Molecular Basis of Fibrinogen Naples Associated with Defective Thrombin Binding and Thrombophilia

Molecular basis of fibrinogen Naples associated with defective thrombin binding and thrombophilia. Homozygous substitution of B beta 68 Ala----Thr.

J Koopman, … , J Grimbergen, P M Mannucci

J Clin Invest. 1992;90(1):238-244. https://doi.org/10.1172/JCI115841.

Research Article

In an abnormal fibrinogen (fibrinogen Naples) associated with congenital thrombophilia we have identified a single base substitution (G----A) in the B beta chain gene that results in an amino acid substitution of alanine by threonine at position 68 in the B beta chain of fibrinogen. The propositus and two siblings were found to be homozygous for the mutation, whereas the parents and another sibling were found to be heterozygous. Individuals homozygous for the defect had a severe history of both arterial and venous thrombosis; heterozygous individuals had no clinical symptoms. The three homozygotes had a prolonged thrombin clotting time in plasma, whereas the heterozygotes had a normal thrombin clotting time. Fibrinopeptide A and B (FpA and FpB) release from purified fibrinogen by human alpha-thrombin was delayed in both the homozygous propositus and a heterozygous family member. Release of FpA from the normal and abnormal amino-terminal disulfide knot (NDSK) corresponded to that found with the intact fibrinogens, indicating a decreased interaction of thrombin with the NDSK part of fibrinogen Naples. Binding studies showed that fibrin from homozygous abnormal fibrinogen bound less than 10% of active site inhibited alpha-thrombin as compared with normal fibrin, while fibrin formed from heterozygous abnormal fibrinogen bound approximately 50% of alpha-thrombin. These results suggest that the mutation of B beta Ala 68----Thr affects the binding of alpha-thrombin […]

Find the latest version: https://jci.me/115841/pdf Molecular Basis of Fibrinogen Naples Associated with Defective Thrombin Binding and Thrombophilia Homozygous Substitution of BB 68 Ala -- Thr Jaap Koopman,** Frits Haverkate,t Susan T. Lord,1 Jos Grimbergen,* and Pier Mannuccio Mannuccill * University Hospital and *Gaubius Laboratory Instituut voor Verouderings-en Vaatziekte Onderzoek, 2300 AK Leiden, The Netherlands; ODepartment of Pathology, University of North Carolina, Chapel Hill, North Carolina 27599-7525; and 1A. Bianchi Bonomi Hemophiliaand Thrombosis Centre and Institute ofInternal Medicine, University ofMilan, 20122 Milan, Italy

Abstract tides A and B (FpA and FpB)' from the amino terminus of the Aa. and B,3 chains, respectively. The interaction of thrombin In an abnormal fibrinogen (fibrinogen Naples) associated with with fibrin(ogen) involves multiple sites on both thrombin and congenital thrombophilia we have identified a single base sub- fibrin(ogen). An important domain of fibrinogen that interacts stitution (G - A) in the B,8 chain gene that results in an amino with the catalytic'site of thrombin is located in the Aa chain acid substitution of alanine by threonine at position 68 in the between amino acids 1 and 23 (2-6). The interaction ofthrom- BB chain of fibrinogen. The propositus and two siblings were bin with fibrin through a site independent of the catalytic site found to be homozygous for the mutation, whereas the parents (anion-binding exosite) (7-12) is located in a cyanogen bro- and another sibling were found to be heterozygous. Individuals mide (CNBr)-derived fragment of the amino-terminal part of homozygous for the defect had a severe history of both arterial the fibrin(ogen) molecule amino-terminal disulfide knot and venous thrombosis; heterozygous individuals had no clini- (NDSK) (13-15). Binding of a-thrombin to fibrin by the an- cal symptoms. The three homozygotes had a prolonged throm- ion-binding exosite results in the removal of thrombin from bin clotting time in plasma, whereas the heterozygotes had a solution (7, 9). It has been proposed that this interaction plays normal thrombin clotting time. Fibrinopeptide A and B (FpA an important role in the regulation of thrombus formation in and FpB) release from purified fibrinogen by human a-throm- vivo by limiting the amount of free active thrombin in the bin was delayed in both the homozygous propositus and a het- circulation (7). Congenitally abnormal fibrinogens are valuable erozygous family member. Release of FpA from the normal and tools for structure-function studies of human fibrinogen. They abnormal amino-terminal disulfide knot (NDSK) corresponded also provide a basis for correlating the molecular defect with to that found with the intact fibrinogens, indicating a decreased the clinical symptoms of affected individuals. Many abnormal interaction of thrombin with the NDSK part of fibrinogen Na- fibrinogens have been described (16), of which a large number ples. Binding studies showed that fibrin from homozygous ab- show defective release of fibrinopeptides due to a mutation at normal fibrinogen bound < 10% of active site inhibited a- or near the thrombin cleaved bond (17-20). The structural thrombin as compared with normal fibrin, while fibrin formed defect of an abnormal fibrinogen (fibrinogen New York I) with from heterozygous abnormal fibrinogen bound - 50% of a- impaired thrombin binding to fibrin (21) has been determined. thrombin. These results suggest that the mutation of BB Ala This fibrinogen lacks amino, acids 9-72 in the Bfl-chain (22). 68 -- Thr affects the binding of a-thrombin to fibrin, and that The patient, who was shown to be heterozygous, suffered from defective binding results in a decreased release of FpA and FpB thrombotic episodes (23). Fibrinogen Naples (Milano II) (24, in both homozygous and heterozygous abnormal fibrinogens. 25) is another abnormal fibrinogen associated with congenital (J. Clin. Invest. 1992. 90:238-244.) Key words: amino-termi- thrombophilia. Preliminary work on fibrinogen Naples demon- nal disulfide knot * dysfibrinogenemia * fibrinopeptide release. strated a defective interaction between bovine thrombin and polymerase chain reaction * a-thrombin binding fibrin of the propositus (24). In this article we report the structural defect of fibrinogen Naples, inferred from genetic analysis Introduction of patient DNA using the polymerase chain reaction (PCR) (26). The presence of the mutation in the family members, the The fibrinogen molecule is involved in the final phase of blood binding of human a-thrombin to fibrin, and the relationship coagulation and consists of pairs ofAa, Bf, and y chains linked between the defect and clinical symptoms were also deter- by 29 disulphide bonds (1). The conversion of fibrinogen to mined. fibrin is initiated by thrombin catalyzed cleavage of fibrinopep- Methods Patients. The propositus (11.3) developed postoperative deep-vein thrombosis at the age of 33 yr. His sister (11. 1) had a stroke at the age of 25 yr due to thrombotic occlusion of the internal carotid artery and his Address reprint requests to Dr. Haverkate, Gaubius Laboratory, brother (11.2) had a stroke and thrombosis ofthe abdominal aorta at the IVVO-TNO, P. 0. Box 430, 2300 AK Leiden, The Netherlands. age of 21 yr. Another brother (11.4) of the propositus is asymptomatic, Receivedfor publication 19 September 1991 and in revisedform 30 as are his parents (. 1 and 1.2) (who are first cousins). December 1991.

