GEADELANDE CAROLINO DELGADO JUNIOR
SISTEMÁTICA DO GÊNERO DICHONDRA (CONVOLVULACEAE)
RECIFE, PE 2019 i
GEADELANDE CAROLINO DELGADO JUNIOR
SISTEMÁTICA DO GÊNERO DICHONDRA (CONVOLVULACEAE)
Tese apresentada ao Programa de Pós-graduação em Botânica da Universidade Federal Rural de Pernambuco – PPGB/UFRPE, como requisito para obtenção do título de Doutor em Botânica.
Orientadora: Drª. Maria Teresa Buril
RECIFE, PE 2019
ii
GEADELANDE CAROLINO DELGADO JUNIOR SISTEMÁTICA DO GÊNERO DICHONDRA (CONVOLVULACEAE)
Presidente da Banca / Orientadora: ______Profa. Drª. Maria Teresa Buril (UFRPE)
Tese defendida e aprovada pela banca examinadora em: __/___/_____
______Profa. Drª. Maria Regina de V. Barbosa (UFPB) Titular
______Prof. Dr. Benoît Francis Patrice Loeuille (UFPE) Titular
______Drª. Sarah Maria Athiê de Souza (UFRPE) Titular
______Drª. Ana Rita Simões (IBT) Titular
______Prof. Dr. Marccus Alves (UFPE) Suplente
______Drª. Priscila Porto Alegre Ferreira (FZB) Suplente
RECIFE, PE 2019
iii
Dedico, aos botânicos taxonomistas, que na solidão, sacrificam a vida para entender as plantas. aos pós-graduandos, que silenciosamente, traduzem as angústias e alegrias vividas, durante 4 anos, em um monte de palavras.
iv
Certas vezes, somos levados a caminhos estreitos que nos confrontam e nos testam, mas que no fim exuberam a maravilha da descoberta de quem somos...
A vida me trouxe uma flor para que eu a desvendasse. mesmo sem encanto a encarei
O que era um enigma se transformou em passos amargos por essa flor caminhei e pelo deserto desesperado chorei...
Deparei com a angústia da solidão embebido sob a pressão de ter que entendê-la Mas segui!
E quanto mais a conhecia mais perdido sentia!
E como teu habito flor, Comecei a rastejar sem desistir. E foi nessa jornada que, com muito ardor, eu fui nos desvendar.
v
AGRADECIMENTOS
Eu tive muita sorte de conviver com pessoas formidáveis ao longo dos meus últimos 4 anos e nada mais justo que agradecê-las. Essa tese tem um pouco de cada um de vocês.
Agradeço à Coordenação de Aperfeiçoamento de Pessoal de Nível Superior CAPES) pela concessão de 4 anos de bolsa e ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) que financiou parte desta tese.
À Universidade Federal Rural de Pernambuco (UFPE) e o Programa de Pós- graduação em Botânica (PPGBV).
Á Teresa Buril que me apresentou o lindo mundo das Convolvulaceae, ainda na época da minha graduação. Muito obrigado pela orientação, pela compreensão, pela paciência, pela amizade, por todo zelo e carinho. Você é uma mulher incrível.
Aos curadores e funcionários dos herbários nacionais e internacionais pela hospitalidade durante as visitas.
À toda equipe do laboratório LASEA (Antoniela, Diego, Silmara, Swami, Juliana, Tainá, Ketley, Deibson e Joilson) com quem aprendi a conviver e a lidar com diferentes tipos de personalidades. Grato pelas conversas, sugestões, reuniões, discussões, aprendizagem e pelos felizes e estressantes momentos
Aos membros da banca examinadora que, gentilmente, aceitaram o convite e tenho certeza que farão valiosas contribuições.
Ao projeto Reflora que me proporcionou trabalhar no Missouri Botanical Garden (MO). Obrigado ao staff do MO, em especial ao Jim Solomon por solicitar os empréstimos dos diferentes herbários e a Carmen Ulloa por toda paciência e gentileza durante minha estadia nos EUA.
A todos do Laboratório de Citogenética Vegetal da UFPE que me acolheram tão bem e me ajudaram sempre que precisei e precisei muito. Obrigado especial a Amanda Melo, Tiago Espósito e Lucas Costa por me ensinarem toda metodologia da filogenia e a Rafaela Alves, minha colega de turma, que me acompanhou nessa jornada de extração de DNA etc. Vocês se tornaram, para mim, uma referência de um ótimo laboratório.
