DOCSLIB.ORG

Microsatellite Loci Isolated from the Mediterranean Species Cicada Barbara (Stål) and C

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Molecular Ecology Notes (2002) 2, 173–175

Blackwell Science, Ltd

PRIMER NOTE

Microsatellite loci isolated from the Mediterranean species Cicada barbara (Stål) and C. orni L. (Hemiptera, Cicadoidea)

S. G. SEABRA,*† H. R. WILCOCK,* J. A. QUARTAU† and M. W. BRUFORD*

*School of Biosciences, Cardiff University, Main Building, Park Place, Cardiff, CF10 3TL, UK, †Centro de Biologia Ambiental e Departamento de Zoologia e Antropologia, Bloco C2, 3° Piso, Faculdade de Ciências de Lisboa, Campo Grande 1700 Lisboa, Portugal

Abstract

We describe the isolation of six polymorphic microsatellites for Cicada barbara (Stål), four of which are also polymorphic for the closely related Cicada orni L. Cicadas from several sites in the Iberian Peninsula, North Africa (C. barbara) and Greece (C. orni) were genotyped at these loci. Polymorphism is higher than that previously obtained with allozymes for these species. One locus allows species diagnosis (nonoverlapping allele size ranges) between C. barbara and C. orni and the others have some exclusive alleles for each species.

Keywords: cicadas, Cicada barbara, Cicada orni, insects, microsatellites Received 6 November 2001; revision received 21 December 2001; accepted 21 December 2001

The genus Cicada L. (Hemiptera, Cicadoidea) includes some sibling species that are morphologically very similar but distinguishable by the specific calling songs produced

by males for mate recognition. Cicada barbara and C. orni are

two of these species that exist in sympatry in some areas in the southern Iberian Peninsula. C. barbara is widely distributed in North Africa while C. orni occurs mostly in European Mediterranean countries. Previous studies using allozymes showed low levels of genetic variation within and between these species (Quartau et al. 2001). With the aim of studying the genetic structure of populations, dispersal and potential interspecific hybridization in these species, microsatellites were isolated and described. Two separate partial genomic libraries were constructed, one for each species, using the protocol of Hammond et al. (1998). Total DNA was extracted from the muscle tissue of the thorax of five specimens from different populations of each species using the QIAamp DNA Mini Kit (QIAGEN). The DNA was digested with MboI (Promega) and selected fragments (300–900 base pairs) were isolated from a 1.5% agarose gel by electroelution into dialysis tubing and purified using Centricon Microconcentrators (Amicon). The fragments were enriched for CA and GA repeats using biotin-labelled probes and then ligated into a pUC18 vector (Amersham Pharmacia Biotech) (Hammond et al. 1998). Ligation products were cloned into One Shot® competent cells TOP 10 (Invitrogen). Colonies were screened following the polymerase chain reaction (PCR) -based screening method of Lunt et al. (1999). Of the 432 colonies screened, 71 were positive and were sequenced directly from the PCR products using a Big Dye™ Terminator Cycle Sequencing Ready Reaction Kit (PE Biosystems), following the cycle sequencing conditions: 25 cycles of 10 s at 96 °C, 5 s at 50 °C and 4 min at 60 °C. The fragments were separated on an ABI 377 Sequencer. Fifty-nine colonies had repeat sequences (14% enrichment). Ten primer pairs were designed using the software programme omiga™ 2.0 (Oxford Molecular Ltd). Amplification of microsatellite loci was performed on a Gene Amp 9700 Perkin Elmer thermal cycler under the following conditions: 2 min at 94 °C, then 30 cycles of 30 s at 94 °C, 40 s at 58–62 °C (Table 1) and 1 min at 72 °C, followed by an extension period of 72 °C for 10–30 min. Optimized PCR reaction mixes contained approximately 100 ng of template DNA, 1.5 or 2 mm MgCl2 (Table 1),