J. Clin. Invest. 1. Abbreviations used in this paper: CNBr, cyanogen bromide; DFP, © The American Society for Clinical Investigation, Inc. difluorophosphate; FpA and FpB, fibrinopeptides A and B; NDSK, 0021-9738/92/07/0238/07 $2.00 amino-terminal disulfide knot; PCR, polymerase chain reaction; t-PA, Volume 90, July 1992, 238-244 tissue-type plasminogen activator.

238 Koopman et al. Coagulation studies on plasma. Blood was collected by venipunc- fibrin monomers was obtained by increasing the pH and performed by ture and anticoagulated with 0.1 vol of 0.11 M trisodium citrate. adding 60 ,d of the fibrin monomer solution to 740 ,1 of 0.1 M Tris/ Plasma was prepared by centrifugation at 2,300 g for 30 min at 4°C. HCI, pH 7.5. The increase in absorbance at 350 nm was recorded as a Thrombin clotting times were performed at 37°C with 200 Al ofplasma function of time on a spectrophotometer (SP 1700; Pye Unicam, Cam- and 50 Ml of human a-thrombin (1,000 National Institutes of Health bridge, UK). (NIH) U/mg; Protogen, Lafelfingen, Switzerland), dissolved in 0.15 M Preparation of ["C]difluorophosphate (DFP) a-thrombin. 1 ml of NaCl containing 0.025% (wt/vol) gelatin to a concentration of 25 NIH human a-thrombin, dissolved at 1 mg/ml in 10 mM Tris/HCl, pH 8.3, U/ml. Reptilase (Boehringer Mannheim, Mannheim, FRG) clotting containing 0.75 M NaCl, was incubated with 100 ,d of ['4C]DFP (108 time was performed as described (24). Fibrinogen concentration was mCi/mmol, 1.9 MM/ml; New England Nuclear, s'Hertogenbosch, The determined functionally according to Clauss (27) and immunologically Netherlands) for 90 min at 250C. Subsequently 10 Ml of a 0.1 M DFP according to Mancini et al. (28). solution in dry isopropanol was added, and incubated for 30 min. The Purification offibrinogen and NDSK Fibrinogen was purified from sample was dialyzed against 50 mM Tris/HCl, pH 7.5, 100 mM NaCl plasma as described (29) and dialyzed against PBS for 24 h at 4°C. for 24 h at 40C. Protein concentration was measured spectrophotomet- NDSK was purified after CNBr digestion of purified fibrinogen (30) by rically at 280 nm (A'%"C"' = 18.0 [34]). The amidolytic activity ofinhib- a fast protein liquid chromatography (FPLC) system equipped with a ited thrombin, determined by using the synthetic substrate S-2238 Superose 12 column (Pharmacia, Uppsala, Sweden). The column was (KabiVitrum, Stockholm, Sweden) according to the manufacturer's equilibrated with 10% acetic acid containing 0.1 M NaCl and run at a instructions, was < 0.05% of the original activity. The relative a-, ,B-, flow rate of 1.0 ml/min. The CNBr digest, 6 mg of protein in 0.3 ml, and y-thrombin content was determined by SDS-PAGE (31) followed was injected and 0.5-ml fractions were collected. Fractions 12-15 (Fig. by autoradiography. The amount of a-thrombin was > 95% (Fig. 2). 1) were pooled and analyzed on SDS-PAGE (3 1). The purified fibrino- To prevent nonspecific adsorption, gelatin (final concentration 0.1% gen NDSK showed an Mr - 65,000 and a purity of - 90% (Fig. 1). wt/vol) was added to the thrombin solution, and this solution was Pooled fractions were dialyzed against distilled water, lyophilized, and stored at -70°C. dissolved in PBS to a concentration of 0.7 mg/ml. The fibrinogen and ['"C]DFP a-thrombin binding to fibrin. Fibrinogen was dialyzed NDSK concentrations were measured spectrophotometrically at 280 against 50 mM Tris/HCI, pH 7.5, 100 mM NaCl, and diluted to 0.5 nm (fibrinogen, A'%"," = 15.0 (32), NDSK, A"%,"mn = 12.0 [calculated mg/ml. Part of this fibrinogen solution was radiolabeled with 125I from amino acid composition]); the yield of this purification was (Amersham, Buckinghamshire, UK) as described (35). To 0.15 ml of - 65%. fibrinogen, 50 ul ofsolutions containing different amounts of['4C]DFP Release offlbrinopeptides fromflbrinogen and NDSK. The rate of inhibited a-thrombin diluted in 50 mM Tris/HCI, pH 7.5, 100 mM FpA and FpB release was determined at 37°C with 100 Ml of fibrinogen NaCI, 0.1% (wt/vol) gelatin were added. Subsequently, fibrin forma- solution (4.0 mg/ml) or NDSK solution (0.7 mg/ml) and 10 M ofeither tion was induced by incubating with 10 ,l of undiluted Reptilase solu- I NIH U/ml human a-thrombin or 1:30 diluted Reptilase. The reaction for 30 min. Fibrin was collected by centrifugation for 10 min at tions were stopped at various times by placing the samples in a boiling 12,000 g. The pellet was washed three times with 0.5 ml 50 mM Tris/ water bath for 2 min. The samples were centrifuged at 12,000 g for 10 HCI, pH 7.5, 100 mM NaCl, and dissolved in 0.2 ml of 50 mM acetic min, and 50 Ml of the supernatant was analyzed by HPLC (LKB Pro- acid. The sample was mixed with 3.0 ml of scintillation fluid (Ultima dukter, Bromma, Sweden) on a C- 18 reversed-phase column (Chrom- Gold, Packard Instrument Co., Inc., Downers Grove, IL) and 14C was pack, Middelburg, The Netherlands) (24, 33). The amount of FpA and counted (Tricarb 1900 CA, Packard Instrument Co., Inc.). The FpB released was determined by measuring the peak area. amount of fibrin formed was determined in parallel experiments con- Fibrin polymerization. Purified fibrinogen was dissolved in PBS to taining trace amounts of '25I-fibrinogen. After dissolving the fibrin in a concentration of 2.0 mg/ml. 1 ml of this solution was clotted by acetic acid, the amount of radioactivity was counted in a y counter adding 0.1 ml of human a-thrombin (25 NIH U/ml) or undiluted Rep- (Cobra, Packard Instrument Co., Inc.). Under these conditions normal tilase over a period of 5 h at 37°C. The fibrin was collected by centrifu- fibrinogen and fibrinogen Naples II.3 and II.4 were 93-96% clottable. gation, washed four times with PBS, and subsequently dissolved in 20 Fibrin stimulation oftissue-type plasminogen activator (t-PA). The mM acetic acid to a concentration of 2.0 mg/ml. Polymerization of the stimulatory capacity of Reptilase and thrombin-induced fibrin mono-