Ao professor Gustavo Souza que foi essencial para a realização do artigo de filogenia, obrigado pela contribuição e discussão.
vi
Ao professor Francisco de Assis Ribeiro e toda sua equipe que me supervisionaram na execução dos trabalhos palinológicos. Obrigado pela colaboração e sugestões.
Ao George Staples, obrigado pela contribuição no artigo de tipificação e por me presentear com Dichondra.
À professora Maria Regina, minha mãe-Botânica, que mudou todo meu destino acadêmico ao me apresentar o incrível mundo das plantas. Obrigado por continuar sendo minha referência de como ser um excelente botânico.
À Sararh-Athié que me acompanha desde o início da tese, obrigado pelas contribuições e sugestões sempre pertinentes.
Aos meus irmãos e irmãs botânicos que fiz ao longo da minha trajetória. Ana Raquel, obrigado por ser quem você é e sempre compartilhar comigo bons momentos e reflexões da vida botânica. James Lucas que entende perfeitamente minhas ausências, mas sempre esteve disposto a colaborar e tirar minhas dúvidas, obrigado pela hospedagem em Feira de Santana. Luciano Soares que compartilhou comigo as angústias e alegrias de um doutorado, obrigado por toda ajuda. Débora Cavalcanti, minha parceira para ministrar minicurso, obrigado por todo apoio na UFPE.
Às minhas amigas Luciana Reis e Belanny Carvalho que foram as melhores pessoas que conheci em Recife. Obrigado por dividir um lar comigo e ser minha família por todo esse tempo. Vocês foram fundamentais!
A todos amigos espalhados pelo mundo. Em especial a Sterling Heron (EUA), Nora Oleas, Mayra Ninazunta (Equador) e Rebecca Hérnandez (México) por me ajudarem com fotos de exsicatas, bibliografias etc. Aos meus amigos Dannielly Batista, Helen Linhares, Anderson Feijó e Felipe Eloi por proporcionarem felizes momentos.
A painho Geadelande Delgado e a mainha Gorete Delgado obrigado por me proporcionarem a chegar ao fim de mais um ciclo. O apoio, o incentivo, amor e o dinheiro de vocês foram fundamentais para essa conquista. Aos meus irmãos, Jovelino Delgado e Layssa Delgado obrigado pela torcida e desculpa a ausência. Estou voltando. Amo vocês.
Cheguei ao fim desta jornada que me levou a conhecer o desconhecido e ter experiências jamais imaginadas. Uma sensação estranha, de vazio, mas de dever cumprido. Obrigado!
vii
LISTA DE FIGURAS
REVISÃO BIBLIOGRÁFICA Figura 1. Esquema filogenético da família Convolvulaceae baseada em números de cromossomos e caracteres morfológicos proposto por Austin (1973)...... 17
CAPÍTULO 1: PALINOLOGIA Figura 1. Details of tricolpate pollen under light microscopy. Dichondra serícea (A), Dichondra nivea (B). Optical section showing thickness of pollen wall……………………………………………………………………………….. 38 Figure 2. A-C. Dichondra argentea. A. Polar view. B. Orbicules, microespines conus and digitate C. Surface detail. D. D. brachypoda. Equatorial view. E. D. brevifolia. Orbicules and microespines digitate. F. Dichondra carolinensis. Orbicules, microespine conus and baculiform. G. Dichondra donelliana. Orbicules, microespine conus, digitate and baculiform. H. Dichondra macrocalyx. Orbicules and microespine conus. Scale bars – 2 µm (B, C, E-I) 5 µm (D), 10 µm (A)…………………………………………………………………………...... 40 Figure 3. A. Dichondra micrantha. Orbicules and microespine conus. B. D. microcalyx. Orbicules, microespine conus and baculiform. C-D. D. nivea. C. Polar view. D. Orbiculares, microespine conus and digitate. E. D. occidentalis. Orbicules, microespine conus and digitate. F. D. repens. Orbicules, microespine digitate and baculiform. G-H. Dichondra sericea var. sericea. G. Microespine conus and granules. H. Polar view and orbicules. I. D. sericea var. holosericea. Orbicules and microespine conus. Scale bars – 1 µm (E), 2 µm (A, B, F, G, I), 5 µm (D, H), 10 µm (C)…………………………………………………………….. 41