Correspondence: Sofia Gonçalves Seabra. Fax: +44(0)2920874305; E-mail: [email protected]

© 2002 Blackwell Science Ltd
Table 1 Characterization of Cicada L. microsatellite loci. The motif, primer sequences, annealing temperatures (Ta) and MgCl2 concentrations are given for each locus. Allele size ranges, number of alleles and heterozygosity (observed – HO and expected – HE) were determined from genotyping 31 specimens of C. barbara (Cb) from seven sites in the Iberian Peninsula (Foz Côa, Crato, Monforte, Arrábida, Alcalar, Toledo and Cordoba) and one site in North Africa (Ceuta), and 32 specimens from C. orni (Co) from six sites in the Iberian Peninsula (Lisboa, Monte da Caparica, Sesimbra, Arrábida, Crato and Monforte) and one site in Greece (Athens)

  • Allele size range (bp)
  • No. alleles

  • H
  • O (HE)

Cb
0.759
Repeat in sequenced allele
Primer sequence (5′ to 3′)
GenBank accession no. Ta (°C) (mm)
MgCl2
Locus

Cib01 Cib03 Cib06 Cib07 Cio08 Cib10

  • Cb
  • Co
  • Cb

10
5

  • Co
  • Co

0.120
(0.607)
0.607
(0.759) —

(GA)18

F: GATAAAATCAGTGGAGTGC R: AGTCGATACAATCGAACC F: ATATCTGATGGACCCTCG R: AGGTATCATGCCTTATTGC F: CGCAGCAGACGATTTTATCC R: GCTCAATAACTGCCCATAACG F: TTGGAATTCAGAGTGTCG R: GTGTCCTGTGTATCCTACG F: CGATGGTTGTAATTTAGTGG R: TCAATAGCATATCTTGCTCC F: AGAAGAAGGTGGACAACC R: TGACGACTTGAAAACAGC

AF437631 AF437632 AF437633 AF437634 AF437636 AF437635
58 62 60 60 60 60

  • 2
  • 164–194

257–267 256–294 133–165 201–217 141–165
162–208 235–253 —
67
(0.828)
0.333
(0.625)
0.793
(0.849)
0.160
(0.706)
0.667

(GT)2T(GT)13 (GT)2TT(GT)11TGT

(GT)15

21.5 1.5 1.5 1.5

  • 8
  • —

129–197 181–213 —

  • 7
  • 11

10 —
0.484
(0.740)
0.241
(0.735) —

(CA)7TA(CA)5

(CA)16

8
(0.811)

  • 0.160
  • 5

(0.675)

PRIMER NOTE 175

0.2 mm dNTPs, 0.2 mm of each primer (forward primer 5′ end-labelled with a fluorescent dye), 0.25 U of Taq polymerase (GIBCO Life Technologies) and the manufacturer’s buffer (20 mm Tris–HCl pH 8.4, 50 mm KCl) in a final reaction volume of 10 µL. Amplified microsatellites were run on polyacrylamide gels (Gene-PAGE, Amresco) on an ABI 377 Automated Sequencer using an internal lane standard (genescan-350 tamra from PE Applied Biosystems). Six out of the 10 loci tested were polymorphic in C. bar- bara and four of these were also polymorphic in C. orni (Table 1). All loci were obtained from the C. barbara library except Cio08. The mean number of alleles was 7.2 1.94 (SD) for C. barbara and 8.5 2.38 (SD) for C. orni. One of the loci (Cib03) had nonoverlapping allele size ranges between the species. In other loci (Cib01, Cib07 and Cio08) there were some exclusive alleles for each species. Observed heterozygosity was significantly lower than expected for all except one species–locus combination (that of C. barbara for Cib06). Since the DNA was of high quality and genotypes were repeated up to three times, allelic dropout is unlikely, but there remains the possibility of null alleles or high levels of localized inbreeding. These are currently under investigation.