2 2

E C 0 7 1 co ciJ 6

V v Figure 1. Elution profiles of /9A/\/\l V /\ FPLC purification of NDSK from CNBr digest of fibrinogen 0 0 and SDS-PAGE analysis of 0 10 20 30 40 0 10 20 30 40 pooledfractions 12-l5.(A)Nor- mal fibrinogen; (B) fibrinogen FRACTION NUMBER Naples 11.3. Fibrinogen Naples: A Homozygous Dys/ibrinogenemia 239 ing 0.5% (wt/vol) SDS, and exposed to x-ray film (X-AR, Eastman - 94 Kodak Co., Rochester, NY) for 16 h. - 67 Results - 43 Coagulation studies on plasma. Table I shows the results of the 30 thrombin and Reptilase clotting time assays and of the immu- - 20.1 nological and functional fibrinogen assays performed on - 14.4 Figure 2. Autoradiogram of ['4C]DFP a-throm- plasma of normal individuals, the propositus (II.3), and his bin after SDS-PAGE under reducing conditions. family members. The propositus and two of his siblings (I. 1, 11.2) showed a strongly delayed thrombin clotting time, but a normal Reptilase time. They also showed a discrepancy between the immunologically and the functionally determined mers, prepared as described for fibrin polymerization, was assayed as fibrinogen concentration. Three other family members (father, described previously (36). mother, and one other sibling: 1. 1, 1.2, and 11.4) showed normal PCR. Genomic DNA was isolated from blood cells as described thrombin and Reptilase clotting times and no significant differ- (37). Oligonucleotides were synthesized on a model 380A DNA synthe- the immunologically and functionally deter- sizer (Applied Biosystems, Inc., Foster City, CA). Oligonucleotides ence between ala(5'GCAGATAGTGGTGAAGGTGAC3') and a lb(5'GTTATTG- mined fibrinogen concentration. GCTGAGGAAAAATCGCC3') were used to amplify the part of the Fibrinopeptide release from fibrinogen. Fig. 3 shows the a-chain gene, coding for amino acids 1-95. Oligonucleotides thrombin-catalyzed release of the FpA and FpB from normal #l a(5'GGTGTTGGAATAGTTACATTCC3') and fl b(5'GGTGTG- fibrinogen, fibrinogen Naples 11.3 (propositus with prolonged TGAGTTCTTCTGGA3') were used to amplify the part of the Bfl- thrombin clotting time), and Naples II.4 (sibling with normal chain gene, coding for amino acids 9-209. fl2a(5'GCCTCTAAGGTT- thrombin clotting time). FpA release (Fig. 3 A) from both fi- GTAGGAATTCTTCAG3')andfl2b(5'ATCAGTGCACCCACCAAG- brinogens Naples 11.3 and 11.4 is strongly delayed as compared TCTGGG3') were used to amplify the ,B-gene segment coding for with normal fibrinogen. There is a large difference in the amino acids 9-72. Oligonucleotidesy Ila(5'GCTCTTCACAAAACG- amount of FpA released after 60 min from normal fibrinogen TTGTTTAAAATGGAATTCTGG3')andy lb(5'CAGTCTTGCAGA- from Naples 11.4 (63%) and Naples 11.3 GCAAATTAAAACAAAAATCCTTAC3') were used to amplify the (100%) and fibrinogens of - 10 min part of the y-chain gene coding for amino acids 1-108. Amplification (24%). Fibrinogen Naples I.3 also showed a lag by PCR (26) was performed in a 1O0-,l reaction volume containing 1 before any FpA could be detected; fibrinogen Naples II.4 and gg of genomic DNA, 0.2 mM of each dNTP (Pharmacia), 0.2 ,uM of normal fibrinogen did not show this lag period. The release of each primer in lx reaction buffer (10 mM Tris/HCl, pH 8.3 at 25°C, FpB (Fig. 3 B) from fibrinogens Naples 11.3 and II.4 was also 50 mM KCI, 3.0 mM MgCl2 and 0.00 1% (wt/vol) gelatin). The DNA strongly delayed as compared with normal fibrinogen. After 60 was denatured