Marine Pollution Bulletin 64 (2012) 2077–2082

Contents lists available at SciVerse ScienceDirect

Marine Pollution Bulletin

journal homepage: www.elsevier.com/locate/marpolbul

Molecular identiﬁcation of green algae from the rafts based infrastructure of Porphyra yezoensis ⇑ ⇑ Qi Shen a, Hongye Li a, Yan Li b, Zongling Wang b, Jiesheng Liu a, , Weidong Yang a, a Department of Biotechnology, Jinan University, Guangzhou 510632, China b The First Institute of Oceanography, State Oceanic Administration, Qingdao 266061, China article info abstract

Keywords: To provide more information on the origin of the Ulva prolifera bloom in Qingdao sea area in China from Green tide 2007 to 2011, the diversity of green algae growing on the rafts of Porphyra yezoensis on the coast in Ulva Jiangsu Province was investigated based on ITS, rbcL and 5S sequences. Eighty-four of green algal samples ITS from various sites and cruises in 2010 and 2011 were collected. According to ITS and rbcL sequences, rbcL samples from the rafts of P. yezoensis fell into four clades: Ulva linza-procera-prolifera (LPP) complex, Ulva 5S ﬂexuosa, Blidingia sp. and Urospora spp. However, based on the 5S rDNA, a more resolved DNA marker, only one of the 84 samples belonged to U. prolifera. Combined with the previous reports, it is likely that U. prolifera bloom in Qingdao sea area might consist of more than one origin, and Porphyra cultivation rafts might be one of the causes. Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction images from 2008 to 2009, the drifted biomass initiated offshore of the coast of Jiangsu Province and was transported across the The excessive growth of green algae species such as Ulva, Enter- Yellow Sea to Qingdao coast by seasonal winds and surface cur- omorpha, Chaetomorpha and Cladophora, has been reported in the rents (Sun et al., 2008; Liu et al., 2009). However, the original formation of macroalgal blooms or green tide events in many parts ‘‘seed’’ source of the drifting bloom remained unclear. Some of the world including Europe, North America, South America, reports proposed that the accumulation and disposal of waste U. Japan and Australia (Fletcher, 1996; Morand and Briand, 1996; prolifera from Porphyra cultivation rafts was the most probable Hiraoka et al., 2004; Morand and Merceron, 2005; Merceron cause of the blooms (Keesing et al., 2011; Wang et al., 2007; Liu et al., 2007). One of the green tide algae, the filamentous alga Ulva et al., 2009). U. prolifera was the dominant fouling species growing prolifera, formerly known as Enteromorpha prolifera (Hayden et al., on the rafts based infrastructure of Porphyra yezoensis aquaculture. 2003), is broadly distributed along the nearshore coasts of the It was estimated that about 91–505 kg/ha U. prolifera was attached north-eastern Asia (Shimada et al., 2008). In the Yellow Sea of to P. yezoensis in the coast of Jiangsu Province, and a total biomass China, large-scale green algal blooms have occurred for five con- came up to 4956 tons during the harvesting of P. yezoensis (Liu secutive years from 2007 to 2011 (Jiang et al., 2008; Sun et al., et al., 2010a). This was sufficient to seed a bloom when they were 2008; Tian et al., 2011). Especially in the summer of 2008, the dislodged from the rafts as a result of harvesting practice (Liu et al., world’s largest green tide occurred along the coast of the Yellow 2010a). However, based on the ribotype analysis of the free-float- sea near Qingdao, China, which caused severe social problems as ing U. prolifera samples in 2008 and 2009 blooms, Duan et al. well as marine ecological issues. The dominant bloom algal species (2012) proposed that the bloom might be derived from the Sea in 2007–2009 was identified to be the Ulva linza-procera-prolifera of Japan. Similarly, Pang et al. (2010) found that the haplotypes (LPP) based on ITS and rbcL analysis (Hayden et al., 2003; Leliaert of the Yellow Sea free-floating U. prolifera were closely related to et al., 2009; Wang et al., 2010; Liu et al., 2010b,c). Later, Duan those from Japanese coast but less to European and American et al. (2012) amended it to U. prolifera based on 5S phylogenetic algae. Together with the similarity of samples from P. yezoensis analysis. farming rafts to U. linza in the morphology, they presented that It is crucial to correctly identify the origin of the bloom for land-based animal aquaculture ponds along the Jiangsu Province understanding the large-scale green tide and exploring solutions coast were the source of the green tide algae. to the problems it can potentially cause. According to satellite To provide more information on the origin of the massive drifting green tide, here we investigated the diversity of the green algae

