 exhibits a kcat of 71 + 9 s ; however, this enzyme also had a larger Km value of 30 + 7 μM.

Preparation of Co(II)-substituted L1 by biological incorporation. Metallo-β-lactamase

L1 was over-expressed in minimal medium (pH 6.8) containing 100 μM CoCl2 according to previously published procedures (25). After FPLC, the Q-Sepharose fractions containing L1, as identified by SDS-PAGE gels, were not pink in color, as expected for Co(II)-substituted L1 (24, 33). Metal analyses revealed that the purified enzyme bound only 1.0 + 0.1 equivalent of cobalt (Table 2.1) and showed that the sample contained less than 0.1 equivalents of Zn(II), Fe, or Mn. Steady-state kinetics revealed that the enzyme -1 exhibited a kcat of 2.8 + 0.1 s and a Km of 13 + 2 μM (Table 2.1) when using nitrocefin

as the substrate. Steady-state kinetics were repeated using buffers containing 100 μM

CoCl2 in an attempt to further load the enzyme with its full complement of metal. However, steady-state kinetic constants were not greatly changed. The UV-Vis difference (spectrum of Co-L1 minus the spectrum of apo-L1) spectrum of the isolated enzyme showed a broad, small feature at 340 nm and no resolved peaks between 500 – 600 nm, which are due to Co(II) ligand field transitions. These characteristics suggest that most of the cobalt in the sample is Co(III) (24). In an effort to increase the cobalt content in L1 via biological incorporation, L1 was over-expressed in minimal medium containing 500

μM or 1 mM CoCl2. However, L1 over-expressed in the presence of 500 μM CoCl2 contained only 1 equivalent of cobalt, and E. coli cells cultured in medium containing 1

mM CoCl2 lysed.

In vitro refolding of L1 in the absence of metal and in the presence of Zn(II) or Co(II). Since the methods of biological incorporation and direct addition of Co(II) did not result in the preparation of Co(II)-substituted L1 that could be used for future spectroscopic/mechanistic studies, we attempted to prepare Co(II)-substituted L1 by refolding L1 in the presence of Co(II). Our initial efforts to unfold and refold L1 involved using L1 that contained 2 equivalents of Zn(II) (2Zn-L1); however, our data suggested that 2Zn-L1 did not unfold completely even in the presence of 6 M guanidinum hydrochloride (data not shown), and the resulting refolded enzyme contained significant amounts of Zn(II). Therefore, we utilized metal-free (apo) L1 in the unfolding/refolding experiments. As previously reported (34), the fluorescence emission spectrum of apo-L1 is less intense than that of wild-type L1 (Figure 2.3). The addition of 6 M guandinium hydrochloride resulted in a red shift of the fluorescence emission spectrum from 335 nm to 345 nm, suggesting that apo-L1 is unfolded (35). A similar shift occurred when RNase

T1 was denatured in guanidinium hydrochloride, and the shift was attributed to a buried trytophan residue that was fully exposed to water upon unfolding (35, 36)

Table 2.1: Characterization of Co(II)-substituted L1 analogs.

Cobalt content -1 Species kcat (s ) Km (μM) (eq)

Biologically- 1.0 ± 0.1 2.8 ± 0.1 13 ± 2 incorporated L1

1 CoL1 1 14 ± 1 10 ± 3

2 CoL1 2 27 ± 1 8 ± 1

3 CoL1 3 71 ± 9 30 ± 7

L1 refolded w 1.8 ± 0.1 63 ± 3 20 ± 1 Co(II)

Steady state kinetic studies were conducted in Chelex-treated 50 mM cacodylate buffer, pH 7.0, using nitrocefin as the substrate, 25 ºC.

The resulting unfolded L1 was refolded by dialyzing the denaturant out of the sample in the (a) absence of metal ions, (b) in the presence of 100 μM Zn(II), or (c) in the presence of 100 μM Co(II). The fluorescence emission spectrum of L1 refolded in all conditions returned back to the position of apo- or wild-type L1 before Gdn-HCl was added; however, the intensities of L1 refolded in the absence of metal or in the presence of Co(II) were lower than that of L1 refolded in the presence of Zn(II) (data not shown). L1 refolded in the absence of metal was shown to bind < 0.03 equivalents of Zn(II) and -1 exhibit a kcat of < 0.1 s . This protein did apparently fold correctly since the addition of 2 equivalents of Zn(II) to L1 refolded in the absence of metal resulted in a protein that -1 exhibited a kcat of 31 + 1 s and a Km of 3.6 + 0.5 μM, when using nitrocefin as the substrate (Table 2.2). On the other hand, L1 refolded in the presence of 100 μM Zn(II) (and after extensive dialysis versus Chelex-treated buffer) was found to bind 2.0 + 0.1 equivalents -1 of Zn(II) and exhibit steady-state kinetic constants of kcat = 41 + 1 s and Km of 4.8 + 1.0

μM. This kcat value is almost 50% larger than that of wild-type (as-isolated) L1 and similar to that of wild-type L1 that is assayed in the presence of 100 μM Zn(II) ((25) and Table 2.2). This protein exhibited a fluorescence emission spectrum similar to that of as- isolated L1 (Figure 2.3). Unfolded L1 was also refolded in the presence of 100 μM Co(II). After dialysis to remove Gdn-HCl and excess Co(II), the resulting refolded protein was purple and bound 1.8 + 0.1 equivalents of cobalt and <0.1 equivalent of -1 Zn(II). The refolded, Co(II)-substituted L1 exhibited a kcat of 63 + 3 s and a Km of 20 + 1 μM when using nitrocefin as the substrate. These steady-state kinetic constants are similar to those of TCEP-reduced L1 containing 3 equivalents of Co(II) (Tables 2.1 and 2.2). The UV-Vis spectrum of refolded, Co(II)-substituted L1 showed several peaks, and there is a small, relatively sharp shoulder at 310 nm (Figure 2.2 (bottom)). The small peak at 400 nm (ε < 40 M-1cm-1) is attributed to small amounts of Co(III) in the sample. The remaining peaks are attributed to d-d bands of high-spin Co(II), and the extinction coefficient for the peak at 550 nm is 180 M-1cm-1, which is consistent with 5-coordinate Co(II) (22, 30).

Figure 2.3: Fluorescence emission spectra of L1 samples. The concentration of L1 in the samples was 1 μM, and the buffer was 50 mM Hepes, pH 7.0. An excitation wavelength of 295 nm was used.

To ascertain whether the refolded, Co(II)-substituted L1 exhibits similar kinetic properties as 2Zn-L1, we conducted stopped-flow fluorescence and UV-Vis studies using nitrocefin as the substrate. The stopped-flow fluorescence time course of 50 μM refolded 2Co-L1 with 50 μM nitrocefin showed a rapid decrease in fluorescence over the first 20 milliseconds of the reaction followed by a rapid return of fluorescence over the subsequent 100-150 milliseconds. The shape of the stopped-flow fluorescence trace and rates of fluorescence change are very similar to those previously reported for 2Zn-L1 (data not shown) (37). The reaction of 50 μM refolded 2Co-L1 with 50 μM nitrocefin was also monitored with stopped-flow UV-Vis studies. The absorbance at 390 nm, which corresponds to substrate (38, 39), decreased over the first 40 milliseconds (Figure 2.4B). The increase in absorbance at 50 ms has been observed previously by Spencer et al. and was attributed to the greater overlap of the absorbance of substrate with product as compared to that with intermediate (37). The relatively larger dip in the absorbance of the 390 nm peak in the stopped-flow data of 2Co-L1 (Figure 2.4B), as compared to that of 2Zn-L1 (Figure 2.4C), suggests that the overlap in absorbance of substrate and intermediate is greater in the case of 2Co-L1, and previous stopped-flow studies on Co- L1 demonstrated this scenario (33). The absorbance at 485 nm, which corresponds to the concentration of product (38, 39), rapidly increased over 100 milliseconds for both 2Co- L1 and 2Zn-L1 (Figure 2.4B). The absorbance at 665 nm, which is attributable to reaction intermediate (38, 39), rapidly increased during the first 20 milliseconds of the reaction and decreased over the next 100 milliseconds for both enzymes. It appears that the decay of the intermediate in the reaction with 2Co-L1 (Figure 2.4B) is slightly slower than that in the reaction with 2Zn-L1. In addition, more intermediate (1.6-fold) is observed in the traces with 2Zn-L1 (absorbance of 1.8) as compared to 2Co-L1 (absorbance of 1.1). Nonetheless, the 2Co-L1 analog exhibits very similar kinetic properties as 2Zn-L1.

Table 2.2: Metal content and steady-state kinetic constants of Zn(II)-containing L1 analogs.

-1 Species Zn(II) content (eq) kcat(s ) Km (μM)

Wild-type L1a 1.9 ± 0.1 27 ± 1 3.8 ± 0.5

Wild-type L1 1.9 ± 0.1 41 ± 1b 4 ± 1b

L1 refolded w/ 2.0 ± 0.1 41 ± 1 4.8 ± 0.3 Zn(II) L1 refolded w/o < 0.03 < 0.1 ND Zn(II) L1 refolded w/o 2 31 ± 1 3.6 ± 0.5 Zn(II)c

Steady state kinetic studies were carried out in Chelex-treated 50 mM cacodylate, pH7.0, using nitrocefin as the substrate, 25 ºC. aL1 over-expressed in LB medium according to previously published protocol (25). bKinetic reactions conducted in Chelex-treated 50 mM cacodylate, pH 7.0, containing 100 μM Zn(II). cTwo equivalents of Zn(II) were added to this sample before the steady state kinetic studies were conducted.

Figure 2.4: Stopped-flow kinetic studies of Co(II)-substituted L1. Fluorescence (top) and UV-Vis (bottom) trace. The reactions were carried out in Chelex-treated 50 mM cacodylate, pH 7.0, at 10 ºC, and the enzyme and substrate concentrations were 50 μM.

2.4: Discussion Zn(II) has been predicted to be a required cofactor in one third of all proteins, and Zn(II) is a cofactor in enzymes from all six major classes of enzymes (40, 41). Zn(II) metalloproteins play vital biological roles in all organisms and are targets for a number of drugs and drug candidates (42). However, the physicochemical properties (diamagnetism, color) of Zn(II) limit the number of physical techniques that can be used to structurally characterize the metal binding sites in Zn(II) metalloproteins, and only EXAFS spectroscopy and X-ray crystallography are commonly used to directly probe these metal binding sites. Therefore, Zn(II) is often replaced with other metal ions to afford spectroscopically-active analogs, and Co(II) is the most commonly used metal ion for this purpose. Co(II) has a similar ionic radius to Zn(II) and can accommodate the binding geometry and ligation of Zn(II) in biological molecules (18, 43). Moreover, almost all Co(II)-substituted enzymes are catalytically-active and allow for the use of UV-Vis, EPR, and paramagnetic 1H NMR spectroscopies to be used to characterize the metal binding sites. The coupling of rapid-freeze quench techniques with EPR spectroscopy allows for detailed structural characterization of reaction intermediates (33, 44, 45). In an effort to probe the metal binding sites to offer information that could lead to inhibitors, we and others have prepared Co(II)-substituted mbl’s and performed spectroscopic studies on the resulting enzymes (26, 29, 33, 44, 45). However, the preparation of Co(II)-substituted mbl L1 from Stenotrophomonas maltophilia (subgroup 3C) has been hampered by the presence of a solvent-accessible disulfide in the enzyme (24). The direct addition of Co(II) to metal-free L1 resulted in oxidation of Co(II) to Co(III) and an inactive L1 analog (24). To circumvent this problem, we reported a strategy in which the disulfide bond in metal-free L1 is reduced with TCEP before addition of Co(II). A catalytically-active analog of L1 was obtained; however, the resulting enzyme was shown to bind 2.5 equivalents of Co(II), which complicated the interpretation of subsequent spectroscopic studies. In fact, this present study shows that it takes 3 equivalents of Co(II) to saturate the metal binding sites in L1 (Figure 2.2). Two of the Co(II) ions are probably bound to the active site. Based on the extinction coefficient of the S to Co(II) LMCT at ~320 nm, the reduced Cys site is minimally occupied. We believe that there is some Co(III) in the sample (peak at ~400 nm), and it is possible that

Co(II) could also bind to the site identified in the recent crystal structure of Cu(II)-L1 (46). To prepare Co(II)-substituted L1, we attempted a biological incorporation strategy in which we over-expressed L1 in minimal medium containing various concentrations of Co(II). We reasoned that the disulfide bond would be reduced during folding and that the folding of L1 in the presence of Co(II) would result in a Co(II)-substituted enzyme. We were careful to make sure that the pH of the growth medium was under 7.0, since air oxidation of Co(II) is more favored at basic pH values (43). Unfortunately, the purified protein only bound 1 equivalent of cobalt regardless of the concentration of Co(II) in the growth medium, and UV-Vis spectra strongly suggest that the cobalt is Co(III). Since both traditional techniques to prepare Co(II)-substituted L1 were unsuccessful, we developed a new strategy that involved in vitro folding of L1 in the presence of metal ions. Our first test of this strategy involved the refolding of L1 in the absence of added metal ions. Apo-L1 was unfolded in the presence of 6M Gdn-HCl, and fluorescence emission spectroscopy was used to verify that the enzyme unfolded. The removal of Gdn-HCl by dialysis resulted in an enzyme that contained 0.03 equivalents of Zn(II) and exhibited very little activity. However, the addition of 2 equivalents of Zn(II) to this protein resulted in an enzyme that exhibited steady-state kinetic constants and fluorescence emission spectra very similar to those of as-isolated L1. This result was surprising since Periyannan et al. previously suggested that the proper in vivo folding of L1 requires the presence of Zn(II) (34). We also refolded apo-L1 in the presence of 100 μM Zn(II), and the resulting enzyme was shown to bind 2 equivalents of Zn(II) and

exhibit a kcat value that was 30% higher than that exhibited by as-isolated L1 (Table 2.2). This result suggests that some of the as-isolated L1 may not be folded correctly and that the in vitro folding procedure results in a higher percentage of correctly folded, catalytically-active enzyme. The refolding of apo-L1 in the presence of 100 μM Co(II) resulted in a pink protein that contained 1.8 equivalents of cobalt, and a UV-Vis spectrum is consistent with the presence of Co(II). The extinction coefficient of the ligand field bands suggests that the Co(II) ions are 5/6 coordinate. Interestingly, Co(II)-substituted

L1 exhibits a larger kcat value, as compared to that of 2Zn-L1, and this result is similar to the results on L1 containing 3 equivalents of cobalt.

The results presented in this work demonstrate a new strategy for preparing Co(II)-substituted analogs of the large number of Zn(II)-containing proteins that also have solvent-accessible disulfide bonds. For example, mung bean nuclease (47), the anti- sigma factor RsrA from S. coelicolor (48), the peroxide regulon repressor PerR (49), and E. coli primase (50) are Zn(II)-binding proteins that also contain a disulfide bond. The resulting Co(II)-substituted proteins could be structurally-characterized using UV-Vis, EPR, and 1H NMR spectroscopies and mechanistically-characterized using rapid-freeze quench EPR/EXAFS spectroscopies or stopped-flow UV-Vis studies. This technique may also be useful for generating Co(II)-substituted, Zn(II)-proteins that have a Cys as a metal binding ligand. The successful preparation of 2Co(II)-L1 now positions us to conduct rapid-freeze quench EPR and EXAFS studies to probe for intermediates in the reaction of the enzyme. These studies are currently underway.

2.5 Acknowledgments The authors would like to thank Karen Anderson for assistance in purifying the enzyme and the National Institutes of Health (GM40052) for funding this work.

2.6 References 1. Bush, K. (1998) "Metallo-β-Lactamases: A Class Apart," Clin. Infect. Dis. 27 (Supplement 1), S-48-53. 2. Crowder, M. W., Spencer, J., and Vila, A. J. (2006) "Metallo-β-lactamases: Novel weaponry for antibiotic resistance in bacteria," Acc. Chem. Res. 39, 721-728. 3. Toney, J. H., and Moloughney, J. G. (2004) "Metallo-β-lactamase inhibitors: promise for the future?," Curr. Opin. Invest. Drugs 5, 823-826. 4. Walsh, T. R., Toleman, M. A., Poirel, L., and Nordmann, P. (2005) "Metallo-β- lactamases: the quiet before the storm?," Clin. Microbiol. Rev. 18, 306-325. 5. Rasmussen, B. A., and Bush, K. (1997) "Carbapenem-Hydrolyzing β- Lactamases," Antimicro. Agents Chemo. 41, 223-232. 6. Galleni, M., Lamotte-Brasseur, J., Rossolini, G. M., Spencer, J., Dideberg, O., and Frere, J. M. (2001) "Standard Numbering Scheme for Class B β-Lactamases," Antimicro. Agents Chemo. 45, 660-663. 7. Frere, J. M., Dubus, A., Galleni, M., Matagne, A., and Amicosante, G. (1999) "Mechanistic Diversity of β-Lactamases," Biochem. Soc. Trans. 27, 58-63. 8. Page, M. I., and Laws, A. P. (1998) "The Mechanism of Catalysis and the Inhibition of β-Lactamases," J. Chem. Soc. Chem. Commun., 1609-1617. 9. Fabiane, S. M., Sohi, M. K., Wan, T., Payne, D. J., Bateson, J. H., Mitchell, T., and Sutton, B. J. (1998) "Crystal Structure of the Zinc-Dependent β-Lactamase from Bacillus cereus at 1.9 Å Resolution: Binuclear Active Site with Features of a Mononuclear Enzyme," Biochemistry 37, 12404-12411. 10. Oelschlaeger, P., Schmid, R. D., and Pleiss, J. (2003) "Insight into the mechanism of the IMP-1 metallo-β-lactamase by molecular dynamics simulations," Protein Eng. 16, 341-350. 11. Materon, I. C., Queenan, A. M., Koehler, T. M., Bush, K., and Palzkill, T. (2003) "Biochemical characterization of β-lactamases Bla1 and Bla2 from Bacillus anthrasis," Antimicro. Agents Chemo. 47, 2040-2042.

12. Concha, N. O., Rasmussen, B. A., Bush, K., and Herzberg, O. (1996) "Crystal Structure of the Wide-Spectrum Binuclear Zinc β-Lactamase from Bacteroides fragilis," Structure 4, 823-836. 13. Crawford, P. A., Sharma, N., Chandrasekar, S., Sigdel, T., Walsh, T. R., Spencer, J., and Crowder, M. W. (2004) "Over-expression, purification, and characterization of metallo-β-lactamase ImiS from Aeromonas veronii bv. sobria," Prot. Express. Purif. 36, 272-279. 14. Garau, G., Bebrone, C., Anne, C., Galleni, M., Frere, J. M., and Dideberg, O. (2005) "A metallo-β-lactamase enzyme in action: crystal structure of the monozinc carbapenemase CphA and its complex with biapenem," J. Mol. Biol. 345, 785-795. 15. Garcia-Saez, I., Mercuri, P. S., Papamicael, C., Kahn, R., Frere, J. M., Galleni, M., Rossolini, G. M., and Dideberg, O. (2003) "Three-dimensional structure of FEZ-1, a monomeric subclass B3 metallo-β-lactamase from Fluoribacter gormanii, in native form and in complex with D-captopril," J. Mol. Biol. 325, 651-660. 16. Ullah, J. H., Walsh, T. R., Taylor, I. A., Emery, D. C., Verma, C. S., Gamblin, S. J., and Spencer, J. (1998) "The crystal structure of the L1 metallo-β-lactamase from Stenotrophomonas maltophilia at 1.7 Å resolution," J. Mol. Biol. 284, 125- 136. 17. Sabath, L. D., and Abraham, E. P. (1966) "Zinc as a Cofactor for Cephalosporinase from Bacillus cereus 569," Biochem. J. 98, 11c-13c. 18. Bennett, B. (2002) "EPR of Co(II) as a Structural and Mechanistic Probe of Metalloprotein Active Sites: Characterization of an Aminopeptidase," Curr. Topics Biophys. 26, 49-57. 19. Bennett, B., and Holz, R. C. (1997) "EPR Studies on the Mono- and Dicobalt(II)- Substituted Forms of the Aminopeptidase from Aeromonas proteolytica. Insight into the Catalytic Mechanism of Dinuclear Hydrolases," J. Am. Chem. Soc. 119, 1923-1933.

20. Breece, R. M., Costello, A., Bennett, B., Sigdel, T. K., Matthews, M. L., Tierney, D. L., and Crowder, M. W. (2005) "A five-coordinate metal center in Co(II)- substituted VanX," J. Biol. Chem. 280, 11074-11081. 21. Gilson, H. S. R., and Krauss, M. (1999) "Structure and Spectroscopy of Metallo- β-Lactamase Active Sites," J. Am. Chem. Soc.121, 6984-6989. 22. Lever, A. B. P. (1984) "Co(II) d7," Inorganic Electronic Spectroscopy 2nd ed. 23. Maret, W., and Vallee, B. L. (1993) in Methods in Enzymology pp 52-71, Academic Press, New York. 24. Crowder, M. W., Yang, K. W., Carenbauer, A. L., Periyannan, G., Seifert, M. A., Rude, N. E., and Walsh, T. R. (2001) "The Problem of a Solvent Exposable Disulfide when Preparing Co(II)-Substituted Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia," J. Biol. Inorg. Chem. 6, 91-99. 25. Crowder, M. W., Walsh, T. R., Banovic, L., Pettit, M., and Spencer, J. (1998) "Overexpression, Purification, and Characterization of the Cloned Metallo-β- Lactamase L1 from Stenotrophomonas maltophilia," Antimicro .Agents Chemo. 42, 921-926. 26. de Seny, D., Heinz, U., Wommer, S., Kiefer, M., Meyer-Klaucke, W., Galleni, M., Frere, J. M., Bauer, R., and Adolph, H. W. (2001) "Metal ion binding and coordination geometry for wild type and mutants of metallo-β-lactamase from Bacillus cereus 569/H/9 (BcII) - A combined thermodynamic, kinetic, and spectroscopic approach," J. Biol. Chem. 276, 45065-45078. 27. Davies, A. M., Rasia, R. M., Vila, A. J., Sutton, B. J., and Fabiane, S. M. (2005) "Effect of pH on the active site of an Arg121Cys mutant of the metallo-β- lactamase from Bacillus cereus: Implications for the enzyme mechanism," Biochemistry 44, 4841-4849. 28. Orellano, E. G., Girardini, J. E., Cricco, J. A., Ceccarelli, E. A., and Vila, A. J. (1998) "Spectroscopic characterization of a binuclear metal site in Bacillus cereus β-lactamase II," Biochemistry 37, 10173-10180. 29. Wang, Z., and Benkovic, S. J. (1998) "Purification, Characterization, and Kinetic Studies of Soluble Bacteroides fragilis Metallo-β-Lactamase," J. Biol. Chem. 273, 22402-22408.

30. Garmer, D. R., and Krauss, M. (1993) "Ab Initio Quantum Chemical Study of the Cobalt d-d Spectroscopy of Several Substituted Zinc Enzymes," J. Am. Chem. Soc. 115, 10247-10257. 31. Costello, A., Periyannan, G., Yang, K. W., Crowder, M. W., and Tierney, D. L. (2006) "Site-selective binding of Zn(II) to metallo-β-lactamase L1 from Stenotrophomonas maltophilia," J. Biol. Inorg. Chem. 11, 351-358. 32. Llarrull, L. I., Tioni, M. F., Kowalski, J., Bennett, B., and Vila, A. J. (2007) "Evidence for a Dinuclear Active Site in the Metallo-β-lactamase BcII with Substoichiometric Co(II): A NEW MODEL FOR METAL UPTAKE," J. Biol. Chem. 282, 30586-30595. 33. Garrity, J. D., Bennett, B., and Crowder, M. W. (2005) "Direct evidence that reaction intermediate in metallo-β-lactamase is metal bound," Biochemistry 44, 1078-1087. 34. Periyannan, G., Shaw, P. J., Sigdel, T., and Crowder, M. W. (2004) "In vivo folding of recombinant metallo-β-lactamase L1 requires the presence of Zn(II)," Prot. Sci. 13, 2236-2243. 35. Lakowicz, J. (1999) Principles of fluorescence spectroscopy, Kluwer Academic Plenum, New York. 36. Wilson, C. J., Apiyo, D., and Wittung-Stafshede, P. (2004) "Role of cofactors in metalloprotein folding," Q. Rev. Biophys. 37, 285-314. 37. Spencer, J., Clark, A. R., and Walsh, T. R. (2001) "Novel Mechanism of Hydrolysis of Therapeutic β-Lactams by Stenotrophomonas maltophilia L1 Metallo-β-Lactamase," J. Biol. Chem. 276, 33638-33644. 38. McMannus-Munoz, S., and Crowder, M. W. (1999) "Kinetic Mechanism of Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia," Biochemistry 38, 1547-1553. 39. Garrity, J. D., Carenbauer, A. L., Herron, L. R., and Crowder, M. W. (2004) "Metal Binding Asp-120 in Metallo-β-lactamase L1 from Stenotrophomonas maltophilia Plays a Crucial Role in Catalysis," J. Biol. Chem. 279, 920-927. 40. Auld, D. S. (2001) "Zinc coordination sphere in biochemical zinc sites," Biometals 14, 271-313.

41. Auld, D. S. (2004) in Handbook of Metalloproteins (Messerschmidt, A., Ed.) pp 416-431, John Wiley & Sons, New York. 42. Holz, R., Bzymek, K., and Swierczek, S. (2003) "Co-catalytic metallopeptidases as pharmaceutical targets," Curr. Opin. Chem. Biol. 7, 197-206. 43. Bertini, I., and Luchinat, C. (1984) "High-Spin Cobalt(II) as a Probe for the Investigation of Metalloproteins," Adv. Inorg. Biochem. 6, 72-111. 44. Sharma, N. P., Hajdin, C., Chandrasekar, S., Bennett, B., Yang, K. W., and Crowder, M. W. (2006) "Mechanistic studies on the mononuclear Zn(II)- containing metallo-β-lactamase ImiS from Aeromonas sobria," Biochemistry 45, 10729-10738. 45. Matthews, M. L., Periyannan, G., Hajdin, C., Sidgel, T. K., Bennett, B., and Crowder, M. W. (2006) "Probing the reaction mechanism of the D-ala-D-ala dipeptidase, VanX, by using stopped-flow kinetic and rapid-freeze quench EPR studies on the Co(II)-substituted enzyme," J. Am. Chem. Soc. 128, 13050-13051. 46. Nauton, L., Kahn, R., Garau, G., Hernandez, J. F., and Dideberg, O. (2008) "Structural insights into the design of inhibitors for the L1 metallo-β-lactamase from Stenotrophomonas maltophilia," J. Mol. Biol. 375, 257-269. 47. McCutchan, T., Hansen, J., Dame, J., and Mullins, J. (1984) "Mung bean nuclease cleaves Plasmodium genomic DNA at sites before and after genes" Science 225, 625-628. 48. Bae, J.-B., Park, J.-H., Hahn, M.-Y., Kim, M.-S., and Roe, J.-H. (2004) "Redox- dependent Changes in RsrA, an Anti-sigma Factor in Streptomyces coelicolor: Zinc Release and Disulfide Bond Formation," J. Mol. Biol. 335, 425-435. 49. Herbig, A. F., and Helmann, J. D. (2001) "Roles of metal ions and hydrogen peroxide in modulating the interaction of the Bacillus subtilis PerR peroxide regulon repressor with operator DNA," Mol. Microbiol. 41, 849-859. 50. Griep, M. A., and Lokey, E. R. (1996) "The Role of Zinc and the Reactivity of Cysteines in Escherichia coli Primase," Biochemistry 35, 8260-8267.

Chapter 3

Metal content of metallo-β-lactamase L1 is determined by the bioavailability of metal ions

Zhenxin Hu,‡ Thusitha S Gunasekera,‡ Lauren Spadafora,‡ Brian Bennett,§ and Michael W. Crowder‡

‡Department of Chemistry and Biochemistry, 160 Hughes Hall, Miami University, Oxford, OH 45056; §National Biomedical EPR Center, Department of Biophysics, Medical College of Wisconsin, 8701 Watertown Plank Road, Milwaukee, WI 53226- 0509

*To whom correspondence should be addressed: M.W. Crowder e-mail: [email protected] phone: (513) 529-7274 fax: (513) 529-5715

†This work was supported by the National Institutes of Health (GM40052 to MWC; AI056231 to BB, and EB001980 to the Medical College of Wisconsin)

Contributions to this chapter: Thusitha carried out the amipicillin sensitivity assay; Lauren assisted with protein over-expression; and Dr. Bennett helped collect and analyze the EPR spectra. All of the other data were collected and analyzed by Zhenxin Hu.

Abbreviations: ICP-AES, inductively-coupled plasma atomic emission spectroscopy; IPTG, isopropyl β-D-thiogalactopyranoside; Gdn-HCl, guanidinium chloride; Hepes, 4- (2-hydroxyethyl)-1-piperazineethanesulfonic acid; FPLC, fast performance liquid chromatography; LB, Luria-Bertani; MALDI-TOF MS, matrix assisted laser desorption ionization mass spectrometry; PBS, phosphate buffered saline; TAT, twin arginine transport.

ABSTRACT In an effort to probe whether the metal content of metallo-β-lactamase L1 is affected by metal ion bioavailability, L1 was over-expressed as mature protein (M-L1) and full-length (FL-L1) analogs, and the analogs were characterized with metal analyses, kinetics, and EPR spectroscopy. FL-L1, containing the putative leader sequence, was localized in the periplasm of E. coli and shown to bind Zn(II) preferentially. The metal content of FL-L1 could be altered if the enzyme was over-expressed in minimal medium containing Fe and Mn, and surprisingly, an Fe-binding analog was obtained. On the other hand, M-L1, lacking the putative leader sequence, was localized in the cytoplasm of E. coli and shown to bind various amounts of Fe and Zn(II), and like FL-L1, the metal content of the resulting enzyme could be affected by the amount of metal ions in the growth medium. L1 was refolded in the presence of Fe, and a dinuclear Fe-containing analog of L1 was obtained, although this analog is catalytically-inactive. EPR spectra demonstrate the presence of an antiferromagnetically-coupled Fe(III)Fe(II) center in Fe- containing L1 and suggests the presence of a Fe(III)Zn(II) center in M-L1. Metal analyses on the cytoplasmic and periplasmic fractions of E. coli showed that the concentration of metal ions in the periplasm is not tightly controlled and increases as the concentration of metal ions in the growth medium increases. In contrast, the concentration of Zn(II) in the cytoplasm is tightly-controlled while that of Fe is less so.