CAPÍTULO 2 Figure 1. Maximum likelihood (ML) consensus topology of combined plastid matK and trnL-F (left) and ITS1-5.8S (right) data for Dichondra. Numbers above the lines are fast tree support. Branches without number corresponds to fast tree support > 0.7. The color green (subg. Dichondra) corresponds to clade indehiscent and color red (subg. Capsularia) to dehiscent in specie-tree topology...... 62 Figure 2. The network tree shows the phylogenetic relationship between Dichondra subg. Dichondra (green) into 3 clusters, while species of Dichondra subg. Capsularia (red) diverged into two different linages………………………... 64 Figure 3. A multilocus species-tree inferred by Star BEAST (BEAST) from all loci (ITS, trnL-F and matK) for Dichondra species. The posterior probability is depicted in each branch. As in Figure 1, colors indicated clades dehiscent (red), corresponding to subg. Capsularia (clade I and II) and indehiscent (green) corresponding to subg. Dichondra (Clade III)…………………………………...... 64 Figure 4. Phylogenetic tree shows relationship between Dichondra species. The clade III presents continuous morphologic variation into Dichondra repens. Shape of calyx, apex and density of trichomes overlaps. The age of the genus Dichondra was estimated at 25 Mya……………………………..…………………………… 65
viii
Figure 5. Figura suplementar...... 83
CAPÍTULO 3 TAXONOMIA Figure 1. a—l. Dichondra argentea. a-b. Habit. c-d. Flower. e-f. Calyx. g-h. Corolla (inside, stames attached on the middle part of tube) and outside respectively. i.Ovary and styles equal and subequal. j-l. Fruit schizocarp dehiscent in different shapes. m—v Dichondra brachypoda. m. Habit. n. Abaxial face leave. o-p. Flower. q. Corolla inside. r. Calyx. s. ovary and unequal styles. t- v. Fruit squizocarp dehiscent. w—z. Dichondra brevifolia. w. Ovary and equal styles. x. Habit. y. corolla inside, stames attached on the top of tube. z corolla pilose outside. 140 Figure 2. a—f. Dichondra argentea. a-b. Habit and leaves silvery. c- Flower. d. fruit. e-f. Dichondra argentea as ornamental. (Photo e: google imagens; f: G Staples). 141 Figure 3. a—h. Dichondra brachypoda. a-b. Habit. c-d- Flower. e-h. Fruit in different development 142 Figure 4. a—e. Dichondra nivea. a. Habit. b Flower. c-d Corolla, c-corolla funnel-form; d corolla pilose outside on lobes. e. Calyx. f—m Dichondra occidentalis. f. Habit. g. Corolla. h. Ovary i. Calyx. j. Styles with trichomes on base to middle part. k. Corolla inside with stames attached on middle part of tube. l. Flower. n—p. Dichondra repens. Habits. 143 Figure 5. a—b Dichondra brevifolia. a. Habit, flower, and tiny leaves. c—d Dichondra nivea. c. Habit, flower, and silvery leaves. d. Dry flower. e—f Dichondra occidentalis. e. Habit. f. Corolla, leaves sparse pilose and stems sericeous.(Photos: A herbarium WELT; C, E, F iNaturalist.org) 144 Figure 6. . a—z. Dichondra repens. a-b. Habits. c-f. Flower, c-e- corolla not ultrapassing calyx, f. corolla ultrapassing calyx. g-j. Corola, g-h. stames attached on top of tube, i. Pilose outside, j. Glabrous outside. k-r. calyx. diffents shapes. s- y. Fruits. z. Ovary and styles 145 Figure 7. a—e Dichondra repens. a-b. Flower and leaves sericeous-pilose. c. Fruit. d. Flower and leaves glabrous. Dichondra argentea as ornamental. (Photo e: google imagens; f: G Staples) 146 Figure 8. a—f. Dichondra repens. a. Fruit. b. leaves sericeous with canescent abaxial face. c- Flower, corolla not excedding calyx. d. Flower, corolla excedding calyx. e. Fruit. f-g. Flower. 147
ix
LISTA DE TABELAS