⇑ Corresponding authors. Tel.: +86 20 85228470. growing on the rafts of P. yezoensis in the Gaoni, Niluosha, E-mail address: [email protected] (W. Yang). Xiaoyangkou of the Jiangsu Province in China from November

2010 to April 2011. The growing green algae twined on the rafts, 2.3. DNA extraction with highly variable morphology at different developmental stages and environmental conditions. So, morphological identification The fresh algal samples were washed three times with sterilized was insufficient to distinguish among the different algae species, water, and then dried with filter paper. Unialgal material for each especially among the Ulva genus. In this study, the diversity of sample was detached carefully for DNA extraction. Total DNA was the green algae was investigated based on the phylogenetic analy- extracted according to the manual of HP plant DNA extract kit sis with the sequences of nuclear encoded ribosomal DNA internal (Omega, USA). DNA quality was examined by 1% TAE agarose gels transcribed spacer region (ITS nrDNA) and the plastid encoded stained with GoldView. large subunit of ribulose-1,5-bisphosphate carboxylase/oxgenase gene (rbcL). In addition, 5S rDNA phylogenetic analysis was con- 2.4. ITS rDNA, rbcL gene and 5S rDNA spacer amplification and ducted to distinguish among the species in the LPP complex sequencing (Shimada et al., 2008; Duan et al., 2012). PCR primers for ITS, rbcL and 5S listed in Table 2 were synthe- 2. Materials and methods sized by Shanghai Sangon Biologic Engineering Technology and Service Co. Ltd., China. The PCR amplifications of ITS nrDNA and 2.1. Collection of samples rbcL genes were performed as described by Leskinen and Pamilo (1997) and Manhart (1994). As for 5S rDNA, the PCR was con- Rudong (RD), is the main coastal city for P. yezoensis aquacul- ducted as reports by Shimada et al. (2008) and Duan et al. ture in Jiangsu Province. It is located in the south-western coast (2012), in which the primer pair 5SF-5SR locates to the 5S rDNA of the Yellow Sea. So, three sites near to RD, Xiaoyangkou, Gaoni tandem arrays amplified multiple DNA fragments. Total genomic and Niluosha were chosen for exploring the distribution of green DNA (30–40 ng) was added to 50 lL PCR reactions containing 1 algae attached to the P. yezoensis. Green algae samples at the three PCR buffer (Takara, Dalian, China), 0.8 mM dNTPs (Takara), sites (Fig. 1) were taken monthly from November-2010 to May- 25 mM of each primer and 1.6 U Taq Polymerase (Takara). PCR 2011 (Table 1). To learn the relationship between diversity of the was carried out in a MJ MiniTM Gradient Thermal Cycler (BIO- green algae attached to the P. yezoensis and dominant bloom algal RAD). PCR profiles for different genes were set as follows: ITS species in Qingdao, totally 84 samples from P. yezoensis and 3 sam- nrDNA amplification included an initial denaturation at 94 °C for ples (qingdao1, qingdao2 and qingdao 724) from Qingdao sea area 5 min, followed by 35 cycles of 94 °C for 1 min 10 s, 54 °C for in China were collected during the 2011 bloom. 50 s and 72 °C for 1 min 30 s; the rbcL gene was amplified according to the reaction profile (94 °C for 3 min, followed by 35 cycles of 94 °C for1 min, 45 °C for 2 min, and 65 °C for 3 min) and the final 2.2. Treatment of algae step at 72 °C for 10 min; the 5S amplification reaction profile included an initial denaturation at 94 °C for 5 min, followed by 35 The green algae collected from the rafts of P. yezoensis were cycles of 94 °C for 1 min, 55 °C for 45 s and 72 °C for 45 s, and a fi- cleaned in situ and brought back to the laboratory in cooled box nal extension at 72 °C for 10 min. The PCR products were resolved within 24 h. After cleaning again with sterilized seawater, the algal by 1.0% agarose gel electrophoresis, excised by the gel purification samples in good growth condition were sorted out and cultured in method using the QIAquick DNA Gel Purification Kit (QIAGEN, USA) PES medium (Berges et al., 2001) for one week to remove epiphytic and sequenced by Invitrogen (Invitrogen, China). When the ITS and diatoms for further DNA analyses. 5S rDNA spacer fragments could not be directly sequenced, PCR products were purified using the QIAquick DNA Gel Purification Shandong province Kit (QIAGEN). PCR products were cloned into pMD19-T Vector Qingdao (Takara, China) according to the manufacturer’s instructions, and sequenced by Invitrogen (Invitrogen, China). 36°