3.1 Introduction Bacterial resistance to β-lactam containing antibiotics such as penicillins, cephalosporins, and carbapenems is most often accomplished by expression of β- lactamases, which hydrolyze the C-N bond of these antibiotics (1-4). A majority of these β-lactamases utilize an active site serine group for the nucleophilic attack on the β-lactam carbonyl, and the serine β-lactamases have been studied extensively for many years (4). On the other hand, one class (Class B) of β-lactamases utilizes a metal-assisted hydrolysis pathway to inactivate β-lactam containing antibiotics, and these enzymes are called metallo-β-lactamases (mβl’s) (1, 2, 5-7). The mβl’s have been further divided into subgroups based on sequence identity, Zn(II) content, substrate preference, and biochemical properties. Subgroup B1 enzymes require 2 Zn(II) ions for full catalytic activity, exhibit kinetic preference for penicillins as substrates, exhibit >23% sequence identity toward other subgroup B1 members, and are represented by mβl’s CcrA from Bacteroides fragilis, BcII from Bacillus cereus, and IMP-1 from various sources (1, 5). Subgroup B2 enzymes require only 1 Zn(II) ion for full catalytic activity, preferentially hydrolyze carbapenems, exhibit 11% sequence identity with the subgroup B1 enzymes, and are represented by mβl’s ImiS from Aeromonas sobria and CphA from Aeronomas hydrophila (1, 5). Subgroup B3 enzymes require 2 Zn(II) ions for full activity, exhibit a kinetic preference for penicillins, contains only 9 conserved residues with the subgroup B1 enzymes, and are represented by mβl’s L1 from Stenotrophomonas maltophilia and FEZ-1 from Legionella gormanii (1, 5). Extensive structural and mechanistic studies have been reported on certain mβl’s, and several studies reporting non-clinical inhibitors have been reported. β-Lactam containing antibiotics are antibacterial because these drugs inactivate transpeptidase, which is an enzyme that catalyzes the crosslinking of peptidoglycan building blocks to form part of the bacterial cell wall (4). In order to interact with transpeptidase in Gram negative bacteria, β-lactam containing antibiotics must be able to cross the outer membrane and be present in the periplasm (8). Likewise, β-lactamases must be exported into the extracellular space in Gram positive bacteria or into the periplasm in Gram negative bacteria in order to interact and inactivate the β-lactam

containing antibiotics. To mimic the physiological situation, most recombinant mβl’s are expressed into the periplasm of E. coli by the addition of fusion tags or leader sequences, and most of the resulting recombinant enzymes have been shown to bind Zn(II) after isolation (1, 5, 7). Despite significant amino acid sequence divergence, mβl’s contain an αββα motif, and the Zn(II) ions bind in a pocket contained in the ββ interface (1, 5, 7). For the

B1 and B3 mβl’s, one of the Zn(II) ions binds to a site (called Zn1 site), in which three histidine residues and the bridging hydroxide serve as metal binding ligands. In all three

classes of mβl’s, Zn(II) binds to a site (called Zn2 site) made up of one aspartic acid, one histidine, one histidine/cysteine, the bridging hydroxide, and a terminally-bound water molecule. Previous modeling, mechanistic, and structural studies have suggested that the

β-lactam carbonyl interacts with the Zn(II) in the Zn1 site (or residues in the Zn1 site for the B2 mβl’s), while the lone pair electrons on the β-lactam nitrogen coordinate metal ion in the Zn2 site (9-13). The αββα tertiary fold motif is called the metallo-β-lactamase fold, and there is an increasing number of proteins that contain this motif, including rubredoxin oxidoreductase (ROO), glyoxalase II, arylsulfatase, cAMP phosphodiesterase, and tRNA maturase (5). The most common metal ion found in these proteins is Zn(II); however, glyoxalase II has been reported to bind Fe, Zn, and Mn (14-16), and ROO has been reported to be a dinuclear Fe protein (17). In addition, Vila and coworkers recently reported that metallo-β-lactamase GOB from E. meningoseptica when over-expressed as a GST-fusion construct and folded in the cytoplasm of E. coli is isolated containing various amounts of Zn(II) and iron (18). These results suggest that the localization where a protein is folded (cytoplasm or periplasm) and the bioavailability of the metal ions in that location play a role in which metal ions bind to recombinant proteins. To test this suggestion, we constructed an over-expression plasmid for full-length L1 that contains the S. maltophilia leader sequence (FL-L1) and a plasmid containing mature L1 that lacked the S. maltophilia leader sequence (M-L1). The resulting over-expression plasmids were used to produce L1, and the FL-L1 and M-L1 were characterized using metal analyses, steady-state kinetics, and spectroscopic studies.

3.2 Materials and Methods Cloning: Forward primer, 5’-AAAAA CAT ATG GCC GAA GTA CCA CTG CCG C, and reverse primer, 5’-AAAAA AAG CTT AGC GGG CCC CG, were purchased from Integrated DNA Technologies. The PCR reactions were carried out with the following conditions: 95 °C, 90 sec; 95 °C, 30 sec, 55.5 °C, 30 sec, 72 °C, 60 sec; 25 cycles. The gel-purified PCR product and pET26b (Novagen) plasmid were digested with NdeI and HindIII according to manufacturer’s instructions. The gene that encodes for L1 was ligated into pET26b, and the resulting plasmid (pM-L1) was transformed into E. coli DH5α and confirmed with DNA sequencing. The pM-L1 plasmid was transformed into E. coli BL21(DE3)pLysS cells, and the resulting cells were used for over-expression studies.

Antimicrobial susceptibility assay: The in vitro activity of ampicillin against L1 (FL-L1, full-length L1) and truncated-L1 (M-L1, mature L1) that was over-expressed in E. coli BL21(DE3) cells was determined by a disk diffusion susceptibility test. Bacterial cultures were grown to mid-log phase, and protein production was induced by making the cultures 1 mM in IPTG. Cultures were then grown approximately 3 hrs, and disk diffusion testing was performed by the NCCLS methodology on Mueller-Hinton agar (Becton-Dickinson) plates (National Committee for Clinical Laboratory, 1997, Performance standards for antimicrobial disk susceptibility tests; approved standard M2- A6. National Committee for Clinical Laboratory Standards, Wayne, PA, USA). Culture plates were incubated for 16 hrs, and the zone diameter sizes were measured. Periplasmic and cytoplasmic accumulation of L1 in both cultures was confirmed by fractionating cytoplamsic and periplasmic components using a PeriPrepsTM periplasting kit (Epicentre, Madison, WI).

Over-expression and purification of L1. A 50 mL overnight preculture of BL21(DE3) E. coli cells containing the pET26b-based plasmid that encodes for M-L1 or FL-L1 was used to innoculate 4 X 1L flasks of LB or minimal medium, and the resulting culture was grown at 37 °C with shaking until the culture reached an optical density at 600 nm of 0.6- 0.8. The cultures were then cooled to 15 °C for 30 minutes, made 0.5 mM in IPTG, and

shaken overnight at 15 oC (roughly 16 hours). For cultures to which metal ions were added, the metal ions were added at the same time as IPTG was added. The culture was centrifuged for 15 minutes (8200 x g), and the resulting cell pellet was resuspended in 50 mM Hepes, pH 6.0 (buffer A). The cells were lysed by passing the resuspended cells through a French Press three times at a pressure of 1000-1500 psi. After removal of insoluble components by centrifugation (25 minutes at 23,400 x g), the supernatant was dialyzed versus buffer A overnight. The dialyzed protein solution was centrifuged (25 min at 23,400 x g) and subjected to FPLC as previously reported (19). The FPLC fractions were analyzed using SDS PAGE gels, and protein bands thought to contain L1 were subjected to in-gel trypsin digestions and peptide identifications using MALDI-TOF mass spectrometry, as previously reported (20).

Preparation of metal-free (apo) L1. A concentrated solution of L1 (~ 0.3 mM) was dialyzed against 4 X 1 L of 50 mM Hepes, pH 7.0, containing 10 mM 1,10- phenanthroline and then dialysed against 6 X 1 L of 50 mM Hepes, pH 7.0. The metal content of the resulting sample was ascertained by ICP-AES, as previously reported (21). The sample was stored in a -80 οC freezer.

In vitro unfolding and refolding of L1. Apo-L1 (2 ml, 100 µM) was unfolded in 18 ml of 6 M guanidinium chloride (Gdn-HCl). The sample was incubated on ice for 1 hour and then dialyzed versus 1 L of 50 mM Hepes, pH 7.0, containing no added metal, 50 μM Fe(II), Mn(II), or Zn (II) or Fe(II) and Zn(II). Refolded L1 was further dialyzed versus 5 X 1L of Chelex-treated, 50 mM Hepes, pH 7.0, to remove any unbound metals and remaining Gdn-HCl. The resulting solution was centrifuged (25 min at 23,400 x g) to remove any precipitates.

EPR spectroscopy. EPR spectra were recorded using a Bruker E600 EleXsys spectrometer equipped with an Oxford Instruments ESR900 helium flow cryostat and ITC503 temperature controller, and an ER4116DM cavity operating at 9.63 GHz in perpendicular mode. Other recording parameters are given in the figure legends. Quantitation of signals was carried out by double integration of spectra recorded under non-saturating conditions at 10 – 12 K. A 2 mM Cu(II)-EDTA standard in Hepes, pH 7.5 1 recorded at 60 K, 50 μW was used. Integration limits and correction factors for S = /2, 5 and S = /2 signals where D is assumed to be small compared to temperature, as employed elsewhere (22) and recently described explicitly by Bou-Abdallah and Chasteen and references therein (23, 24).

Metal content in cytoplasm and periplasm of E. coli cells. E. coli BL21 cells were cultured in M9 minimal medium containing no added metal ions or 100 μM Zn(II), Fe(II), or Mn(II) until reaching an optical density at 600 nm of 1.0. The cells were collected by centrifugation (8 min at 6000 x g). The resulting cell pellets were washed

twice with 5 mL of PBS (137 mM NaCl; 2.7 mM KCl; 1.5 mM KH2PO4; 7.7 mM

Na2HPO4; pH 7.4), and cytoplasmic fractions were separated from periplasmic components of the cell using a PeriPrepsTM periplasting kit (Epicentre, Madison, WI) according to manufacturer’s instructions. The metal content of the cytoplamsic/periplasmic fractions of the cells was measured using ICP-AES, as previously reported (21).

3.3 Results S. maltophilia leader sequence leads to L1 being exported to and folded in the periplasm of E. coli. The gene for metallo-β-lactamase L1 from pathogen Stenotrophomonas maltophilia encodes for a 290 amino acid protein that contains a 21 amino acid (MRSTLLAFALAVALPAAHTSA) leader sequence (25), which presumably targets the protein for export into and folding in the periplasm, and a 269 amino acid mature peptide containing the N-terminus of AEVPLPQ (19). To determine if the leader sequence from S. maltophilia is recognized by E. coli and used to target L1 for export into the periplasm, we generated a pET26b-based over-expression plasmid containing the

L1 gene lacking the leader sequence (M-L1) and used this plasmid to over-express L1. The over-expression plasmid containing the gene for L1 and the leader sequence (FL-L1) has previously been reported (19) and was used as a control in these studies. Both over- expression plasmids were transformed into E. coli BL21(DE3)pLysS cells, and M-L1 and FL-L1 were over-expressed. The periplasmic fraction of each cell culture was obtained using the PeriPrepsTM periplasting kit according to manufacturer’s instructions. An SDS- PAGE gel (Figure 3.1A), followed by in-gel trypsin digestions/peptide identifications with MALDI-TOF MS, demonstrated that L1 was only found in the sample that was produced from the over-expression plasmid containing the L1 gene and the leader sequence. The over-expression plasmid containing the gene for L1 without the leader sequence (M-L1) produced no L1 in the periplasm of E. coli. SDS-PAGE gels of the boiled cell fractions from the cultures demonstrated that L1 was over-expressed at similar levels in both cultures (data not shown). This result demonstrates that the S. maltophilia leader sequence can be recognized by E. coli and directs L1 for export in the periplasm. To confirm this result, an antibiotic sensitivity assay was conducted. E. coli cells containing the over-expression plasmids for M-L1 (Figure 3.1B) and FL-L1 (Figure 3.1C) were plated on LB plates containing kanamycin. Disks containing 10 μg ampicillin were placed on the plates, and the petri dishes were incubated at 37 oC for 16 hours. The E. coli cells containing the gene for FL-L1 in pET26b grew well in the presence of ampicillin; however, those cells containing the gene for M-L1 in pET26b did not grow in the area near the disk containing ampicillin. Since ampicillin imparts its antibacterial activity in the periplasm, this result demonstrates that E. coli containing the gene for FL- L1 exports L1 into the periplasm of the cell, while E. coli containing the gene for M-L1 does not.

Characterization of M-L1 and FL-L1. M-L1 and FL-L1 were over-expressed and purified as described by Crowder et al. (19). As previously reported (19), purified FL-L1, which was over-expressed in LB medium, contained 1.9 equivalents of Zn(II) and -1 exhibited steady-state kinetic constants of Km = 4 μM and kcat = 26 s when using nitrocefin as the substrate (Table 3.1). In contrast, M-L1, which was over-expressed in LB medium, bound 0.7 eq. of Fe and 0.6 eq. of Zn(II) (Table 3.2). This enzyme

A. B. C.

Figure 3.1: Localization of L1 produced in cells that contain the L1 gene and the leader sequence (FL-L1) and the L1 gene without the leader sequence (M-L1). (A) SDS-PAGE gel of periplasmic fractions of (left) E. coli cells containing gene for FL-L1 and (right) E. coli cells containing gene for M-L1. Arrow marks the band for L1. (B and C) Antibiotic selection assay. (B) E. coli cells on LB-kanamycin plate containing gene for L1 and leader sequence. (C) E. coli cells on LB-kanamycin plate containing gene for L1 without leader sequence. The white dots are the disks containing 10 μg ampicillin.

Table 3.1: Steady-state kinetic and metal content data for FL-L1. Substrate used in the kinetic studies was nitrocefin, and kinetic studies were conducted as described in Materials and Methods.

-1 Enzyme kcat (s ) Km (μM) Metal content (eq)

FL-L1 w/ Mna 13 + 1 5 + 1 0.3Mn/0.4Fe/0.6Zn(II)

FL-L1 w/ Zn(II)a 28 + 2 6 + 1 0.1Fe/1.9Zn(II)

FL-L1 w/ Fea 3.6 + 0.1 6 + 1 0.9Fe/0.3Zn(II)

FL-L1 in LB 26 + 1 4 + 1 1.9 + 0.1 Zn(II) mediumb

FL-L1 in minimal 10 +1 4 + 1 0.4Fe/0.3Zn(II) mediumb

aL1 was over-expressed in minimal medium containing 50 μM of the indicated metal ion as described in Materials and Methods. bL1 was over-expressed in minimal or LB medium without adding any additional metal ions.

-1 exhibited a kcat of 10 s and a Km of 1.0 μM when using nitrocefin as substrate. Clearly, the metal content of L1 is greatly affected by where the protein is localized. To probe further the relationship where a protein is localized and the resulting metal content of the purified protein, FL-L1 and M-L1 were over-expressed in minimal medium in the presence of iron, zinc, or manganese. As a control, the proteins were also over-expressed in minimal medium that had no added metal ions. When the two proteins were over-expressed in minimal medium in the absence of added metal ions, FL-L1 -1 contained 0.4 eq. Fe and 0.3 eq. Zn(II) and exhibited a kcat of 10 s and a Km of 4 μM (Table 3.1); while M-L1 contained 0.2 eq. Mn, 0.7 eq. of Fe, and 0.1 eq. Zn(II) and exhibited no measurable catalytic activity (Table 3.2). From minimal medium containing -1 50 μM Zn(II), FL-L1 contained 1.9 eq. Zn(II) and 0.1 eq. Fe and exhibited a kcat of 28 s and a Km of 6 μM (Table 3.1), while M-L1 contained 0.3 eq. Fe and 1.2 eq. Zn(II) and -1 exhibited a kcat of 21 s and a Km of 7 μM (Table 3.2). From minimal medium that was

made 50 μM in Fe(II), FL-L1 contained 0.9 eq. Fe and 0.3 eq. Zn(II) and exhibited a kcat -1 of 3.6 s and a Km of 6 μM (Table 3.1), while M-L1 contained 1.5 eq. Fe and 0.1 eq. Zn(II) and exhibited no measureable catalytic activity (Table 3.2). Lastly from minimal medium containing 50 μM Mn, FL-L1 contained 0.3 eq. Mn, 0.4 eq. Fe, and 0.6 eq. -1 Zn(II) and exhibited a kcat of 13 s and a Km of 5 μM (Table 3.1), while M-L1 contained -1 0.4 eq. Mn, 0.4 eq. Zn(II), and 0.4 eq. Fe and exhibited a kcat of 4.2 s and a Km of 2.1 μM (Table 3.2). Mβl L1 can bind a number of different metal ions, and the final metal content depends greatly on whether the protein is exported and localized in the periplasm or whether it is localized in the cytoplasm.

Refolding L1 in the presence of different divalent metal ions. The biological incorporation of metal ions experiments described above suggest that the bioavailability of metal ions has a large effect on the metal content of L1 after purification. Even though the steady-state kinetic studies demonstrated that L1 localized in the cytoplasm does have catalytic activity when bound to Zn(II), it is possible that the different metal content of the M-L1 and FL-L1 may be due to different folding mechanisms in the periplasm and

Table 3.2: Steady-state kinetic and metal content data for L1 folded in the cytoplasm (M- L1). Substrate used in the kinetic studies was nitrocefin, and kinetic studies were conducted as described in Materials and Methods.

-1 Enzyme kcat (s ) Km (μM) Metal content (eq)

M-L1 w/ Mn(II)a 4.2 ± 0.4 2.1 ± 0.9 0.4 Mn; 0.4Zn; 0.4 Fe

a M-L1 w/ Zn(II) 21 ± 1 7.0 ± 1.1 0.3 Fe ; 1.2 Zn(II)

M-L1 w/ Fe(II)a <0.1 N/A 1.5 Fe; 0.1 Zn(II)

M-L1 in minimal <0.1 N/A 0.2 Mn;0.7 Fe;0.1 Zn(II) mediumb

M-L1 in LB 10 ± 1 1.0 ± 0.2 0.7 Fe; 0.6 Zn(II) b medium

cytoplasm. In an effort to probe whether bioavailability of metal ions does in fact affect metal content, in vitro unfolding/refolding experiments were conducted. Purified, apo-L1 was unfolded in the presence of 6M Gdn-HCl and refolded in the presence of 50 μM Fe(II), Mn(II), Zn(II), and Fe(II)/Zn(II) (Table 3.3). L1 refolded in the presence of Zn(II) was shown to bind 2 equivalents of Zn(II) and exhibited steady-state kinetic -1 constants of kcat = 37 + 1 s and Km = 3.5 + 0.2 μM when using nitrocefin as substrate (Table 3.3). These values are very similar to those of FL-L1 (Table 3.1). L1 refolded in the presence of Fe(II) resulted in an protein that binds 2 equivalents of iron; however, the protein exhibited no catalytic activity. L1 refolded in the presence of Mn(II) did not bind its full complement of metal (only 0.2 equivalents), and this protein also did not exhibit any catalytic activity. Since both Zn(II) and Fe appear to bind well to L1, we conducted a competition study in which L1 (20 μM) was refolded in the presence of equimolar amounts (50 μM) of Fe(II) and Zn(II). The resulting enzyme was shown to bind 1.5 equivalents of Zn(II) and 0.4 equivalents of Fe and -1 exhibited steady-state kinetic constants of kcat = 28 + 1 s and Km of 3.0 + 0.2 μM. This result demonstrates that L1 “prefers” Zn(II) binding but can also bind Fe.

EPR studies on Fe-containing forms of L1. EPR spectra of as-isolated M-L1, containing 0.7 eq. Fe and 0.6 eq. Zn(II), exhibited typical temperature-dependent features at geff values of 9.3 (745 G; 74.5 mT) and 4.3 (1616 G; 161.6 mT) due to transitions in the ground state and middle 5 Kramers’ doublets, respectively, of S = /2 Fe(III) (Figure 3.2A). An additional signal was

observed with geff < 2.0 and was assigned to an Fe(II)Fe(III) species on the basis of the similarity of the signal to one from glyoxalase 2-5 (16). Similar signals have been reported for uteroferrin and mammalian purple acid phosphatases (26, 27). This signal in M-L1 exhibited a complex temperature and power dependence and was optimally developed at 10 – 12 K. Difference analysis indicated that the g < 2 signal was due to at least two discrete but extremely similar species with slightly different spin Hamiltonian and relaxation parameters, due either to discrete

[Fea(II)Feb(III)] and [Fea(III)Feb(II)] species or to structural microheterogeneity. EPR of L1 that was refolded in the presence of Fe(II) showed the same sets of S = ½ and S = 5/2 signals but in very different proportions (Figure 3.2B). Because of the complex temperature dependence of the 1 5 S = /2 signal and because of the inherent complexity of the S = /2 “geff = 4.3” system (28), results of attempts at quantitation should be treated

Table 3.3: Characterization of L1 refolded in the presence of Fe(II), Zn(II), and Mn(II). Substrate used in the kinetic studies was nitrocefin, and kinetic studies were conducted as described in Materials and Methods.

-1 Enzyme refolded kcat (s ) Km (μM) Metal content (eq)

w/ Zn(II) 37 ± 1 3.5 ± 0.2 2.0 + 0.1 Zn

w/ Fe(II) < 0.1 N/A 2.0 + 0.1 Fe

w/ Mn(II) < 0.1 N/A 0.20 + 0.05 Mn

w/ Zn(II) + 1.5 + 0.1 Zn 28 ± 1 3.0 ± 0.2 Fe(II) 0.4 + 0.1 Fe

Figure 3.2: EPR of Fe-containing L1. (A) EPR spectra of as-isolated M-L1 recorded at 5.6 K, 63 mW (filled line), 12 K, 63 mW (dotted line) and 12 K, 10 mW (dashed line). Various regions of the spectrum are shown to highlight the different behaviors as a function of temperature and microwave power. (B) EPR spectrum of as-isolated L1, ‘FeZn-L1' (dotted line, 12 K, 10 mW), and that of L1 refolded in the presence of iron, ‘Fe-L1’ (filled line; 10 mW, 10 K).

with some caution; for signals of the quality obtained, an error of ± 5 % in spin concentration is expected and an additional error due to uncertainty in the respective zero-field splittings in the species is estimated be ± 5 %, leading to an overall error of ± 10 %. Nevertheless, the results of quantitation are enlightening as a comparison tool. The EPR signal from as-isolated M-L1, containing both Fe and Zn(II), was estimated to be due to a 45 ± 5 % contribution of the Fe(III) signal and a 55 ± 5 % contribution of the Fe(II)Fe(III) signal. In contrast, L1 refolded in the presence of iron exhibited a spectrum with > 90 % spin density due to the Fe(II)Fe(III) signal 5 and only 6 – 8 % due to isolated S = /2 Fe(III). The total spin density of the refolded L1 corresponded to 0.8 eq. spins and, therefore, suggests that 0.8 × 90% ~ 70 % of the molecules contained an Fe(II)Fe(III) center. This, in turn, suggests an overall Fe content of ~ 1.55 ± 0.15 Fe/mol, which is in very good agreement with the analytical value of 1.5 eq. Fe/mol. Efforts to collect 1H NMR spectra of the iron-containing L1 samples have not been successful as the proteins are not stable and precipitate during acquisition times.

Zn(II) and Fe content in E. coli. The studies above strongly suggest that the metal content of L1 is determined by the bioavailability of Fe and Zn(II) where the protein is folded/localized. In an effort to evaluate the amount of Fe and Zn(II) in the periplasm and cytoplasm of E. coli cells, we conducted metal analyses on the periplasmic and cytoplasmic fractions of E. coli cells grown in minimal medium containing no additional metal ions and containing 100 μM Zn(II) or Fe. The amount of Zn(II) and Fe in the soluble portion of the cytoplasm of E. coli cells cultured in the absence of added metal ions is ca. 45 μM for both metal ions. If the cells are cultured in minimal medium containing 100 μM Zn(II) or Fe, the amount of Zn(II) in the cytoplasm remains at 45 μM, while the amount of Fe increases 3-fold to about 153 μM. In the soluble periplasmic fractions, the amount of Zn(II) and Fe from cells cultured in the absence of added metal ion is < 1 μM. In the soluble periplasmic fraction of cells cultured in the presence of Zn(II) and Fe, the amount of Zn(II) increased >10-fold to 1.23 mM, while the amount of Fe increased >20-fold to 2.83 mM. The bioavailability of Zn(II) in the periplasm and the preference for Zn(II) binding to FL-L1 leads then to the preparation of ZnZn-L1 when the protein is over-expressed in medium containing enough Zn(II). In the absence of enough Zn(II), Fe can bind to L1 (in the cytoplasm and in the samples over-expressed with added Fe).

3.4 Discussion While the number of Zn(II) ions physiologically bound to mβl’s is under debate (29-33), there is universal agreement that Zn(II) is the metal ion bound to these enzymes in vivo. Nonetheless, several groups have reported spectroscopic studies using Co(II)- and Cd(II)-analogs (29, 34-39) (both metal ions are excellent surrogates of Zn(II)) of several mβl’s, and early papers on several mβl’s reported activation of apo-enzymes by manganese, iron, and other metal ions (40, 41). A recent paper by Vila and coworkers reports the binding of Fe to GOB-1 from E. meningoseptica, although the resulting enzyme was catalytically-inactive (33). Page and coworkers recently reported that manganese-substituted BcII exhibited catalytic activity (42). Since mβl’s are enzymes that confer resistance to antimicrobial agents, it seems reasonable that the activation of these enzymes by different metal ions, particularly in environments that lack sufficient quantities of Zn(II), would be beneficial to the organism. There certainly is precedence in the literature for Zn(II) binding sites in Zn(II)-metalloenzymes being able to bind a number of different metal ions (14, 15), and a large of number of studies on metal-substituted aminopeptidase from A. proteolytica have been reported (43-47). Nonetheless, it is not clear that many of these metal-substituted enzymes are physiologically-relevant. In the present study, we were interested in determining whether the metal content of mβl L1 is affected by where the protein is folded/metallated/localized. We, therefore, prepared over-expression constructs that contained the full length gene for L1 (leader sequence plus gene for L1, FL-L1) or that contained only the gene for L1 (no leader sequence, M-L1) and used these plasmids to over-express L1. Our first task was to determine where L1 was localized in E. coli after protein production, and our data clearly show that L1 produced from the FL-L1 plasmid is exported into the periplasm, while L1 produced from the M- L1 plasmid is in the cytoplasm. The over-expression and localization of L1 in the cytoplasm without a fusion peptide/protein is the first example of a mature mβl being produced and localized in the cytoplasm. Biochemical analyses of the two enzymes when over-expressed in rich medium clearly show that the two enzymes are different, with FL-L1 binding only Zn(II) and M-L1 binding nearly equal amounts of Fe and Zn(II). This latter result is similar to results previously reported for recombinant glyoxalase II, which is a member of the β-lactamase superfamily of proteins (14, 15) and is over-expressed and localized in the cytoplasm of E. coli.

The export of L1 into the periplasm could be accomplished by at least two different pathways. The first pathway is the TAT system in E. coli, which transfers fully-folded proteins from the cytoplasm into the periplasm (48). This system requires the presence of an Arg rich sequence in the protein that serves as a signaling sequence. Given that L1 does not have this Arg- rich sequence (25) and that M-L1 and FL-L1 bind different metal ions, it is highly unlikely that L1 is transported as a folded, metallated protein via the TAT system. The second major transport system is the Sec system, which has been studied in detail (49). The Sec system exports unfolded proteins, and therefore once in the periplasm, the periplasmic protein must be folded by folding proteins in the periplasm. Moreover, periplasmic proteins must be metallated in the periplasm, and the metal content data presented in this work supports this pathway in use by L1. To further probe how the metal content of L1 is affected by where the protein is folded and metallated, we over-expressed and purified M-L1 and FL-L1 from minimal medium containing Fe, Zn(II), Mn, or Fe/Zn(II). The resulting proteins contained different amounts of metal ions and exhibited different kinetic properties. The amount of metal available for metallation of L1 is determined by the amount of the metal in the growth medium, no matter if the protein is folded in the periplasm or cytoplasm. While the increase in bioavailability of a metal ion in the periplasm as the metal concentration of the medium goes up was expected, the increase in bioavailable metal in the cytoplasm was unexpected. All cells have elaborate homeostatic pathways that presumably maintain metal ion concentrations in a very narrow range of concentrations (50-52). For example, the cytoplasmic concentrations of Zn(II) are maintained by importers ZnuABC and ZupT and exporters ZitB and ZntA (53). Metal analyses of the soluble periplasmic and cytoplasmic fractions of E. coli demonstrate that the concentration of metal ions in both fractions increase with increasing levels (only slightly so for Zn(II)) of the metal ion in the growth medium. The relatively higher increase in cytoplasmic Fe levels may be due to the cell’s better ability to store Fe rather than Zn(II) in bacterioferritin (54). The preparation of L1 that was folded and metallated in the cytoplasm contains a different metal content, and this result indicates that caution should be exercised when recombinant metalloproteins are over-expressed. Ideally, over-expression constructs should be made so that bacterial metalloproteins will be over-expressed and folded in the same place in E. coli as they are folded in the original organism. When over-expressing eukaryotic metalloproteins in E. coli, over-expression constructs should be designed to fold/metallate the protein in the cytoplasm,

periplasm, and/or if possible in the extracellular environment (using a pelB leader for example) so that the possibility of different metal content of the resulting protein can be evaluated. The over-expression of M-L1 in the cytoplasm yielded an analog of L1 that contains

nearly equimolar concentrations of Fe and Zn(II). Given the tri-histidine site in the Zn1 site of L1 (13), it was predicted that this enzyme was a FeZn-analog of L1; however, EPR studies demonstrated that there is a mixture of metal centers in this sample including a spin-coupled Fe(III)Fe(II) center and a Fe(III)Zn(II) center. Our ability to refold L1 in the presence of Zn(II) and/or Fe allowed for us to obtain metal-enriched forms of L1. These data clearly show that the FeFe-analog of L1 is inactive, possibly due to Asp120 bridging the metal centers (55, 56), which is probably required for the observed antiferromagnetic coupling between the Fe ions (57), and not being available to form an essential hydrogen bond with the bridging hydroxide (55). It is not clear from our data whether the Fe(III)Zn(II)-analog of L1 is catalytically-active, but the refolding of L1 in the presence of equimolar concentrations of Fe and Zn(II) clearly shows a preference for Zn(II) binding to L1. Future studies will address whether the Fe(III)Zn(II) analog of L1 is catalytically-active. Taken together, this work demonstrates that the metal content of L1 depends strongly on bioavailability of metal ions where the protein is folded. This result will aid in the preparation of metal-substituted metalloproteins to study the structure/function of these proteins.

3.5 References 1. Crowder, M. W., Spencer, J., and Vila, A. J. (2006) "Metallo-β-lactamases: Novel weaponry for antibiotic resistance in bacteria," Acc. Chem. Res. 39, 721-728. 2. Walsh, T. R., Toleman, M. A., Poirel, L., and Nordmann, P. (2005) "Metallo-β- lactamases: the quiet before the storm?," Clin. Microbiol. Rev. 18, 306-325. 3. Georgopapadakou, N. H. (2004) "β-Lactamase inhibitors: evolving compounds for evolving resistance targets," Expert Opin. Investig. Drugs 13, 1307-1318. 4. Fisher, J. F., Meroueh, S. O., and Mobashery, S. (2005) "Bacterial resistance to β-lactam antibiotics: compelling opportunism, compelling opportunity," Chem. Rev. 105, 395-424. 5. Bebrone, C. (2007) "Metallo-β-lactamases (classification, activity, genetic organization, structure, zinc coordination) and their superfamily," Biochem. Pharmacol. 74, 1686- 1701. 6. Toney, J. H., and Moloughney, J. G. (2004) "Metallo-β-lactamase inhibitors: promise for the future?," Curr. Opin. Invest. Drugs 5, 823-826. 7. Heinz, U., and Adolph, H. W. (2004) "Metallo-β-lactamases: two binding sites for one catalytic metal ion?," CMLS, Cell. Mol. Life Sci. 61, 2827-2839. 8. Knowles, J. R. (1980) in Enzyme Inhibitors (Brodbeck, U., Ed.) pp 163-167, Verlag Chemie, Weinheim. 9. Park, H., Brothers, E. N., and Merz, K. M. (2005) "Hybrid QM/MM and DFT investigations of the catalytic mechanism and inhibition of the dinuclear zinc metallo-β- lactamase CcrA from Bacteroides fragilis," J. Am. Chem. Soc. 127, 4232-4241. 10. Rasia, R. M., and Vila, A. J. (2003) "Mechanistic study of the hydrolysis of nitrocefin mediated by B. cereus metallo−β-lactamase," ARKIVOC 3, 507-516. 11. Oelschlaeger, P., Schmid, R. D., and Pleiss, J. (2003) "Insight into the mechanism of the

IMP-1 metallo−β-lactamase by molecular dynamics simulations," Protein Eng. 16, 341- 350. 12. Suarez, D., Brothers, E. N., and Merz, K. M. (2002) "Insights into the structure and dynamics of the dinuclear zinc β-lactamase site from Bacteroides fragilis," Biochemistry 41, 6615-6630.