Acknowledgements

This work was supported by Fundação para a Ciência e a Tecnologia, Portugal (PhD grant SFRH/BD/1027/2000). We thank Genage André, Gabriela Pinto, Mónica Ribeiro, Paula Simões and Teresa Fernandes for their help in the field.

References

Hammond RL, Saccheri IJ, Ciofi C et al. (1998) Isolation of micro-

satellite markers in animals. In: Molecular Tools for Screening

Biodiversity (eds Karp A, Isaac PG, Ingram DS), pp. 279–287. Chapman & Hall, London. Lunt DH, Hutchinson WF, Carvalho GR (1999) An efficient method for PCR-based isolation of microsatellite arrays (PIMA).

Molecular Ecology, 8, 891–894.

Quartau JA, Ribeiro M, Simões PC, Coelho MM (2001) Genetic divergence among populations of two closely related species of Cicada Linnaeus (Hemiptera: Cicadoidea) in Portugal. Insect

Systematics and Evolution, 32, 99–106.

© 2002 Blackwell Science Ltd, Molecular Ecology Notes, 2, 173–175

Recommended publications
  • Rapid and Simple Species Identification of Cicada Exuviae

    Rapid and Simple Species Identification of Cicada Exuviae

    insects Article Rapid and Simple Species Identification of Cicada Exuviae Using COI-Based SCAR Assay Pureum Noh, Wook Jin Kim, Jun-Ho Song , Inkyu Park , Goya Choi and Byeong Cheol Moon * Herbal Medicine Resources Research Center, Korea Institute of Oriental Medicine, Naju 58245, Korea; [email protected] (P.N.); [email protected] (W.J.K.); [email protected] (J.-H.S.); [email protected] (I.P.); [email protected] (G.C.) * Correspondence: [email protected]; Tel.: +82-61-338-7100 Received: 5 February 2020; Accepted: 4 March 2020; Published: 6 March 2020 Abstract: Cicadidae periostracum (CP), the medicinal name of cicada exuviae, is well-known insect-derived traditional medicine with various pharmacological effects, e.g., anticonvulsive, anti-inflammatory, antitussive, and anticancer effects; it is also beneficial for the treatment of Parkinson’s disease. For appropriate CP application, accurate species identification is essential. The Korean pharmacopoeia and the pharmacopoeia of the People’s Republic of China define Cryptotympana atrata as the only authentic source of CP. Species identification of commercially distributed CP based on morphological features, however, is difficult because of the combined packaging of many cicada exuviae in markets, damage during distribution, and processing into powder form. DNA-based molecular markers are an excellent alternative to morphological detection. In this study, the mitochondrial cytochrome c oxidase subunit I sequences of C. atrata, Meimuna opalifera, Platypleura kaempferi, and Hyalessa maculaticollis were analyzed. On the basis of sequence alignments, we developed sequence-characterized amplified-region (SCAR) markers for efficient species identification. These markers successfully discriminated C.
  • An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna

    An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna

    © Copyright Australian Museum, 2005 Records of the Australian Museum (2005) Vol. 57: 375–446. ISSN 0067-1975 An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna M.S. MOULDS Australian Museum, 6 College Street, Sydney NSW 2010, Australia [email protected] ABSTRACT. The history of cicada family classification is reviewed and the current status of all previously proposed families and subfamilies summarized. All tribal rankings associated with the Australian fauna are similarly documented. A cladistic analysis of generic relationships has been used to test the validity of currently held views on family and subfamily groupings. The analysis has been based upon an exhaustive study of nymphal and adult morphology, including both external and internal adult structures, and the first comparative study of male and female internal reproductive systems is included. Only two families are justified, the Tettigarctidae and Cicadidae. The latter are here considered to comprise three subfamilies, the Cicadinae, Cicadettinae n.stat. (= Tibicininae auct.) and the Tettigadinae (encompassing the Tibicinini, Platypediidae and Tettigadidae). Of particular note is the transfer of Tibicina Amyot, the type genus of the subfamily Tibicininae, to the subfamily Tettigadinae. The subfamily Plautillinae (containing only the genus Plautilla) is now placed at tribal rank within the Cicadinae. The subtribe Ydiellaria is raised to tribal rank. The American genus Magicicada Davis, previously of the tribe Tibicinini, now falls within the Taphurini. Three new tribes are recognized within the Australian fauna, the Tamasini n.tribe to accommodate Tamasa Distant and Parnkalla Distant, Jassopsaltriini n.tribe to accommodate Jassopsaltria Ashton and Burbungini n.tribe to accommodate Burbunga Distant.
  • Vital Strategy for Cicada Orni L. Survival in the Regional Park Maremma (Italy)