at 95°C for 8 min and 2.0 U Taq DNA polymerase min, normal fibrinogen released 92% of FpB, fibrinogen Na- (Perkin-Elmer Cetus, Emeryville, CA) were added. Cycles consisted of ples 11.4 released 30% of FpB, and Naples 11.3 only released a 1-min 95°C, 0.5-min 60°C, and 3-min 70°C incubation. After 30 10% of FpB. With normal fibrinogen and fibrinogen Naples cycles 5 gul of the sample was analyzed on a 1.0% agarose gel (A-601 3, II.4, FpB was detected after a lag period of 2.5 min; with fibrin- Sigma Chemical Co., St. Louis, MO). this was 25 min. Reptilase-cata- Direct sequencing PCR fragments. PCR samples were run on a 1% ogen Naples I.3 lag period (wt/vol) ultralow gelling agarose gel (A-5030, Sigma Chemical Co.). lyzed release of FpA was the same for all three fibrinogens (data The band with the appropriate size, as predicted by the genomic se- not shown). quence of the Aa (16), Bf (16, 38), andy chain genes (36), was cut out Fibrinopeptide release ofNDSK. Fig. 4 shows the release of of the gel and heated to 65°C. 1 gil of the melted agarose, containing FpA and FpB by thrombin from NDSK purified from normal - 10 ng of DNA, was mixed with 1 gl of the appropriate PCR primer fibrinogen and fibrinogen Naples 11.3. As was found with intact (60 ng), and 2 ,ul of SX sequence buffer (T7 sequence kit, Promega fibrinogens, the release of FpA from NDSK Naples 11.3 was Corp., Madison, WI), the volume was brought up to 10 gl with distilled strongly delayed as compared with that of normal NDSK. The water. The mixture was heated to 95°C for 3 min and immediately put release of FpA from both normal and Naples I.3 NDSK was on ice. Labeling and termination reactions were performed using the T7 DNA sequence kit (Promega Corp.) according to the manufacturer's instruction. I. Studies Southern blot analysis offamily members and normal population. Table Plasma Coagulation chain gene containing the sequence Amplified fragments of the BB Plasma clotting time Plasma fibrinogen coding for amino acids 9-72 (- 50 ng) were run on a 2% (wt/vol) agarose gel (A-6013, Sigma Chemical Co.). The gel was washed (twice Human for 15 min) with 0.5 M NaOH, 1.5 M NaCl, and the denatured DNA a-thrombin Reptilase Functional Immunological using was transferred to a nylon membrane (Hybond N, Amersham) S mg/mi the Vacugene blotting system (LKB Produkter). 100 ng of sequence- specific oligonucleotides (f-normal: 5TGTCTTCACGCTGACC- Normal 19.8 22.1 2-4 2-4 CAG3 and f-Naples: 5TGTCTTCACACTGACCCAG3') were radio- 1.1 21.3 22.3 2.1 2.5 labeled with T4 polynucleotide kinase (Gibco BRL, Breda, The Neth- 1.2 20.7 22.6 2.6 2.8 erlands) according to the manufacturer's instructions, using > 21.9 1.6 2.7 with 11.1 180 [y-32P]ATP (3,000 Ci/mmol, Amersham). The blots were washed 1.4 2.4 0.015 M and 11.2 > 180 22.4 2x SSC (I x SSC contains 0.15 M NaCl and Na3C6H507) 3.0 hybridized with the labeled oligonucleotides in 40 ml of 7% SDS, 0.36 11.3 > 180 21.8 1.7 M Na2HPO4, 0.14 M NaH2PO4, and 10 mM EDTA for 4 h at 42°C. 11.4 21.0 22.9 2.3 2.5 Blots were washed three times for 30 min at 58°C with 6x SSC contain-

240 Koopman et al. A B

100 100 w -JC,)

50 50 wcn w

_- 0._._0_. Figure 3. Release of fibrinopeptides 0 20 40 60 0 20 40 60 from intact fibrinogen by human a-thrombin, determined by HPLC. (A) FpA and (B) FpB release from (a) normal fibrinogen (A) fibrinogen Naples 11.4, and (v) fibrinogen Na- TIME (min) ples 11.3.