13. Ullah, J. H., Walsh, T. R., Taylor, I. A., Emery, D. C., Verma, C. S., Gamblin, S. J., and Spencer, J. (1998) "The crystal structure of the L1 metallo-β-lactamase from Stenotrophomonas maltophilia at 1.7 Å resolution," J. Mol. Biol. 284, 125-136. 14. Schilling, O., Wenzel, N., Naylor, M., Vogel, A., Crowder, M., Makaroff, C., and Meyer- Klaucke, W. (2003) "Flexible metal binding of the metallo-β-lactamase domain: Glyoxalase II incorporates iron, manganese, and zinc in vivo," Biochemistry 42, 11777- 11786. 15. Wenzel, N. F., Carenbauer, A. L., Pfiester, M. P., Schilling, O., Meyer-Klaucke, W., Makaroff, C. A., and Crowder, M. W. (2004) "The binding of iron and zinc to glyoxalase II occurs exclusively as di-metal centers and is unique within the metallo−β-lactamase family," J. Biol. Inorg. Chem. 9, 429-438. 16. Marasinghe, G. P. K., Sander, I. M., Bennett, B., Periyannan, G., Yang, K. W., Makaroff, C. A., and Crowder, M. W. (2005) "Structural studies on a mitochondrial glyoxalase II," J. Biol. Chem. 280, 40668-40675. 17. Gomes, C. M., Silva, G., Oliveira, S., LeGall, J., Liu, M. Y., Xavier, A. V., Rodrigues- Pousada, C., and Teixeira, M. (1997) "Studies on the redox centers of the terminal oxidase from Desulfovibrio gigas and evidence for its interaction with rubredoxin," J. Biol. Chem. 272, 22502-22508. 18. Moran-Barrio, J., Gonzalez, J. M., Lisa, M. N., Costello, A. L., Peraro, M. D., Carloni, P., Bennett, B., Tierney, D. L., Limansky, A. S., Viale, A. M., and Vila, A. J. (2007) "The Metallo-β-lactamase GOB Is a Mono-Zn(II) Enzyme with a Novel Active Site," J. Biol. Chem. 282, 18286-18293. 19. Crowder, M. W., Walsh, T. R., Banovic, L., Pettit, M., and Spencer, J. (1998) "Overexpression, Purification, and Characterization of the Cloned Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia," Antimicro. Agents Chemo. 42, 921-926. 20. Sigdel, T. K., Cilliers, R., Gursahaney, P. R., and Crowder, M. W. (2004) "Fractionation of soluble proteins in Escherichia coli using DEAE-, SP-, and phenyl sepharose chromatographies," J. Biomol. Tech. 15, 199-207. 21. Crowder, M. W., Maiti, M. K., Banovic, L., and Makaroff, C. A. (1997) "Glyoxalase II from A. thaliana Requires Zn(II) for Catalytic Activity," FEBS Lett. 418, 351-354.

22. Purpero, V. M., and Moran, G. R. (2006) "Catalytic, noncatalytic, and inhibitory phenomena: kinetic analysis of (4-hydroxyphenyl)pyruvate dioxygenase from Arabidopsis thaliana," Biochemistry 45, 6044-6055. 23. Bou-Abdallah, F., and Chasteen, N. D. (2008) "Spin concentration measurements of high-spin (g '=4.3) rhombic iron(III) ions in biological samples: theory and application," J. Biol. Inorg. Chem. 13, 15-24. 24. Aasa, R., and Vanngard, T. (1975) "EPR Signal Intensity and Powder Shapes: A Reexamination," J. Mag. Res. 19, 308-315. 25. Walsh, T. R., Hall, L., Assinder, S. J., Nichols, W. W., Cartwright, S. J., MacGowan, A. P., and Bennett, P. M. (1994) "Sequence Analysis of the L1 Metallo-β-Lactamase from Xanthomonas maltophilia," Biochim. Biophys. Acta 1218, 199-201. 26. Crowder, M. W., Vincent, J. B., and Averill, B. A. (1992) "Electron Paramagnetic Resonance Studies on the High-Salt Form of Bovine Spleen Purple Acid Phosphatase," Biochemistry 31, 9603-9608. 27. David, S. S., and Que, L. (1990) "Anion Binding to Uteroferrin. Evidence for Phosphate Coordination to the Iron(III) Ion of the Dinuclear Active Site and Interaction with the Hydroxo Bridge," J. Am. Chem. Soc. 112, 6455-6463. 28. Copik, A. J., Waterson, S., Swierczek, S. I., Bennett, B., and Holz, R. C. (2005) "Both nucleophile and substrate bind to the catalytic Fe(II)-center in the type II methionyl aminopeptidase from Pyrococcus furiosus," Inorg. Chem. 44, 1160-1162. 29. Badarau, A., Damblon, C., and Page, M. I. (2007) "The activity of the dinuclear cobalt-β- lactamase from Bacillus cereus in catalysing the hydrolysis of β-lactams," Biochem. J. 401, 197-203. 30. Badarau, A., and Page, M. I. (2006) "Enzyme deactivation due to metal ion dissociation during turnover of the cobalt-β-lactamase catalyzed hydrolysis of β-lactams," Biochemistry 45, 11012-11020. 31. Wommer, S., Rival, S., Heinz, U., Galleni, M., Frere, J. M., Franceschini, N., Amicosante, G., Rasmussen, B., Bauer, R., and Adolph, H. W. (2002) "Substrate- activated zinc binding of metallo-β-lactamases - Physiological importance of the mononuclear enzymes," J. Biol. Chem. 277, 24142-24147.

32. Gonzalez, J. M., Medrano Martin, F. J., Costello, A. L., Tierney, D. L., and Vila, A. J. (2007) "The Zn2 position in metallo-β-lactamases is critical for activity: a study on chimeric metal sites on a conserved protein scaffold," J. Mol. Biol. 373, 1141-1156. 33. Moran-Barrio, J., Gonzalez, J. M., Lisa, M. N., Costello, A. L., Dal Peraro, M., Carloni, P., Bennett, B., Tierney, D. L., Limansky, A. S., Viale, A. M., and Vila, A. J. (2007) "The metallo-β-lactamase GOB is a mono-Zn(II) enzyme with a novel active site," J. Biol. Chem. 282, 18286-18293. 34. Periyannan, G., Costello, A. L., Tierney, D. L., Yang, K. W., Bennett, B., and Crowder, M. W. (2006) "Sequential binding of cobalt(II) to metallo-β-lactamase CcrA," Biochemistry 45, 1313-1320. 35. Crawford, P. A., Yang, K. W., Sharma, N., Bennett, B., and Crowder, M. W. (2005) "Spectroscopic studies on cobalt(II)-substituted metallo-β-lactamase ImiS from Aeromonas veronii bv. sobria," Biochemistry 44, 5168-5176. 36. Paul-Soto, R., Zeppezauer, M., Adolph, H. W., Galleni, M., Frere, J. M., Carfi, A., Dideberg, O., Wouters, J., Hemmingsen, L., and Bauer, R. (1999) "Preference of Cd(II) and Zn(II) for the Two Metal Sites in Bacillus cereus β-Lactamase II: A Perturbed Angular Correlation of X-Rays Spectroscopic Study," Biochemistry 38, 16500-16506. 37. Paul-Soto, R., Bauer, R., Frere, J. M., Galleni, M., Meyer-Klaucke, W., Nolting, H., Rossolini, G. M., de Seny, D., Hernandez-Villadares, M., Zeppezauer, M., and Adolph, H. W. (1999) "Mono- and Binuclear Zn2+ β-Lactamase," J. Biol. Chem. 274, 13242- 13249. 38. Wang, Z., and Benkovic, S. J. (1998) "Purification, Characterization, and Kinetic Studies of Soluble Bacteroides fragilis Metallo-β-Lactamase," J. Biol. Chem. 273, 22402-22408. 39. Paul-Soto, R., Hernandez-Valladares, M., Galleni, M., Bauer, R., Zeppezauer, M., Frere, J. M., and Adolph, H. W. (1998) "Mono- and Binuclear Zn-β-Lactamase from Bacteroides fragilis: Catalytic and Structural Roles of the Zinc Ions," FEBS Lett. 438, 137-140. 40. Saino, Y., Kobayashi, F., Inoue, M., and Mitsuhashi, S. (1982) "Purification and Properties of Inducible Penicillin β-Lactamase Isolated from Pseudomonas maltophilia," Antimicro. Agents Chemo. 22, 564-570.

41. Sato, K., Fujii, T., Okamoto, R., Inoue, M., and Mitsuhashi, S. (1985) "Biochemical Properties of β-Lactamase Produced by Flavobacterium odoratum," Antimicro. Agents Chemo. 27, 612-614. 42. Badarau, A., and Page, M. I. (2006) "The variation of catalytic efficiency of Bacillus cereus metallo-β-lactamase with different active site metal ions," Biochemistry 45, 10654-10666. 43. Bennett, B., Antholine, W. E., D'Souza, V. M., Chen, G. J., Ustinyuk, L., and Holz, R. C. (2002) "Structurally distinct active sites in the copper(II)- substituted aminopeptidases from Aeromonas proteolytica and Escherichia coli," J. Am. Chem. Soc. 124, 13025- 13034. 44. Bennett, B., and Holz, R. C. (1997) "Spectroscopically Distinct Cobalt(II) Sites in Heterodimetallic Forms of the Aminopeptidase from Aeromonas proteolytica: Characterization of Substrate Binding," Biochemistry 36, 9837-9846. 45. Bienvenue, D. L., Mathew, R. S., Ringe, D., and Holz, R. C. (2002) "The aminopeptidase from Aeromonas proteolytica can function as an esterase," J. Biol. Inorg. Chem. 7, 129- 135. 46. D'Souza, V. M., Swierczek, S. I., Cosper, N. J., Meng, L., Ruebush, S., Copik, A. J., Scott, R. A., and Holz, R. C. (2002) "Kinetic and Structural Characterization of Manganese(II) Loaded Methionyl Aminopeptidase," Biochemistry 41, 13096-13105. 47. D'souza, V. M., Bennett, B., Copik, A. J., and Holz, R. C. (2000) "Divalent Metal Binding Properties of the Methionyl Aminopeptidase from Escherichia coli," Biochemistry 39, 3817-3826. 48. Gohlke, U., Pullan, L., McDevitt, C. A., Porcelli, I., de Leeuw, E., Palmer, T., Saibil, H. R., and Berks, B. C. (2005) "The TatA component of the twin-arginine protein transport system forms channel complexes of variable diameter," Proc. Nat. Acad. Sci. 102, 10482- 10486. 49. Driessen, A. J. M., Fekkes, P., and van der Wolk, J. P. W. (1998) "The Sec system," Curr. Opin. Microbiol. 1, 216-222. 50. Andrews, S. C., Robinson, A. K., and Rodriguez-Quinones, F. (2003) "Bacterial iron homeostasis," FEMS Microbiol. Rev. 27, 215-237.

51. Moore, C. M., and Helmann, J. D. (2005) "Metal ion homeostasis in Bacillus subtilis," Curr. Opin. Microbiol. 8, 188-195. 52. Solioz, M., and Stoyanov, J. V. (2003) "Copper homeostasis in Enterococcus hirae," FEMS Microbiol. Lett. 27, 183-195. 53. Chimienti, F., Aouffen, M., Favier, A., and Seve, M. (2003) "Zinc homeostasis- regulating proteins: New drug targets for triggering cell fate," Curr. Drug. Targets. 4, 323-338. 54. Andrews, S. C. (1998) "Iron storage in bacteria," Adv. Microb. Physiol. 40, 281-351. 55. Garrity, J. D., Carenbauer, A. L., Herron, L. R., and Crowder, M. W. (2004) "Metal Binding Asp-120 in Metallo-β-lactamase L1 from Stenotrophomonas maltophilia Plays a Crucial Role in Catalysis," J. Biol. Chem. 279, 920-927. 56. Crisp, J., Conners, R., Garrity, J. D., Carenbauer, A. L., Crowder, M. W., and Spencer, J. (2007) "Structural basis for the role of Asp-120 in metallo-β-lactamases," Biochemistry 46, 10664-10674. 57. Vincent, J. B., Olivier-Lilley, G. L., and Averill, B. A. (1990) "Proteins Containing Oxo- Bridged Dinuclear Iron Centers: A Bioinorganic Perspective," Chem. Rev. 90, 1447- 1467.

Chapter 4

Role of the Zn1 and Zn2 sites in metallo-β-lactamase L1

Zhenxin Hu,† Gopalraj Periyannan,†,‡ Brian Bennett,*‡ and Michael W. Crowder*†

†Department of Chemistry and Biochemistry, Miami University, Oxford, OH 45056 ‡Department of Biophysics and National Biomedical EPR Center, Medical College of Wisconsin, Milwaukee, WI 53226

*Michael W. Crowder, Department of Chemistry and Biochemistry, 160 Hughes Hall, Miami University, Oxford, OH 45056, Tel. 513-529-7274, Fax 513-529-5715, E-mail: [email protected]; Brian Bennett, Department of Biophysics and National Biomedical EPR Center, Medical College of Wisconsin, 8701 Watertown Road, Milwaukee, WI 53226- 0509, Tel. 414-456-4787, Fax 414-456-6512, E-mail: [email protected].

Contributions to this chapter: Gopal prepared and characterized the His to Cys mutants. Dr. Bennett helped Zhenxin collect the RFQ-EPR samples and EPR spectra, and he interpreted the EPR data. The rest of data collection and analyses were accomplished by Zhenxin Hu.

ABSTRACT

In an effort to probe the role of the Zn(II) sites in metallo-β-lactamase L1, mononuclear metal ion containing and heterobimetallic analogs of the enzyme were generated and characterized using kinetic and spectroscopic studies. Mononuclear Zn(II)-containing L1, which binds Zn(II) in the consensus Zn1 site, was shown to be active; however, this enzyme did not stabilize a nitrocefin-derived reaction intermediate that had been previously detected. Mononuclear Co(II)- and Fe(III)-containing L1 were essentially inactive, and NMR and EPR studies suggest that these metal ions bind to the consensus Zn2 site in L1. Heterobimetallic analogs (ZnCo and ZnFe) analogs of L1 were generated, and stopped-flow kinetic studies revealed that these enzymes rapidly hydrolyze nitrocefin and that there are large amounts of the reaction intermediate formed during the reaction. The heterobimetallic analogs were reacted with nitrocefin, and the reactions were rapidly freeze quenched. EPR studies on these samples demonstrate that Co(II) is five-coordinate in the resting state, proceeds through a four-coordinate species during the reaction, and is five-coordinate in the enzyme-product complex. These studies demonstrate that the metal ion in the Zn1 site is essential for catalysis in L1 and that the metal ion in the Zn2 site is crucial for stabilization of the nitrocefin-derived reaction intermediate.

4.1 Introduction β-Lactam containing compounds are the most widely used antibiotics, and they exert their antimicrobial activity by inhibiting the crosslinking of the peptidoglycan building blocks of bacterial cell walls (1). Ever since the introduction of these antibiotics in the clinic, there have been an increasing number of bacterial strains that are resistant to these drugs. The most common way that bacteria become resistant to β-lactams is through the production of β-lactamases, which cleave the β-lactam bond and inactivate the drug (2). There are 500 known β-lactamases, and these enzymes have been classified into 4 groups (3). Although groups A, C, and D exhibit different substrate specificities and susceptibilities to clinical inhibitors, they are similar in the fact that they utilize an active site serine as a nucleophile to attack the β-lactam carbonyl, generating a tetrahedral intermediate (1). The group B enzymes, on the other hand, require 1-2 Zn(II) ions to hydrolyze β-lactams and thus are called metallo-β-lactamases (Mβls) (4). Mβls have been further categorized into three subgroups according to amino acid homology, substrate preference, and the number of Zn(II) ions required for full activity. The B1 subgroup,

represented by CcrA, BcII, and IMP-1, have two metal binding sites: Zn1, which consists of three

histidines and a bridging hydroxide to coordinate Zn(II), and Zn2, which consists of one

histidine, one aspartate, one cysteine, the bridging hydroxide, and a terminally-bound H2O to coordinate Zn(II). The B2 enzymes, represented by CphA and ImiS, bind Zn(II) at the consensus

Zn2 site, which contains one histidine, one aspartate, one cysteine, and a solvent molecule to coordinate Zn(II). The B3 enzymes, represented by L1 and FEZ bind two Zn(II) ions, contain

the same Zn1 site as the B1 enzymes, and utilize a Zn2 site, which consists of two histidines, one aspartate, one terminally-bound water, and the bridging hydroxide. Recently, a B2/B3 hybrid,

metallo-β-lactamase GOB from E. meningoseptica, binds only 1 Zn(II) in the Zn2 site (5). There exists considerable controversy about the metal content of the nominally dinuclear Zn(II)-containing (B1 and B3) Mβl’s. The initial crystal structure of BcII showed a single Zn(II) ion in the Zn1 site of the enzyme (6); however, subsequent structures have shown a dinuclear Zn(II) site in BcII (7, 8). Similar conflicting data on the metal content of L1, IMP-1, and CcrA have not been reported; however, Wommer et al. used in vitro binding assays to predict that all Mβl’s are metal-free in vivo and become mononuclear enzymes only in the presence of substrate (9). Wommer et al. continued by concluding that dinuclear Zn(II)-containing Mβl’s are isolation artifacts. Nonetheless, Page and coworkers have recently reported that BcII containing only one

equivalent of Co(II) is inactive, and the loss of metal ion during catalysis is the reason for the burst kinetics exhibited by this enzyme (10-12). In constrast, Vila and coworkers have recently published that BcII containing only one equivalent of Zn(II) is catalytically-active (13, 14) and that B3 subgroup member, GOB, requires only a single metal ion in the Zn2 site to be active, analogous to the B2 enzymes (5). The metal ion binding characteristics of L1, CcrA, and BcII have been investigated and characterized (4, 15). However, of much greater interest is the nature of the metal ion complement that is required for activity and the roles in catalysis, if any, of each of the metal ions that can be accommodated by these enzymes. The study of mononuclear or mixed-metal analogs of the enzymes provides one mechanism for the elucidation of the role of each metal and to indicate whether one or both are essential for activity. In addition, this information could be

used to guide rational drug design efforts that use the Zn1, Zn2, or both sites as targets for inhibitors. In this work, we describe the preparation and characterization of mononuclear metal ion and mixed-metal containing analogs of Mβl L1 from Stenotrophomonas maltophilia; kinetic, spectroscopic and spectrokinetic analyses of these species reveal roles for both metal ions in catalysis.

4.2 Materials and Methods Materials. E. coli strains DH5α and BL21(DE3)pLysS were purchased from Gibco BRL (Gaithesberg, MD) and Novagen (Madison, WI), respectively. Plasmids pET26b(+) and pUC19 were purchased from Novagen. Restriction enzymes, NcoI and HindIII, deoxynucleotides

(dNTPs), thermopol buffer, MgSO4, and T4 DNA ligase were obtained from New England Biolabs (Beverly, MA), Promega Corporation (Madison, WI), and Gibco BRL. QuikChange site- directed mutagenesis kit was purchased from Stratagene. All mutagenic primers were purchased from Integrated DNA Technologies (IDT, Coralville, IA). Polymerase Chain Reaction (PCR) was performed using a Thermolyne Amplitron II from Barnstead (Dubuque, IA). DNA purification was performed by using a Qiagen Quick Gel Extraction kit (Velencia, CA). The QIAGEN-tip 100 kit and protocols were used for large-scale plasmid purifications. A Wizard Plus Miniprep kit from Promega was used for small-scale plasmid DNA preparations. Luria- Bertani (LB) media was purchased from Invitrogen (Carlsbad, CA). Isopropyl-β-D-

thiogalactoside (IPTG) was purchased from Anatrace (Maumee, OH). All buffer solutions were prepared using chemicals purchased from Fisher Scientific (Pittsburgh, PA). All buffers and growth media were made with Barnstead NANOpure, ultrapure water. For metal-free solutions, Chelex 100 resin (Biorad Laboratories, Hercules, CA) was used, and the resulting solutions were filtered through a 0.45-micron filter membrane (Osmonic Inc.). Dialysis tubing was prepared as per Sambrook et al. (16) from Spectro/Por regenerated cellulose, molecular porous membranes with a molecular weight cut off of 10,000 Da (Spectrum Corporation, Gardena, CA). A Fast Protein Liquid Chromatography (FPLC) system, chromatography columns, and resins were purchased from GE Healthcare. Nitrocefin was obtained from Becton Dickinson Microbiology System (Cockeysville, MD), and solutions of nitrocefin were prepared as previously described (17).

Generation of histidine mutants of L1 by site-directed mutagenesis: The over-expression plasmids of four His→Cys L1 mutants, H116C, H118C, H121C and H196C were constructed using the L1 over-expression plasmid pET26b(+), which yields the full length form of the enzyme, and the QuikChange site-directed mutagenesis kit as per the instructions of the manufacturer. The following primers were used to generate the mutants: H116Cfor CGGCTGATCCTGCTCAGCTGCGCACACGCCGACCATGCC H116Crev GGCATGGTCGGCGTGTGCGCAGCTGAGCAGGATCAGCCG H118C for ATCCTGCTCAGCCACGCATGCGCCGACCATGCCGGACCG H118Crev CGGTCCGGCATGGTCGGCGCATGCGTGGCTGAGCAGGAT H121Cfor CACGCACACGCCGACTGCGCCGGACCGGTGGCG H121Crev CGCCACCGGTCCGGCGCAGTCGGCGTGTGCGTG H196Cfor CACTTCATGGCGGGGTGCACCCCGGGCAGCACCGCG H196Crev CGCGGTGCTGCCCGGGGTGCACCCCGCCATGAAGTG H225Cfor GTGTTGCTGACACCGTGCCCGGGTGCCAGCAAC H225Crev GTTGCTGGCACCCGGGCACGGTGTCAGCAACAC

Over-expression of His→Cys mutants: Large scale preparations of His→Cys L1 mutants were conducted by using the procedure of Crowder et al. (17). L1 was quantitated by monitoring the absorbance at 280 nm and using an extinction coefficient of 54,600 M-1cm-1 (17).

Preparation of 1Zn-, 1Co-, and 1Fe-L1. Mature L1 (M-L1) was over-expressed as previously

described (18) by adding 100 μM ZnCl2, CoCl2, or Fe(NH4)2(SO4)2 to the minimal medium. After protein over-expression and centrifugation to collect the E. coli cells, the pellet was resuspended in 300 mL of 50 mM Hepes, pH 6.0, and the suspension was centrifuged for 15 minutes (8,200 xg). The resulting pellet was resuspended in 50 mM Hepes, pH 6.0, and the cells were lysed by using a French press as previously described (17). The cleared supernatant (centrifugation for 25 minutes at 23,400 xg) was loaded onto a 25 mL SP-Sepharose column that was equilibrated with 50 mM Hepes, pH 6.0, and bound proteins were eluted from the column using a linear 0 – 500 mM NaCl gradient in the same buffer. L1 typically eluted at 80-120 mM NaCl, and the fractions were analyzed for the presence of L1 by using SDS-PAGE, as previously described (17).

Preparation of ZnCoL1, ZnFeL1, FeFeL1, and CoCoL1 samples. The ZnFe analog of L1 was prepared by adding 3 equivalents of Zn(II) to as-isolated 1FeL1 or 3 equivalents of Fe(II) to as- isolated 1ZnL1, followed by dialysis against 4 X 1L of Chelex-treated 50 mM Hepes, containing 50 mM NaCl, to remove unbound metal. The ZnCo analog was prepared by adding 3 equivalents of Zn(II) to 1CoL1. The FeFe- and CoCo- analogs of L1 were prepared by refolding apo-L1 in the presence of 100 μM Fe(II) or Co(II), as recently described (18).

Metal analyses. The metal content of the protein samples was determined by using a Varian Liberty 150 Inductively Coupled Plasma spectrometer with atomic emission spectroscopy detection (ICP-AES). All the proteins were diluted to 10 μM with 50 mM Hepes, pH 7.0. A calibration curve with 4 standards and a correlation coefficient of greater than 0.999 was generated using Zn(II), Fe, and Co(II) reference solutions from Fisher Scientific. The following emission wavelengths were chosen to ensure the lowest detection limits possible: Zn(II), 213.856 nm, Fe, 259.940 nm, and Co(II), 238.892 nm.

1H NMR spectroscopy. 1H NMR spectra were collected on a Bruker Avance 500 spectrometer operating at 500.13 MHz, 298 K, magnetic field of 11.7 T, recycle delay (AQ) of 41 ms, and

sweep width of 400 ppm. Proton chemical shifts were calibrated by assigning the H2O signal the

value of 4.70 ppm. A modified presaturation pulse sequence (zgpr) was used to suppress the proton signals originating from solvent. The presaturation pulse was as short as possible (500 ms) to avoid saturation of solvent-exchangeable proton signals. The concentration of NMR

samples was generally in the range of 1.0 – 1.2 mM. Samples in D2O were prepared by performing three or more dilution/concentration cycles in a Centricon-10.

Rapid-freeze-quench (RFQ) and EPR spectroscopy. L1 (0.5 mM) was reacted with 1.5 mM nitrocefin in 50 mM cacodylate buffer, pH 7.0, and at 3 ± 1 °C, and the reaction mixture was freeze-quenched for EPR spectroscopy using a system described in earlier work (19, 20); the calibrated reaction time was 10.4 ± 0.5 ms. Following EPR data collection, some samples were thawed by agitation of the sample tubes in water at 25 °C for 2 min and refrozen in liquid nitrogen. Low temperature EPR spectroscopy was carried out using a Bruker EleXsys E600 spectrometer equipped with an Oxford Instruments ITC503 liquid helium flow system. EPR was

recorded at 9.63 GHz (B0⊥B1) or 9.37 GHz (B0||B1) using an ER4116DM dual-mode cavity, with 100 kHz magnetic field modulation. Other EPR recording parameters are given in the legends to figures.

Steady-state kinetics. All kinetic studies were conducted on a Agilent 8453 UV-Vis diode array spectrophotometer at 25 °C. Steady-state kinetic parameters, the Michaelis constant Km and the

turnover number kcat, were determined by monitoring product formation at 485 nm using nitrocefin as substrate in 50 mM Chelex-treated, cacodylate, pH 7.0. The rate of change in the absorbance at 485 nm was converted into the rate of change in the concentration of the product by dividing the absorbance (path length = 1 cm) by the extinction coefficient of the product 17,420 M-1cm-1 (17).

treated, cacodylate buffer to 100 μM, and the substrate was prepared and diluted to 100 μM in the same buffer.

4.3: Results Mutations of metal binding histidines. Our previous attempts to prepare a mixed-metal analog of L1 by adding Co(II) to apo- or 1Zn-L1 were unsuccessful primarily due to the oxidation of Co(II) to Co(III) (24). Another potential problem with generating a mixed-metal analog is the reported dissociation constants for metal binding to the Zn1 and Zn2 sites in L1. Wommer et al. reported that the Zn(II) binding constants to the two sites in L1 are 2.6 and 6 nM (9). This result suggests that the addition of different metal ions to apo-L1 would result in sample with mixtures of possible metal centers. Therefore, we attempted to prepare a mixed-metal analog of L1 by weakening one of the metal binding sites through mutation of one of the histidine groups in each

metal binding site. For example, we reasoned that the mutation of His116 to Cys in the Zn1 site

would result in a mutant that binds the first added metal ion tightly to the Zn2 site and the second

metal ion much less tightly to the Zn1 site. Five metal binding mutants of L1 (H116C, H118C, H121C, H160C, and H263C) were successfully prepared using nondegenerate oligonucleotides, the QuikChange Site Directed Mutagenesis kit, and the polymerase chain reaction. DNA sequencing of the resulting L1 genes in both directions was used to confirm that only the desired mutations were present. Small-scale growth cultures showed that all five mutants were over-expressed at levels comparable to that of wild-type L1. However, large-scale (4 L) over-expression and purification of these mutants showed that only the H116C and H121C mutants were soluble and could be purified. The purified mutants were analyzed for metal binding. After purification, the H116C mutant was shown to bind 0.33 equivalents of Zn(II), while the H121C mutant bound 0.11 equivalents of Zn(II) (Table 4.1). The mutants were incubated with a 10 molar excess of Zn(II), and the resulting enzymes were then exhaustively dialyzed versus Chelex-treated buffer. Zn(II)- loaded H116C and H121C mutants were shown to bind 0.85 and 0.98 equivalents of Zn(II), respectively (Table 4.1), which is one-half of the metal bound by recombinant wild-type L1. The as-isolated and Zn(II)-loaded mutants were characterized by using steady state kinetic studies. -1 As-isolated H116C and H121C mutants exhibited kcat values of < 0.01 s when using nitrocefin

as substrate; however, the Zn(II)-loaded H116C and H121C mutants exhibited kcat values of 0.38

Table 4.1: Steady state kinetic parameters and metal content of HXXC mutants of L1.

-1 Mutant k (s ) K (μM) Zn(II) Content cat m a H116C < 0.01 ND 0.33 ± 0.01 a H121C < 0.01 ND 0.11 ± 0.01 b H116C 0.38 ± 0.01 20 ± 1 0.85 ± 0.05 b H121C 2.3 ± 0.2 72 ± 25 0.98 ± 0.05 c H116C 0.35 ± 0.01 18 ± 1 NA c H121C 33 ± 4 99 ± 15 NA As-isolated/wild- 41±1 4±1 1.90 ± 0.01 type L1c aas isolated; bafter adding 2 equivalents of Zn(II) and then dialysis; creaction with 100 μM Zn(II) in buffer; ND – not determined; NA – not applicable

-1 and 2.3 s and Km values of 20 and 72 μM, respectively. The inclusion of 100 μM Zn(II) in the steady-state kinetics assay buffer resulted in no change in the steady-state kinetic constants for -1 the H116C mutant, and a kcat = 33 s and a Km = 99 μM for the H121C mutant, when using nitrocefin as the substrate. While we were successful in preparing analogs of L1 with differential metal binding affinities for the Zn1 and Zn2 sites, one of the mutants exhibited very little activity

(H116C) and the other exhibited a Km value that suggested a large change in the active site of the enzyme (H121C).