    Vital Strategy for Cicada Orni L. Survival in the Regional Park Maremma (Italy)

    ECOLOGIA BALKANICA 2014, Vol. 5, Special Edition April 2014 pp. 75-79 Vital Strategy for Cicada orni L. Survival in the Regional Park Maremma (Italy) Peter Genov1, Atidzhe Ahmed1*, Stefka Kitanova2 1 - Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Sciences, 2 Gagarin Str., Sofia, BULGARIA 2 - Forest Research Institute – Sofia, Bulgarian Academy of Sciences, 132, St. Kliment Ohridski Blvd., Sofia, BULGARIA * Corresponding author: [email protected] Abstract. The study took place in the period 1991-2000, in the Regional Park Maremma, Central Italy (42˚39’N, 11˚ 05’E). It is with an area of 9800 ha, covered by Mediterranean vegetation: Pinus halepensis Mill., Pinus pinea domesticus L., Quercus ilex L., Q .pubescens Willd., Arbutus unedo L., Phillirea latifolia L., Erica multiflora L., Pistacia lentiscus L., Rosmarinus officinalis L. The larvae of Cicada orni L. live in the soil and it with three-year life cycle. When it starts going out of the skin it becomes a pray for some animals, among them ants and wild boar, as it does not move. During one only observation it was established the presence of 222 cicada skins on the sand only some of which reached to fly. On the sand there were also signs from lizards, snakes, birds, hedge hocks, foxes, wild boars, etc. After a deep analysis it was established that their number decreased 30 times from the ground to the trees crowns where the adults live. During 10 years were collected data about the flying dynamics of cicada in order to answer the following hypothesis: what is the life strategy which the insect uses to survive among the numerous enemies.
  • Cicadas Fact Sheet No

    Cicadas Fact Sheet No

    Cicadas Fact Sheet No. 5.590 Insect Series|Trees and Shrubs by W.S. Cranshaw and B. Kondratieff* Cicadas are among the largest Colorado Quick Facts insects in the order Hemiptera, which includes other sap-sucking groups with • Cicadas are large insects with prominent beaks such as leafhoppers, aphids, young stages that burrow and and spittlebugs. Twenty-nine species occur in develop underground and the state (Table 1). The largest (Megatibicen feed on fluids from roots of spp.) are stout-bodied insects that are 1 to grasses, shrubs, and trees. 1 ½ inches but Colorado’s cicadas range considerably in size. Beameria venosa, • The adult cicadas found Cicadettana calliope and C. kansa are small in Colorado emerge 3 to 5 species (ca. ½ inch) that is develop on grasses years, sometimes longer, after and shrubs growing in hillsides of canyons Figure 1: Megatibicen dealbatus, a large eggs have hatched. and arroyos of both eastern and western “dog-day” type of cicada that is expanding populations along the Front Range. Colorado. • Periodical cicadas, such Although abundant, cicadas are far more as the 17-year and 13-year often heard than seen. Males make a variety cicadas, do not occur in of sounds to attract females. Most commonly Colorado. heard are loud, often shrill, buzzing calls, • Male cicadas “sing” to attract sometimes with several individual insects females. Many produce loud, synchronizing their songs. Other cicadas make rustling or clicking noises. shrill buzzing noises. Despite their large size, cicadas cause • Cicadas do little if any injury little injury. The immature stages (nymphs) while feeding on plants.
  • Ecosystem Services Provided by the Little Things That Run the World