identical to the release from intact normal and Naples 11.3 fi- ported previously (24), and indicate that the mutation in fibrin- brinogen, respectively (compare Fig. 4 with Fig. 3 A). ogen Naples does not affect the fibrin polymerization. The release of FpB from NDSK Naples I.3 was delayed as Binding ofactive-site inhibited human a-thrombin tofibrin. compared with normal NDSK. In contrast to the FpA release, Fig. 5 shows that the binding of [14C]DFP inhibited a-thrombin the FpB release from normal NDSK is slower than the FpB to Reptilase-induced fibrin clots from normal fibrinogen and release from intact normal fibrinogen (compare Fig. 4 with Fig. fibrinogens Naples II.3 and II.4. With normal fibrin, thrombin 3 B). However, the FpB release of NDSK Naples II.3 was ap- binding increased with increasing thrombin concentration,

proximately the same as the FpB release of intact fibrinogen reaching saturation at - 1 mol of inhibited a-thrombin per Naples II.3 (compare Fig. 4 with Fig. 3 B). mol of fibrin. With fibrin Naples 11.4, the shape of the binding The release of FpA by Reptilase from NDSK Naples II.3 curve was similar, but saturation was achieved at - 0.5 mol of was the same as that from normal NDSK (data not shown). thrombin per mol of fibrin. Thrombin bound poorly to fibrin Fibrin polymerization. The polymerization profiles of fi- Naples I.3 with < 0.1 mol of thrombin bound/mol of fibrin at brin monomers obtained from fibrinogen Naples I.3, by Rep- the highest thrombin concentration tested. Scatchard analysis tilase and thrombin, were similar to the profiles obtained with of the binding data for normal fibrinogen and Naples II.4 (in- the corresponding monomers prepared from normal fibrino- set, Fig. 5) indicated one class of binding sites. The maximal gen (data not shown). These results are consistent with the molar binding ratio (thrombin/fibrin) for normal fibrin was normal Reptilase clotting time and prothrombin-staphyloco- 1.1±0.25 with Ka = 12.7±3.0 X I05 M-', for fibrin Naples 11.4 agulase clotting time of purified fibrinogen Naples 11.3, re- this ratio was 0.70±0.15 with Ka = 13.8±3.1 x 105 M-'. No Scatchard plot could be constructed for the binding data ob- 100 r tained with fibrin Naples II.3, because of low binding under these conditions. Fibrin stimulation oft-PA-inducedplasminogen activation. The stimulatory effect of fibrin Naples 11.3 on t-PA-induced plasminogen activation was normal, as compared with fibrin prepared from normal fibrinogen, by both Reptilase and w thrombin (data not shown). These results indicate that the in- CO, 50 teraction among fibrin Naples, t-PA, and plasminogen in a w purified system is not affected by the mutation in fibrinogen w Figure 4. Release of fi- Naples. This concurs with the previously described normal in- brinopeptides from pu- teraction between fibrin Naples and several components of the rified NDSK by human fibrinolytic system in plasma (24). It also indicates that the a-thrombin determined observed thrombophilia in the affected individuals is not re- by HPLC. (e) FpA and oe~l F (o) FpB form normal lated to defective fibrinolysis. 0 20 40 60 NDSK, and (.) FpA and Amplification and direct sequencing ofgenomic DNA frag- (o) FpB from NDSK ments. Based on the evidence of fibrinopeptide release by TIME (min) Naples 11.3. thrombin, which showed that the defect was located in the

Fibrinogen Naples: A Homozygous Dysfibrinogenemia 241 c = 7. ._ -1C<2 Figure (Top) Pedigree .0D of the family. The pro- ____ positus (11.3) has symptoms of venous throm- 1 4b 1 * 2 3 4 boembolism, and his E sister (11. 1) and brother (11.2) have symptoms C A_ of arterial thrombosis, 0 A _ _= * whereas the parents 1.1 .0 and 1.2 (first cousins) m Ii 12 11it 112 113 114 nor and the brother 11.4 are asymptomatic. (Bottom) .0E Southern blot analysis 0 of the Bft chain gene -CI-c fragment of normal and 4) Naples family using se- -J quence-specific oligonucleotides. (A) Normal sequence; (B) Naples 0 1 2 3 4 sequence. Thrombin free (PM) hybridize with both oligonucleotides, indicating that the asymp- Figure 5. Binding of [14CJDFP a-thrombin to Reptilase-induced fibrin tomatic clots. (.) Normal fibrinogens; (v) fibrinogen Naples 11.4; and (v) fi- family members are heterozygous for the mutation brinogen Naples 11.3. Inset: Scatchard plot of binding data (normal found in the B/3 fragment. Amplified B/3 fragments of Naples fibrinogen and fibrinogen Naples 11.4). I. 1, 11.2, and 11.3 hybridized only with the ,8-Naples oligonucle- otide, showing that the symptomatic family members were homozygous for the mutation. The corresponding fragment of NDSK part of fibrinogen Naples, we amplified the genomic 120 normal individuals hybridized only with the /3-normal oli- DNA which codes for NDSK, specifically amino acids Aa gonucleotide (data not shown), indicating that the mutation 1-51, B/3 1-1 18, and y 1-79 of the fibrinogen molecule. After was not a common polymorphism. amplification, fragments with the sizes predicted from the genomic DNA sequences for the human fibrinogen Aa, B/3, and y Discussion chain genes (16, 38, 39) were sequenced. The fragments containing the Aa or My gene sequence were completely normal, The mutation in fibrinogen Naples is associated with a defec- whereas the B/3 fragment of Naples I.3 had a single base substi- tive release of FpA and FpB by thrombin. Because this defect tution (Fig. 6) in the codon normally coding for alanine at was present in the purified NDSK fragment of fibrinogen Na- position 68. This mutation changed the codon GCT (alanine) ples, we amplified and sequenced the genomic DNA segments to ACT which codes for threonine. The normal sequence was encoding the NDSK fragments Aa, B/3, and y chains. Sequence completely missing in Naples II.3, indicating that the proposi- analysis of the amplified products demonstrated that the pro- tus was homozygous for this mutation. positus (11.3) was homozygous for a single base substitution in Detection ofmutation in family members and normal indi- the codon for B/3 Ala 68 (GCT) resulting in a Thr (ACT) at this viduals. The amplified B/3 fragments of the family members position. Southern blot analysis using sequence specific oligo- were hybridized with two synthetic oligonucleotides, one with nucleotides showed that all three asymptomatic family the normal sequence (/3-normal) and the other with the se- members were heterozygous for the mutation while the three quence found in fibrinogen Naples (,3-Naples). Fig. 7 shows symptomatic members (including the propositus) were homo- that the amplified B/3 fragments of Naples 1.1, 1.2, and 11.4 zygous. This indicates that the homozygous mutation (B/3 68 Ala--oThr) is associated with thrombophilia, and that this type of dysfibrinogenemia is clinically recessive. By using fibrinogen purified from the homozygous proposi- Normal Naples 11.3 tus, a-thrombin-catalyzed FpA release was delayed relative to normal fibrinogen. The rate of FpA release from fibrinogen GATC GATC isolated from a heterozygous family member (II.4) was approximately half that of normal, indicating that heterozygous indi-