Preparation and characterization of the ZnCo-analog of L1. Our initial attempts to prepare Co(II)-substituted L1 by biological incorporation were unsuccessful because of the oxidation of Co(II) to Co(III) presumably during protein purification (24). In these studies, the gene for L1 contained a leader sequence that directed the export of over-expressed L1 into the periplasm of E. coli, and our recent studies strongly suggest that folding and metallation of L1 occurs in the periplasm (18). In this same study, we demonstrated that the removal of the leader sequence from the L1 gene resulted in the enzyme being folded and metallated in the cytoplasm of E. coli. Significantly, the metal content of the resulting enzyme could be affected greatly by the addition of metal ions in the growth medium. In an effort to prepare a Co(II)-substituted form of L1, we over-expressed L1 in minimal

medium containing 100 μM CoCl2 using the L1 gene without the leader sequence. The resulting, purified enzyme (called 1Co-L1) was pink, and the color did not change up to two months in 4 ºC. Metal analyses revealed that the protein bound 0.9 equivalents of cobalt and 0.1 equivalents

of Zn(II) (Table 4.2). Steady-state kinetic studies revealed that the enzyme exhibited a kcat of 11 -1 + 1 s and a Km of 4.3 + 0.1 μM, when using nitrocefin as a substrate (Table 4.2). These steady- -1 state kinetic constants are different than those of ZnZn-L1 (kcat of 26 s ; Km of 4 μM); 1Zn-L1 -1 -1 (kcat of 33 s ; Km of 9 μM), and CoCo-L1 (kcat of 63 s ; Km of 20 μM) (Table 4.2). In addition,

the kcat value exhibited by 1Co-L1 is not one-half of that exhibited by CoCo-L1, suggesting that the sample of 1Co-L1 is not made up of one-half CoCo-L1 and one-half apo-L1. The UV-Vis difference spectrum of 1Co-L1 revealed a broad, weak peak between 500 – 650 nm (Figure 4.1A), which was assigned to ligand field transitions of high-spin Co(II), and the extinction coefficient at 550 nm was 130 M-1cm-1, which suggests that the Co(II) is 5-coordinate (25). This

Table 4.2: Steady state kinetics of different metal bound analogs of L1.

-1 Species k (s ) K (μM) Metal Content cat m As-isolated/wild- 26 ± 1 4 ± 1 1.90 ± 0.01 Zn(II) type L1 1Zn-L1 33 ± 3 9 ± 3 1.0 + 0.1 Zn(II) 1Co-L1 11 ± 1 4.3 ± 0.1 0.9 + 0.1 Co, 0.10 + 0.01 Zn(II) 1Fe-L1 2.6 ± 1 53 ± 25 0.9 + 0.1 Fe, 0.20 + 0.01 Zn(II) CoCo-L1a 63 ± 3 20 ± 1 1.80 ± 0.20 Co FeFe-L1a 0 N/A 1.90 ± 0.01 Fe ZnCo-L1 26 ± 0.3 2.3 ± 0.1 1.0 ± 0.1 Zn(II); 1.0 ± 0.1 Co ZnFe-L1b 20 ± 2 3.6 ± 1 1.0 ± 0.1 Zn(II); 1.0 ± 0.1 Fe ZnFe-L1c 24 ± 3 4.0 ± 1 1.2 ± 0.1 Zn(II); 0.9 ± 0.1 Fe

adata from (18); bFe added to Zn-L1 and then dialysis; cZn(II) added to Fe-L1 and then dialysis

spectrum is different than that of CoCo-L1, which was prepared by adding Co(II) to TCEP (tris(2-carboxyethyl)phosphine)-treated apo-L1, in that there is no broad absorbance peak between 330-360 nm corresponding to a S to Co(II) ligand to metal charge transfer band (26).The addition of 1 eq. of Zn(II) to 1Co-L1 did not change the UV-Vis spectrum (Figure 4.1A). The 1H NMR spectrum of 1Co-L1 showed one broad peak, which integrated to 2 protons, at 50 ppm, and the peak was solvent-exchangeable (Figure 4.1C). Since there are two histidines

in the Zn2 site and three histidines in the Zn1 site (27), we assign these peaks to the NH protons

on Co(II)-bound His121 and His263, which indicates the Co(II) is bound to the Zn2 site in L1. The addition of 1 eq. of Zn(II) to 1Co-L1 did not change the NMR spectrum (Figure 4.1C). Previously, we reported that 1Zn-L1 could be prepared by addition of 1 equivalent of Zn(II) to apo-L1, and this sample was characterized with steady-state kinetics and EXAFS -1 spectroscopy (28). The enzyme exhibited a kcat of 33 s and a Km of 9 μM when using nitrocefin as the substrate (Table 4.2), but we were uncertain whether these constants reflected an enzyme sample that contained significant amount of ZnZn-L1 due to the amounts of adventitious Zn(II) found in buffers (9, 29). The addition of Co(II) to 1Zn-L1 resulted in a pink coloration that immediately turned orange in less than 10 seconds, indicating oxidation of Co(II) to Co(III). On the other hand, the addition of Zn(II) to 1Co-L1, which was prepared by the biological incorporation method described above, resulted in a protein that remained pink in color. The

ZnCo-L1 (this notation indicates Zn(II) in the Zn1 site and Co(II) in the Zn2 site) analog of L1 -1 exhibited a kcat of 26 s and a Km of 2.3 μM, when using nitrocefin as substrate. These values are similar to those of 1Zn-L1 and ZnZn-L1, and it is not possible with steady-state kinetics alone to determine if the ZnCo-L1 analog is responsible for the observed activity.

EPR spectroscopy of metal-ion-substituted forms of L1. EPR spectra of L1 with increasing Co(II) complement show a complex but sequential pattern of Co(II) binding (Figure 4.2A – E). A sample of 1Co-L1 that was found to contain only 0.8 eq Co(II) exhibited an EPR spectrum (Figure 4.2A) that contained two reasonably well-resolved components. A 59Co hyperfine pattern -3 -1 with A = 9.8 × 10 cm , centered at 996 G (geff. = 6.89), and a derivative feature at 2320 G (geff.

= 2.97) were assigned to a rhombic species with greal(⊥) = 2.55 and E/D = 0.27. The second species exhibited no sharp resonances and was due to an axial species similar to that observed from Co(II) in L1 in earlier work (20). More typically, 1Co-L1 contained 0.9 –

Figure 4.1: UV-Vis and NMR spectra of 1Co-L1. A: UV-Vis difference spectrum of 1Co-L1 prepared using biological incorporation method. The enzyme concentration was 550 μM, and the buffer was 50 mM Hepes, pH 7.0. B: 1H NMR spectrum of 550 μM 1Co-L1. The asterisk signifies the peak that is solvent-exchangeable.

1.0 eq Co(II), and the spectrum (Figure 4.2B) became less well-resolved, with only inflection points to suggest the presence of the distinct species observed at lower Co(II) complement. The spectrum of ZnCo-L1 (Figure 4.2C) was very similar to that of 1Co-L1 (Figure 4.2B), suggesting that the presence of Zn(II) in either of the binding sites did not significantly perturb the electronic structure of Co(II) in the remaining sites. In contrast, the spectrum of 2Co-L1 (Figure 4.2D) was markedly different from those of 1Co-L1 and ZnCo-L1; the spectrum could not be simulated assuming even two distinct species, and spin-Hamiltonian parameters could not be assigned. EPR absorption at very low field, 0 – 500 G, suggested the presence of a spin-coupled component in the spectrum, and this was confirmed by parallel mode EPR (Figure 4.2E), which

revealed a resonance at geff. ~ 10, consistent with S’ = 2 and/or S’ = 3 resonances in an S’ = 0, 1, 2, 3 spin ladder due to coupling of two S = 3/2 Co(II) ions.

Stopped-flow kinetic studies on ZnCo-L1. The accurate interpretation of steady-state kinetic studies on mixed-metal and mononuclear metal-containing analogs can be complicated by the presence of adventitious Zn(II) in the assay buffers. For example, typical steady-state kinetic studies contain 1-10 nM L1, and the amount of adventitious Zn(II) in buffers, even those that have been Chelex-treated, can be between 10-100 nM (9, 29). Therefore, it is probable that steady-state kinetic assays were conducted with enzymes containing a mixture of possible metal centers. Therefore, we characterized the mixed-metal analogs and proteins containing only one metal ion with pre steady-state kinetic studies at or near single turnover conditions (~50 μM enzyme and ~50 μM nitrocefin). The advantage of this approach is that the enzyme concentrations in these samples are at least 2 orders of magnitude higher than the concentration of adventitious Zn(II) in the buffer. This approach also allowed us to monitor the role of each metal ion in catalysis. 1Zn-L1 was prepared by the biological incorporation method described in Materials and Methods. The stopped-flow traces for 1Zn-L1 showed that substrate (absorbs at 390 nm) was depleted within 1.3 seconds (Figure 4.3A) and that very little intermediate (absorbs at 665 nm) was observed. The stopped-flow traces were fitted to an exponential equation, and the rate of product formation was 0.92 + 0.03 s-1 (Table 4.3). In comparison, the stopped-flow trace of ZnZn-L1 showed that substrate was depleted in 0.06 seconds and that significant amount of

Figure 4.2: EPR spectra from metal-containing species of L1. Spectra are of the following species of L1: (A) L1 containing 0.8 eq Co(II) at 12 K, 25 mW; (B) 1Co-L1 at 12 K, 2 mW; (C)

ZnCo-L1 at 10 K, 2 mW; (D) CoCo-L1 at 12 K, 10 mW; (E) CoCo-L1 at 7 K, 20 mW, B0||B1; (F) 1Fe-L1 at 10 K, 2 mW; (G) ZnFe-L1 at 12 K, 10 mW; (H) FeFe-L1 at 10 K, 2 mW; (I) FeNi- L1 at 7 K, 50 mW; (J) FeCo-L1 at 10 K, 2 mW. Spectra are shown with arbitrary intensities.

Figure 4.3: Stopped-flow traces of reaction of Zn(II)-containing L1 analogs and nitrocefin. Stopped-flow traces of 50 μM 1Zn- (A) and ZnZn-L1 (B) analogs when reacted with 50 μM nitrocefin at 4 oC. The absorbance at 485 nm is due to the product, the absorbance at 390 nm is due to the substrate, and the absorbance at 665 nm is due to the intermediate (30).

intermediate form (Figure 4.3B). The rate of product formation was 17 + 1 s-1 (Table 4.3), which reflects an 18-fold increase in activity as compared to 1Zn-L1. Previous EXAFS studies on L1 demonstrated that there is sequential binding of Zn(II) to apo-L1, and that the first equivalent of

Zn(II) binds to the Zn1 site (28). This result coupled with the stopped-flow traces described above indicates that metal ions in both of the metal binding sites is required for the stabilization and observation of the reaction intermediate when nitrocefin is used as a substrate. Stopped-flow studies were also conducted on the Co(II)-containing samples. The stopped-flow trace for 1Co-L1 showed that substrate decay took over 10 seconds and that no intermediate formed (Figure 4.4A). The rate of product formation was 0.05 + 0.01 s-1 (Table 4.3). This result is not consistent with the steady-state kinetic results that showed that 1Co-L1 is very active (Table 4.2) and suggests that most of the activity observed in the steady-state kinetic studies was due to the ZnCo analog of L1. The stopped-flow trace for ZnCo-L1 (Figure 4.4B) showed that substrate depleted as fast as it did for ZnZn-L1 (Figure 4.3B), and the rate of product formation was 12 + 1 s-1 (Table 4.3), which reflects a 240-fold increase in activity over that of 1Co-L1. There is a 1.4-fold decrease in the amount of intermediate formed for ZnCo-L1, as compared to ZnZn-L1; however, there is a 1.4-fold increase in the amount of intermediate formed for ZnCo-L1 as compared to CoCo-L1 (Figure 4.5). The intermediate decays faster in the reaction with ZnZn-L1, as compared with CoCo- and ZnCo-L1, and the rates of intermediate decay for CoCo- and ZnCo-L1 are very similar. This result, along with the results described

above, strongly indicates that cobalt binds to the Zn2 site and that the Zn2 site is involved in stabilizing the intermediate.

RFQ-EPR studies. EPR spectra recorded on ZnCo-L1 during an RFQ-EPR experiment are shown in Figure 4.6. The resting signals from ZnCo-L1 recorded at 10 K, 2 mW (Figure 4.6A)

and at 7 K, 80 mW (Figure 4.6B) were very similar and are due to two isolated S = 3/2, MS = ± ½ systems. These systems are in turn due to Co(II) in either of the binding sites in singly-occupied L1. There is likely an additional component due to molecules containing two Co(II) ions. Upon reaction with nitrocefin for 10 ms, the color of the sample became bright blue, and the EPR spectra shown in Figure 4.6C – E were observed. At 10 K, 2 mW (Figure 4.6C), the inflections in the spectrum (1600 – 2000G), due to the presence of the isolated rhombic species of Figure

4.2A, were no longer observable, and instead, a small but distinct sharp peak at 1025 G (geff. =

Figure 4.4: Stopped-flow traces of the reaction of Co(II)-containing L1 analogs with nitrocefin. 50 μM 1Co- (A) and ZnCo-L1 (B) analogs were reacted with 50 μM nitrocefin at 4 oC. The absorbance at 485 nm is due to the product, the absorbance at 390 nm is due to the substrate, and the absorbance at 665 nm is due to the intermediate.

100

6.65) was observed. At successively higher microwave power and lower temperature, this signal became more prominent as other features were lost to saturation and rapid-passage effects

(Figure 4.6D, E), characteristic of an MS = ± 3/2 system and of tetrahedral Co(II). Upon further reaction, the sample turned red, indicating the hydrolysis of nitrocefin, and new EPR signals were observed (Figure 4.6F, G) that are presumably due to a product complex. These signals showed no evidence of an MS = ± 3/2 component but were unusual in that the gz feature at 2650

G (geff. = 2.6) was very well-resolved, indicative of constrained geometry and consistent with binding of Co(II) to a more rigid ligand than water (31).

101

Table 4.3: Exponential fits to the stopped-flow kinetic data and kinetic simulations.

Species Rate of product formation (s-1)a

1ZnL1 0.92 + 0.03 ZnZnL1 17 + 1 1CoL1 0.05 + 0.01 ZnCoL1 12 + 1 ZnFeL1 12 + 1

1FeL1 0.12 + 0.02

arates determined by exponential fitting of the stopped-flow data in Figures 4. 3, 4.4, and 4.7.

102

Figure 4.5: Intermediate formation by L1 analogs. The absorbance at 665 nm arises from the presence of intermediate. Each reaction contained 50 μM L1 analog and 50 μM nitrocefin at 4 oC in 50 mM cacodylate, pH 7.0. Inset: Intermediate formation for ZnZn-, ZnCo-, and CoCo-L1 analogs over 200 ms.

103

Figure 4.6: RFQ-EPR of ZnCo-L1 with nitrocefin. Spectra (A) and (B) are from resting ZnCo- L1. Spectra (C – E) are from ZnCo-L1 after reaction with nitrocefin for 10 ms at 3 °C. Spectra (F) and (G) are from ZnCo-L1 after incubation with nitrocefin for 2 min (at which time all of the added nitrocefin has been hydrolyzed). Spectra (A), (C) and (F) were recorded at 10 K, 2 mW, spectra (B), (D) and (G) at 7 K, 80 mW, and spectrum (E) at 5 K, 126 mW. Spectra are shown with arbitrary intensities.

104

Preparation and characterization of the ZnFe-analog of L1. Our ability to prepare a mixed- metal analog of L1 by using a biological incorporation method led us to speculate whether a ZnFe analog of L1 could also be prepared. Recently, our studies using the over-expression plasmid that results in L1 being folded in the cytoplasm allowed us to prepare an iron-containing analog of L1 (Hu, Gunasekera et al submitted). However, the FeFe-L1 analog was catalytically- inactive. In an effort to prepare a ZnFe analog of L1, we over-expressed L1 in minimal medium containing 100 μM Fe(II). The purified enzyme was green in color, contained 0.9 equivalents of -1 Fe and 0.2 equivalents of Zn(II), and exhibited a kcat of 2.6 s and a Km of 53 μM, when using nitrocefin as the substrate. The addition of 0.8 equivalents of Zn(II) resulted in a sample that -1 exhibited a kcat of 24 s and a Km of 4 μM (Table 4.2). The EPR signal of 1Fe-L1 (Figure 4.2F) consisted of two types of signals. A rhombic S =

5/2 signal was observed with resonances at geff. ~ 9 and ~ 4.3, and with some structure in the g ~ 4.3 region indicative of protein-bound Fe(III). The other contribution was from two very similar

and largely overlapping signals with geff. < 2 (3400 – 4000 G) and indicative of an antiferromagnetically coupled Fe(II)-Fe(III) dinuclear site (32, 33). Addition of Zn(II) generated ZnFe-L1, though the EPR signal varied from sample to sample. In all cases, there were small but reproducible changes in the Fe(III) signal, perhaps indicative of formation of an Zn(II)Fe(III) center in some molecules, and the intensity of the Fe(II)Fe(III) signal diminished, sometimes by a rather modest amount, as in Figure 4.2G, and sometimes almost completely. Further addition of iron, to form FeFe-L1, consistently abolished the Fe(II)Fe(III) signal (Figure 4.2H), as did additions of Ni(II) (Figure 4.2I) and Co(II) (Figure 4.2J). Additionally, marked changes in the Fe(III) signals in these bimetallic forms of L1 were observed. The g ~ 9 and 4.3 regions of the spectrum of FeFe-L1 differ from those of 1Fe-L1 and ZnFe-L1. Additional transitions were observed flanking the g ~ 4.3 region of the spectrum of FeNi-L1, indicating of a narrowing of the distribution of E/D due to lowering of strain terms and a more constrained Fe(III) environment. The shape and intensity change of the g ~ 9 feature suggests changes in both strains and in D. In FeCo-L1, transitions due to Fe(III) and Co(II) in the region 800 – 3000 G could not be deconvoluted with confidence, but the very sharp nature of the g ~ 4.3 resonance from Fe(III) again indicates changes in the zero-field splitting parameters of Fe(III).

In an effort to further probe which site (Zn1 or Zn2) that the Fe binds, we attempted to obtain a 1H NMR spectrum of this sample; however, no peaks were observed between -200 to

105

+200 ppm. We believe that the inability to observe any peaks in this sample is due to the relatively slow electron spin relaxation rate (T1e) of high-spin Fe(III) and the large size (118 kDa) of L1, both of which result in significant broadening of 1H NMR peaks (34). The ZnFe-analog of L1 was also prepared by adding 1 equivalent of Fe(II) directly to 1Zn-L1, which was made by adding 1 equivalent of Zn(II) directly to apo-L1. This sample exhibited almost identical steady-state kinetic constants as the sample described above (Table 4.2). Similar to the results on cobalt-containing samples of L1, the 1Fe-L1 analog exhibited little or no activity and produced no intermediate (Figure 4.7), suggesting the steady-state kinetic data for this enzyme was due to small amounts of ZnFe-L1. The rate of product formation for 1Fe-L1 was 0.12 + 0.02 (Table 4.3). The stopped-flow traces for ZnFe-L1 showed substrate depletion occurred during the first 0.08 seconds and 2.6-fold less intermediate formed for this enzyme as compared to ZnZn-L1 (Figure 4.7). The rate of product formation for ZnFe-L1 (made by adding Zn(II) to 1Fe-L1 or by adding Fe(II) to 1Zn-L1) was 12 + 1, which reflects a 100-fold increase in activity as compared to 1Fe-L1 (Table 4.3).

RFQ-EPR studies with FeZn-L1 and nitrocefin. As with ZnCo-L1, the EPR spectrum of ZnFe- L1 was observed to change upon incubation with nitrocefin for 10 ms at 3 °C (Figure 4.8). The various transitions that make up the g ~ 4.3 line in ZnFe-L1 (Figure 4.8A) are due to the mean E/D being slightly less than 1/3 and the strain-dependent distribution in E/D not being large enough to broaden out all of the transitions. Upon reaction with nitrocefin, the resonance positions of these partially-resolved transitions change, indicative of a change in E/D and, hence, in the ligand field at Fe(III) (Figure 4.8B, G, H). Further change in the g ~ 9 resonance was observed (Figure 4.8C, D), and a shoulder was observed at g ~ 5 (1350 G Figure 4.8E, F) upon reaction of ZnFe-L1 with nitrocefin.

106

Figure 4.7: Stopped-flow traces of Fe-containing L1 analogs reacted with nitrocefin. 50 μM 1Fe- (A), ZnFe-L1 (made by adding Fe(II) to 1Zn-L1) (B), and ZnFe-L1 (made by adding Zn(II) to 1Fe-L1) (C) were reacted with 50 μM nitrocefin at 4 oC. The absorbance at 485 nm is due to the product, the absorbance at 390 nm is due to the substrate, and the absorbance at 665 nm is due to the intermediate.

107

Figure 4.8: RFQ-EPR of ZnFe-L1 with nitrocefin. Trace A shows the 500 – 2500 G region of the spectrum of resting ZnFe-L1. Trace B shows the 500 – 2500 G region of the spectrum of ZnFe-L1 upon reaction with nitrocefin for 10 ms at 3 °C (solid) overlaid with that of resting ZnFe-L1 (dashed). The inserts show more detailed comparisons between the spectra over particular field ranges; traces (C), (F) and (G) are from resting ZnFe-L1 and traces (D), (E) and (H) are from ZnFe-L1 after reaction with nitrocefin for 10 ms at 4 °C.

108

4.4 Discussion Zn(II) plays an essential catalytic role in enzymes from all of the major classes of enzymes and a structural role in a large number of other proteins (35-37). Due to its valence electronic configuration of [Ar]3d10, Zn(II) is silent to most spectroscopic techniques. Fortunately, Zn(II) can be substituted with Co(II), and the resulting enzymes are catalytically- active and contain metal binding sites nearly identical to those of the Zn(II)-containing analogs (31, 38). For mononuclear Zn(II)-containing enzymes such as carbonic anhydrase, the Co(II)- substituted analog yields unambiguous results regarding the function of the metal site in catalysis (39). However in the case of dinuclear Zn(II)-containing enzymes, the interpretation of kinetic/spectroscopic results are more complicated due to the presence of up to three distinct

species, [M1_], [_M2] and [M1M2], that can interact with substrates in distinct ways and that can display overlapping spectroscopic signatures. Nonetheless, previous studies on dinuclear metal ion-containing aminopeptidase from Aeromonas proteolytica demonstrated that mixed-metal ion containing analogs of the enzyme could be used to probe the role of each metal in catalysis/binding (31, 40, 41). The metal binding mode of this enzyme is sequential, which allowed for the preparation and characterization of the ZnZn, ZnCo (or CoZn), 1Zn, and 1Co analogs. For other enzymes such as BcII however, the binding constants of the two metal binding sites are similar, leading to mixtures of enzyme containing mononuclear, dinuclear, and even trinuclear metal ion containing analogs (13, 14). The interpretation of kinetic and spectroscopic results on such mixtures is difficult if not impossible to accomplish.

Since the metal binding Kd1 and Kd2 for Zn(II) binding to L1 was reported to be 2.6 and 6.0 nM (9), respectively, we did not initially believe that we could prepare enzyme samples containing 1Zn-, 1Co-, or ZnCo-centers by simply adding the metal ion to metal-free enzyme. Therefore, our first attempt to prepare these analogs involved the use of site-directed mutagenesis. The rationale for these studies was to introduce a mutation in one of the metal binding sites and to weaken metal binding to this site. Since Asp120 is essential for catalysis in L1 (23), we decided to substitute the metal binding histidines in the enzyme. Five site-directed mutants, with single point mutations, were generated; however surprisingly, only two of the resulting mutants were soluble. Fortunately, there was one HXXC mutation in each of the metal

binding sites (H116C for Zn1 site, H121C for Zn2 site). Steady-state kinetic studies showed that the catalytic activities of both mutants were low (Table 4.1), which is consistent with the low

109

observed Zn(II) incorporation. After incubation with excess Zn(II) and dialysis to remove loosely-bound or nonbound Zn(II), both mutants were shown to bind nearly 1 equivalent of Zn(II), which suggests that the one amino acid substitution did impair metal binding as expected. Steady-state kinetic studies conducted in the presence of 100 μM Zn(II) demonstrated that -1 H121C exhibits similar activity (kcat = 33 ± 3 s ) as wild-type L1, although the mutant exhibited

a much higher value for Km. In contrast, the H116C mutant exhibited almost no activity even in the presence of added Zn(II). Since His161 is in the Zn1 site, this result suggests that the Zn1 site is important for catalysis; however, we cannot rule out the possibility that the point mutation did not alter the substrate binding site. These results also demonstrate that a mutation to one of the metal binding histidines results in an enzyme that requires excess metal ion to saturate the mutated site. Since the excess metal ions would undoubtedly complicate subsequent spectroscopic analyses, we concluded that this strategy cannot be used to prepare the mixed- metal analogs of L1. Consequently, we utilized a biological incorporation strategy in an attempt to prepare L1 analogs containing only one equivalent of Co(II) and the mixed metal ion containing analogs. Over-expression of L1 in minimal medium containing cobalt resulted in an enzyme that binds 0.9 equivalents of Co(II). Spectroscopic studies strongly suggest that Co(II) is not delocalized

between the two metal binding sites and that it binds to the consensus Zn2 site (Figures 4.1 and 4.2). A similar metal content is obtained when L1 is over-expressed in the presence of Zn(II) using this same technique. Our previous EXAFS studies (28) and recent crystallographic studies

by Dideberg (42) demonstrate that Zn(II) preferentially binds to the Zn1 site. In agreement with

the model of Co(II) binding to the Zn2 site and Zn(II) binding to the Zn1 site, the addition of 1 equivalent of Zn(II) to 1Co-L1 results in an enzyme with almost identical EPR properties as 1Co-L1 (Figure 4.2B, C); however, the two analogs exhibit significantly different pre-steady state kinetic behaviors (Figure 4.4). Surprisingly, a FeZn analog of L1 can also be prepared by using the same strategy. EPR studies show that the resulting 1Fe-L1 contains a predominant ZnFe center;

110

however, samples also sometimes contained some antiferromagnetically-coupled Fe(III)Fe(II) (Figure 4.2G) The formation of an ZnFe center was reflected in differences between the Fe(III) EPR spectra of 1Fe-L1 and ZnFe-L1 and the narrowing of the spectrum upon incorporation of Zn(II) suggests increased conformational rigidity of the active site in the dimetallic form. While the effect of Zn(II) on the EPR signal was quite subtle, much more dramatic effects were observed with Ni(II) and Co(II). In both cases a significant reduction in the structural microheterogeneity of the Fe(III) environment was revealed by EPR, giving rise to resolved E/D < 1/3 transitions with Ni(II) and a very sharp E/D = 1/3 g = 4.3 line with Co(II). Interestingly, no spin-spin exchange coupling was detected in FeCo-L1. Both metal ions in L1 are required for maximum catalytic activity. Thus, a role is proposed for the second binding metal ion in fine tuning the electronic structure of the first ion via a structural, rather than electronic, mechanism. We were unable to obtain 1H NMR spectra of the Fe-containing analogs of L1 due to the

relatively slow T1e of Fe(III) (43) and presumably due to the low concentration of Fe(II)Fe(III) in

the sample. Nonetheless, we hypothesize that Fe(III) is binding to the Zn2 site since the H-H-D motif is a common Fe(III) binding site in biology (44). Fe(II) can bind at the Zn1 site, but the addition of Zn(II) to 1Fe-L1 results in a reduction of the signal corresponding to the mixed- valent, dinuclear iron center (Figure 4.2G). The ZnFe analog can be prepared either by adding Fe to 1Zn-L1 or Zn(II) to 1Fe-L1, since the resulting enzymes exhibit the same steady state and pre- steady state kinetic characteristics (Table 4.2 and Figure 4.7). Taken together, these results demonstrate that mixed-metal analogs of L1 can be generated and used in mechanistic studies to probe the role of each metal in catalysis. Stopped-flow kinetic studies on 1Zn-, 1Co-, ZnZn-, and ZnCo-L1 were used to probe the

role of the metal ions. 1Zn-L1, with Zn(II) in the Zn1 site, exhibited significant activity (ZnZn- L1 is 18-fold more active than 1Zn-L1, Table 4.3); however, very little intermediate was

detected in these studies (Figure 4.3). On the other hand, 1Co-L1, with Co(II) in the Zn2 site, is almost completely inactive (ZnZn-L1 is 340-fold more active than 1Co-L1, Table 4.3). It is likely that the small activity exhibited by 1Co-L1 in the stopped-flow studies (0.29% as compared to ZnZn-L1) is due to small amounts of Zn(II) in 1Co-L1 preparations (Table 4.1) and in the buffer (estimated to be 100 nM, which is 0.2% of the concentration of enzyme in the stopped-flow studies). The 1Fe-L1 analog was >140-fold less active than ZnZn-L1 (Figures 4.4 and 4.7; Table 4.3), and this higher activity, as compared to that of 1Co-L1, is mostly due to the

111

higher amounts of Zn(II) in the 1Fe-L1 samples (Table 4.2). We cannot unambiguously rule out that one of the Fe-containing analogs of L1 is active; although, our studies indicate that FeFe-L1 is inactive (Table 4.2 and (18)). These results indicate that both metal ions are required to detect intermediate in the reaction of nitrocefin with the ZnCo- and ZnFe-analogs of L1 (Figures 4.3, 4.4, 4.5, and 4.7). These results also indicate that an analog of L1 with metal (Co(II) or Fe) only

in the Zn2 site is inactive. In contrast, an analog of L1 with Zn(II) in the Zn1 site does exhibit some activity, albeit very small (compare rates of product formation for 1Zn-L1 with those of 1Co-L1 and 1Fe-L1; Table 4.3), and this analog does allow for the formation of a small (4%) amount of intermediate (Figure 4.3A). Taken together, these results demonstrate that both metal ions in L1 are required for maximum catalytic activity. The Zn1 site “prefers” Zn(II) over any other metal ion, and the role of this metal ion is presumably to provide the reactive nucleophile during catalysis. L1 analogs with metal ion only in the Zn2 are not catalytically-active. The Zn2 site can bind a number of metal ions including Co(II) and Fe(III)/Fe(II). The role of this site is to stabilize the reaction intermediate during catalysis. This result is consistent with previous suggestions on CcrA (45) and on model complex-catalyzed hydrolysis of nitrocefin (46, 47). It is not absolutely essential to have the Zn2 filled in order that L1 be active since 1Zn-L1 does exhibit some catalytic activity. Based on previous studies on CcrA (45, 48, 49), the roles of the metal ions are most like the same in this subgroup 3A β-lactamase. The results presented above can not necessarily be applied to BcII, since there is considerable controversy presently regarding whether the mononuclear Zn(II)-containing enzyme is active (10, 12-14). In addition, Vila and coworkers have reported that no ring-opened, nitrogen anionic intermediate is observed when BcII is reacted with nitrocefin (50). The successful preparation of a heterobimetallic analog of L1 that contained a paramagnetic metal ion in one metal binding site allowed us to directly probe the reaction mechanism of L1 with RFQ EPR studies. The EPR spectrum of ZnCo-L1 was consistent with Co(II) being 5-coordinate in the resting form of the enzyme (Figure 4.6A and B). Within 10 ms reaction time, a 4-coordinate tetrahedral intermediate, not seen at all in any of the resting spectra from Co(II)-containing L1, was formed. This species decayed as substrate was exhausted, and a higher coordination product complex remained. This result confirms our previous work that showed that substrate, intermediate, and product coordinate the metal ion(s) in L1(20). RFQ- EPR of ZnFe-L1 also showed catalytically-competent changes in the EPR spectrum, here due to

112

Fe(III). In the case of Fe(III), however, the changes were relatively subtle, reflecting the likelihood that while Co(II) plays the more active role in ZnCo-L1, it is Zn(II) that undergoes the corresponding coordination number change during reaction of ZnFe-L1. Based on all of the data on L1 presented to date, we are in position to propose a reaction mechanism of nitrocefin hydrolysis by L1 (Figure 4.9). When nitrocefin binds, the terminally-

bound water molecule on Zn2 releases and the β-lactam carbonyl interacts with the metal ion in

the Zn1 site while the nitrogen lone pair on the nitrogen of the β-lactam interacts with Zn2 (27,

51). The binding of substrate results in the loss of the Zn2-bridging hydroxide bond, thereby

generating a four-coordinate metal ion in the Zn2 site and the reactive nucleophile that is directed for attack by Asp120 (23). The resulting, very short-lived tetrahedral species is converted to the ring-opened, nitrogen anionic intermediate after the loss of the β-lactam bond. At this time it is not clear if one metal ion or both are involved in the stabilization of the intermediate, but the data

in this work clearly shows that the metal ion in the Zn2 site is essential for stabilization. The breakdown of the intermediate involves a protonation, which likely occurs during the concerted formation of a new bridging water/hydroxide. Our previous kinetic studies strongly suggested that Asp120 plays a role in orienting the acidic proton on the solvent molecule for protonation of intermediate (23). When other substrates are used, there is evidence that the reaction intermediate does not accumulate (52), suggesting that ring opening and protonation of the β- lactam nitrogen is concerted. Regardless of substrate, the EP complex is in equilibrium with the

resting enzyme, and in both cases, the coordination number at the Zn2 site is 5. The successful preparation of mononuclear metal ion containing and heterobimetallic analogs of L1 has allowed us for the first time to probe the roles of the metal ions in this enzyme. It is clear

that the metal ion in the Zn1 site is essential for activity and that the most active form of the

enzyme requires both metal ions. The metal ion in the Zn2 site appears to be involved in the stabilization of a reaction intermediate and possibly in orienting the β-lactam nitrogen for protonation. These results demonstrate that potential inhibitors can be designed to target the Zn1

site only or both sites, although compounds that bind to the Zn2 site and that block the Zn1 site may also be effective inhibitors.