    Ecosystem Services Provided by the Little Things That Run the World

    Chapter 13 Ecosystem Services Provided by the Little Things That Run the World Olga Maria Correia Chitas Ameixa,Chitas Ameixa, António Onofre Soares,Onofre Soares, Amadeu M.V.M. SoaresM.V.M. Soares and andAna AnaI. Lillebø I. Lillebø Additional information is available at the end of the chapter http://dx.doi.org/10.5772/intechopen.74847 Abstract Highest extinction risk and consequently biodiversity loss are predicted to occur in inver- tebrates, specifically insects, and these declines are expected to cascade onto ecosystem functioning and human well-being. Although this knowledge is intrinsically present in more traditional communities, in more urban environments, mapping ecosystem ser - vices can be an important tool to raise people’s awareness on the importance of pre - serving insect diversity. After an extensive revision of the available literature, we used a rule-based approach to assess the provisioning, regulating and maintenance, and cul - tural services delivered by insects. We followed the Common International Classification of Ecosystem Services (CICES) and identified several potential indicators that may help underpin the mapping and valuation of the services delivered by insects. From our search, we extracted a total of 73 indicators, divided as 17 Provisional indicators, 27 Regulation and Maintenance indicators, and 29 Cultural indicators. We concluded that insects are providers of services in the three major ‘Sections’ of ecosystem services defined by CICES. Despite the lack of recognition of provisioning and cultural services, the indicators provided may help to raise awareness on the importance of the little things the run the world, in order to preserve traditional and technological uses of insects and their services.
  • Download Download

    Download Download

    Book Reviews 865 SANBORN, A. F. 2014. Catalogue of the Cicadoidea (Hemiptera: Auchenorrhyncha). Academic Press/ Elsevier, London, UK. Hardcover, ISBN 978-0-12-416647-9. viii + 1001 pp. US $112.46. All aspects of Sanborn’s “Catalogue of the Ci- (2011), and many of the resulting new combina- cadoidea” affirm this is a labor of love–carefully tions first appear in Wang et al. (2014). These two prepared, beautifully presented, easy to read, sources were not even indexed in the online ver- and durably bound. Based on this massive com- sion of the Zoological Record as of 7 March 2014. pilation, the superfamily includes two extant Furthermore, Sanborn’s emphasis on organizing families: Tettigarctidae (with only 2 species in the higher taxa based on recent phylogenetic the Australian genus Tettigarcta) and Cicadidae studies enhances the predictive value of his clas- (with 3 subfamilies, 40 tribes, 412 genera, and sification over those that preceded it. more than 2,900 valid species). Cicadas are con- The “Summary Species List” is a simple check- spicuous components of natural environments the list of all cicada taxa listing their synonyms, which world over owing to their distinctive male court- provides a useful overview of the detailed cata- ship calls, relatively large size, and, in the United logue. Based on this summary, I counted roughly States, spectacular mass emergences of Magici- 2,916 valid species, of which about 82 have 2-12 cada. All cicadas feed on plants and, in deposit- valid subspecies each. Counting the valid species ing their eggs, females often injure the stems of and subspecies is arduous and problematic be- various cultivated crops, shrubs, and trees.
  • Common True Bugs and Related Insects (Orders Hemiptera and Homoptera) in the Wichita Mountains and Surrounding Areas

    Common True Bugs and Related Insects (Orders Hemiptera and Homoptera) in the Wichita Mountains and Surrounding Areas