2.5. Phylogenetic analysis Rizhao The phylogenetic trees were constructed by neighbor-joining 35° Haizhou Bay (NJ) method using the program Mega 4.0 (Tamura et al., 2007). The reliability of branches was evaluated with non-parametric Lianyungang bootstrapping (1000 replicates) (Felsenstein, 1985). The evolution-

Jiangsu Proince Yellow Sea ary distances of the NJ tree were computed using the Kimura 2-parameter method (Kimura, 1980). Branches corresponding to 34° partitions reproduced in <50% bootstrap replicates were collapsed. Sheyang The tree was drawn to scale, with branch lengths in the same units as those of the evolutionary distances were used to infer the Yancheng? phylogenetic tree.

C 33° B 3. Results A Rudong 3.1. Morphology and phylogenetic analysis based on ITS and rbcL sequences

32° 119° 120° 121° 122° 123° Based on the morphology, we found that green algae were widely distributed in Porphyra cultivation rafts. Among the 84 sam- Fig. 1. The sampling sites in the Jiangsu coast. A, B and C indicate Xiangyangkou, ples, 41 samples belonged to Blidingia sp. However, it was difﬁcult Gaoni and Niluosha, respectively. to further distinguish among the green algae due to the variability Q. Shen et al. / Marine Pollution Bulletin 64 (2012) 2077–2082 2079

Table 1 Description of different green algae.

Sample Collection date Collection sites Xiao1-3(4), xiao3-5(4), xiao3-2(4), xiao2-2(4), xiao1-6(4), xiao2-1(4) April–May 2011 Xiaoyangkou, Jiangsu province, China Xiao1-1(3), xiao1-2(3), xiao2-5(3), xiao2-1(3), xiao3-3(3), xiao3-2(3) March 2011 Xiao3-5(2), xiao3-6(2), xiao1-4(2), xiao1-6(2), xiao2-4(2), xiao2-5(2) February 2011 xiao1-2(1), xiao1-3(1), xiao1-6(1), xiao1-1(1) January 2011 Xiao1-2(12), xiao1-5(12), xiao2-1(12), xiao2-2(12), xiao3-3(12), xiao3-6(12) December 2010 Xiao1-4(11), xiao1-1(11), xiao2-2(11), xiao2-5(11), xiao3-5(11), xiao3-2(11) November 2010 Gao3-6(4), gao3-3(4), gao2-1(4), gao2-5(4), gao1-6(4), gao1-1(4) April–May 2011 Gaoni, Jiangsu province, China Gao1-5(3), gao1-6(3), gao2-3(3), gao2-5(3), gao3-1(3), gao3-3(3), gao3-6(3) March 2011 Gao3-5(2), gao3-6(2), gao3-1(2) February 2011 Gao3-4(1) January 2011 Gao1-2(12), gao1-1(12), gao2-2(12), gao2-6(12), gao3-6(12), gao3-3(12) December 2010 Gao1-3(11), gao1-1(11), gao2-1(11), gao2-2(11), gao3-2(11), gao3-6(11) November 2010 Ni1-3(4), ni1-6(4), ni2-5(4), ni2-1(4), ni3-5(4), ni3-1(4) April–May 2011 Niluosha, Jiangsu province, China Ni1-2(3), ni1-6(3), ni2-2(3), ni2-1(3), ni3-5(3), ni3-2(3) March 2011 Ni1-3(2), ni1-5(2), ni3-2(2), ni2-5(2) February 2011 Ni2-2(1), ni3-1(1) Jan. 2011 Ni1-1(12), ni1-4(12), ni2-1(12), ni2-5(12), ni3-5(12), ni3-2(12) Dec. 2010 Ni1-1(11), ni2-6(11), ni2-3(11), ni3-1(11), ni3-3(11) Nov. 2010 Qingdao1, qingdao2, qingdao724 Jul.2011 Qingdao sea area, China