113

Figure 4.9: Proposed reaction mechanism of L1 for the hydrolysis of nitrocefin.

114

4.5: Acknowledgment. The authors thank the Volwiler Professorship (MWC) and the National Institutes of Health (EB001980 and AI056231 to BB) for funding this work.

115

4.6: References: 1. Fisher, J. F., Meroueh, S. O., and Mobashery, S. (2005) "Bacterial resistance to β-lactam antibiotics: compelling opportunism, compelling opportunity," Chem. Rev. 105, 395-424. 2. Perez, F., Endimiani, A., Hujer, K. M., and Bonomo, R. A. (2007) "The continuing challenge of ESBLs," Curr. Opin. Pharm. 7, 459-469. 3. Walsh, T. R., Toleman, M. A., Poirel, L., and Nordmann, P. (2005) "Metallo-β- lactamases: the quiet before the storm?," Clin. Microbiol. Rev. 18, 306-325. 4. Crowder, M. W., Spencer, J., and Vila, A. J. (2006) "Metallo-β-lactamases: Novel weaponry for antibiotic resistance in bacteria," Acc. Chem. Res. 39, 721-728. 5. Moran-Barrio, J., Gonzalez, J. M., Lisa, M. N., Costello, A. L., Dal Peraro, M., Carloni, P., Bennett, B., Tierney, D. L., Limansky, A. S., Viale, A. M., and Vila, A. J. (2007) "The metallo-β-lactamase GOB is a mono-Zn(II) enzyme with a novel active site," J. Biol. Chem. 282, 18286-18293. 6. Carfi, A., Pares, S., Duee, E., Galleni, M., Duez, C., Frere, J. M., and Dideberg, O. (1995) "The 3-D Structure of a Zinc Metallo-β-Lactamase from Bacillus cereus Reveals a New Type of Protein Fold," EMBO J. 14, 4914-4921. 7. Fabiane, S. M., Sohi, M. K., Wan, T., Payne, D. J., Bateson, J. H., Mitchell, T., and Sutton, B. J. (1998) "Crystal Structure of the Zinc-Dependent β-Lactamase from Bacillus cereus at 1.9 A Resolution: Binuclear Active Site with Features of a Mononuclear Enzyme," Biochemistry 37, 12404-12411. 8. Davies, A. M., Rasia, R. M., Vila, A. J., Sutton, B. J., and Fabiane, S. M. (2005) "Effect of pH on the active site of an Arg121Cys mutant of the metallo-β-lactamase from Bacillus cereus: Implications for the enzyme mechanism," Biochemistry 44, 4841-4849. 9. Wommer, S., Rival, S., Heinz, U., Galleni, M., Frere, J. M., Franceschini, N., Amicosante, G., Rasmussen, B., Bauer, R., and Adolph, H. W. (2002) "Substrate- activated zinc binding of metallo-β-lactamases - Physiological importance of the mononuclear enzymes," J. Biol. Chem. 277, 24142-24147. 10. Badarau, A., and Page, M. I. (2006) "Enzyme deactivation due to metal ion dissociation during turnover of the cobalt-β-lactamase catalyzed hydrolysis of β-lactams," Biochemistry 45, 11012-11020.

116

11. Badarau, A., and Page, M. I. (2006) "The variation of catalytic efficiency of Bacillus cereus metallo-β-lactamase with different active site metal ions," biochemistry 45, 10654-10666. 12. Badarau, A., Damblon, C., and Page, M. I. (2007) "The activity of the dinuclear cobalt-β- lactamase from Bacillus cereus in catalysing the hydrolysis of b-lactams," Biochem. J. 401, 197-203. 13. Llarrull, L. I., Tioni, M. F., Kowalski, J., Bennett, B., and Vila, A. J. (2007) "Evidence for a Dinuclear Active Site in the Metallo-β-lactamase BcII with Substoichiometric Co(II): A NEW MODEL FOR METAL UPTAKE," J. Biol. Chem. 282, 30586-30595. 14. Gonzalez, J. M., Medrano Martin, F. J., Costello, A. L., Tierney, D. L., and Vila, A. J. (2007) "The Zn2 position in metallo-β-lactamases is critical for activity: a study on chimeric metal sites on a conserved protein scaffold," J. Mol. Biol. 373, 1141-1156. 15. Heinz, U., and Adolph, H. W. (2004) "Metallo-β-lactamases: two binding sites for one catalytic metal ion?," CMLS, Cell. Mol. Life Sci. 61, 2827-2839. 16. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning - A Laboratory Manual, Vol. 1, Second ed., Cold Spring Harbor Laboratory Press. 17. Crowder, M. W., Walsh, T. R., Banovic, L., Pettit, M., and Spencer, J. (1998) "Overexpression, Purification, and Characterization of the Cloned Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia," Antimicro. Agents Chemo.42, 921-926. 18. Hu, Z., Gunasekera, T. S., Spadafora, L., Bennett, B., and Crowder, M. (2008) "Metal Content of Metallo-β-lactamase L1 Is Determined by the Bioavailability of Metal Ions," Biochemistry, in press 19. Sharma, N. P., Hajdin, C., Chandrasekar, S., Bennett, B., Yang, K. W., and Crowder, M. W. (2006) "Mechanistic studies on the mononuclear Zn(II)-containing metallo-β- lactamase ImiS from Aeromonas sobria," Biochemistry 45, 10729-10738. 20. Garrity, J. D., Bennett, B., and Crowder, M. W. (2005) "Direct evidence that reaction intermediate in metallo-β-lactamase is metal bound," Biochemistry 44, 1078-1087. 21. Carenbauer, A. L., Garrity, J. A., Periyannan, G., Yates, R. B., and Crowder, M. W. (2002) "Probing Substrate Binding to Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia by Using Site-Directed Mutagenesis," BMC Biochemistry 3, 4-10.

117

22. Garrity, J. D., Pauff, J. M., and Crowder, M. W. (2004) "Probing the dynamics of a mobile loop above the active site of L1, a metallo-β-lactamase from Stenotrophomonas maltophilia, via site-directed mutagenesis and stopped-flow fluorescence spectroscopy," J. Biol. Chem. 279, 39663-39670. 23. Garrity, J. D., Carenbauer, A. L., Herron, L. R., and Crowder, M. W. (2004) "Metal Binding Asp-120 in Metallo-β-lactamase L1 from Stenotrophomonas maltophilia Plays a Crucial Role in Catalysis," J. Biol. Chem. 279, 920-927. 24. Crowder, M. W., Yang, K. W., Carenbauer, A. L., Periyannan, G., Seifert, M. A., Rude, N. E., and Walsh, T. R. (2001) "The Problem of a Solvent Exposable Disulfide when Preparing Co(II)-Substituted Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia," J. Biol. Inorg. Chem. 6, 91-99. 25. Garmer, D. R., and Krauss, M. (1993) "Ab Initio Quantum Chemical Study of the Cobalt d-d Spectroscopy of Several Substituted Zinc Enzymes," J. Am. Chem. Soc. 115, 10247- 10257. 26. Hu, Z., Periyannan, G. R., and Crowder, M. W. (2008) "Folding strategy to prepare Co(II)-substituted metallo-β-lactamase L1," Anal. Biochem. 378, 177-183. 27. Ullah, J. H., Walsh, T. R., Taylor, I. A., Emery, D. C., Verma, C. S., Gamblin, S. J., and Spencer, J. (1998) "The crystal structure of the L1 metallo-β-lactamase from Stenotrophomonas maltophilia at 1.7 Å resolution," J. Mol. Biol. 284, 125-136. 28. Costello, A., Periyannan, G., Yang, K. W., Crowder, M. W., and Tierney, D. L. (2006) "Site-selective binding of Zn(II) to metallo-β-lactamase L1 from Stenotrophomonas maltophilia," J. Biol. Inorg. Chem. 11, 351-358. 29. Outten, C. E., and O'Halloran, T. V. (2001) "Femtomolar sensitivity of metalloregulatory proteins controlling zinc homeostasis," Science 292, 2488-2492. 29. Bennett, B. (2002) "EPR of Co(II) as a Structural and Mechanistic Probe of Metalloprotein Active Sites: Characterization of an Aminopeptidase," Curr. Topics. Biophys. 26, 49-57. 30. McMannus-Munoz, S., and Crowder, M. W. (1999) "Kinetic Mechanism of Metallo-β- Lactamase L1 from Stenotrophomonas maltophilia," Biochemistry 38, 1547-1553.

118

31. Bennett, B. (2002) "EPR of Co(II) as a Structural and Mechanistic Probe of Metalloprotein Active Sites: Characterization of an Aminopeptidase," Curr. Topics. Biophys. 26, 49-57. 32. Marasinghe, G. P. K., Sander, I. M., Bennett, B., Periyannan, G., Yang, K. W., Makaroff, C. A., and Crowder, M. W. (2005) "Structural studies on a mitochondrial glyoxalase II," J. Biol. Chem. 280, 40668-40675. 33. Schilling, O., Wenzel, N., Naylor, M., Vogel, A., Crowder, M., Makaroff, C., and Meyer- Klaucke, W. (2003) "Flexible metal binding of the metallo-β-lactamase domain: Glyoxalase II incorporates iron, manganese, and zinc in vivo," Biochemistry 42, 11777- 11786. 34. Bertini, I., Turano, P., and Vila, A. J. (1993) "Nuclear Magnetic Resonance of Paramagnetic Metalloproteins," Chem. Rev. 93, 2833-2932. 35. Auld, D. S. (1997) in Metal Sites in Proteins and Models: Phosphatases, Lewis Acids, and Vanadium (Hill, H. A. O., Sadler, P. J., and Thomson, A. J., Eds.) pp 29-50, Springer-Verlag, New York. 36. Auld, D. S. (2001) "Zinc coordination sphere in biochemical zinc sites," Biometals 14, 271-313. 37. Auld, D. S. (2004) in Handbook of Metalloproteins (Messerschmidt, A., Ed.) pp 416-431, John Wiley & Sons, New York. 38. Bertini, I., and Luchinat, C. (1984) "High-Spin Cobalt(II) as a Probe for the Investigation of Metalloproteins," Adv. Inorg. Biochem. 6, 72-111. 39. Bertini, I., Luchinat, C., and Scozzafava, A. (1982) "Carbonic Anhydrase: An Insight into the Zinc Binding Site and into the Active Cavity Through Metal Substitution," Struct. Bond. 48, 45-92. 40. Bennett, B., and Holz, R. C. (1997) "EPR Studies on the Mono- and Dicobalt(II)- Substituted Forms of the Aminopeptidase from Aeromonas proteolytica. Insight into the Catalytic Mechanism of Dinuclear Hydrolases," J. Am. Chem. Soc. 119, 1923-1933. 41. Bennett, B., and Holz, R. C. (1997) "Spectroscopically Distinct Cobalt(II) Sites in Heterodimetallic Forms of the Aminopeptidase from Aeromonas proteolytica: Characterization of Substrate Binding," Biochemistry 36, 9837-9846.

119

42. Nauton, L., Kahn, R., Garau, G., Hernandez, J. F., and Dideberg, O. (2008) "Structural insights into the design of inhibitors for the L1 metallo-β-lactamase from Stenotrophomonas maltophilia," J. Mol. Biol. 375, 257-269. 43. Bertini, I., and Luchinat, C. (1986) NMR of Paramagnetic Molecules in Biological Systems, Benjamin Cummings Publishing Company, Menlo Park, CA. 44. Hegg, E. L., and Que, L. (1997) "The 2-His-1-Carboxylate Facial Triad, An Emerging Structural Motif in Mononuclear Non-Heme Iron(II) Enzymes," E. J. Biochem. 250, 625- 629. 45. Wang, Z., Fast, W., and Benkovic, S. J. (1999) "On the Mechanism of the Metallo-β- Lactamase from Bacteroides fragilis," Biochemistry 38, 10013-10023. 46. Kaminshaia, N. V., Spingler, B., and Lippard, S. J. (2000) "Hydrolysis of β-Lactam Antibiotics Catalyzed by Dinuclear Zinc(II) Complexes: Functional Mimics of Metallo- β-Lactamases," J. Am. Chem. Soc. 122, 6411-6422. 47. Kaminskaia, N. V., Spingler, B., and Lippard, S. J. (2001) "Intermediate in β-lactam hydrolysis catalyzed by a dinuclear zinc(II) complex: Relevance to the mechanism of metallo-β- lactamase," J. Am. Chem. Soc. 123, 6555-6563. 48. Wang, Z., and Benkovic, S. J. (1998) "Purification, Characterization, and Kinetic Studies of Soluble Bacteroides fragilis Metallo-β-Lactamase," J. Biol. Chem. 273, 22402-22408. 49. Wang, Z., Fast, W., and Benkovic, S. J. (1998) "Direct Observation of an Enzyme-Bound Intermediate in the Catalytic Cycle of the Metallo-β-Lactamase from Bacteroides fragilis," J. Am. Chem. Soc. 120, 10788. 50. Rasia, R. M., and Vila, A. J. (2003) "Mechanistic study of the hydrolysis of nitrocefin mediated by B. cereus metallo-β-lactamase," ARKIVOC 3, 507-516. 51. Spencer, J., Read, J., Sessions, R. B., Howell, S., Blackburn, G. M., and Gamblin, S. J. (2005) "Antibiotic recognition by binuclear metallo-β-lactamases revealed by X-ray crystallography," J. Am. Chem. Soc. 127, 14439-14444. 52. Spencer, J., Clark, A. R., and Walsh, T. R. (2001) "Novel Mechanism of Hydrolysis of Therapeutic b-Lactams by Stenotrophomonas maltophilia L1 Metallo-β-Lactamase," J. Biol. Chem. 276, 33638-33644.

120

Chapter 5

Structure and mechanism of Cu- and Ni-substituted analogs of metallo-β-lactamase L1

121

Structure and mechanism of Cu- and Ni-substituted analogs of metallo-β-lactamase L1

.and Michael W ׀׀,Zhenxin Hu,‡ Lauren J. Spadafora,‡ Christine E. Hajdin ‡ Brian Bennett Crowder‡

‡Department of Chemistry and Biochemistry, 160 Hughes Hall, Miami University, Oxford, OH National Biomedical EPR Center, Department of Biophysics, Medical College of׀׀ ;45056 Wisconsin, 8701 Watertown Plank Road, Milwaukee, WI 53226-0509

*To whom correspondence should be addressed: Michael W. Crowder e-mail: [email protected] phone: (513) 529-7274 fax: (513) 529-5715

†This work was supported by the National Institutes of Health (AI056231 to BB, and EB001980 to the Medical College of Wisconsin) and Miami University (to MWC).

Contributions to this chapter: Lauren assisted in the preparation of the enzymes. Christine simulated the kinetic data. Professor Bennett assisted Zhenxin in the acquisition of the EPR spectra. The rest of data collection and analysis were accomplished by Zhenxin Hu.

122

ABSTRACT In an effort to further probe whether the metal binding sites of metallo-β-lactamase L1 (mβl L1) could accommodate other metal ions, Cu- and Ni-substituted L1 were prepared and characterized by kinetic and spectroscopic studies. The Cu-containing analog of L1 (Cu-L1) bound 1.7 equivalents of Cu and trace amounts of Zn(II) and Fe. The EPR spectrum of this analog exhibited two overlapping, axial signals, indicative of type 2 Cu(II), and showed that -1 there was no spin-coupling between the Cu(II) ions. Cu-L1 exhibited higher kcat (96 s ) and Km (224 μM) values, as compared to the values of dinuclear Zn(II)-containing L1, when nitrocefin was used as substrate. The Ni-containing analog (Ni-L1) bound 1 equivalent of Ni and 0.3 equivalents of Zn(II). Ni-L1 was EPR-silent, suggesting that the oxidation state of nickel was +2; this suggestion was confirmed by 1H NMR spectra, which showed relatively sharp proton resonances. Stopped-flow kinetic studies showed that ZnNi-L1, which contained 1 equivalent of Ni(II) and 1 equivalent of Zn(II), stabilized significant amounts of the nitrocefin-derived intermediate and that the decay of intermediate is rate-limiting. 1H NMR spectra demonstrate

that Ni(II) binds in the Zn2 site and that the ring-opened product coordinates Ni(II). Both Cu-L1 and ZnNi-L1 hydrolyze cephalosporins (such as nitrocefin and cefaclor) and carbapenems

(imipenem, for example), but not penicillins (penicillin G or ampicillin), suggesting that the Zn2

site modulates substrate preference in mβl L1. These studies demonstrate that the Zn2 site in L1 is very flexible and can accommodate a number of different transition metal ions; this flexibility could possibly offer an organism that produces L1 an evolutionary advantage when challenged with β-lactam containing antibiotics.

123

5.1 Introduction β-Lactams are inexpensive and widely-used antibiotics against microbes since the 1940’s. There are three different major classes of β-lactams, penicillins, cephalosporins, and carbapenems (Figure 1) that have been used clinically. However, most microorganisms have obtained the ability to either pump the β-lactams out of the cell via transporter proteins (1) or to hydrolyze these compounds by secreting β-lactamases into the periplasm or milieu (2). Four distinct classes of β-lactamases have been identified (3). Unlike class A, C, and D β-lactamases, which utilize an active site serine as a nucleophile, class B β-lactamases, metallo-β-lactamases or Μβl’s, are a group of enzymes that require Zn(II) to hydrolyze β-lactams. There have have been >50 Mβl’s identified and categorized into three subgroups, according to amino acid sequence homology, the requirement of Zn(II) (1 or 2) for maximal activity, the identity of the metal binding ligands, and substrate preference. Although the amino acid sequence homology is less than 30% between the different subgroups of Mβl’s, the Zn(II) binding motif, HXHXD, is

highly-conserved (4). Most Mβl’s have a Zn1 site, consisting of three histidines and one bridging

hydroxide, and a relatively more variable Zn2 site, consisting of two histidines (or one histidine and one cysteine in B1 and B2 Mβl’s), one aspartate, one terminally-bound water, and the bridging hydroxide (Figure 2). Since the electronic configuration of Zn(II) is Ar[d10], which makes the metal center in Mβl’s spectroscopically-silent with the most common techniques(5), Zn(II) has often been replaced by Co(II), resulting in catalytically-active analogs that can be characterized by a number of common spectroscopic techniques(6-9). The Zn(II) ions have also been substituted with Cd(II) in Mβl CcrA(10), and this analog was catalytically-active and could be characterized with 119Cd NMR spectroscopy (11). While the Mβl’s demonstrate a preference for Zn(II) binding, Crowder and coworkers have recently reported that the metallation of Mβl L1 depends on the bioavailability of metal ions (12). In these previous studies, L1 was shown to bind Fe, Zn(II), and Mn. This result suggests that L1 contains a highly-flexible metal binding site, raising the question of whether other 1st row transition metal ions could bind to L1. In this work, we explored whether Ni- and Cu-containing analogs of L1 could be prepared, and we characterized the resulting analogs using spectroscopic and kinetic studies. These studies demonstrate that Cu-

124

N S

N S O CN O O CN COO- O Cl

COO- Penicillin G Cefaclor

Imipenem Nitrocefin

Figure 5.1: Structures of β-lactam antibiotics used as substrates in these studies.

125

HisO His His H His O O His

Asp

Figure 5.2: Active site of Mβl L1. The metal ion in the Zn1 site is coordinated by 3 histidines

(His116, His118, His196), and one bridging hydroxide. The metal ion in the Zn2 site is coordinated by two histidines (His121 and His263), one aspartate (Asp120), one bridging hydroxide, and one terminally bound H2O (not shown).

126

and Ni-containing analogs of L1 are active and suggest that the flexible metal binding site in L1 offers organisms an evolutionary advantage by being able to produce an enzyme that confers antibiotic resistance in environments containing transition metal ions other than Zn(II).

5.2 Materials and Methods Preparation of Ni- and Cu-containing analogs of L1. Mature L1 (M-L1) was over-expressed as

previously described by adding 100 μM NiSO4 or CuSO4 to the minimal medium during cell growth and protein production (13, 14). After protein over-expression the E. coli cells were centrifuged for 15 minutes (8,200 x g), and the cell pellet was resuspended in 300 mL of 50 mM Hepes (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), pH 6.0. The suspension was was centrifuged for 15 minutes (8,200 x g), and the resulting pellet was resuspended in 50 mM Hepes, pH 6.0. The cells were lysed by using a French press as previously described (15), and the mixture was centrifuged for 25 minutes (23,400 x g). The cleared, crude protein solution was loaded onto a 25 mL SP-Sepharose column that was equilibrated with 50 mM Hepes, pH 6.0, and bound proteins were eluted from the column using a linear 0 – 500 mM NaCl gradient in the same buffer. L1 typically eluted at 80-120 mM NaCl, and the fractions were analyzed for the presence of L1 by using SDS-PAGE, as previously described (15).

Metal anaylses. The metal content of the protein samples was determined by using a Varian Liberty 150 Inductively Coupled Plasma spectrometer with atomic emission spectroscopy detection (ICP-AES). All the proteins were diluted to 10 μM with 50 mM Hepes, pH 7.0. A calibration curve with 4 standards and a correlation coefficient of greater than 0.999 was generated using Zn(II), Cu, and Ni reference solutions from Fisher Scientific. The following emission wavelengths were chosen to ensure the lowest detection limits possible: Zn(II), 213.856 nm, Cu, 324.754 nm, and Ni, 221.647 nm.

1H NMR spectroscopy. 1H NMR spectra were collected on a Bruker Avance 500 spectrometer operating at 500.13 MHz, 298 K, magnetic field of 11.7 T, recycle delay (AQ) of 41 ms, and

sweep width of 400 ppm. Proton chemical shifts were calibrated by assigning the H2O signal the value of 4.7 ppm. A modified presaturation pulse sequence (zgpr) was used to suppress the proton signals originating from solvent. The presaturation pulse was as short as possible (500

127

ms) to avoid saturation of paramagnetically-shifted proton signals. The concentration of NMR

samples was generally in the range of 1.0 – 1.2 mM. Samples in D2O were prepared by performing three or more dilution/concentration cycles in a Centricon-10.

EPR spectroscopy. Low temperature EPR spectroscopy was carried out using a Bruker EleXsys E600 spectrometer equipped with an Oxford Instruments ITC503 liquid helium flow system.

EPR spectra were recorded at 9.63 GHz (B0⊥B1) or 9.37 GHz (B0||B1) using an ER4116DM dual-mode cavity, with 100 kHz magnetic field modulation. Other EPR recording parameters are given in the legends to figures.

Steady-state kinetics. All kinetic studies were conducted on an Agilent 8453 UV-Vis diode array spectrophotometer at 25 °C. Steady-state kinetic parameters, the Michaelis constant Km and the

turnover number kcat, were determined by monitoring product formation at 485 nm using nitrocefin or substrate decay at 235 nm for pencillin G, 280 nm for cefaclor, or 295 nm for imipenem in 50 mM Chelex-treated, cacodylate, pH 7.0. Absorbance changes were converted to concentration changes using Beer’s law and the extinction coefficients (in M-1cm-1) of nitrocefin product (17,420), penicillin G (-926), cefaclor (-6,410), or imipenem (-9,000), respectively.

Stopped-flow kinetic studies. Stopped-flow kinetic experiments were performed on an Applied Photophysics SX18MV spectrophotometer equipped with a constant temperature circulating water bath as previously described(16). All experiments were performed in 50 mM Chelex- treated, cacodylate buffer, pH 7.0, at 10 ºC. All the proteins were diluted with 50 mM Chelex- treated, cacodylate buffer to 100 μM and nitrocefin was prepared and diluted to 100 μM in the same buffer. The progress UV-Vis and fluorescence curves were fitted with single or double exponential equation.

5.3 Results Preparation and characterization of Ni(II)- and Cu(II)-containing analogs of L1. L1 was over-expressed using an over-expression plasmid that contains the gene for mature L1 (M-L1), which lacks the N-terminal targeting sequence. This over-expression plasmid has been previously used to prepare Fe-containing analogs of L1 that are folded in the cytoplasm of E. coli

128

(Chapter 3). When M-L1 was over-expressed in minimal medium containing 100 μM Cu(II), 5 mg of purified protein could be obtained per liter of growth medium. The resulting protein was shown to bind 1.7 ± 0.1 (Table 5.1) equivalents of Cu, 0.10 ± 0.05 equivalents of Zn(II), and 0.20 ± 0.05 equivalents of Fe. When M-L1 was over-expressed in minimal medium containing 100 μM Ni(II), 4 mg of purified protein could be obtained per liter of growth medium. The resulting protein was shown to bind 1.0 ± 0.1 equivalents of Ni, 0.30 ± 0.05 equivalents of Zn(II), and no other metal ions at greater than 0.03 equivalents. The Cu- and Ni-containing analogs of L1 were characterized using steady-state kinetic studies. As-isolated Cu-containing L1 (called Cu-L1), which contained 1.7 eq. of Cu (Table 5.1), -1 exhibited a kcat of 96 ± 8 s and a Km of 224 ± 20 μM, when using nitrocefin as substrate. While

exhibiting a larger kcat than wild-type L1, which binds 1.9 equivalents of Zn(II), Cu-L1 exhibits a

Km that is 56 times larger than that of ZnZn-L1, resulting in a kcat/Km value that is >10-fold lower

than that of ZnZn-L1. The as-isolated Ni-containing analog of L1 (called Ni-L1) exhibited a kcat -1 of 24 ± 2 s and a Km of 18 + 2 μM, when using nitrocefin as substrate. Zn(II) was added to as- -1 isolated Ni-containing L1 to generate ZnNi-L1, and this analog exhibited a kcat of 36 ± 1 s and a Km of 18 + 1 μM. In order to test the substrate specificity of the Cu- and Ni-containing analogs of L1, three different substrates, penicillin G, cefaclor, and imipenem, were used in steady-state kinetic studies with the metal-substituted forms of L1, and the results from these studies were compared to results with ZnZn-L1 (Table 5.2). When cefaclor, a cephalosporin like nitrocefin, was used as substrate, Cu- and Ni-containing L1 exhibited kcat values similar to those exhibited by ZnZn-L1;

however, the Km values exhibited by both metal-substituted analogs were significantly higher.

With the carbapenem imipenem as substrate, Cu- and ZnNi-L1 exhibited much higher kcat and

Km values than ZnZn-L1. The largest difference in kinetic behavior, however, was observed when penicillins were used as substrates. Neither Cu- nor ZnNi-L1 hydrolyzed penicillin G

(Table 5.2) or ampicillin, while the ZnZn-analog hydrolyzed penicillin G with a high kcat value. To test whether other metal-substituted analogs of L1 exhibited similar substrate specificity profiles, the ZnCo-, CoCo-, and ZnFe-analogs were also used in steady-state kinetic studies with the same substrates (Table 5.2). The ZnCo analog exhibited steady-state kinetic constants most similar to those of ZnZn-L1; however, the ZnCo analog did exhibit Km values for cephalosporins and carbapenems much higher than those of ZnZn-L1. The CoCo analog of L1

129

exhibited activity with all substrates tested; however, this analog exhibit a much lower Km value

for penicillins and higher Km values for cephalosporins and penicillins as compared to those of ZnZn-L1. The ZnFe analog of L1 behaved similarly as Cu-L1 and ZnNi-L1 with respect to the

values of Km; however, this analog did not exhibit the higher kcat values that were exhibited by Cu- and ZnNi-L1. Like Cu- and ZnNi-L1, the ZnFe analog of L1 exhibited no hydrolysis activity towards pencillin G.

Spectroscopic studies on Cu- and Ni-containing analogs of L1. As-isolated Cu-L1 was pale blue, and the UV-Vis spectrum of the enzyme revealed a broad peak between 500-950 nm (molar absorptivity at 780 nm of 120 M-1cm-1) (data not shown). In contrast, the as-isolated Ni- containing analog of L1 was pale green; however, there were no resolved UV-Vis peaks between 330 and 1000 nm. In an effort to better characterize the metal centers in the Cu- and Ni- containing analogs of L1, 1H NMR and EPR studies were conducted. The EPR signal of Cu-L1

hyperfine constant) of) ׀׀consisted of two overlapping, axial signals; one signal exhibited an A

,of 2.20 ׀׀of 93 G, g ׀׀of 2.27, and a g┴ of 2.06, and the second signal exhibited an A ׀׀G, g 160 and a g┴ of 2.06 (Figure 5.3). The former signal describes a typical type 2 Cu(II) center, which is not spin-coupled, and this signal is similar to those previously reported for Cu(II)-substituted thermolysin, dipeptidyl peptidase III, and carboxypeptidase (17). The presence of type 2 copper centers in Cu-L1 is consistent with the UV-Vis data mentioned above. The second signal, with

is most likely due to another type 2 Cu(II) center, and a similar signal has ,׀׀its relatively small A been observed previously with Cu(II)-substituted carboxypeptidase with added

value and the absence of an intense sulfur to ׀׀phenylproprionate (17). The magnitude of the A Cu(II) LMCT in the UV-Vis spectrum argue against the presence of any type 1 Cu(II) in Cu-L1. We cannot unambiguously rule out the presence of a type 3 Cu(II) center, which would be spin- coupled and EPR- and UV-Vis silent. We also attempted to obtain the EPR spectrum of Ni-L1; however, this sample did not yield an observable EPR signal. This result is not surprising since high spin Ni(II) would have an S =1 spin state, and to our knowledge, no EPR spectrum of a Ni(II)-containing protein has been reported. The absence of an EPR signal for Ni-L1 argues against nickel having a +1 or +3 oxidation state.

130

Table 5.1: Steady-state kinetic studiesa and metal analyses on Cu- and Ni-containing analogs of L1.

-1 Analog kcat (s ) Km (μM) Metal content (equivalents) ZnZn-L1b 26 + 1 4 + 1 1.9 ± 0.1 Zn(II) Cu-L1 96 + 8 224 + 20 1.7 ± 0.1 Cu, 0.10 ± 0.05 Zn(II), 0.20 ± 0.05 Fe Ni-L1c 24 + 2 18 + 2 0.30 ± 0.05 Zn(II), 1.0 ± 0.1 Ni NiZn-L1d 36 + 1 16 + 1 1.0 Zn(II), 1.0 ± 0.1Ni aSteady state kinetic studies were conducted at 25 oC in 50 mM chelex-treated, cacodylate, pH 7.0, using nitrocefin as the substrate; bData from (Chapter 4). cAs-isolated Ni-L1; dSample prepared by direct addition of Zn(II) to as-isolated Ni-L1.