    Common True Bugs and Related Insects (Orders Hemiptera and Homoptera) in the Wichita Mountains and Surrounding Areas Angel Chiri agricultural pests, and a few, such as bed bugs Entomologist and assassin bugs in the genus Triatoma, feed on blood. Bugs undergo a simple metamorphosis Introduction and pass through five nymphal instars before reaching the adult stage. Young nymphs A word about common names - The scientific resemble small wingless adults, and wing stubs name of an organism, whether plant or animal, do not appear until the fourth instar. consists of the genus and species, written in italics. The genus is writen in full the first time There are approximately 3,600 recorded species that it is mentioned in a paper (e.g. Arilus of Hemiptera in the U.S. and Canada. A few of cristatus). Thereafter, the genus name is the more common species in our area are abbreviated to its initial (e.g. A. cristatus). Less discussed below. All photos in this guide were than 2% of known insect species in the U.S. taken by the author using a Canon PowerShot have approved common names. Relying on only SX110 IS camera. common names for individual species may lead to confusion, since more than one common Family Pentatomidae (stink bugs) name may be used for the same species, or the same common name may be used for more than This is a large family with some 200 species in one species. Using the scientific name, which is the U.S. Stink bugs can be recognized by their the same in any language or region, eliminates shield-shaped body.
  • The Periodical Cicada

    The Periodical Cicada

    BULLETIN NO. 14, NEW SERIES. U. S. DEPARTMENT OF AGRICULTURE. DIVISION OF ENTOMOLOGY. THE PERIODICAL CICADA. AN ACCOUNT OF CICADA SEPTENDECIM, ITS NATURAL ENEMIES AND THE MEANS OF PREVENTING ITS INJURY, TOGETHER WITH A SUMMARY OF THE DISTRIBUTION OF THE DIFFERENT BROODS. C. JJ. MAELATT, M. S., FIRST ASSISTANT ENTOMOLOGIST. WASHINGTON: GOVERNMENT PRINTING OFFICE. 1898. 1, So, 14, new series, Div. of Entomology, U. S. Dept. of Agriculture. frontispiece. !'hilo I V Riley.del L.SuIhv m p TRANSFORMATION OF CICADA SEPTENDECIM —*"— " R E C £ ' V E D "n.ftv vVoA\ .v ;P-M o 'HÖH w >* ■ • • ^ ; _; __ ÛTsT Departmen^o^Agriculture^ BULLETIN No. 14, NEW SERIES. U. S. DEPARTMEiNT OF AGRICULTURE. DIVISION OF ENTOMOLOGY. THE PERIODICAL CICADA. AN ACCOUNT OF CICADA SEPTENDECIM, ITS NATURAL ENEMIES AND THE MEANS OF PREVENTING ITS INJURY, TOGETHER WITH A SUMMARY OF TUB DISTRIBUTION OF THE DIFFERENT BROODS. C. L. M AUL, ATT, M. S. FIIIST ASSISTANT ENTOMOLOGIST WASHINGTON: GOVERNMENT PRINTING OFFICE. 1898. DI VISTON OF ENTOMOLOG Y. Entomologist : L. O. Howard. Assist. Entomologists : C. L. Marlatt, Th. Pergande, Frank Benton. Investigators : E. A. Schwarz, H. G. Hubbard, D. W. Coquillett, F. H. Chittenden. Assistants : R. S. Clifton, Nathan Banks, F. C. Pratt, August Busck. Artist: Miss L. Sullivan. LETTER OF TRANSMITTAL IL S. DEPARTMENT OF AGRICULTURE, DIVISION OF ENTOMOLOGY, Washington, D. (7., May 1, 1898. SIR : The periodical, or seventeen-year, Cicada has a peculiar interest in addition to its economic importance, in that it is distinctly American and has the longest life period of any known insect. Economically, it is chiefly important in the adult stage from the likelihood of its injuring nursery stock and young fruit trees by depositing its eggs.
  • Two New Species of Cicadatra (Hemiptera: Cicadoidea) from Greece