groups (Fig. 4): the U. linza group, including 7 samples from P. yezo- Table 2 ensis cultivation rafts; the U. prolifera group, containing 1 samples PCR primers used in the study. from P. yezoensis rafts and 2 samples from Qingdao sea area during

Primes Sequence Target Direction the bloom. This result indicated that the samples in LPP clade from the P. yezoensis cultivation rafts had U. prolifera, the dominant alga FWa 50–TCGTAACAAGGTTTCCGTAGG–30 ITS Forward RVa 50–TTCCTTCCGCTTATTGATATGC–30 ITS Reverse in the Qingdao bloom. rbcLFb 50–TAAAGCAGGTGCAGGATTTAAAGC–30 rbcL Forward b 0 rbcLR 5–TATCAAATTCAAATTTAATTTCTTTCCAAAC–3 rbcL Reverse 3.3. The green alga distribution in different sampling site 5SFc 50–GGTTGGGCAGGATTAGTA –30 5S Forward 5SRc 50- AGGCTTAAGTTGCGAGTT–30 5S Reverse From Fig. 5, it can be seen that the diversity of green algae in the a Leskinen and Pamilo (1997). three sites, including LPP, U. flexuosa, U. neglecta and Blidingia sp., b Manhart (1994). c Shimada et al. (2008). was similar with some differences. However, no LPP was found in Gaoni site. in morphology at different developmental stages and environmental conditions. The morphological characteristics might not be the 4. Discussion most judicious and accurate markers for discriminating the Ulva and other green algae on the rafts. Green tide was a growing and worldwide environmental prob- For comparison, some sequences of ITS nrDNA and rbcL from lem. As mentioned in the introduction, large-scale green tide has Genbank were used to construct phylogenetic tree besides the occurred in the Yellow Sea of China for five consecutive years from samples collected from Jiangsu Province. According to ITS phyloge- 2007 to 2011. Accurate identification of the source of the green tide netic analysis (Fig. 2), 87 samples in our study were separated into had puzzled scientists for a long time. Some reports suggested that five clades with high bootstrap support: the U. linza-procera-prolif- the bloom was caused by the rapid expansion of aquaculture of P. era (LPP) (10 samples) including seven samples from Xiaoyangkou, yezoensis along the coastline of Jiangsu Province (Liu et al., 2009, one sample from Niluosha, two samples from Qingdao, and the se- 2010a). It was proposed that the accumulation and disposal of quences of U. prolifera (HM584744, AB298314, AB298315), U. linza waste U. prolifera from Porphyra cultivation rafts was the most (HM584729, AB298634) and Ulva procera (AY422521, AY260558) probable cause of the Yellow Sea blooms (Keesing et al., 2011). retrieved from Genbank; the Ulva compressa clade, containing only Here, 84 green algae species attached to the P. yezoensis rafts in dif- one sample (qingdao1) from Qingdao; Ulva flexuosa clade (28 sam- ferent locations and different cruises in 2010 and 2011 were ana- ples); Blidingia sp. clade (41 samples); Urospora neglecta clade (7 lyzed based on ITS nrDNA and rbcL sequences. Molecular data samlpes). It was noted that the three samples collected from Qing- showed that the green algal species attached on P. yezoensis rafts dao sea area during the bloom were attributed to LPP clade and U. were diverse, greater than previously thought (Duan et al., 2012). compressa clade, respectively. Samples of those green algae were grouped in the four phyloge- The rbcL phylogenetic dataset showed more conserved than netic clades: the LPP clade, the U. flexuosa clade, U. neglecta clade, that of ITS (Fig. 3), all 87 samples formed four clades: LPP clade and the Blidingia sp. clade. This result was consistent with findings (10 samples); U. flexuosa clade (28 samples); U. compressa clade by Tian et al. (2011), suggesting that the large scale of green algae (1 samples), and the other clade including samples fell into Blidin- such as Ulva, Blidingia, and U. neglecta were widely distributed in P. gia sp. and U. neglecta clade in the ITS phylogenetic tree, which was yezoensis rafts. high homology with Tellamia contorta, Pseudendoclonium fucicola 5S rDNA spacer, a more resolved DNA marker, had already been and Blidingia minima. Similar to the ITS result, the three samples reported to be useful in inferring inter-species phylogeny of Phae- collected from Qingdao sea area during the bloom were attributed ophyceae (Yotsukura et al., 2002, 2006). It was about 10 times more to LPP clade and U. compressa clade, respectively. variable than ITS region and thus allowed a better understanding of 3.2. 5S phylogenetic analysis the phylogenetic relationships within the LPP complex (Shimada et al., 2008). To confirm the taxonomic status of the LPP complex, According to 5S sequence, LPP clade in the phylogenetic tree samples in the LPP clade were further analyzed based on 5S se- based on ITS and rbcL sequence was clearly divided into two quences. Similar to the previous reports by Duan et al. (2012), 2080 Q. Shen et al. / Marine Pollution Bulletin 64 (2012) 2077–2082