131

Table 5.2: Steady state kinetics of different L1 analogs with different substrates.

ZnZnL1 ZnCoL1 CoCo-L1 ZnFe-L1 Cu-L1 ZnNi-L1

-1 -1 -1 -1 -1 -1 kcat (s ) Km(µM) kcat (s ) Km(µM) kcat(s ) Km (µM) kcat(s ) Km (µM) kcat(s ) Km (µM) kcat(s ) Km (µM)

Penicillin G 761 278 692 218 118 36 < 1 ND < 1 ND < 1 ND

Cefaclor 38 8 26 40 14 43 16 35 29 58 27 91

Imipenem 13 2 12 23 43 13 59 27 205 42 166 61

* Standard deviation < 10%. ND = not determined. aSteady state kinetic studies were conducted at 25 oC in 50 mM chelex-treated cacodylate, pH 7.0

132

2200 2400 2600 2800 3000 3200 3400 3600 3800 4000 4200 Magnetic Field (G) Figure 5.3: The EPR spectrum of 670 μM Cu-L1. Spectra were recorded at 45 K, 2 mW microwave power, and 0.25 mT magnetic field modulation amplitude.

133

The Cu-containing analog of L1 did not yield a 1H NMR spectrum, and this result is not surprising given the very slow electron relaxation time exhibited by Cu(II). While the Ni-containing analog of L1 did not yield an EPR spectrum, Ni(II) exhibits an electronic relaxation time of 10-13-10-11s (18), which makes Ni(II) an excellent metal ion for 1H NMR studies. The 1H NMR spectrum of the Ni-containing analog of L1 showed 4 resolved, paramagnetically-shifted peaks: one peak at 18 ppm and three peaks between 55-80 ppm (Figure 5.4A). Peaks a, c, and d integrated to 1 proton each, and peak b integrated to 2 protons. Peak b was assigned to a non-exchangeable proton, possibly an ortho proton on a Ni(II)-bound histidine (18). Peaks c and d disappear completely when the buffer in the Ni-L1 samples is exchanged with buffer in 90% D2O, suggesting that these two protons can be assigned to NH protons on metal-bound histidines. This result strongly suggests that Ni(II) binds to the Zn2 site in L1, since the Zn2 site has 2 metal binding histidines (19). We cannot unambiguously rule out the possibility that Ni(II) binds in a position that uses metal binding histidines from both the Zn1 and Zn2 site. While this behavior has been reported for Mβl BcII (20), the use of ligands from both sites to bind a single equivalent of metal has not been reported in any of the structural studies on L1.

In order to probe the function of Ni(II) in the Zn2 site of Ni-L1, one milligram of nitrocefin powder (to avoid dilution of the protein) was added to the Ni-L1 sample in 1 90% D2O. The H NMR spectrum was immediately obtained (Figure 5.4C), and a new peak at 65 ppm was observed. The intensity of this peak increased and stabilized over 15 minutes. We assign this peak to a proton on product (Figure 5.4C), and this result suggests that the nitrogen on product coordinates the metal ion in the Zn2 site.

Pre-steady state kinetic studies on Cu and Ni-containing analogs of L1. In an effort to probe whether the different metal ions in Cu-L1 and Ni-containing L1 affected the kinetic mechanism of the analogs, pre-steady state kinetic studies were carried out on the reaction of 50 μM Cu-L1 or Ni-containing L1 with 50 μM nitrocefin (Figures 5.4 and 5.5). Stopped-flow fluorescence studies, in which changes in intrinsic tryptophan fluorescence were monitored over time, showed a rapid decrease in fluorescence over the

134

b a c A d

100 80 60 40 20 p p m

Figure 5.4: 1H NMR spectra of Ni-L1. (A) Spectrum of Ni-L1 in buffer containing 10%

D2O, (B) spectrum of Ni-L1 in buffer containing 90% D2O, and (C) spectrum of Ni-

L1with nitrocefin in buffer containing 90% D2O. The enzyme concentration was 1.0 mM, and the buffer in these samples was 50 mM Hepes, pH 7.0. The spectra were collected at a temperature of 300 K on a 500 MHz NMR spectrometer.

135

2.9 (A) 2.8

2.7

2.6 Fluorescence 2.5

2.4

0.00.20.40.60.81.0 Time (s)

1.0 485 nm

0.8 (B)

0.6

390 nm Absorption 0.4 665 nm

0.2

0.00.20.40.60.81.0 Time (s) Figure 5.5. Stopped-flow kinetic studies on Cu-L1. (A) Stopped-flow fluorescence trace of the reaction of 50, μM Cu-L1 and 50 μM nitrocefin at 10 oC. (B) Stopped-flow UV- Vis traces of the reaction of 50 μM Cu-L1 with 50 μ M nitrocefin at 10 oC. The absorbance at 485 nm is due to the product, the absorbance at 390 nm is due to the substrate, and the absorbance at 665 nm is due to the intermediate.

136

first 0.05 seconds of the reaction and a relatively slower regain of fluorescence over the subsequent 1 second (Figure 5.5A). A similar stopped-flow fluorescence progress curve was observed with ZnZn-L1, and the fluorescence changes were attributed to changes in

the fluorescence properties of Trp38 (21, 22), which is close to the metal ion in the Zn2 site, upon substrate binding. The stopped flow fluorescence curve strongly indicates that Cu(II) in Cu-L1 plays a similar role as Zn(II) in the native enzyme. Stopped-flow UV- Vis studies on Cu-L1 showed a rapid decrease in substrate concentration (rate = 3.6 + 0.1 s-1), and a rapid formation of product (rate = 2.6 + 0.1 s-1), which matched the fluorescence recovery (2.8 + 0.1 s-1). The rate of intermediate decay (rate = 1.0 + 0.1 s-1) was slower than the rate of product formation. The rapid kinetic studies also revealed the presence of significant amounts of reaction intermediate, which absorbs at 665 nm. However, the intermediate in the reaction of Cu-L1 with nitrocefin was only 15% of that observed for ZnZn-L1The pre-steady state kinetic behavior of Ni-L1, which contains 1 equivalent of Ni(II) and 0.3 equivalent of Zn(II), was unusual. The substrate depletion progress curve showed a very rapid decrease in absorbance over the first 20 milliseconds of the reaction, followed by a linear decrease in absorbance until substrate was depleted (Figure 5.5). The intermediate progress curve showed a rapid increase, a relatively-long presence of intermediate over 600 milliseconds, and a decrease in intermediate concentration. The product formation curve appears to be linear over the first 600 milliseconds of the reaction with no apparent rapid phase like that seen in the substrate decay plot. The stopped-flow UV-Vis plots of ZnNi-L1, which contained 1 eq. of Zn(II) and 1 eq. of Ni(II), were very similar to those of ZnZn-L1. There was a rapid decrease (269 + 20 s-1) in substrate concentration and increase (188 + 1 s-1) in intermediate concentration, and a decrease (15.0 + 0.1 s-1) in intermediate concentration that was similar to that of product formation (15.8 + 0.1 s-1). The stopped-flow fluorescence curve of this analog showed the typical decrease (140 + 3 s-1) in intrinsic tryptophan fluorescence, followed by a slower regain (12.3 + 0.2 s-1) of fluorescence (Figure 5.6).

137

1.0 485 nm (A) 0.8

390 nm 0.6 Absorption 0.4 665 nm

0.2

0.0 0.2 0.4 0.6 0.8 1.0 Time (s)

1.0 485 nm 665 nm 0.8 (B)

0.6

0.4 Absorption 390 nm

0.2

0.0 0.0 0.1 0.2 0.3 0.4 Time (s)

2.8

2.7

2.6 (C) 2.5

2.4

2.3 Fluorescence

2.2

2.1

2.0 0.00 0.05 0.10 0.15 0.20 Time (s) Figure 5.6: Stopped-flow kinetic studies on Ni-containing L1. (A) Stopped-flow UV-Vis traces of the reaction of 50 μM Ni-L1 with 50 μM nitrocefin 10 oC. The absorbance at 485 nm is due to the product, the absorbance at 390 nm is due to the substrate, and the absorbance at 665 nm is due to the intermediate. (B) Stopped-flow UV-Vis traces of the reaction of 50 μM ZnNi-L1 with 50 μM nitrocefin 10 oC. The absorbance at 485 nm is due to the product, the absorbance at 390 nm is due to the substrate, and the absorbance

138

at 665 nm is due to the intermediate. (C) Stopped-flow fluorescence trace of the reaction of 50 μM ZnNi-L1 with 50 μM nitrocefin at 10 oC.

5.4 Discussion Recently, Hu et al. showed that the metallation of Mβl L1 is dependent on the bioavailability of metal ions (12). This study showed that mature L1, which is produced from an over-expression plasmid containing the gene for L1 lacking the targeting sequence, could be isolated containing iron, zinc, or cobalt when the enzyme was over- expressed in minimal medium containing Fe(II), Zn(II), or Co(II), respectively. In an effort to extend this study, we used the same method to demonstrate that L1 containing 1.7 equivalents of Cu(II) or 1.0 equivalents of Ni(II) can be isolated. Our data show that L1 can bind ~ 2 equivalents of Zn(II), Co(II), Cu(II), or Fe, and that the first three dinuclear metal ion-containing analogs are catalytically-active, while the last analog is inactive. Since the EPR spectrum of Fe-containing L1 shows evidence for an antiferromagnetically-coupled Fe(III)Fe(II) center (23), it is possible that Asp120 bridges the two Fe ions and is not available for orienting the bridging solvent molecule for nucleophilic attack or proton transfer (24).

L1 can also bind 1 equivalent of Ni(II) in the Zn2 site, and the Ni(II)-containing analog utilizes the same reaction mechanism as the wild-type enzyme, at least when nitrocefin is used as the substrate. This flexibility of the metal binding sites is unusual; however, there are examples of other metalloenzymes with similar properties. For example, AAP (aminopeptidase from Aeromonas proteolytica), which is an unrelated, dinuclear Zn(II)-containing enzyme, is also active containing dinuclear copper, nickel, and cobalt centers (25-28). In addition, several heterobimetallic analogs (CoZn, etc.) of AAP are active (26, 27). These heterobimetallic forms are possible because of the sequential metal binding properties of the enzyme. In L1, Zn(II) preferentially binds to the Zn1 site, which is made up of 3 histidines and 1 bridging hydroxide, and Co(II) and

Ni(II) preferentially bind to the Zn2 site (Chapter 4). It is not clear from our data which site Cu(II) preferentially binds, since this analog is isolated containing nearly 2 equivalents of Cu(II). A recent crystal structure of a copper-containing analog of L1, which was prepared by soaking apo-L1 with Cu(II) in the presence of phenanthroline,

139

showed that Cu(II) was bound to the Zn1 site (29). The dinuclear Cu(II) center in Cu-L1 is different than that in 2Cu-AAP from spectroscopic studies. Hyperfine-shifted NMR and EPR signals of 2Cu-AAP were observed at a pH of 6.7(28), but disappeared at pH of 8.0, presumably due to the loss of the bridging solvent molecule. Unlike 2Cu-AAP (28), there is likely only one bridging hydroxide linking the two Cu ions in CuCu-L1, resulting in no spin-coupling, which could be detected by EPR, and no paramagnetically-shifted 1H resonances in the NMR studies. However, EPR spectra of 2Fe-L1, prepared by refolding L1 in the presence of Fe(II), did provide evidence for the presence of a spin-coupled Fe(II)Fe(III) center (Chapter 3). As mentioned above, we believe that the spin-coupling in 2Fe-L1 is due to the recruitment of Asp120 as a bridging ligand, and EXAFS studies on this analog are currently in progress to confirm this hypothesis. Importantly, 2Fe-L1 is catalytically inactive. Taken together, we hypothesize that Cu binds to L1 in both Zn(II) binding sites and that there is a single bridging hydroxide in the analog. 1H NMR studies on ZnNi-L1 yielded novel information about product binding to the metal center. The 1H NMR spectra (Figure 5.4 A&B) of Ni-L1, which binds 1 equivalent of Ni(II) and 0.3 equivalents of Zn(II), showed that only two histidines were bound to the paramagnetic metal ion. We cannot unambiguously rule out the possibility

that Ni(II) coordinates one histidine from the Zn1 site and one histidine from the Zn2 site; however, this type of binding mode is unprecedented in studies on L1. In addition, the NMR spectrum of the enzyme-product complex showed that the non-solvent- exchangeable peak (peak b in Figure 5.4) did not shift, suggesting that Ni(II) did not change the binding ligands upon substrate/product binding. The fact that Ni-L1 contains some Zn(II), that Zn(II) can be added to Ni-L1 to generate a more active analog, and that there are only 2 histidines bound to Ni(II) strongly suggests that Ni(II) is bound in the consensus Zn2 site in L1. The NMR spectrum of the enzyme-product complex (Figure 5.4) is the first example of the detection of such a complex using NMR spectroscopy and confirms our previous EPR data (Chapter 4). Peak c in Figure 5.4A and peak c* in Figure 5.4C are shifted downfield to the same position, suggesting similar chemical environments for both protons. The former peak was assigned to a remote NH proton on a Ni(II)-bound histidine. By analogy, we hypothesize that peak c* in Figure 5.4C is due to a NH proton on product (Figure 5.4C).

140

Pre-steady state kinetic studies showed that both Cu-L1 and ZnNi-L1 utilize a similar kinetic mechanism to hydrolyze nitrocefin as ZnZn-L1 and CcrA (Figure 5.5, 5.6) (16, 30). The rate of product formation in Cu-L1 is similar to the rate of fluorescence regain (2.6 and 2.8 s-1, respectively); however, these rates are higher than the rate of intermediate decay (1 s-1), suggesting Cu-L1 may utilize two different pathways to hydrolyze nitrocefin. One pathway, which accounts for 30% of the turnover, utilizes an intermediate, as shown by the species that absorbs at 665 nm in Figure 5.5. The remaining turnover is accomplished through a mechanism in which there is not intermediate formed. The hydrolytic activity of ZnNi-L1 was much higher compared than that of Cu- L1. The rates of substrate depletion and intermediate formation were very high, while the rates of production formation and intermediate decay were >10-fold lower (Figure 5.6). This result suggests that the rate-limiting step of nitrocefin hydrolysis by Ni-L1 is protonation of reaction of intermediate (31). Steady-state kinetic studies on metal-substituted analogs of L1 yielded surprising results, and there are no clear trends evident in the data. The most efficient enzyme, in

terms of kcat/Km, is the ZnZn-analog. There are three analogs that presumably have Zn(II) in the Zn1 site: ZnCo-, ZnFe-, and ZnNi-L1; however, these analogs exhibit significantly different kinetic properties with the substrates tested. ZnCo-L1 exhibits steady-state kinetics constants similar to those of ZnZn-L1 for penicillin G, but the Km values for studies with cefaclor, imipenem, and nitrocefin are much larger. On the other hand,

ZnFe- and ZnNi-L1 do not hydrolyze penicillin G at all, exhibit decreased kcat values

when using cefaclor as substrate, exhibit increased kcat values when using imipenem and

nitrocefin as substrate, and exhibit increased values of Km for all substrates tested. The

metal-substituted analogs with metal ions other than Zn(II) in the Zn1 site (CoCo- and CuCu-L1) exhibit kinetic properties that do not follow any trend. For example, CoCo-L1

hydrolyzes penicillin G with significant kcat and Km values, while CuCu-L1 does not

hydrolyze the same substrate. CoCo- and CuCu-L1 exhibit very large values for kcat for

some substrates; however, the Km values for all tested substrates are also significantly higher. It is not clear why there are no trends in the steady state kinetic data. However, we cannot rule out that some of the enzyme samples contain mixtures of metal centers,

141

since the concentration of adventitious Zn(II) in the assay buffers is ca. 100 nM, while the enzyme concentration in the same assays is 10 nM. We can rule out that the different analogs utilize a different reaction mechanism, as all of the metal-substituted analogs shown in Table 5.2 utilize a reaction mechanism that contains a ring-opened nitrogen anion, at least when nitrocefin is the substrate. We do not know if the differences can be explained by different metal centers caused by the geometric preference of the specific metal ions. We are currently collaborating with Professor David Tierney to obtain metal- metal distances in all of the metal-substituted analogs. Previous EPR studies on the FeFe- L1 analog suggest a short Fe-Fe distance (chapter 3), which is most likely caused by the recruitment of Asp120 as an additional bridging ligand. To explain the different behaviors of the analogs with different substrates, we have started collaboration with Professor Hua Guo at the University of New Mexico to examine how substrate binds by using computational studies. In addition, we have been working with Dr. Jim Spencer at the University of Bristol, UK to obtain the crystal structure of an enzyme-substrate complex. The results of this work demonstrate further that the metal binding sites, particularly the Zn2 site, in L1 are very flexible and can accommodate a number of different divalent metal ions. This flexibility can possibly offer a competitive advantage to organisms that produce L1 when the organisms are threatened with β-lactam containing antibiotics. The ability of L1to be active containing a number of different metal ions would allow bacteria to survive in environments with limited Zn(II) concentrations.

142

5.5 References 1. Dong, H. K., Dore, M. P., Kim, J. J., Kato, M., Lee, M., Wu, J. Y., and Graham, D. Y. (2003) "High-Level ß-Lactam Resistance Associated with Acquired Multidrug Resistance in Helicobacter pylori," Antimicro. Agents Chemo. 47, 2169-2178. 2. Sykes, R. B., and Georgopapadakou, N. H. (1981) in β-Lactam Antibiotics pp 199-214, Academic Press. 3. Bush, K., Jacoby, G. A., and Medeiros, A. A. (1995) "A Functional Classification Scheme for β-lactmases and Its Correlation with Molecular Structure," Antimicro. Agents Chemo. 39, 1211-1233. 4. Crowder, M. W., Spencer, J., and Vila, A. J. (2006) "Metallo-β-lactamases: Novel weaponry for antibiotic resistance in bacteria," Acc. Chem. Res. 39, 721-728. 5. Bennett, B. (2002) "EPR of Co(II) as a Structural and Mechanistic Probe of Metalloprotein Active Sites: Characterization of an Aminopeptidase," Curr. Topics Biophys. 26, 49-57. 6. Garrity, J. D., Bennett, B., and Crowder, M. W. (2005) "Direct evidence that reaction intermediate in metallo-β-lactamase is metal bound," Biochemistry 44, 1078-1087. 7. Periyannan, G., Costello, A. L., Tierney, D. L., Yang, K. W., Bennett, B., and Crowder, M. W. (2006) "Sequential binding of cobalt(II) to metallo-β-lactamase CcrA," Biochemistry 45, 1313-1320. 8. Llarrull, L. I., Tioni, M. F., Kowalski, J., Bennett, B., and Vila, A. J. (2007) "Evidence for a Dinuclear Active Site in the Metallo-β-lactamase BcII with Substoichiometric Co(II): A new model for metal uptake." J. Biol. Chem. 282, 30586-30595. 9. Crawford, P. A., Yang, K. W., Sharma, N., Bennett, B., and Crowder, M. W. (2005) "Spectroscopic studies on cobalt(II)-substituted metallo-β-lactamase ImiS from Aeromonas veronii bv. sobria," Biochemistry 44, 5168-5176. 10. Concha, N. O., Rasmussen, B. A., Bush, K., and Herzberg, O. (1997) "Crystal Structures of the Cadmium- and Mercury-Substituted Metallo-β-Lactamase from Bacteroides fragilis," Prot. Sci.6, 2671-2676.

143

11. Hemmingsen, L., Damblon, C., Antony, J., Jensen, N., Adolph, H. W., Wommer, S., Roberts, G. C. K., and Bauer, R. (2001) "Dynamics of mononuclear cadmium β-lactamase revealed by the combination of NMR and PAC spectroscopy," J. Am. Chem. Soc. 123, 10329-10335. 12. Hu, Z., Gunasekera, T. S., Spadafora, L., Bennett, B., and Crowder, M. (2008) "Metal Content of Metallo-β-lactamase L1 Is Determined by the Bioavailability of Metal Ions," Biochemistry, In press. 13. Rajagopalan, P. T. R., Grimme, S., and Pei, D. (2000) "Characterization of Cobalt(II)-Substituted Peptide Deformylase: Function of the Metal Ion and the Catalytic Residue Glu-133," Biochemistry 39, 779-790. 14. Periyannan, G., Shaw, P. J., Sigdel, T., and Crowder, M. W. (2004) "In vivo folding of recombinant metallo-β-lactamase L1 requires the presence of Zn(II)," Prot. Sci. 13, 2236-2243. 15. Crowder, M. W., Walsh, T. R., Banovic, L., Pettit, M., and Spencer, J. (1998) "Overexpression, Purification, and Characterization of the Cloned Metallo-β- Lactamase L1 from Stenotrophomonas maltophilia," Antimicro. Agents. Chemo. 42, 921-926. 16. Carenbauer, A. L., Garrity, J. A., Periyannan, G., Yates, R. B., and Crowder, M. W. (2002) "Probing Substrate Binding to Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia by Using Site-Directed Mutagenesis," BMC Biochemistry 3, 4-10. 17. Hirose, J., Ohsaki, T., Nishimoto, N., Matuoka, S., Hiromoto, T., Yoshida, T., Minoura, T., Iwamoto, H., and Fukasawa, K. (2006) "Characterization of the Metal-Binding Site in Aminopeptidase B," Biol. Pharm. Bull. 29, 2378-2382. 18. Bertini, I., Turano, P., and Vila, A. J. (1993) "Nuclear Magnetic Resonance of Paramagnetic Metalloproteins," Chem. Rev. 93, 2833-2932. 19. Ullah, J. H., Walsh, T. R., Taylor, I. A., Emery, D. C., Verma, C. S., Gamblin, S. J., and Spencer, J. (1998) "The crystal structure of the L1 metallo-β-lactamase from Stenotrophomonas maltophilia at 1.7 Å resolution," J. Mol. Biol. 284, 125- 136.

144

20. de Seny, D., Heinz, U., Wommer, S., Kiefer, M., Meyer-Klaucke, W., Galleni, M., Frere, J. M., Bauer, R., and Adolph, H. W. (2001) "Metal ion binding and coordination geometry for wild type and mutants of metallo-β-lactamase from Bacillus cereus 569/H/9 (BcII) - A combined thermodynamic, kinetic, and spectroscopic approach," J. Biol. Chem.276, 45065-45078. 21. Spencer, J., Clark, A. R., and Walsh, T. R. (2001) "Novel Mechanism of Hydrolysis of Therapeutic β-Lactams by Stenotrophomonas maltophilia L1 Metallo-β-Lactamase," J. Biol. Chem. 276, 33638-33644. 22. Garrity, J. D., Pauff, J. M., and Crowder, M. W. (2004) "Probing the dynamics of a mobile loop above the active site of L1, a metallo-β-lactamase from Stenotrophomonas maltophilia, via site-directed mutagenesis and stopped-flow fluorescence spectroscopy," J. Biol. Chem. 279, 39663-39670. 23. Marasinghe, G. P. K., Sander, I. M., Bennett, B., Periyannan, G., Yang, K. W., Makaroff, C. A., and Crowder, M. W. (2005) "Structural studies on a mitochondrial glyoxalase II," J. Biol. Chem. 280, 40668-40675. 24. Garrity, J. D., Carenbauer, A. L., Herron, L. R., and Crowder, M. W. (2004) "Metal Binding Asp-120 in Metallo-β-lactamase L1 from Stenotrophomonas maltophilia Plays a Crucial Role in Catalysis," J. Biol. Chem. 279, 920-927. 25. Bennett, B., and Holz, R. C. (1997) "EPR Studies on the Mono- and Dicobalt(II)- Substituted Forms of the Aminopeptidase from Aeromonas proteolytica. Insight into the Catalytic Mechanism of Dinuclear Hydrolases," J. Am. Chem. Soc. 119, 1923-1933. 26. Bennett, B., and Holz, R. C. (1997) "Spectroscopically Distinct Cobalt(II) Sites in Heterodimetallic Forms of the Aminopeptidase from Aeromonas proteolytica: Characterization of Substrate Binding," Biochemistry 36, 9837-9846. 27. Bennett, B., Antholine, W. E., D'Souza, V. M., Chen, G. J., Ustinyuk, L., and Holz, R. C. (2002) "Structurally distinct active sites in the copper(II)-substituted aminopeptidases from Aeromonas proteolytica and Escherichia coli," J. Am. Chem. Soc. 124, 13025-13034. 28. Holz, R. C., Bennett, B., Chen, G., and Ming, L. J. (1998) "Proton NMR Spectroscopy as a Probe of Dinuclear Copper(II) Active Sites in Metalloproteins.

145

Characterization of the Hyperactive Copper(II)-Substituted Aminopeptidase from Aeromonas proteolytica," J. Am. Chem. Soc. 120, 6329-6335. 29. Nauton, L., Kahn, R., Garau, G., Hernandez, J. F., and Dideberg, O. (2008) "Structural insights into the design of inhibitors for the L1 metallo-β-lactamase from Stenotrophomonas maltophilia," J. Mol. Biol. 375, 257-269. 30. Wang, Z., Fast, W., and Benkovic, S. J. (1998) "Direct Observation of an Enzyme-Bound Intermediate in the Catalytic Cycle of the Metallo-β-Lactamase from Bacteroides fragilis," J. Am. Chem. Soc. 120, 10788. 31. McMannus-Munoz, S., and Crowder, M. W. (1999) "Kinetic Mechanism of Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia," Biochemistry 38, 1547-1553.

146

Chapter 6

Probing the function of the flexible loop in metallo-β-lactamase L1

147

Probing the function of the flexible loop in metallo-β-lactamase L1

Zhenxin Hu,a Brian Bennett,b Daniel M. Freed,c Stephen M. Lukasik,c David S. Cafiso,c Michael W. Crowdera

aDepartment of Chemistry and Biochemistry, 160 Hughes Hall, Miami University, Oxford, OH 45056; bNational Biomedical EPR Center, Department of Biophysics, Medical College of Wisconsin, 8701 Watertown Plank Road, Milwaukee, WI 53226- 0509 cDepartment of Chemistry and Biophysics Program, University of Virginia, Charlottesville, Virginia 22904,

Contributions to this chapter: The preliminary DEER spectra were collected and analyzed by Drs. Freed, Lukasik, and Cafiso. We used Dr. Bennett’s rapid-freeze quench system to obtain the preliminary RFQ-samples. All of the other data were collected and analyzed by Zhenxin Hu.

148

ABSTRACT In an effort to probe the function of the loop above the active site of metallo-β-lactamase L1, several cysteine double mutants were prepared and characterized by steady state kinetics, metal analyses, and fluorescence studies. In order to use these mutants in stopped-flow fluorescence resonance energy transfer (FRET) experiments, the resulting double mutants were successfully labeled with Cy3; however, the Cy3-labeled mutants could not be labeled with the required Cy5 label, presumably due to steric effects. Therefore, the double mutants were labeled with the smaller MTSL spin label, and the resulting labeled mutants were characterized with steady-state kinetics, metal analyses, EPR spectroscopy, and MALDI-TOF mass spectrometry. The doubly spin-labeled T163C/T265C mutant bound 1.7 equivalents of Zn(II), showed similar fluorescence spectra, and retained 90% activity of wild-type L1. Double electron electron resonance (DEER) spectra of this spin-labeled double mutant showed two peaks, representing distance populations of 48 and 30 Å. The former distance was assigned to an intermolecular dipolar coupling between spin labels on different L1 subunits, while the latter spin population is assigned to an intramolecular dipolar coupling between the spin label on the loop (T163C) and the spin label bound away from the loop (T265C). This labeled double mutant was reacted with nitrocefin, and the reaction was freeze quenched after 10 ms. The DEER spectrum of the resulting sample showed three distinct distance distributions at 25, 30, and 38 Å, suggesting that the loop moves 5 Å towards the C- terminus of the protein upon nitrocefin binding. Future studies are required to improve the signal to noise of these spectra and to narrow the DEER peaks; however, this study shows that RFQ-DEER can be used to probe intramolecular motions of an enzyme during catalysis.

149

6.1 Introduction β-Lactam compounds, such as penicillins, cephalosporins, and carbapenems, are usually inexpensive and the most widely-used antibiotics in hospitals (1). However, the increasing β-lactam resistance among different bacteria, especially pathogenic organisms, has resulted in serious concerns that antibiotic resistance will horizontally transfer and generate “superbugs.” There are different mechanisms for bacteria to resist β-lactam antibiotics. The most common strategy involves the secretion of β-lactamases into the milieu of the cell, and these enzymes hydrolyze the C-N bond of conserved β-lactam ring, rendering an inactive product. There are four different classes of β-lactamases: class A, B, C, and D (2, 3), and enzymes in the A, C, and D classes utilize an active site serine as a nucleophile during catalysis and are collectively called serine β-lactamases. Class B enzymes, called metallo-β-lactamases (mβl’s), depend on Zn(II) for hydrolysis (3) Mβl’s are further categorized into three different subgroups, B1, B2, and B3, according to amino acid homologies, amount of Zn(II) required for maximal activity, and substrate preference. There are two metal binding sites for class B1 and B3 mβl’s: the first site

(Zn1) is tetrahredrally-coordinated by 3 histidines and one bridging hydroxide, and the second site (Zn2) is penta-coordinated by 1 histidine, 1 aspartate, 1 cysteine/histidine, one bridging hydroxide, and one terminally-bound water molecule. The enzymes that belong to the B2 subclass have one binding site, which is identical to the Zn2 site of the subclass B1 enzymes. The available crystal structures show that all mβl’s possess an αβ/βα tertiary structure and that the Zn(II) ions bind in the cleft between the two β-sheets (3, 4). In addition, the enzymes in the B1 and B3 subclasses have a flexible loop above the metal binding site, while the B2 mβl’s have a position-conserved α-helix. Recently, Sharma et al. reported that the α-helix in ImiS rotated during substrate binding and turnover, suggesting that that the α-helix plays a role in catalysis (5). Scrofani et al. used NMR spectroscopy to probe the loop in CcrA and reported that the loop flexibility decreased upon inhibitor binding, thereby shielding the Zn(II) ions from solvent molecules (6). Moali et al. generated chimeras of BcII and IMP in which the loops on the enzymes were swapped. The resulting mutants exhibited vastly different kinetic

150

properties, particularly different Km values. These researchers concluded that the loops in the mβl’s play a large role in modulating substrate binding (7). Metallo-β-lactamase L1 is secreted by S. maltophilia, which is an opportunistic pathogenic bacterium (8), and L1 belongs to subclass B3 (9). Mβl L1 is unique because it is tetrameric, while all other mβl’s are monomeric or dimeric. The metal binding sites have been extensively studied by Crowder’s group (10-14), and a large number of kinetic and mechanistic studies have been reported (15, 16). Garrity et al. reported that the flexible loop (from residue 152 to 164 (Figure 6.1)) moves during catalysis at a kinetically-competent rate (17). As mentioned above, there are a few crystal structures of inhibitors/products bound to mβl’s that show that loops/helix moves over the active site (18, 19). However, there is no information available on how the loops move (distance/direction) during substrate binding/catalysis. We proposed to utilize stopped- flow fluorescence (FRET, fluorescence resonance energy transfer) and rapid-freeze quench DEER (double electron electron resonance) spectroscopy along with site-specific labeling to probe how far and what direction the loop in L1 moves during catalysis.