REVISÃO BIBLIOGRÁFICA Tabela 1. Classificação infragenêrica de Dichondra proposta por Tharp & Johnston...... 21
CAPÍTULO 1: PALINOLOGIA Tabela 1. Measurements of pollen grains of Dichondra (Convolvulaceae) species…………………………………………………………………………… 39
CAPÍTULO 2 Tabela 1. Species dataset used in this analysis. Regions sequenced are marked with a XXXXX. 71 Tabela 2. Sequencing features used in the analysis 74
x
SUMÁRIO
RESUMO ...... 9 ABSTRACT ...... 11 INTRODUÇÃO GERAL ...... 13 REVISÃO BIBLIOGRÁFICA ...... 16 1. BREVE HISTÓRICO DA SISTEMÁTICA DE CONVOLVULACEAE ...... 16 2 TRIBO DICHONDREAE ...... 19 3. O GÊNERO DICHONDRA J.R.FORST. & G.FORST...... 20 3.1. HISTÓRICO ...... 20 3.2 MORFOLOGIA ...... 24 3.2.1. FRUTO ...... 24 3.2.2. POLÉN ...... 25 3.3 DIVERSIDADE E DISTRIBUIÇÃO GEOGRÁFICA ...... 25 3.4. IMPORTÂNCIA ECONÔMICA DE DICHONDRA ...... 26 REFERÊNCIAS ...... 28 CAPÍTULO 1: PALINOLOGIA ...... 33 POLLEN MORPHOLOGY IN DICHONDRA (CONVOLVULACEAE) ...... 34 CAPÍTULO 2: FILOGENIA ...... 51 A GLEAM IN THE DARK: PHYLOGENETIC AND MORPHOLOGICAL SPECIES DELIMITATION IN THE CONFUSING GENUS DICHONDRA (CONVOLVULACEAE)...... 52 CAPÍTULO 3: TAXONOMIA ...... 84 TYPIFICATION OF SPECIES NAMES IN DICHONDRA (CONVOLVULACEAE) ...... 85 THE CREEPY GENUS DICHONDRA (CONVOLVULACEAE) IN THE WORLD: THE CHALLENGE TO REVIEW WEED PLANTS ...... 99 CONSIDERAÇÕES FINAIS ...... 151
xi
RESUMO
Dichondra é um dos gêneros de Convolvulaceae que ocorre naturalmente em toda
América, Austrália e Nova Zelândia. Historicamente, as espécies do gênero têm sido mal delimitadas e é um verdadeiro desafio identificar os taxa, visto que os caracteres utilizados para separar as espécies são plásticos e contínuos, a exemplo densidade dos tricomas e forma do cálice ou qualitativos, como a espessura dos ramos. Isso conduziu diferentes autores a interpretar os taxa de Dichondra de formas diferentes. Ora consideravam uma única espécie (Dichondra repens) morfologicamente variável, ora como uma espécie com variedades, ou ainda como até 15 espécies distintas. Nesta tese, tivemos como objetivo investigar a morfologia dos grãos de polén das espécies de
Dichondra, realizar o tratamento taxonômico de todo o gênero e propor uma hipótese filogenética para o grupo, a fim de responder as seguintes questões: O grão de pólen é um caracter útil para delimitar espécies ou grupos? Quantas espécies de Dichondra existem no mundo? O que é Dichondra repens? Qual a relação entre o subgênero Dichondra e o subgênero Capsularia? Afinal, qual a terminologia correta para o fruto de Dichondra?
Análises filogenieticas podem ajudar na taxonomia do grupo? Ao final da análise morfólogica de cerca de 3.000 espécimes depositados em herbários nacionais e internacionais, coletas na América do Sul e EUA, análise do grão de pólen e do estudo filogenético molecular com três loci matK, trnL-trnF (plastidiais) e ITS (nuclear), as repostas das perguntas anteriores e os resultados obtidos são apresentados aqui em três capítulos. (1) O primeiro é um estudo palinológico das espécies de Dichondra, que demonstrou que caracteres polínicos são, no geral, estáveis entre as espécies e não contribuem para a delimitação do grupo. Os resultados foram submetidos ao periódico
Grana. (2) O segundo capítulo trata da análise filogenética molecular de Dichondra. A
9
árvore de espécies gerou uma boa resolução intraclado em comparação a árvore de genes.
Apontando o mofiletismo dos subgêneros de Dichondra e indicando a importância da morfologia do fruto para entender os processos evolutivos no gênero (3) O terceiro é o tratamento taxonômico, o qual está dividido em dois artigos. O primeiro traz a tipificação de quatro espécies do gênero, e resolve a estabilidade de nomes com histórico complexo.