Fig. 3. Neighbor-joining (NJ) tree constructed from the analysis of rbcL gene Fig. 2. Neighbor-joining (NJ) tree of green algae based on the ITS sequences. Values sequences. Values at branch nodes represent NJ bootstrap probability, respectively at branch nodes represent NJ bootstrap probability, respectively (>50%). For (>50%). The numbers at inter-for sequences acquired from GenBank, the accession sequences acquired from GenBank, the Accession number is followed by the number is followed by the species name. For samples from the rafts of P. yezoensis species name. For samples from the rafts of P. yezoensis cultivation, xiao, gao and ni cultivation, xiao, gao and ni indicate Xiangyangkou, Gaoni and Niluosha, respec- indicate Xiangyangkou, Gaoni and Niluosha, respectively, the number in follow tively, the number in follow represents different rafts and the number in bracket represents different rafts and the number in bracket represents different cruise. represents different cruise. Q. Shen et al. / Marine Pollution Bulletin 64 (2012) 2077–2082 2081

In conclusion, our results of the diversity of green algae on the raft based infrastructure of P. yezoensis demonstrated that U. prolifera bloom in Qingdao sea area might have more than one origin, and the Porphyra cultivation raft was only one of the possible sources.

Acknowledgements

This work was supported by the National Basic Research Pro- gram of China (973 Program) (2010CB428702) and the National Natural Science Foundation of China (41176088).