151

Figure 6.1: Crystal structure of Mβl L1. The magenta color balls represent the two Zn(II) ions, and the blue ribbon shows the the flexible loop above active site.

152

6.2 Materials and methods General: E. coli strains DH5α and BL21(DE3)pLysS were purchased from Gibco BRL (Gaithesberg, MD) and Novagen (Madison, WI), respectively. Plasmids pET26b(+) and pUC19 were purchased from Novagen. The QuikChange site-directed mutagenesis kit was purchased from Stratagene. All mutagenic primers were purchased from Integrated DNA Technologies (IDT, Coralville, IA). Polymerase chain reaction (PCR) was performed using a Thermolyne Amplitron II from Barnstead (Dubuque, IA). DNA purification was performed by using a Qiagen Quick Gel Extraction kit (Velencia, CA). A QiaPrep Spin kit from Qiagen was used for small-scale plasmid DNA preparations. Luria-Bertani (LB) medium was purchased from Invitrogen (Carlsbad, CA). Isopropyl-β- D-thiogalactoside (IPTG) was purchased from Anatrace (Maumee, OH). All buffer solutions were prepared using chemicals purchased from Fisher Scientific (Pittsburgh, PA). All buffers and growth media were made with Barnstead NANOpure water. Dialysis tubing was prepared as per Sambrook et al. (20) from Spectro/Por regenerated cellulose, molecular porous membranes with a molecular weight cut off of 10,000 Da (Spectrum Corporation, Gardena, CA). A Fast Protein Liquid Chromatography (FPLC) system, chromatography columns, and resins were purchased from GE Healthcare, formerly Pharmacia Biotech. Nitrocefin was obtained from Becton Dickinson Microbiology System (Cockeysville, MD), and solutions of nitrocefin were prepared as previously described (10). Cy3 and Cy5 (Figure 6.2) were purchased from GE Healthcare. MTSSL (1-oxyl-2,2,5,5-tetramethylpyrolinyl-3-methyl)-methanethiosulfonate) (Figure 6.3) was purchased from Toronto Research, Toronto.

153

- - O3S SO3

N N

O N

O O - O3S -SO3

N N

O N

Figure 6.2: Structures of Cy3 (top) and Cy5 (bottom).

154

Figure 6.3: Scheme of spin labeling reaction of MTSSL and protein.

155

Generation of cysteine mutants of L1 by site-directed mutagenesis: The over-expression plasmids of four X→Cys L1 mutants, D35C, T73C, S153C, D160C, T163C, K287C, T265C, and D296C were constructed using the L1 over-expression plasmid pET26L1 and the QuikChange site-directed mutagenesis kit as per the instructions of the manufacturer. The following primers were used to generate the mutants: D35Cfor 5'- GGG CCT ACA CCG TGT GCG CCT CGT GGC TG -3' D35Crev 5'- CAG CCA CGA GGC GCA CAC GGT GTA GGC CC -3' T73C for 5'- GCG CGT GGC GTG TGC CCT CGG GAT CTG CGG -3' T73Crev 5'- CCG CAG ATC CCG AGG GCA CAC GCC ACG CGC -3' S153Cfor 5'- CTG GCG CGT GGC GGC TGC GAT GAC CTG CAC -3' S153Crev 5'- GTG CAG GTC ATC GCA GCC GCC ACG CGC CAG -3' D160Cfor 5'- CTG CAC TTC GGC TGC GGC ATC ACC TAC CCG -3' D160Crev 5'- CGG GTA GGT GAT GCC GCA GCC GAA GTG CAG -3' T163Cfor 5'- GGC GAT GGC ATC TGC TAC CCG CCT GCC AAT G -3' T163Crev 5'- CAT TGG CAG GCG GGT AGC AGA TGC CAT CGC C -3' K287Cfor 5'- GCC AGG GCC GGT GCC TGC GCA CTG ACC TGC -3' K287Crev 5'- GCA GGT CAG TGC GCA GGC ACC GGC CCT GGC -3' T265Cfor 5'- CTG GCC AAG GAA TGC GCC GGG GCC CGC -3' T265Crev 5'- GCG GGC CCC GGC GCA TTC CTT GGC CAG -3' D296Cfor 5'- GCA AGG CCT ACG CGT GCG CGG CAG AAC AG -3' D296Crev 5'- CTG TTC TGC CGC GCA CGC GTA GGC CTT GC -3' The double mutants D35C/D160C, D160C/K287C, D160C/D296C, T73C/T163C, T163C/K287C, and T163C/T265C were generated by using D160C L1 or T163C L1 as the template and using the same procedure as described to produce the single mutants. The mutants were sequenced, using the ABI3100 DNA sequencer and the BigDye termination sequencing kit. The verified mutated plasmids were transformed into E. coli BL21(DE3)pLysS, and cells containing the plasmids were recovered on LB plates containing 25 μg/mL of chloramphenicol and kanamycin.

156

Over-expression of X→Cys mutants. Large scale preparations of X→Cys L1 mutants were conducted by using the procedure of Crowder et al. (10) with the induction temperature decreased from 37 to 28 °C. Mutated L1 samples were quantitated by monitoring the absorbance at 280 nm and using a molar absorption of 54,600 M-1cm-1 .

Refolding double mutants. Unlike the wild-type enzyme and single point mutants, the double mutants of L1 were not obtained as soluble proteins and were instead isolated as inclusion bodies. After over-expression, the cells were harvested by centrifugation (8,600 xg for 15 minutes) and resuspended in 100 mL of 50 mM Hepes, pH 7.0. The resuspended cells were ruptured by passage through a French press three times at 1500 psi. The lysed cell mixture was centrifuged at 23,400 xg for 25 minutes, and the supernatant was discarded. The pale white inclusion bodies were resuspended in 80 mL of 7 M Gdn-HCl, containing 100 μM Zn(II). After vortexing for 5 minutes, the solution was centrifuged (25 minutes at 23,400 xg) to remove insoluble debris. The supernatant was then dialyzed versus 4 X 1L of 50 mM Hepes, pH 7.0, containing 100 mM NaCl. The dialyzed solution was centrifuged (23,400 xg for 25 minutes) to remove insoluble matter and then concentrated to 4 mL by using an Amicon equipped with a YM-10 membrane. The concentrated protein solution was loaded onto a G-25 size exclusion column (1.5 × 68 cm, bed volume 120 ml). The buffer used in the size exclusion chromatography was 50 mM Hepes, pH 7.0, containing 100 mM NaCl. Fractions containing L1 samples were determined by SDS-PAGE.

Preparation of L1 samples with attached fluorescence dyes. Cy3 (0.3 equivalents) was added to 10 mL of 10 μM refolded T163C/T265C, and the mixture was incubated on ice for 30 minutes. Another 0.3 equivalents of Cy3 was added, and the mixture was incubated on ice for another 30 minutes. A third 0.3 equivalents of Cy3 was added, and the mixture was incubated on ice for 30 minutes. After the third addition of Cy3, the solution was subjected to G-25 chromatography using the same column and buffer used to purify the L1 double mutants. The resulting protein samples were mixed with a 10-fold excess of Cy5, and the mixture was kept at 4 oC overnight. The mixture was run on the G-25 column, as described above, to remove unbound dye. The fractions containing Cy3-

157

and Cy5-labeled protein determined by UV-Vis, according to manufacturer’s

instructions.

Preparation of spin-labeled L1 mutants. L1 mutants (300 μM in 10-15 mL), both single and double mutants, were dialyzed versus 1 L of 50 mM Hepes, pH 7.0, containing 100 mM NaCl. Before the reaction with MTSSL, 1 equivalent of DTT was added to the enzyme samples 30 minutes prior to the addition of MTSSL. A 10 molar excess of MTSSL was dissolved in 50-100 μL of neat dimethyl sulfoxide, and the entire solution of MTSSL was added into DTT-pretreated L1 samples. The spin labeling reaction was carried out in the dark with magnetic stirring overnight at 4 °C

Preparation of magnetic spin diluted L1 mutant samples. Double mutant of L1 (1 mL, 200 μM) was mixed with 1 mL of 800 μM apo-wild-L1, and the mixture was unfolded in 18 mL of 7 M Gdn-HCl, containing 100 μM Zn(II). After incubation on ice for 30 minutes, the resulting mixture (20 mL) was dialyzed versus 4 X 1L of 50 mM Hepes, pH 7.0, containing 100 mM NaCl. The refolded protein was centrifuged (23,400 x g; 25 minutes) to remove any insoluble species. The refolded, magnetically-diluted double mutants of L1 were labeled with MTSSL using the procedure described above.

Steady state kinetic studies. All steady state kinetic studies were conducted on an Agilent 8453 UV-Vis diode array spectrophotometer at 25 °C using nitrocefin as substrate and 50 mM cacodylate, pH 7.0, as the buffer. Steady-state kinetic parameters, the Michaelis

constant Km and the turnover number kcat, were determined by monitoring product formation as previously reported (15). The rate of change in the absorbance at 485 nm was converted into the rate of change in the concentration of product by dividing the

158

(path length = 1 cm) absorbance by the extinction coefficient of the product, 17,420 M- 1cm-1.

Fluorescence spectra of mutants of L1. A Perkin-Elmer LS55 Luminescence spectrometer, tuned to an excitation wavelength of 295 nm and emission wavelength of 340 nm with a slit width of 5 nm, was used to monitor fluorescence emission intensities of the proteins. A 4 mm quartz cuvette was used, and the protein concentrations were 1 μM. Chelex-treated 50 mM Hepes, pH 7.0, was used as a buffer blank.

Preparation of rapid-freeze quench EPR samples. Double spin-labeled mutants of L1 (50 μM), T73C/T163C, T163C/K287C, T163C/T265C, in 50 mM Hepes, pH 7.0, containing 20% glycerol, were reacted with 150 μM nitrocefin in 50 mM cacodylate, pH 7.0, containing 20% glycerol at 3 ± 1 °C. The samples were freeze-quenched using an Update Instruments systems, as previously described (5, 21), in 4 mm outer diameter quartz EPR tubes.

Continuous-wave EPR studies: Low temperature EPR spectroscopy was carried out using a Bruker EleXsys E600 spectrometer equipped with an Oxford Instruments ITC4 liquid helium flow system and a 90 dB dynamic range microwave bridge for low power measurements. Ambient temperature EPR spectroscopy (25 ± 1 °C) was carried out using a Bruker EMX spectrometer equipped with a flat cell and nitrogen flow temperature control. Recording parameters for individual spectra are given in the figure legends.

Double electron-electron resonance (DEER) studies. The measurements were conducted on a Bruker Elexsys 580 Pulse EPR Spectrometer equipped with a MD-5 5mm dielectric resonator. The four-pulse DEER sequence was used with pulse lengths of 16 ns (90 deg.) and 32 ns (180 deg.), and a dipolar evolution time of 1200 ns. The DEER frequency was chosen as the center peak of the absorption spectrum and the observation frequency at the low-field peak of the absorption spectrum (Figure 6.4). The temperature was 80 K.

159

Observe Echo π/2 π π

τ1 τ1 τ2 τ2 π

t Pump (ν2) Echo

ν2

ν1

Figure 6.4: Scheme of four pulse DEER. (Top) Four pulse of DEER; (bottom)

Absorption EPR, ν1 and ν2 are frequencies used in DEER.

160

6.3 Results Determination of where to introduce cysteine residues in L1. In order to use FRET studies to probe for intramolecular motions, L1 must be site-specifically labeled with a donor molecule at one position and an acceptor molecule at a distant position (22). There are several ways to site-specifically label a protein; however, we opted to label L1 by introducing Cys residues at specific sites in the protein. Wild-type L1 has 2 cysteines (Cys256 and Cys284) that form a disulfide bond that is 17.5 Å from the active site. Since the Cys residues are involved in a disulfide bond, we did not believe that these residues would be available to react with our FRET labels. Nonetheless, we reacted wild-type L1 with a small spin label, MTSL, which reacts with free cysteines, and none of the enzyme was labeled (Dr. Ke-Wu Yang, unpublished results). Another issue with labeling one protein with 2 different labels is obtaining mixtures of differentially-labeled enzyme (i.e., donor molecule at site 1, donor molecule at site 2, or donor molecule at both sites). However, Benkovic and coworkers have recently relied on differential reactivities of Cys residues in different parts of the enzyme to govern site-specific labeling using FRET labels (23). For the proposed FRET studies, we introduced a cysteine on the loop at three different positions (S153C, D160, or T163C) to attach a FRET label. The other point mutation was made by identifying sites that were ca. 30 Å from the loop and in a part of the protein that was relatively rigid (residues on α-helix or β-sheet).

Over-expression, purification, and characterization of single and double mutants of L1. By using the Stratagene site-directed mutagenesis kit, eight X to C single mutants and six double mutants of L1 were generated, and the DNA sequence of each mutant was verified by sequencing. All of these mutated plasmids were then transformed into E. coli BL21(DE3)pLysS. Small scale cultures were used to demonstrate that all mutants could be over-expressed in high yields. Unfortunately, only seven of the single mutants were isolated as soluble proteins after using the over-expression and purification protocol described in Materials and Methods. The seven single mutants (D35C, T73C, S153C, D160C, T163C, K287C, and T265C), which were soluble after purification, were over-expressed, purified, and characterized by steady state kinetics, metal analyses, and fluorescence spectra. The three

161

mutants (S153C, D160C, and T163C) were designed to introduce a cysteine on the flexible loop of L1. All three mutants were shown to bind ~2 equivalents of Zn(II);

however, only the T163C mutant exhibited kcat values similar to that exhibited by wild- type L1 (Table 6.1). Therefore, we decided to use the T163C mutant in our efforts to prepare a double FRET-labeled mutant of L1 (see below). All of the other soluble, single mutants bound ~ 2 equivalents of Zn(II), except the K287C mutant (Table 6.1). These -1 mutants exhibited kcat values ranging from 13 to 29 s and Km values ranging from 0.5 to 5 μM, when using nitrocefin as substrate. The fluorescence spectra were obtained to ascertain whether the point mutations caused changes in the tertiary structures of the mutants (24). The fluorescence spectra of the T163C mutants were similar to that of wild- type L1 (Figure 6.5). In order to generate the double mutants, the gene for the T163C single mutant was used as the template in site-directed mutagenesis studies, and cysteines at sites ca. 30 Å away from T163C were introduced. None of the double mutants (or the single mutant D296C) was soluble if over-expressed and purified as described in Materials and Methods. Efforts to improve the solubility of these mutants involved lowering the over- expression temperature to 15 oC or reducing the IPTG concentration to 0.1 mM; however, none of the modifications improved the solubility of the mutants. Since the K287C mutant was soluble and active and Lys287 is very close to Asp296, we decided not to continue efforts to solubilize the D296C mutant. To solubilize the double mutants, the T73C/T163C, T163C/K287C, and T163C/T265C mutants were over-expressed as described in Materials and Methods. These mutants were processed as inclusion bodies; therefore, we used Gdn-HCl to unfold the mutants and dialysis to solubilize the resulting enzymes (see procedure in Materials and Methods). The solubilized double mutants were shown to bind ~ 2 equivalents of Zn(II) and to exhibit steady-state kinetic constants similar to those exhibited by wild-type L1 (Table 6.1). The double mutants exhibited a maximal fluorescence emission at 360 nm (Figure 6.5), which is similar to that observed for wild-type L1 (14, 25), however, these mutants also exhibited a relatively sharp peak between 400-500 nm, which is unlikely due to the misfolding of the protein, and it is not clear what is giving rise to these sharp peaks in the fluorescence emission spectra.

162

Table 6.1: Steady-state kinetics and metal analyses of L1 mutants.

-1 Species kcat (s ) Km (μM) Metal content (eq)

Wild-type L1 41 ± 1 4 ± 1 1.9 ± 0.1

D35C 18 ± 1 5 ± 1 2.1 ± 0.1

T73C 29 ± 2 4 ± 1 1.7 ± 0.1

S153C 13 ± 1 2.3 ± 0.2 2.0 ± 0.1

5.5 ± 0.5 7 ± 1 2.0 ± 0.1 D160C

T163C 40 ± 2 11 ± 2 1.7 ± 0.1

K287C 27 ± 1 3.0 ± 0.3 1.3 ± 0.1

T265C 13 ± 0.3 0.5 ± 0.1 1.7 ± 0.1

T73C/T163C 14 ± 1 3.3 ± 0.3 1.7 ± 0.1

T163C/K287C 21 ± 1 3.7 ± 0.5 1.7 ± 0.1

T163C/T265C 23 ± 2 5 ± 1 1.8 ± 0.1

Nitrocefin was the substrate, and the buffer was 50 mM cacodylate, pH 7.0, with 100 μM Zn(II), at 25 °C

163

(A)

Wavelength (nm)

(B)

Wavelength (nm)

140 (C) 120

100

Fluorescence Intensity Fluorescence 40

0 300 350 400 450 500 550 Wavelength (nm) Figure 6.5: Fluorescence spectra of mutants. (A)T163C; (B) refolded T73C/T163C; and (C) T73C/T163C L1 analogs. The enzyme concentration was 1 μM enzyme, and the buffer was 50 mM Hepes buffer, pH 7.0.

164

Attachment of fluorescence dyes to L1 mutants. To attach the FRET labels to the double mutants of L1, we utilizes a procedure similar to one used previously by Benkovic and coworkers. The Cy3 FRET labeled was introduced in 3 equal amounts, and each label/enzyme mixture was allowed to incubate on ice for 30 minutes. Unbound Cy3 was removed from labeled L1 by using G-25 chromatography. The eluted labeled protein was pink, and this protein was then allowed to incubate with the second FRET label, Cy5. However, the color of the pink protein did not change upon incubation, and the protein remained pink after a second G-25 chromatography step. This result suggested that Cy5 was not binding to the protein. We attempted several other approaches to obtain a double FRET-labeled protein; however, none of the attempts were successful.

Preparation and characterization of spin-labeled mutants of L1. Since we were unsuccessful at obtaining L1 with FRET donor/acceptor molecules attached, we attempted to attach spin labels to the double Cys mutants described above. To prepare the double spin-labeled T163C/T265C analog of L1, we reacted a 10-fold molar excess of MTSSL with the double mutant and allowed the mixture to incubate overnight at 4 oC in the dark. Unbound MTSSL was removed from the enzyme by G25 chromatography, and the fractions containing L1 were identified by UV-Vis and SDS-PAGE. The other double mutants and the T163C single mutant were labeled using the same approach. To ascertain whether the spin labels affected the activity of L1, the spin-labeled T163C and T163C/T265C analogs were analyzed with steady-state kinetics (Table 6.2).

All of the spin-labeled analogs exhibited kcat values similar to that exhibited by wild-type

L1, and importantly, the double spin-labeled analog, T163C/T265C, exhibited kcat and Km values similar to those of wild-type L1. MALDI-TOF mass spectrometry was used to ascertain that T163C and T265C were the sites that were spin-labeled (Figure 6.6). The T163C/T265C analog was digested with trypsin and subjected to MALDI-TOF MS. Fourteen peaks were identified, including peaks at 2176.23 m/z (corresponding to fragment R G G S D D L H F G D G I C Y P P A N A D) and 2494.39 m/z (corresponding to fragment R A L P C D V L L T P H P G A S N W D Y A A G A), which are due to the fragments that contain the two introduced cysteines. The double spin-labeled T163C/T265C analog was then digested with trypsin and subjected to

165

MALDI-TOF MS. Two new fragments, 2361.23 m/z and 2679.45 m/z, which are 185 m/z larger than the fragments containing the introduced cysteines (the molecular weight of the MTSL-derived label is 185 amu (Figure 6.6)). The EPR spectrum of double spin-labeled T163C/T265C was collected, and free MTSSL was used as control (Figure 6.7). Three peaks, corresponding to the hyperfine splitting of 14N with the unpaired electron, were observed in spectra of free MTSSL and the double spin-labeled T163C/T265C mutant. The linewidths of the spin-labeled mutant were much broader than those of the free spin label, due to the slower relative rotation of the spin label when bound to a large macromolecule.

Preliminary DEER and RFQ-DEER spectra. The steady-state kinetic, MALDI-TOF MS, and cw EPR data strongly indicate that the double spin-labeled T163C/T265C analog is active and has site-specific spin labels; therefore, we analyzed the analog with DEER spectra. The DEER spectrum of the resting, double spin-labeled T163C/T265C analog was first obtained, and the echo (time domain) spectrum is shown in Figure 6.8 (top). The echo is very noisy, and there is no evidence of a discrete sine wave, suggesting that spin modulation relaxation exists (26). The data were fitted to a distance distribution (line in Figure 6.8 (top)), and the simulated line was Fourier-transformed to yield the distance domain spectrum shown in Figure 6.8 (bottom). Two discrete distance distributions were evident: a broad signal centered at 30 Å and a narrower signal at 49 Å. The DEER spectrum of a rapid-freeze quench sample of the double spin-labeled T163C/T265C analog reacted with nitrocefin for 10 ms was obtained (Figure 6.9). The time domain spectrum was very noisy, possibly due to the dilution of the sample during the freeze quench process. The data were fitted to a distance distribution, and the simulated time domain data were Fourier-transformed to yield the distance domain spectrum. This spectrum showed three discrete peaks: a broad peak at 24 Å, a small peak at 30 Å, and a broad peak at 38 Å.

166

a.i. 1900 1800

1700

1600

1500 1400 1300 1200 1100 1000 900

800

700

600 500 400 300 200 100 0 1300 1800 2300 m/z

Figure 6.6: MALDI-TOF MS of double spin-labeled T163C/T265C. Red arrows show one fragment with and without the spin label and the blue arrows show the other pair.

167

Table 6.2: Steady state kinetic data with spin-labeled analogs of L1.

-1 Mutants kcat (s ) Km (μM)

T163C 32 ± 1 24 ± 3

T163C/T265C 37 ± 5 6 ± 2

Nitrocefin was the substrate, and the buffer was 50 mM cacodylate, pH 7.0, containing 100 μM Zn(II) 25°C.

168

(A)

6000

4000 (B)

2000

0 Intensity -2000

-4000

-6000 3320 3340 3360 3380 3400 3420 Magnetic Field (G) Figure 6.7: EPR spectra of double spin-labeled L1 mutant. (A) free MTSSL and (B) MTSSL- labeled T163C/T265C. Spectra were recorded at 25 ± 1 °C, 9.395 GHz, 1 mW microwave power, and 0.1 mT (1 G) field modulation at 100 kHz.

169

Figure 6.8: DEER spectra of resting double spin-labeled L1 mutant. (Top) Time domain spectrum and (Bottom) distance domain spectrum. The mutant concentration was 200 μM, and the sample contained 20% glycerol. The data were fitted with DEER2006 software.

170

1.00

0.98

0.96

0.94

0.92

V(t)/V(o) 0.90

0.88

0.86

0.84 0.0 0.2 0.4 0.6 0.8 1.0 Time (μs)

0.05

0.04

0.03 P(r) 0.02

0.01

0.00 2345678 r (nm) Figure 6.9: DEER spectrum of T163C/T265C rapid freeze quenched with nitrocefin. (Top) Time domain spectrum and (Bottom) distance domain spectrum. The mutant concentration before RFQ was 200 μM enzyme containing 20% glycerol, and the substrate concentration before RFQ was 300 μM nitrocefin. The data were fitted with DEER2006 software.

171

6.4 Discussion Protein dynamics, particular those probing the interaction of portions of the enzyme with substrate, are important for the understanding of how enzymes work. One excellent, albeit uncommon, way to probe such interactions is to trap different enzyme-substrate complexes and to solve the crystal structures of each of the distinct species along the catalytic pathway. A remarkable example of this approach is the relatively recent report on cytochrome P450 that showed the crystal structures of 4 discrete enzyme-substrate/intermediate/product species (27). Unfortunately, this approach has only been successful with a few enzymes, particularly those that utilize intermediates that are stable enough to be trapped or that have multiple substrates. A more commonly used, although not as informative, approach is fluorescence spectroscopy. The simplest experiment in this approach utilizes intrinsic fluorescence changes, usually from tryptophans in the enzyme, and the monitoring of these changes with a stopped-flow fluorescence instrument as the enzyme is reacted with substrate. The technique is limited by not knowing which tryptophan in an enzyme is causing the fluorescence change; however, Garrity et al. reported a procedure to attribute an observed fluorescence change to a single tryptophan(17). Unfortunately, only the rate of fluorescence change can be determined, and very little information about changes in structure can be extracted with this approach Fluorescence Resonance Energy Transfer (FRET) is a technique in enzymology to study specific residue movements during enzyme catalysis or during binding events (28-30). In FRET, the fluorescence donor and acceptor (such as Cy3 and Cy5, Figure 6.2) are site-specifically bound to introduced cysteine residues, and the energy transfer efficiency is measured and converted to distance. By comparing the distance of donor/acceptor in the resting enzyme and the distance in enzyme during the reaction during catalysis, it is possible to probe domain movements during the catalytic reaction. The reaction of enzyme and substrate is monitored with stopped-flow fluorescence, and well-established calculations can lead to distance measurements between domains in the enzyme during catalysis. Practically, FRET is used to probe distances between 10 and 75 Å (22). Therefore, our initial approach to study loop dynamics in L1 was FRET. We reasoned that the positioning of a donor molecule on the loop and an acceptor molecule on a relatively rigid portion of the enzyme, as determined by X-ray crystallographic B factors, would allow for us to monitor a distance change between the loop and the rest of the

172

enzyme as substrate binds, and the enzyme-substrate complex proceeds through catalysis. Additionally, we reasoned that the choice of two additional donor/acceptor pairs on the loop and relatively rigid portions of the enzyme would allow for us to “triangulate” the movement of the loop and obtain a 3D picture of how the loop moves during catalysis. The crystal structures of resting enzymes and enzyme-inhibitor complexes have previously showed that the loops in pig pancreatic α-amylase move 6 and 2 Å (31). We acknowledged going into this project that distance changes of this magnitude would be difficult to discern, given the errors in distance measurements associated with FRET, based on the flexibility of the linker groups on the dyes. However, we believed that loop movements in the enzyme as it proceeds through catalysis would be larger than those in Mβl enzyme-product/inhibitor complexes if the prediction that the loop “clamps” down on substrate during catalysis to activate the substrate is valid (6). Therefore, we prepared single and double cysteine mutants of L1 by using site-directed mutagenesis. We chose the mutations, T73C, T163C, K287C, and T265C due to the following considerations: (1) all these amino acids are solvent-exposable, (2) the amino acids are > 10 Å away from the active site, and (3) cysteine is good replacement for threonine to retain secondary and tertiary structure (in the case of three of the mutants). The single mutants were characterized with steady-state kinetics, metal analyses, and fluorescence spectroscopy; and the data showed that the activity/structure of the enzyme did not change appreciably with the point mutations. We chose to prepare the T73C/T163C, T163C/K285C, and T163C/T265C double mutants because the distances between the labeled residues were around 30 Å (Figure 6.10), which is in the optimal FRET detection range (22). Unfortunately, the double mutants were insoluble using a number of over-expression and purification protocols. We overcame this hurdle by folding the double mutants from inclusion bodies in the presence of Zn(II), and steady-state kinetics, metal analyses, and fluorescence spectroscopic studies indicate that the three double mutants are folded correctly, are catalytically-active, and could be used for the proposed FRET experiments. All three double mutants were successfully labeled with Cy3, as determined by UV-Vis spectra of the proteins after column chromatography. However, repeated attempts to label the Cy3-labeled, double mutants with Cy5 were unsuccessful. We believe that all of the double mutants were labeled at the non-loop site and that steric issues prevented the labeling of the T163C site (Figure 6.11). We explored the option of using different FRET donor/acceptor

173

K287

T265

T163

T73

Figure 6.10: Sites on L1 where labels were attached.

174

pairs, but all of the FRET pairs are sterically-bulky and have long tethers. In addition, there are relatively few FRET pairs that are water soluble and allow for site-specific binding using introduced Cys residues. Therefore, we decided to try another approach to probe intramolecular motions during catalysis. Therefore, we chose to utilize DEER experiments to probe loop dynamics in L1. Double electron electron resonance (DEER) spectroscopy can be used to measure dipolar coupling between spin radicals, which have been site-specifically introduced on the protein via cysteine residues. The distance between the spin radicals can be determined by well-known fitting algorithms, and DEER has been used to determine spin-spin distances up to 75 Å. Unlike FRET studies, DEER measurements are made at low temperatures, and therefore, the most common distance measurements are made on static systems. To probe loop dynamics in our case, we proposed to couple DEER with rapid-freeze quench methodologies to measure distances at discrete time periods after the reaction of enzyme and substrate. This approach, to our knowledge, is unprecedented and has the potential to be used in a large number of other enzyme systems. We were fortunate in that DEER, like FRET, requires site-specific labeling of the enzyme and that there is a common spin label called MTSSL, which utilizes introduced cysteine residues to label the enzyme. An added advantage of DEER is that we would be using a smaller label (see Figure 6.3) and that we can label both positions in the double mutant with the same label, eliminating the complication of mixtures of differently labeled protein. Therefore, the mutants generated for the failed FRET experiments could also be used in the subsequent DEER experiments. MALDI-TOF MS and CW EPR demonstrated that a double spin-labeled analog of L1 could be prepared, and steady-state kinetics and metal analyses showed that the labeled enzyme was active and contained the same metal content as wild-type L1. DEER spectra of the resting form of the double spin-labeled enzyme were noisy and revealed very wide distance distributions for the distance domain spectra. One reason for these very wide distance distributions is that L1 is tetrameric in solution. If we examine the tetrameric structure of L1 and all of the possible spin- spin interactions, there are 10 possible dipolar interactions (Table 6.3). In fact, a preliminary interpretation of the DEER spectra of the T163C/T265C labeled enzyme in Figure 6.8 is that the peak at 38 Å is most likely due to the intermolecular interaction between T265C on subunit A

175

Figure 6.11: Thr163 in tetrameric L1. The differently colored threonine residues are from different subunits of the tetramer.

176

and T265C on subunit C. The peak at 30 Å is tentatively assigned to the desired intramolecular interaction between T163C and T265C in each subunit; however, we cannot rule out the possibility that the intermolecular interaction between T163C in subunit B and T265C in subunit C contribute to this peak. The broadness of the peak may be due to the flexibility of the linker in MTTSL, which in the frozen state, can adopt a number of orientations and discrete distances. This averaging of distances can lead to a broadened peak in the distance domain spectrum. One last thing that contributes to the broad distance distributions is how the data are fitted. We attempted to fit the time domain data using several different algorithms. Fortunately, we found that the distances determined from all of the methods are very similar; however, the distance distributions can change significantly when different fitting algorithms are used. This issue is a significant one with the use of DEER in determining distances and is one that must be addressed by the EPR community if DEER is to be used as a method to rival FRET. Nonetheless, we prepared a rapid freeze quench sample of double spin-labeled T163C/T265C mutant when mixed with nitrocefin for 10 ms. The resulting distance domain DEER spectrum showed that the peak at 38 Å, which we assigned to the intermolecular interaction T265C between subunit A and C is still present. There is also a small peak at 30 Å, which we tentatively assigned to the intramolecular, dipolar interaction between spin labels at T163C and T265C. There is also a new peak/shoulder at 25 Å, which we assign to the “moved” loop during catalysis. The presence of the peak at 30 Å suggests that not all of the active sites in the tetramer are loaded with substrate. These preliminary data provide a proof of concept that DEER can be used to probe intramolecular interactions during catalysis; however, a great deal of work/controls are required to definitively establish this point. The noisy data of the RFQ sample cast doubt on whether the peak at 30 Å is real. Efforts will have to be made to simplify the DEER spectra. One way to accomplish this task is to eliminate all peaks associated with intermolecular, dipolar interactions. Previous work by our group demonstrated that a single point mutant, M140D (12), is monomeric in solution, and site specific spin labels could be introduced into this analog. However, this mutant was shown to exhibit very high values for Km, suggesting that this double spin-labeled analog could not be saturated with substrate. Another approach involves the use of magnetic dilution. We have mixed the double mutant (T163C/T265C) and wild-type L1 in a 1:4 ratio, and unfolded/refolded the enzyme. Statistically, the resulting tetramer should contain less than one subunit of double mutant. Therefore, the incorporation of spin-label

177

Table 6.3: Possible dipolar couplings in the T163/T265 double mutant of tetrameric L1.