    Two New Species of Cicadatra (Hemiptera: Cicadoidea) from Greece

    bs_bs_banner Entomological Science (2013) 16, 83–90 doi:10.1111/j.1479-8298.2012.00540.x ORIGINAL ARTICLE Two new species of Cicadatra (Hemiptera: Cicadoidea) from Greece Paula Cristina SIMÕES1, Allen SANBORN2 and José Alberto QUARTAU1 1Centro de Biologia Ambiental, Departamento de Biologia Animal, Faculdade de Ciências da Universidade de Lisboa, Lisboa, Portugal; and 2Department of Biology, Barry University, Miami Shores, Florida, USA Abstract The present study is the description of two new species of Cicadatra Kolenati, 1857 found in some Greek islands during the summers of 1998 and 2001. Cicadatra icari sp. n. is described from Ikaria and Samos and Cicadatra karpathosensis sp. n. from Karpathos. Description of the external morphology is provided. The male genitalia were dissected for close examination and illustration. Acoustic signals produced by males were recorded and analyzed and a description of the calling songs is provided. Discrimination from the closely allied species is also provided. Key words: calling song, cicadas, morphology, taxonomy INTRODUCTION Along the Mediterranean basin, the Aegean Sea islands and the Balkans constitute a high diversity area Cicadas constitute the superfamily Cicadoidea, a group which offered a number of important refugia during the of the Hemiptera Auchenorrhyncha where males typi- last glacial period, and hence where several taxa might cally communicate during pair formation and courtship have evolved and from where species might have through acoustic distinctive signals (Claridge 1985; dispersed, namely in Europe (e.g. Oosterbroek 1994; Boulard & Mondon 1995; Quartau et al. 1999; Simões Taberlet et al. 1998; Hewitt 1999; Çiplak 2004; et al. 2000). These striking acoustic signals make them Augustinos et al.
  • Differences in the Male Calling Songs of Two Sibling Species of Cicada

    Differences in the Male Calling Songs of Two Sibling Species of Cicada

    NOTE Eur. J.Entomol. 97: 437-440, 2000 ISSN 1210-5759 Differences in the male calling songs of two sibling speciesCicada of (Hemiptera: Cicadoidea) in Greece Paula C. SIMOES1, M ichel BOULARD4, Maria T. REBELO1, S akis DROSOPOULOS3, Michael F. CLARIDGE2, John C. MORGAN2 and J osé A. QUARTAU1* 1Centro de Biología Ambiental, Departamento de Zoología & Antropología, C2-30 Piso, Faculdade de Ciencias de Lisboa, Campo Grande, 1700 Lisboa, Portugal 2School ofBiosciences, University ofWales, Cardiff, CFTL, UK 3Agricultural University of Athens, Department of Agricultural Biology and Biotechnology, Iera odos 75, Votanicos, 11855 Athens, Greece 4EPHE, Biologie et Évolution des Insectes, Muséum national d’Histoire Naturelle, 45 rue Buffon, 75005 Paris, France Key words. Cicada mordoganensis, Cicada acoustic orni, signals, acoustic divergence, calling songs, Greece Abstract. Cicada orni L. is one of the most abundant and common species of cicada in Greece. However, this species was not found during recent field work on the Greek islands of Samos and Ikaria. Instead, the very closely related C. mordoganensis Boulard was found practically everywhere on these islands.C. orni and C. mordoganensis are very closely related species which are morphologi­ cally very similar (sibling species), even the male genitalia, and the acoustic signals produced by males during courtship and pair formation have the same general pattern. In order to describe the acoustic signals produced by these sibling species, temporal and spectral analyses were made of the calling songs of the males and certain acoustic variables were measured. Based on the duration of echemes, the number of pulse units they contain, the intervals between echemes and the number of echemes per second, the song of C.
  • Amberif 2018