-S viduals have both normal and abnormal molecules. Human a-thrombin-catalyzed release of FpA from the purified NDSK fragment of normal fibrinogen was identical to that of intact fibrinogen. As previously reported (2, 3), this provides evidence - '. _ - that the NDSK fragment contains all the essential information

- for an effective interaction ofthrombin with fibrinogen. Analo- gously, NDSK from the homozygous fibrinogen Naples I.3 had the same decreased rate of FpA release by a-thrombin as intact fibrinogen Naples 11.3, indicating that the defective do- Figure 6. DNA sequence of BP3-chain gene fragment after amplifica- main is located in the NDSK part of the fibrinogen Naples tion coding for amino acids 9-209 (arrows indicate the mutation). molecule. The release of FpA by Reptilase from fibrinogen

242 Koopman et al. Naples and NDSK Naples 11.3 was normal, indicating that the thrombin in the circulation results in excessive coagulation mutation did not affect the substrate cleavage site of FpA in the and/or platelet aggregation which in its turn can lead to throm- Aa-chain. bosis. From the dramatic history of thrombophilia in the fam- The rate of FpB release from homozygous fibrinogen Na- ily with fibrinogen Naples and the genetic analysis of the fam- ples 11.3 was also strongly delayed as compared to normal fi- ily, it is clear that the occurrence of thrombosis is related to the brinogen. The FpB release from NDSK Naples 11.3 was approx- defect in fibrinogen Naples only in homozygous family imately the same as from intact fibrinogen Naples 11.3, which is members. The mutation in fibrinogen Naples (Bo 68 Ala -- in contrast with the slower release of FpB from normal NDSK Thr) prevents thrombin binding to fibrin and is correlated with as compared with normal fibrinogen. The reduced release of thrombophilia. These results demonstrate that thrombin bind- FpB from normal NDSK as compared with normal intact fi- ing to fibrin is an important in vivo mechanism to limit the brinogen, can be explained by the accelerating effect of fibrin presence of free active thrombin in circulation and to prevent polymerization on FpB release (40-43), which is absent when excessive coagulation and/or platelet activation leading to using NDSK. The similar release of FpB from NDSK Naples thrombosis. II.3 and intact fibrinogen Naples 11.3 suggests that this accelerating effect of fibrin polymerization is absent in fibrin Naples. Acknowledgment Active site-inhibited thrombin binds to fibrin by a site independent of the catalytic site designated the anion-binding exo- We thank Dr. Dana Fowikes for synthesizing the oligonucleotides. site (7-12). Active site-inhibited human a-thrombin bound to This work was supported by National Institutes of Health grant normal fibrin formed by Reptilase. In contrast, thrombin bind- HL-31048 (STL), North Atlantic Treaty Organization grant CRG ing to fibrin Naples 11.3 was very low whereas thrombin bind- 860110, and PF Ingegneria Genetica CNR (to Dr. Mannucci). ing to fibrin Naples II.4 was about half that of normal fibrin. Scatchard analysis ofthe binding data indicated a single class of References binding sites with maximal binding of 1.1 mol of thrombin per 1. Doolittle, R. F. 1984. Fibrinogen and fibrin. Annu. Rev. Biochem. 53:195- mole of fibrin and Ka = 1.3 X 106 M-'. This approximates the 229. strongest binding (Ka = 5.8 X IO' M-') determined by Liu et al. 2. Hogg, D. H., and B. Blomback. 1978. The mechanism of the fibrinogen- thrombin reaction. Thromb. Res. 12:953-964. (7), who reported that fibrin contains two classes of binding 3. Marsh, H. C., Y. C. Meinwald, T. W. Thannhauser, and H. A. Scheraga. sites. Our data determined under different experimental condi- 1983. Mechanism of action of thrombin on fibrinogen: kenetic evidence for in- tions indicate only one class of binding sites. Irrespective of volvement of aspartic acid at position P10. Biochemistry. 22:4170-4174. these differences, many studies indicate that a-thrombin binds 4. Ni, F., Y. Konishi, R. B. Frazier, H. A. Scheraga, and S. T. Lord. 1989. High-resolution NMR studies of fibrinogen-like peptides in solution: interaction to fibrin by a site distinct from its catalytic centre and that the of thrombin with residues 1-23 of the Aa chain of human fibrinogen. Biochemis- binding site on fibrin is located in the NDSK part of the fibrin- try. 28:3082-3094. ogen molecule (13-15). The results with fibrinogen Naples indi- 5. Ni, F., Y. C. Meinwald, M. Vasquez, and H. A. Scheraga. 