References

Berges, J.A., Franklin, D.J., Harrison, P.J., 2001. Evolution of an artificial seawater medium: provements in enriched seawater, artificial water over the last two Fig. 4. Neighbor-joining (NJ) tree constructed from the analysis of 5S gene decades. J. Phycol. 37, 1138–1145. sequences. Values at branch nodes represent NJ bootstrap probability, respectively Ding, L., Luan, R., 2009. The taxonomy, habit and distribution of a green alga (>50%). For sequences acquired from GenBank, the accession number is followed by Enteromorpha prolifera (Ulvales, Chlorophyta). Oceanol. Limnol. Sin. 40, 68–71. the species name. For samples from the rafts of P. yezoensis cultivation, xiao, gao and Duan, W., Guo, L., Sun, D., Zhu, S., Chen, X., Zhu, W., Xu, T., Chen, C., 2012. ni indicate Xiangyangkou, Gaoni and Niluosha, respectively, the number in follow Morphological and molecular characterization of free-floating and attached green macroalgae Ulva spp. in the Yellow Sea of China. J. Appl. Phycol. 24, 97– represents different rafts and the number in bracket represents different cruise. 108. Fletcher, R.T., 1996. The occurrence of ‘green-tide’. In: Schramm, W., Nienhuis, P.H. (Eds.), Marine Benthic Vegetation–Recent Changes and the Effects of Eutrophication. Springer Verlag, Berlin, pp. 7–43. 60% Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. 50% LPP Hayden, H.S., Blomster, J., Maggs, C.A., Silva, P., Stanhope, M.J., Waaland, J.R., 2003. Ulva flexuosa Linnaeus was right all along: Ulva and Enteromorpha are not distinct genera. 40% Eur. J. Phycol. 42, 275–284. Blidingia sp. Hiraoka, M., Ohno, M., Kawaguchi, S., Yoshida, G., 2004. Crossing test among floating 30% Urospora neglecta Ulva thalli forming ‘green tide’ in Japan. Hydrobiologia 512, 239–245. Jiang, P., Wang, J., Cui, Y., Li, Y., Lin, H., Qin, S., 2008. Molecular phylogenetic analysis 20% of attached Ulvaceae species and free-floating Enteromorpha from Qingdao coasts in 2007. Chin. J. Oceanol. Limnol. 26, 276–279. 10% Keesing, J.K., Liu, D., Fearns, P., Garcia, R., 2011. Inter- and intra-annual patterns of Ulva prolifera green tides in the Yellow Sea during 2007–2009, their origin and 0% relationship to the expansion of coastal seaweed aquaculture in China. Mar. Xiaoy angkou Gaoni Niluosha Poll. Bull. 67, 1169–1182. Percentage of the green algae distribution algae green of the Percentage Kimura, M., 1980. A simple method for estimating evolutionary rates of base Sampling site substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. Leliaert, F., Zhang, X., Ye, N., Malta, E., Engelen, A.H., Mineur, F., Verbruggen, H., De Clerck, O., 2009. Research note: identity of the Qingdao algal bloom. Phycol. Res. Fig. 5. The green algae distribution in different sampling site. 57, 147–151. Leskinen, E., Pamilo, P., 1997. Evolution of the ITS sequences of ribosomal DNA in Enteromorpha (Chlorophyceae). Hereditas 126, 17–23. the LPP complex was further subdivided into two groups: U. linza Liu, D., Keesing, J.K., Dong, Z., Zhen, Y., Di, B., Shi, Y., Fearns, P., Shi, P., 2010a. Recurrence of the world’s largest green-tide in 2009 in Yellow Sea, China: group and U. prolifera group, indicating that these two entities Porphyra yezoensis aquaculture rafts confirmed as nursery for macroalgal were genetically separated. Based on the results from 5S se- blooms. Mar. Poll. Bull. 60, 1423–1432. quences, 7 samples in the LPP clade from P. yezoensis cultivation Liu, D., Keesing, J.K., Xing, Q., Shi, P., 2009. World’s largest macroalgal bloom caused by expansion of seaweed aquaculture in China. Mar. Poll. Bull. 58, 888–895. rafts belonged to U. linza, one sample from P. yezoensis cultivation Liu, F., Pang, S., Chopin, T., Xu, N., Shan, T., Gao, S., Sun, S., 2010b. The dominant Ulva rafts and two from Qingdao sea area during the bloom belonged to strain of the 2008 green algal bloom in the Yellow Sea was not detected in the U. prolifera. That’s to say, there was only one sample among the 84 coastal waters of Qingdao in the following winter. J. Appl. Phycol. 22, 531–540. samples from the P. yezoensis cultivation rafts belonged to U. prolif- Liu, F., Pang, S., Xu, N., Shan, T., Sun, S., Hu, X., Yang, J., 2010c. Ulva diversity in the Yellow Sea during the large-scale green algal blooms in 2008–2009. Phycol. Res. era. This small proportion of U. prolifera among the green algal 58, 270–279. samples from P. yezoensis cultivation rafts and the dominating Manhart, J.R., 1994. Phylogenetic analysis of green plant rbcL sequences. Mol. bloom algae in Qingdao largely diminished the possibility that Phylogenet. Evol. 3, 114–127. Merceron, M., Antoine, V., Auby, I., Morand, P., 2007. In situ growth potential of the waste U. prolifera from Porphyra cultivation rafts was the main subtidal part of green tide forming Ulva spp. stocks. Sci. Total Environ. 384, 293– cause of the Yellow Sea blooms. Combined that previous finding 305. mentioned above (Duan et al., 2012; Liu et al., 2009), it was likely Morand, P., Briand, X., 1996. Excessive growth of macroalgae: a symptom of environmental disturbance. Bot. Mar. 39, 491–516. that U. prolifera bloom in Qingdao sea area might have more than Morand, P., Merceron, M., 2005. Macroalgal population and sustainability. J. Coastal one origin, and the Porphyra cultivation raft was only one of the Res. 21, 1009–1020. possible causes. Pang, S., Liu, F., Shan, T., Xu, N., Zhang, Z., Gao, S., Chopin, T., Sun, S., 2010. Tracking the algal origin of the Ulva bloom in the Yellow Sea by a combination of Most previous findings indicated that one algal species formed molecular, morphological and physiological analyses. Mar. Environ. Res. 69, the green tide (Zhang et al., 2010; Ding and Luan, 2009). Recently, 207–215. Duan et al. (2012) identified three free-floating Ulva species: U. Shimada, S., Yokoyama, N., Arai, S., Hiraoka, M., 2008. Phylogeography of the genus Ulva (Ulvophyceae, Chlorophyta), with special reference to the Japanese compressa, U. pertusa and U. prolifera. In this study, based on the se- freshwater and brackish taxa. J. Appl. Phycol. 20, 979–989. quences of ITS, rbcL and 5S, samples from Qingdao sea area during Sun, S., Wang, F., Li, C.L., et al., 2008. Emerging challenges: massive green algae bloom in 2011 were distinguished to U. compressa and U. prolifera. blooms in the Yellow Sea. Nat. Proc., hdl:10101/npre.2008.2266.1. These all supported that blooms involved more than one species of Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596– Ulva. 1599. 2082 Q. Shen et al. / Marine Pollution Bulletin 64 (2012) 2077–2082