Residue Distance Subunit

30.0 Å T163-T265 Within the same unit

36.6 Å T163-T265 B-A

41.3 Å T163-T265 B-C

54.5 Å T163-T265 B-D

46.3 Å T163-T163 B-A

70.0 Å T163-T163 B-D

77.3 Å T163-T163 B-C

5.9 Å T265-T265 B-D

35.3 Å T265-T265 B-C

33.7 Å T265-T265 B-A

178

to this heterotetramer would result in only one subunit containing spin-labels.If our preliminary assignments are correct, the DEER spectrum of this sample would only have the peak at 30 Å. In addition, the peak at 30 Å would be sharper if any intermolecular interactions contributed to the peak at 30 Å. Our first attempt at preparing this sample was successful; however, the DEER spectrum showed that the sample was too dilute to obtain a strong enough signal after 8 hours of signal averaging. The optimization of mixing is required to prepare a sample that is concentrated enough to obtain sufficiently intense signals. Another way to narrow the distance distribution in the distance domain spectra is to use a modified tyrosine-based spin label, which has constrained rotation (32). This work demonstrates that the use of RFQ-DEER to probe intramolecular motions of an enzyme during catalysis is possible. Once this technique is optimized, it can be used to probe similar motions in an unlimited number of enzymes. Our ability to spin-label L1 also opens the possibility to probe the catalytic mechanism of this enzyme using DEER and other pulsed EPR techniques. For example, our data show that we can generate analogs of L1 with a single spin label. We can use rapid-freeze studies on the reaction of this singly-labeled enzyme with a substrate that contains a spin label, such as spin-labeled penicillin (Figure 6.12) reported by Professor Marvin Makinen at the University of Chichago (33). We have obtained this substrate, and studies to map enzyme-substrate distance during catalysis are under way.

6.5 Acknowledgment: The authors would like to thank Aleksey Pisarenko for his assistance in obtaining the MALDI-TOF MS data.

179

H N S

ON N O . O COO-

Figure 6.12: Structure of spin-labeled penicillin (SLPEN).

180

6.6 References:

1. Jacobs, F. (1985) Breakthrough: The True Story of Penicillin, Dodd, Mead & Company, New York. 2. Walsh, T. R., Toleman, M. A., Poirel, L., and Nordmann, P. (2005) "Metallo-β- lactamases: the quiet before the storm?," Clin. Microbiol. Rev. 18, 306-325. 3. Crowder, M. W., Spencer, J., and Vila, A. J. (2006) "Metallo-β-lactamases: Novel weaponry for antibiotic resistance in bacteria," Acc. Chem. Res. 39, 721-728. 4. Heinz, U., and Adolph, H. W. (2004) "Metallo-β-lactamases: two binding sites for one catalytic metal ion?," CMLS, Cell. Mol. Life Sci. 61, 2827-2839. 5. Sharma, N., Hu, Z., Crowder, M. W., and Bennett, B. (2008) "Conformational Changes in the Metallo-β-lactamase ImiS During the Catalytic Reaction: An EPR Spectrokinetic Study of Co(II)-Spin Label Interactions," J. Am. Chem. Soc. 130, 8215-8222. 6. Scrofani, S. D. B., Chung, J., Huntley, J. J. A., Benkovic, S. J., Wright, P. E., and Dyson, H. J. (1999) "NMR Characterization of the Metallo-β-lactamase from Bacteroides fragilis and Its Interaction with a Tight-Binding Inhibitor: Role of an Active-Site Loop," Biochemistry 38, 14507-14514. 7. Moali, C., Anne, C., Lamotte-Brasseur, J., Groslambert, S., Devreese, B., Van Beeumen, J., Galleni, M., and Frere, J. M. (2003) "Analysis of the importance of the metallo-β- lactamase active site loop in substrate binding and catalysis," Chem. Biol. 10, 319-329. 8. Saino, Y., Kobayashi, F., Inoue, M., and Mitsuhashi, S. (1982) "Purification and Properties of Inducible Penicillin β-Lactamase Isolated from Pseudomonas maltophilia," Antimicro. Agents Chemo. 22, 564-570. 9. Bush, K., Jacoby, G. A., and Medeiros, A. A. (1995) "A Functional Classification Scheme for β-lactmases and Its Correlation with Molecular Structure," Antimicro. Agents Chemo. 39, 1211-1233. 10. Crowder, M. W., Walsh, T. R., Banovic, L., Pettit, M., and Spencer, J. (1998) "Overexpression, Purification, and Characterization of the Cloned Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia," Antimicro. Agents Chemo. 42, 921-926.

181

11. Carenbauer, A. L., Garrity, J. A., Periyannan, G., Yates, R. B., and Crowder, M. W. (2002) "Probing Substrate Binding to Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia by Using Site-Directed Mutagenesis," BMC Biochemistry 3, 4-10. 12. Simm, A. M., Higgins, C. S., Carenbauer, A. L., Crowder, M. W., Bateson, J. H., Bennett, P. M., Clarke, A. R., Halford, S. E., and Walsh, T. R. (2002) "Characterization of Monomeric L1 Metallo-β-lactamase and the Role of the N-terminal Extension in Negative Cooperativity and Antibiotic Hydrolysis," J. Biol. Chem. 277, 24744-24752. 13. Garrity, J. D., Carenbauer, A. L., Herron, L. R., and Crowder, M. W. (2004) "Metal Binding Asp-120 in Metallo-β-lactamase L1 from Stenotrophomonas maltophilia Plays a Crucial Role in Catalysis," J. Biol. Chem. 279, 920-927. 14. Periyannan, G., Shaw, P. J., Sigdel, T., and Crowder, M. W. (2004) "In vivo folding of recombinant metallo-β-lactamase L1 requires the presence of Zn(II)," Prot. Sci. 13, 2236- 2243. 15. McMannus-Munoz, S., and Crowder, M. W. (1999) "Kinetic Mechanism of Metallo-β- Lactamase L1 from Stenotrophomonas maltophilia," Biochemistry 38, 1547-1553. 16. Spencer, J., Clark, A. R., and Walsh, T. R. (2001) "Novel Mechanism of Hydrolysis of Therapeutic β-Lactams by Stenotrophomonas maltophilia L1 Metallo-β-Lactamase," J. Biol. Chem. 276, 33638-33644. 17. Garrity, J. D., Pauff, J. M., and Crowder, M. W. (2004) "Probing the dynamics of a mobile loop above the active site of L1, a metallo-β-lactamase from Stenotrophomonas maltophilia, via site-directed mutagenesis and stopped-flow fluorescence spectroscopy," J. Biol. Chem. 279, 39663-39670. 18. Spencer, J., Read, J., Sessions, R. B., Howell, S., Blackburn, G. M., and Gamblin, S. J. (2005) "Antibiotic recognition by binuclear metallo-β-lactamases revealed by X-ray crystallography," J. Am. Chem. Soc. 127, 14439-14444. 19. Garau, G., Bebrone, C., Anne, C., Galleni, M., Frere, J. M., and Dideberg, O. (2005) "A metallo-β-lactamase enzyme in action: crystal structure of the monozinc carbapenemase CphA and its complex with biapenem," J. Mol. Biol. 345, 785-795. 20. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning - A Laboratory Manual, Vol. 1, Second ed., Cold Spring Harbor Laboratory Press.

182

21. Garrity, J. D., Bennett, B., and Crowder, M. W. (2005) "Direct evidence that reaction intermediate in metallo-β-lactamase is metal bound," Biochemistry 44, 1078-1087. 22. dos Remedios, C., and Moens, P. (1995) "Fluorescence Resonance Energy Transfer Spectroscopy Is a Reliable "Ruler" for Measuring Structural Changes in Proteins Dispelling the Problem of the Unknown Orientation Factor," J. Struct. Biol. 115, 175- 185. 23. Antikainen, N., Smiley, D., Benkovic, S., and Hammes, G. (2005) "Conformation Coupled Enzyme Catalysis: Single-Molecule and Transient Kinetics Investigation of Dihydrofolate Reductase," Biochemistry 44, 16835-16843. 24. Zang, T. M., Hollman, D. A., Crawford, P. A., Crowder, M. W., and Makaroff, C. A. (2001) "Arabidopsis Glyoxalase II Contains a Zinc/Iron Binuclear Metal Center That Is Essential for Substrate Binding and Catalysis," J. Biol. Chem. 276, 4788-4795. 25. Hu, Z., Periyannan, G. R., and Crowder, M. W. (2008) "Folding strategy to prepare Co(II)-substituted metallo-β-lactamase L1," Anal. Biochem. 378, 177-183. 26. Fajer, P., Brown, L., and Song, L. (2007) ESR Spectroscopy in Membrane Biophysics, Springer. 27. Schlichting, I., Berendzen, J., Chu, K., Stock, A. M., Maves, S. A., Benson, D. E., Sweet, R. M., Ringe, D., Petsko, G. A., and Sligar, S. G. (2000) "The Catalytic Pathway of Cytochrome P450cam at Atomic Resolution," Science 287, 1615-1622. 28. Deniz, A. A., Dahan, M., Grunwell, J. R., Ha, T., Faulhaber, A. E., Chemla, D. S., Weiss, S., and Schultz, P. G. (1999) "Single-pair fluorescence resonance energy transfer on freely diffusing molecules: Observation of Förster distance dependence and subpopulations," Proc. Natl. Acad. Sci. 96, 3670-3675. 29. Hillisch, A., Lorenz, M., and Diekmann, S. (2001) "Recent advances in FRET: distance determination in protein-DNA complexes," Curr. Opin. Struct.Biol. 11, 201-207. 30. Yang, H., Luo, G., Karnchanaphanurach, P., Louie, T. M., Rech, I., Cova, S., Xun, L., and Xie, X. S. (2003) "Protein conformational dynamics probed by single-molecule electron transfer," Science 302, 262-266. 31. Bompard-Gilles, C., Rousseau, P., Rouge, P., and Payan, F. (1996) "Substrate mimicry in the active center of a mammalian α amylase: structural analysis of an enzyme–inhibitor complex," Structure 4, 1441-1452.

183

32. Seyedsayamdost, M., Chan, T., Mugnaini, V., Stubbe, J., and Bennati, M. (2007)

"PELDOR Spectroscopy with DOPA-β2 and NH2Y-α2s: Distance Measurements between Residues Involved in the Radical Propagation Pathway of E. coli Ribonucleotide Reductase," J. Am. Chem. Soc. 129, 15748-15749. 33. Mustafi, D., Knock, M. M., Shaw, R. W., and Makinen, M. W. (1997) "Conformational Changes in Spin-Labeled Cephalosporin and Penicillin Upon Hydrolysis Revealed by Electron Nuclear Double Resonance Spectroscopy," J. Am. Chem. Soc.119, 12619- 12628.

184

Chapter 7

Conclusions

185

This dissertation describes efforts to understand the structure and function of Mβl L1, and results from spectroscopic and kinetic studies provide novel ideas for future rational design of inhibitors against this enzyme. In this dissertation, two major issues were addressed: (1) what is

the role(s) of metal ions in the Zn1 and Zn2 sites of Mβl L1 and (2) what role does the invariant loop play in catalysis.

The function of metal ions in the Zn1 and Zn2 sites in Mβl’s is under intense debate (1, 2), and this debate is most heatedly argued in studies on Mβl BcII. The initial crystal structure of

BcII showed a single Zn(II) ion bound to the enzyme in the Zn1 site. All subsequent structures showed that BcII binds two Zn(II) ions, and most researchers argue that the mononuclear Zn(II) enzyme in the initial structure was due to crystal growth conditions (low pH) (3, 4). Nonetheless, the crystallographic work lead to the widely-held notion that there is one tight Zn(II) binding site

in BcII (Zn1 site) and a weaker binding site (Zn2 site), and Vila, Wommer (1, 5), and others reported metal binding dissociation constants that supported this notion. However recently, there

are reports that cast doubts on these previous metal binding KD’s, and several groups, even those that previously reported that BcII has tighter and weaker binding site, now argue that the two

BcII Zn(II) binding sites exhibit roughly equal KD values. This information is important because Page and coworkers recently published two papers on the reaction mechanism of BcII (6, 7), and they concluded that only the dinuclear metal ion containing enzyme is active. On the other hand, Vila and coworkers and de Seny et al. have observed that the mononuclear metal ion containing

enzyme is active (8). Interestingly, Vila recently asserted that the Zn2 site in BcII (and all other Mβl’s) might be the catalytically-important site (9). Given the disagreement between groups about the catalytically-active form of the enzyme, it is impossible to probe the roles of the Zn1 and Zn2 sites in BcII. Fortunately, all of the data on Mβl L1 consistently demonstrates that both Zn(II) ions

bind tightly to the enzyme and that the metal binding KD’s are almost identical in L1 (1). Our understanding of these issues allowed us to probe directly the roles of the two Zn(II) binding sites in catalysis. We accomplished this task by preparing, characterizing, and utilizing a number of metal-substituted analogs of L1, including mononuclear metal ion containing forms and heterobimetallic forms. In Chapter 2, we reported a novel procedure to prepare Co(II)-substituted L1 that involved a novel unfolding/refolding technique. This procedure allowed us, for the first time, to overcome the problem of Co(II) oxidation by a solvent-exposable disulfide, and

186

significantly, we are now able to prepare a spectroscopically-active form of L1 that has 2 equivalents of Co(II) in the active site. In Chapter 3, we showed that the metal content of L1 is determined by the bioavailability of metal ions. Using this knowledge, we were able to prepare a heterobimetallic ZnFe-containing analog of L1, and this analog was used in pre steady state

kinetic studies to probe the role of the Zn1 and Zn2 sites. In addition by using the refolding technique described in Chapter 2, we were able to generate a dinuclear iron containing analog of L1. For the first time, these studies demonstrate that L1 has very flexible metal binding sites, and this property was further exploited in subsequent chapters. By using the information gleaned in Chapters 2 and 3, we successfully prepared the ZnCo-containing analog of L1 (described in

Chapter 4). Our spectroscopic data clearly shows that Co(II) binds in the Zn2 site, while Zn(II)

binds in the Zn1 site. Stopped-flow kinetic data show that the metal ion in the Zn1 site is essential

for catalysis and that the metal ion in the Zn2 site is important for intermediate stabilization when nitrocefin is used as the substrate. In Chapter 5, we continued to explore the flexibility of the metal binding sites in L1, and we found that the enzyme can bind Cu(II) and Ni(II), and these analogs were characterized. These studies, along with those in Chapters 3 and 4, strongly indicate that the Zn1 site preferentially binds Zn(II), while the Zn2 site is very flexible, although dinuclear Co(II)-, Cu(II)-, and Fe-containing analogs of L1 can be generated. In summary, our data in Chapters 2-5 demonstrate: (1) 2Zn(II)-L1 is the most active form of L1 and that 1Zn-L1

(Zn(II) in Zn1 site) is only slightly active, (2) both metals are required to stabilize the nitrocefin-

derived intermediate, (3) the metal ion in the Zn2 site can modulate substrate preference in Mβl

L1, and (4) the product does bind to the metal ion in the Zn2 site. While the majority of successful results in this dissertation describe our efforts to probe the issue of the roles of the metal binding sites in L1, an enormous amount of my time was spent in the addressing the issue of the role of the flexible loop in catalysis (Chapter 6). We attempted to use FRET and DEER studies to monitor intramolecular motions during catalysis. Unfortunately, the preparation of the necessary samples was very difficult due to solubility and steric issues. Fortunately, the solubility issues were overcome by utilizing the refolding procedure described in Chapter 2, and we were able to generate site-specific fluorescence dye- and spin labeled analogs of L1. These labeled analogs were catalytically-active and bound Zn(II). Unfortunately, we were never able to obtain the analog of L1 containing both the donor and acceptor molecules, which is required for FRET studies. We were able to obtain the analog

187

with two spin labels, and preliminary DEER studies, for the first time, demonstrate that rapid- freeze quench DEER studies can be used to probe intramolecular dynamics during catalysis. A great deal of future work is required to optimize this procedure. The results presented in this dissertation answered a number of long-standing questions about L1 specifically and the Mβl’s generally; however as with many research projects, many additional questions/issues remain.

(1) Does L1 (and other Mβl’s) utilize different reaction mechanisms depending on the substrate? Previously in stopped-flow kinetic studies with nitrocefin as substrate, Crowder and co-workers reported that Mβl L1 utilizes a mechanism in which a kinetically-competent intermediate formed, and the decay of this intermediate was rate-limiting (10). Later Spencer et al. showed that a different reaction mechanism was used when penicillin G, cefaclor, and meropenem are used as substrates (11). This result was not surprising since the latter substrates do not have a long π electron conjugated substituent, which stabilizes a nitrogen anionic intermediate in nitrocefin (12). Spencer and coworkers speculated that the mechanism that L1 utilizes to hydrolyze penicillin G, cefaclor, and meropenem was used to hydrolyze all antibiotics except nitrocefin (11).. However in Chapter 5, our data clearly show that the heterobimetallic and Cu- containing analogs (ZnNi-, ZnFe-, and CuCu-L1) do not hydrolyze penicillin G and ampicillin, while these enzymes hydrolyze cefaclor, nitrocefin, and imipenem. Simm et al. reported that N- truncated L1 (L1 with the first 20 amino acids deleted) did not hydrolyze penicillin G (13); however, no explanation for this observation was offered. Our work in Chapter 3 clearly shows that this N-truncated L1 was most likely the ZnFe analog. In addition, previous mutagenesis research in Crowder lab found that the S224D mutant of L1 did not hydrolyze penicillin G or ampicillin, while it did effectively hydrolyze meropenem and cefaclor (14). All of these data

suggest that the Zn2 site is important for the hydrolysis of penicillins; however, it is not clear

what role the metal ion in this site is playing. To answer this question, the Zn1Co2 (Zn(II) in the

Zn1 site and Co(II) in the Zn2 site) analog of L1, discussed in Chapter 4, should be used in RFQ- EPR and –EXAFS studies to trap the intermediate and to monitor how the electronic environment of Co(II) changes upon penicillin binding. These results should then be compared to those when nitrocefin is used as the substrate.

188

(2) Does the invariant carboxylate (Figure 7.1) on substrate bind to Zn(II)? Previous modeling and crystallographic studies suggest that the invariant carboxylate on substrate binds to the metal ion in the Zn2 site or to Ser224 (K224 in other Mβls) (14, 15). The spectroscopic studies presented in this dissertation did not support the idea that the substrate carboxylate binds to the

metal ion in the Zn2 site; however, this point was not explicitly tested. This information is important because if the carboxylate binds to the metal center, any future inhibitors should maintain a carboxylate in this position. One way to explicitly test whether the carboxylate 17 directly binds to the metal ion in the Zn2 site is to prepare a substrate analog with O in the carboxylate. RFQ-EPR studies on the ZnCo- or ZnFe-analogs of L1 could possibly show broadening and provide direct evidence that this interaction occurs during catalysis. Additionally, this interaction could also be probed with ENDOR spectroscopy, using the new pulsed EPR spectrometer that was funded by NSF. X X R' R" R' R" N N O O 17 O O O OH

Figure 7.1: (Left) Carboxylate group (in red) in β-lactam containing compounds. (Right) 17O- labeled substrate.

(3) What is the function of tetramer? Among all Mβls, L1 is unique because it is tetrameric, while the rest of the enzymes are monomeric. Previous mutation studies showed that the Met140 mutant of L1 is monomeric (13); however, the catalytic efficiency of this mutant is much lower than that of wild-type L1 due to a very high Km value. At this point, it is not clear if the single point mutation caused significant changes in the secondary or tertiary structure of the mutant, and the crystal structure of this mutant should be determined. In the absence of this structure, we

can still probe whether the higher Km is due to the loss of subunit contacts. The refolding strategy described in Chapter 2 could be used to address this issue: 5% of the Met140 mutant

189

should be mixed with 95% of the D120C (inactive) mutant, and the proteins should be unfolded and refolded in the presence of Zn(II). Steady-state and pre-steady state kinetic studies will allow

for us to determine the impact of the other subunits in the Km value exhibited by the M140D mutant.

D120C Wild L1

D120C D120C

Figure 7.2: Chimeric tetramer of L1. It contains one subunit of wild-type L1 and three subunits of the D120C mutant.

(4) How does substrate bind to the active site? Previous computational studies have suggested several substrate binding models (16); however, all of these studies assumed that the β-lactam carbonyl on substrate interacts with the metal ion in the Zn1 site. Other details about how the substrate binds are different in the computational studies. The most direct evidence about substrate binding will come from a crystal structure with bound substrate. However, previous studies on Mβl L1 have shown that the enzyme retains activity even in the crystalline state, and large movements of the enzyme during catalysis have resulted in cracked crystals. I propose that the S224D mutant of L1 (14), which was prepared and characterized previously in the Crowder lab, should be used in the crystallization studies. This mutant does not have any metal binding ligands altered but the enzyme is only 1% as active as wild-type L1. Rapid soaking of S224D crystals with a substrate would better our chances of obtaining a crystal structure of an enzyme- substrate complex. (5) More techniques are required to study the interaction between the substrate and the metal

center. In Chapter 4, we described the successful preparation of Zn1Co2-L1, which is an excellent analog to accomplish this task. For example by using a 15N-labeled substrate (Figure 7.3), RFQ-

190

ENDOR (electron nuclear double resonance) spectroscopy could be used to directly detect a Co- N interaction. X R' 15 R" N -O C 2 O Figure 7.3: 15N-labeled substrate.

As mentioned above, most of the information about substrate binding to Mβl’s come from computational studies, which assumed that the β-lactam carbonyl binds to the metal ion in

the Zn1 site. To explicitly test this assumption, the thiono analog of substrate (Figure 7.4) can be used in RFQ-EPR/ENDOR and EXAFS studies. Dr. Ke-Wu Yang, while a postdoc in the Crowder lab, generated the thiono analog of moxalactam. RFQ samples of the ZnCo-containing analog of L1 reacted with the thiono analog can be analyzed with cw EPR (there should be a significant change in the E/D value of the Co(II) if bound to oxygen versus sulfur). EXAFS studies could clearly show whether the sulfur is interacting with the Zn(II) or Co(II) by collecting data on both absorption edges. Lastly if the 33S analog of the substrate can be generated, ENDOR spectroscopy could be used to determine if sulfur is binding to Co(II) in the ZnCo-analog.

X R' R" N -O C 2 S Figure 7.4: Thiono analog of substrate.

191

(6) Our proposed mechanism presented in Chapter 4 suggests the formation of a reaction intermediate, which was coordinated by metal ions in both sites and whose breakdown is rate- limiting. It is widely accepted and mentioned in many papers that transition states bind more tightly to enzyme than substrate. However, the synthesis of a transition state analog of the intermediate (a ring open with anionic N containing a long H-bond) is not possible (17, 18). Thus a potential inhibitor, sharing the similar structure of the intermediate state of nitrocefin hydrolysis, is shown in Figure 7.5. X R' R" N - P OH O2C - O Figure 7.5: Potential inhibitor for mβl L1.

(7) The author has screened many potential inhibitors, and two of the compounds were very promising (Figures 7.6 and 7.7). It would be interesting to determine the mode of inhibition for each compound. Since both compounds are β-lactams, it is also important to analyze the compounds after reaction with L1, to determine if the β-lactam bond is hydrolyzed. Crystal structures of L1-inhibitor complexes would yield information about how these compounds bind, and it is likely that the inhibitors could be rationally re-designed to be tighter binding. In the absence of crystal structures, we can still determine if the compounds bind to the metal ions in L1 by using the ZnCo-analog and the spectroscopic studies described throughout the dissertation.

192

N 40

30 IC50 = 129.5 ± 9.14 nM Kcat = 45.535 ± 0.888 /s L1 inhibitor experiment w/ compound #1 w/ 50 mM Cacodylate buffer w/ 100 uM Zn O O 20

S I 10 kcat of pseudo zero reaction (/s) zero reaction pseudo of kcat N 0 500 1000 1500 2000 O inhibition concentration (nM) COO_

Figure 7.6: (Left) Structure of first compound tested. (Right) IC50 plot of first compound reacted with L1.

Br 40

35 s IC50 = 15.359 ± 0.77 uM Br 30 Kcat = 42.429 ± 0.649 /s L1 inhibitor exp. w/ compound #2 25 in 50 mM cacodylate w 100 uM Zn (II)

N O 20

O 15 O 10 COO- kcat of pseudo zero reaction (/s)

0 20 40 60 80 100 inhibitor concentration (uM)

Figure 7.7: (Left) Structure of second compound tested. (Right) IC50 plot of second compound reacted with L1.

The long term goal on mβl’s research is to rationally design and prepare clinically useful inhibitors. The crystal structures of mβl’s have provided a wealth of information for us to speculate how mβl’s hydrolyze β-lactams. However, the reaction mechanism is not clear due to the lack of information on dynamics. In this dissertation, we focused on demonstrating the function of the conserved Zn sites and loop region of mβl L1, which are possible targets for inhibitor design. Zn1 site will be the first and most effective target site since our research showed

that Zn1 site is crucial for the hydrolytic activity of L1. However, an inhibitor targeting the Zn2

site might block the access to Zn1 site. More importantly, if Zn2 site is occupied by physiologically relevant Fe ion, L1 will be inactive towards penicillins. A potential inhibitor

(Figure 7.4), supposed to bind the Zn1 and Zn2 site, is proposed based on the spectrokinetic

193

studies of ZnCo-L1 with nitrocefin. Besides the Zn(II) active site, the loop above the active site of L1 is another target. Our previous data showed the movement of the loop is concerted with the hydrolysis of substrate in the active site. Our preliminary data in this dissertation supported our previous observation and suggested that substrates containing large, bulky substituents may block the movement of the loop, and these compounds will be poor substrates for L1.

194

References:

1. Wommer, S., Rival, S., Heinz, U., Galleni, M., Frere, J. M., Franceschini, N., Amicosante, G., Rasmussen, B., Bauer, R., and Adolph, H. W. (2002) "Substrate- activated zinc binding of metallo-β-lactamases - Physiological importance of the mononuclear enzymes," J. Biol. Chem.277, 24142-24147. 2. Cricco, J. A., Orellano, E. G., Rasia, R. M., Ceccarelli, E. A., and Vila, A. J. (1999) "Metallo-β-Lactamases: Does it Take Two to Tango?," Coord. Chem. Rev. 190-192, 519-535. 3. Carfi, A., Pares, S., Duee, E., Galleni, M., Duez, C., Frere, J. M., and Dideberg, O. (1995) "The 3-D Structure of a Zinc Metallo-β-Lactamase from Bacillus cereus Reveals a New Type of Protein Fold," EMBO J. 14, 4914-4921. 4. Carfi, A., Duee, E., Galleni, M., Frere, J. M., and Dideberg, O. (1998) "1.85 A Resolution Structure of the Zinc (II) β-Lactamase II from Bacillus cereus," Acta. Cryst. D 54, 313- 323. 5. Llarrull, L. I., Tioni, M. F., Kowalski, J., Bennett, B., and Vila, A. J. (2007) "Evidence for a Dinuclear Active Site in the Metallo-β-lactamase BcII with Substoichiometric Co(II): A NEW MODEL FOR METAL UPTAKE," J. Biol. Chem. 282, 30586-30595. 6. Badarau, A., and Page, M. I. (2006) "Enzyme deactivation due to metal ion dissociation during turnover of the cobalt-β-lactamase catalyzed hydrolysis of β-lactams," Biochemistry 45, 11012-11020. 7. Badarau, A., and Page, M. (2008) "Loss of enzyme activity during turnover of the Bacillus cereus β-lactamase catalysed hydrolysis of β-lactams due to loss of zinc ion," J Biol. Inorg. Chem. 8. Moran-Barrio, J., Gonzalez, J. M., Lisa, M. N., Costello, A. L., Peraro, M. D., Carloni, P., Bennett, B., Tierney, D. L., Limansky, A. S., Viale, A. M., and Vila, A. J. (2007) "The Metallo-β-lactamase GOB Is a Mono-Zn(II) Enzyme with a Novel Active Site," J. Biol. Chem. 282, 18286-18293. 9. Moran-Barrio, J., Gonzalez, J. M., Lisa, M. N., Costello, A. L., Dal Peraro, M., Carloni, P., Bennett, B., Tierney, D. L., Limansky, A. S., Viale, A. M., and Vila, A. J. (2007) "The metallo-β-lactamase GOB is a mono-Zn(II) enzyme with a novel active site," J. Biol. Chem. 282, 18286-18293.

195

10. McMannus-Munoz, S., and Crowder, M. W. (1999) "Kinetic Mechanism of Metallo-β- Lactamase L1 from Stenotrophomonas maltophilia," Biochemistry 38, 1547-1553. 11. Spencer, J., Clark, A. R., and Walsh, T. R. (2001) "Novel Mechanism of Hydrolysis of Therapeutic β-Lactams by Stenotrophomonas maltophilia L1 Metallo-β-Lactamase," J. Biol. Chem. 276, 33638-33644. 12. Wang, Z., Fast, W., and Benkovic, S. J. (1998) "Direct Observation of an Enzyme-Bound Intermediate in the Catalytic Cycle of the Metallo-β-Lactamase from Bacteroides fragilis," J. Am. Chem. Soc. 120, 10788. 13. Simm, A. M., Higgins, C. S., Carenbauer, A. L., Crowder, M. W., Bateson, J. H., Bennett, P. M., Clarke, A. R., Halford, S. E., and Walsh, T. R. (2002) "Characterization of Monomeric L1 Metallo-β -lactamase and the Role of the N-terminal Extension in Negative Cooperativity and Antibiotic Hydrolysis," J. Biol. Chem. 277, 24744-24752. 14. Carenbauer, A. L., Garrity, J. A., Periyannan, G., Yates, R. B., and Crowder, M. W. (2002) "Probing Substrate Binding to Metallo-β-Lactamase L1 from Stenotrophomonas maltophilia by Using Site-Directed Mutagenesis," BMC Biochemistry 3, 4-10. 15. Ullah, J. H., Walsh, T. R., Taylor, I. A., Emery, D. C., Verma, C. S., Gamblin, S. J., and Spencer, J. (1998) "The crystal structure of the L1 metallo-β-lactamase from Stenotrophomonas maltophilia at 1.7 Å resolution," J. Mol. Biol. 284, 125-136. 16. Xu, D., Guo, H., and Cui, Q. (2007) "Antibiotic deactivation by dizinc β-lactamase: Mechanistic insights from QM/MM and DFT studies," J. Am. Chem. Soc. 129, 10814- 10822. 17. Kaminshaia, N. V., Spingler, B., and Lippard, S. J. (2000) "Hydrolysis of β-Lactam Antibiotics Catalyzed by Dinuclear Zinc(II) Complexes: Functional Mimics of Metallo- β-Lactamases," J. Am. Chem. Soc. 122, 6411-6422. 18. Kaminskaia, N. V., Spingler, B., and Lippard, S. J. (2001) "Intermediate in β-lactam hydrolysis catalyzed by a dinuclear zinc(II) complex: Relevance to the mechanism of metallo-β-lactamase," J. Am. Chem. Soc. 123, 6555-6563.

196