1989. High-resolution NMR studies of fibrinogen-like peptides in solution: structure of a throm- cate that the Bo Ala 68 Thr substitution fully disrupts bin-bound peptide corresponding to residues 7-16 of the Aa chain of human thrombin binding at this site. fibrinogen. Biochemistry. 28:3094-3105. The loss of the anion-binding exosite from a-thrombin in 6. Lord, S. T., P. A. Byrd, K. L. Hede, C. Wei, and T. J. Colby. 1990. Analysis the f- and y-thrombins, results in a reduced clot- of fibrinogen Aa-fusion proteins: mutants which inhibit thrombin equivalently formation of are not equally good substrates. J. Biol. Chem. 265:838-843. ting activity of f- and y-thrombins for fibrinogen (9, 13). This 7. Liu, C. Y., H. L. Nossel, and K. L. Kaplan. 1979. The binding of thrombin suggests that the reduced fibrinopeptide release observed in by fibrin. J. Biol. Chem. 254:10421-10425. fibrinogen Naples could be fully accounted for by the decreased 8. Fenton, J. W. II, M. P. Zabinski, K. Hsieh, and G. D. Wilner. 1981. Throm- bin noncovalent-protein binding and fibrin(ogen) recognition. Thromb. Hae- noncatalytic binding of a-thrombin to fibrinogen Naples. How- mostasis. 46:177. (Abstr.) ever, the possibility of influence by amino acid substitution in 9. Wilner, G. W., M. P. Danitz, S. Mudd, K. H. Hsieh, and J. W. Fenton II. fibrinogen Naples on the catalytic binding of a-thrombin can- 1981. Selective immobilization of a-thrombin by surface-bound fibrin. J. Lab. Clin. Med. 97:403-411. not be ruled out. 10. Kaminski, M., and J. McDonagh. 1983. Studies on the mechanism of Fibrinogen New York I (23) also showed a decreased re- thrombin. J. Bio. Chem. 258:10530-10535. lease of FpA and FpB, and a defective binding of thrombin 11. Berliner, L. J., and Y. Sugawara. 1985. Human a-thrombin binding to (24). In contrast to fibrinogen Naples, the defect in fibrinogen nonpolymerized fibrin-sepharose: evidence for an anionic binding region. Bio- chemistry. 24:7005-7009. New York I is extensive, in that amino acids Bol 9-72 are de- 12. Kaminski, M., and J. McDonagh. 1987. Inhibited thrombins: interactions leted. This large deletion is likely to have multiple effects on the with fibrinogen and fibrin. Biochem. J. 242:881-887. defective fibrinogen structure, particularly because Bo Cys 65, 13. Fenton, J. W. II, T. A. Olsen, M. P. Zabinski, and G. D. Wilner. 1988. Anion-binding exosite of human a-thrombin and fibrin(ogen) recognition. Bio- which normally forms a disulphide bond with Aa Cys 36, is chemistry. 27:7106-7112. missing. Without information about the three-dimensional 14. Vali, Z., and H. A. Scheraga. 1988. Localization of the binding site on structure of NDSK, it is difficult to determine the exact influ- fibrin for the secondary binding site of thrombin. Biochemistry. 27:1956-1963. ence of the BJ3 68 Ala -> Thr substitution on the binding to 15. Kaczmarek, E., and J. McDonagh. 1988. Thrombin binding to the Aa-, Bo3- and y-chains of fibrinogen and to their remnants contained in fragment E. J. thrombin. One possible explanation is that Bo 68 alanine par- Biol. Chem. 263:13896-13900. ticipates in a nonpolar interaction with thrombin and that this 16. Ebert, R. F. 1991. Index of Variant Human Fibrinogens, 1991 edition. is disrupted by threonine. Alternatively, the slightly larger side R. F. Ebert, editor. CRC Press, Boca Raton, FL. 17. Southan, C., D. A. Lane, W. Bode, and A. Henschen. 1985. Thrombin chain of threonine could lead to incorrect folding or disulfide induced fibrinopeptide release from a fibrinogen variant (fibrinogen Sydney I) bond formation of this part of the fibrinogen molecule, pre- with an Aa Arg 16 - His substitution. Eur. J. Biochem. 147:593-600. venting thrombin binding. 18. Kaudewitz, H., A. Henschen, C. Soria, J. Soria, 0. Bertrand, and D. It been to fibrin is a Heaton. 1986. The molecular defect of the genetically abnormal fibrinogen has suggested that thrombin binding Christchurch 11. In Fibrinogen and Its Derivatives: Biochemistry, Physiology and mechanism that prevents active thrombin from existing free in Pathophysiology. G. Muller-Berghaus, U. Scheefers-Borchel, E. Selmayr, and A. the circulation (7). In the absence of this binding, free active Henschen, editors. Elsevier, Amsterdam. 31-36.