    Amberif 2018

    AMBERIF 2018 Jewellery and Gemstones INTERNATIONAL SYMPOSIUM AMBER. SCIENCE AND ART Abstracts 22-23 MARCH 2018 AMBERIF 2018 International Fair of Ambe r, Jewellery and Gemstones INTERNATIONAL SYMPOSIUM AMBER. SCIENCE AND ART Abstracts Editors: Ewa Wagner-Wysiecka · Jacek Szwedo · Elżbieta Sontag Anna Sobecka · Janusz Czebreszuk · Mateusz Cwaliński This International Symposium was organised to celebrate the 25th Anniversary of the AMBERIF International Fair of Amber, Jewellery and Gemstones and the 20th Anniversary of the Museum of Amber Inclusions at the University of Gdansk GDAŃSK, POLAND 22-23 MARCH 2018 ORGANISERS Gdańsk International Fair Co., Gdańsk, Poland Gdańsk University of Technology, Faculty of Chemistry, Gdańsk, Poland University of Gdańsk, Faculty of Biology, Laboratory of Evolutionary Entomology and Museum of Amber Inclusions, Gdańsk, Poland University of Gdańsk, Faculty of History, Gdańsk, Poland Adam Mickiewicz University in Poznań, Institute of Archaeology, Poznań, Poland International Amber Association, Gdańsk, Poland INTERNATIONAL ADVISORY COMMITTEE Dr Faya Causey, Getty Research Institute, Los Angeles, CA, USA Prof. Mitja Guštin, Institute for Mediterranean Heritage, University of Primorska, Slovenia Prof. Sarjit Kaur, Amber Research Laboratory, Department of Chemistry, Vassar College, Poughkeepsie, NY, USA Dr Rachel King, Curator of the Burrell Collection, Glasgow Museums, National Museums Scotland, UK Prof. Barbara Kosmowska-Ceranowicz, Museum of the Earth in Warsaw, Polish Academy of Sciences, Poland Prof. Joseph B. Lambert, Department of Chemistry, Trinity University, San Antonio, TX, USA Prof. Vincent Perrichot, Géosciences, Université de Rennes 1, France Prof. Bo Wang, Nanjing Institute of Geology and Palaeontology, Chinese Academy of Sciences, China SCIENTIFIC COMMITTEE Prof. Barbara Kosmowska-Ceranowicz – Honorary Chair Dr hab. inż. Ewa Wagner-Wysiecka – Scientific Director of Symposium Prof.
  • Catalogue of Type Specimens 4. Linnaean Specimens

    Catalogue of Type Specimens 4. Linnaean Specimens

    Uppsala University Museum of Evolution Zoology section Catalogue of type specimens. 4. Linnaean specimens 1 UPPSALA UNIVERSITY, MUSEUM OF EVOLUTION, ZOOLOGY SECTION (UUZM) Catalogue of type specimens. 4. Linnaean specimens The UUZM catalogue of type specimens is issued in four parts: 1. C.P.Thunberg (1743-1828), Insecta 2. General zoology 3. Entomology 4. Linnaean specimens (this part) Unlike the other parts of the type catalogue this list of the Linnaean specimens is heterogenous in not being confined to a physical unit of material and in not displaying altogether specimens qualifying as types. Two kinds of links connect the specimens in the list: one is a documented curatorial tradition referring listed material to collections handled and described by Carl von Linné, the other is associated with the published references by Linné to literary or material sources for which specimens are available in the Uppsala University Zoological Museum. The establishment of material being 'Linnaean' or not (for the ultimate purpose of a typification) involves a study of the history of the collections and a scrutiny of individual specimens. An important obstacle to an unequivocal interpretation is, in many cases, the fact that Linné did not label any of the specimens included in the present 'Linnaean collection' in Uppsala (at least there are no surviving labels or inscriptions with his handwriting or referable to his own marking of specimens; a single exception will be pointed out below in the historical survey). A critical examination must thus be based on the writings of Linné, a consideration of the relation between between these writings and the material at hand, and finally a technical and archival scrutiny of the curatorial arrangements that have been made since Linné's time.