Tian, X., Huo, Y., Chen, L., He, J., Zhang, J., Jia, R., Liu, H., Wang, J., Xu, R., Yang, J., Hu, X., Yotsukura, N., Kawai, T., Kawashima, S., Ebata, H., Ichimura, T., 2006. Nucleotide Fang, J., Ma, J., He, P., 2011. Molecular detection and analysis of green seaweeds sequence diversity of the 5S rDNA spacer in the simple blade kelp genera from Rudong coasts in Jiangsu Province. Chin. Sci. 56, 309–317 (in Chinese). Laminaria, Cymathaere and Kjellmaniella (Laminariales, Phaeophyceae) from Wang, J., Jiang, P., Cui, Y., Li, N., Wang, M., Lin, H., He, P., Qin, S., 2010. Molecular northern Japan. Phycol. Res. 54, 269–279. analysis of green-tide-forming macroalgae in the Yellow Sea. Aquat. Bot. 93, Yotsukura, N., Kawai, T., Motomura, T., Ichimura, T., 2002. Tandem 5S ribosomal 25–31. RNA genes and the spacer region sequences of three Japanese Laminaria species. Wang, R., Xiao, H., Zhang, P., Qu, L., Cai, H., Tang, X., 2007. Allelopathic effects of Ulva J. Appl. Phycol. 14, 233–239. pertusa, Corallina pilulifera and Sargassum thunbergii on the growth of the Zhang, X., Wang, H., Mao, Y., Liang, C., Zhuang, Z., Wang, Q., Ye, N., 2010. Somatic dinoﬂagellates Heterosigma akashiwo and Alexandrium tamarense. J. Appl. cells serve as a potential propagule bank of Enteromorpha prolifera forming a Phycol. 19, 109–121. green tide in the Yellow Sea. J. Appl. Phycol. 22, 173–180.