Fibrinogen Naples: A Homozvgous Dysfibrinogenemia 243 19. Pirkle, H., H. Kaudewitz, A. Henschen, I. Theodor, and G. Simmons. 31. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly 1987. Substitution of BB-14 Arginine by Cyst(e)ine in fibrinogen Seattle I. In of the head of bacteriophage T4. Nature (Lond.). 227:680-685. Fibrinogen 2: Biochemistry, Physiology and Clinical Relevance. G. D. 0. Lowe, 32. Van der Drift, A. C. M., and A. Poppema. 1983. Hydrodynamic character- J. T. Douglas, C. D. Forbes, and A. Henschen, editors. Elsevier, Amsterdam. ization of human fibrinogen. In Fibrinogen-Structure, Functional Aspects, Me- 49-52. tabolism. F. Haverkate, A. Henschen, W. Nieuwenhuizen, and P. W. Straub, 20. Koopman, J., and F. Haverkate. 1990. Structure-function relationships in editors. Walter de Gruyter, Berlin. 3-18. abnormal fibrinogens: defects at the DNA level. In Fibrinogen 4: Current Basic 33. Kehl, M., F. Lottspeich, and A. Henschen. 1981. Analysis of human and Clinical Aspects. M. Matsuda, S. Iwanaga, A. Takada, and A. Henschen, fibrinopeptide by high performance liquid chromatography. Hoppe Seyler's Z. editors. Elsevier, Amsterdam. 179-183. Physiol. Chem. 362:1661-1664. 21. Liu, C. Y., P. Wallen, and D. A. Handley. 1986. Fibrinogen New York I: 34. Fenton, J. W. II, M. J. Fasco, and A. B. Stackrow. 1977. Human throm- the structural, functional, and genetic defects and a hypothesis ofthe role of fibrin bins. Production, evaluation, and properties of a-thrombin. J. Biol. Chem. in the regulation of coagulation and fibrinolysis. In Fibrinogen-Fibrin Forma- 252:3587-3598. tion and Fibrinolysis. D. A. Lane, A. Henschen, and M. K. Jasani, editors. Walter 35. Nieuwenhuizen, W., J. J. Emeis, A. Vermond, P. Kurver, and D. van der de Gruyter, Berlin. 79-90. Heide. 1980. Studies on the catabolism and distribution of fibrinogen in rats: 22. Liu, C. Y., J. A. Koehn, and F. J. Morgan. 1985. Characterization of application of the IodogenO labelling technique. Biochem. Biophys. Res. Com- fibrinogen New York I. J. Biol. Chem. 260:4390-4396. mun. 97:49-55. 23. Al-Mondhiry, H. A. B., S. B. Bilezikian, and H. L. Nossel. 1975. Fibrino- 36. Engesser, L., J. Koopman, G. de Munk, F. Haverkate, I. Novikova, J. H. gen "New York"-an abnormal fibrinogen associated with thromboembolism: Verheijen, E. Briet, and E. J. P. Brommer. 1988. Fibrinogen Nijmegen: congeni- functional evaluation. Blood. 45:607-619. tal dysfibrinogenemia associated with impaired t-PA mediated plasminogen acti- M. and vation and decreased binding of t-PA. Thromb. Haemostasis. 60:113-120. 24. Haverkate, F., J. Koopman, C. Kluft, A. D'Angelo, Cattaneo, 37. Gustafson, S., J. A. Proper, E. J. W. Bowie, and S. S. Sommer. 1987. P. M. Mannucci. 1986. Fibrinogen Milano II: a congenital dysfibrinogenaemia Parameters affecting the yield of DNA from human blood. Anal. Biochem. associated with juvenile arterial and venous thrombosis. Thromb. Haemostasis. 165:294-299. 55:131-135. 38. Chung, C. W., B. G. Que, M. W. Rixon, M. Mace, Jr., and E. W. Davie. 25. Haverkate, F., J. Koopman, C. Kluft, A. D'Angelo, M. Cattaneo, and 1983. Characterization of complementary deoxyribonucleic acid and genomic P. M. Mannucci. 1987. Fibrinogens "Milano II"-"Naples." Thromb. Haemo- deoxyribonucleic acid for the # chain of human fibrinogen. Biochemistry. stasis. 57:375. 22:3244-3250. 26. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn, 39. Rixon, M. W., D. W. Chung, and E. W. Davie. 1985. Nucleotide sequence K. B. Mullis, and H. A. Erlich. 1988. Primer directed enzymatic amplification of of the gene for the y-chain of human fibrinogen. Biochemistry. 24:2077-2086. DNA with a thermostable DNA polymerase. Science (Wash. DC). 39:487-49 1. 40. Blomback, B., B. Hessel, D. Hogg, and L. Therkildsen. 1978. A two-step 27. Clauss, A. 1957. Gerinnungsphysiologische Schnellmethode zur Bestim- fibrinogen-fibrin transition in blood coagulation. Nature (Lond.). 275:501-505. mung des Fibrinogens. Acta Haematol. 17:237-246. 41. Hurlet-Jensen, A., H. Z. Cummins, H. L. Nossel, and C. Y. Liu. 1982. 28. Mancini, G., A. 0. Carbonara, and J. F. Heremans. 1965. Immunochemi- Fibrin polymerization and release of fibrinopeptide B by thrombin. Thromb. Res. cal quantitation of antigens by single radial immunodiffusion. Immunochemis- 27:419-427. try. 2:235-254. 42. Ruf, W., A. Bender, D. A. Lane, K. T. Preissner, E. Selmayr, and G. 29. Van Ruijven-Vermeer, I. A. M., and W. Nieuwenhuizen. 1978. Purifica- Muller-Berghaus. 1988. Thrombin-induced fibrinopeptide B release from normal tion of rat fibrinogen and its constituent chains. Biochem. J. 169:653-658. and variant fibrinogens: influence of inhibitors of fibrin polymerization. Bio- 30. Blomback, B., B. Hessel, S. Iwanaga, J. Reuterby, and M. Blomback. chim. Biophys. Acta. 965:169-175. 1972. Primary structure of human fibrinogen and fibrin. J. Biol. Chem. 43. Naski, M. C., and J. A. Shafer. 1990. a-Thrombin-catalyzed hydrolysis of 247:1496-1512. fibrin I. J. Biol. Chem. 265:1401-1407.

244 Koopman et al.