Este artigo está publicado na Taxon 67(5): 1020-1023. O segundo artigo é a revisão do gênero Dichondra para o mundo, no qual consideramos seis espécies no gênero, propondo a sinonimização de 14 nomes sob D. repens, além de apresentarmos uma chave de identificação, ilustrações e comentários taxonômicos.
Palavras-chave: Dichondreae, filogenia, nomenclatura, pólen, taxonomia
10
ABSTRACT
Dichondra is included in Convolvulaceae and naturally occurs throughout America,
Australia and New Zealand. Historically, species of the genus have been poorly delimited, and it is a tremendous challenge to identify taxa, since characters used to recognize the species are plastic and continuous such as trichomes density and calyx shape or qualitative, as branches thickness. This led several authors to interpret Dichondra taxa in different ways. They considered just a single species (Dichondra repens) morphologically variable, or a species with different varieties or still as up to 15 distincts species. In this dissertation, we aimed to investigate the pollen momorphology of
Dichondra species, to carry out the taxonomic treatment of the genus and to propose a phylogenetic hypothesis for the group, in order to answer the following questions: The pollen grain is a character useful for delimiting species or groups? How many species of
Dichondra are there around the world? What is Dichondra repens? What is the relationship between the subgenus Dichondra and the subgenus Capsularia? After all, what is the correct termilogy for fruit type in Dichondra? Can phylogenetic analysis help with group taxonomy? At the end of the morphological analysis of approximately 3,000 specimens deposited in national and international herbariums, field work in South
America and the USA, analysis of pollen grain of all species and molecular phylogenetic study with three loci matK, trnL-F (plastidial) and ITS (nuclear), the answers to previous questions and the results obtained are here presented in three chapters. (1) The first is a palynological study of Dichondra species, which shows the homogeneity of pollen characters. The results were submitted to the journal Grana. (2) The second chapter deals with the molecular phylogenetic analysis of Dichondra which demonstrate the species- tree exhibited better resolution intraclado than gene tree. The monophiletism of subgenera
Dichondra was confirmed and fruit morphology is importance to elucidate evolution
11 within the group (3) The third is the taxonomic treatment, which is divided into two manuscripts. The first one presents typifications for four names with a complex history.
It is already published in Taxon 67 (5): 1020-1023. The second one comprises a taxonomic revision of the Dichondra to the world, were we consider six species and proposed to synonymize 14 names under Dichondra repens. It presenta an indetification key, descriptions, illustrations and taxonomic comments.
Keywords: Dichondreae, morphology, nomenclature, pollen, taxonomy.
12
INTRODUÇÃO GERAL
Dichondra J.R. Forst. & G. Forst. (FORSTER & FORSTER, 1776) é um dos gêneros mais antigos de Convolvulaceae. Compreende 15 espécies e duas variedades
(sensu STAPLES ET AL, 2019), que ocorrem naturalmente nas Américas, Nova Zelândia e Austrália (THARP & JOHNSTON, 1961). Devendo-se considerar que sementes de
Dichondra são vendidas em todo o mundo como ornamental e como tapete de “grama”
(AUSTIN, 1998).
O gênero está inserido na tribo Dichondreae juntamente com outros sete gêneros e possuem como possível sinapomorfia morfológica o fruto utrículo (STEFANOVIĆ ET
AL, 2003). Dichondra é reconhecido por serem ervas rastejantes, prostradas, com folhas reniformes de margem inteira, ovário bicarpelar, dois estiletes livres e ginobásicos, e ausência da região mesopétala (adaptado THARP & JOHNSTON, 1961). Tais características são incomuns dentro de Convolvulaceae, e por isso o gênero já foi classificado como uma família distinta: Dichondraceae (DUMORTIER, 1829).
Embora o gênero tenha sido um dos primeiros a ser descrito na família,
Dichondra é taxonomicamente mal compreendido e com diversos problemas nomenclaturais (THARP & JOHNSTON, 1961). É evidente a dificuldade de identificação e delimitação das espécies em Dichondra, dependendo do conceito taxonômico adotado, o número de espécies varia entre 5–15 (JOHNSON ET AL, 2014).
A obra de maior relevância sobre Dichondra é a revisão das espécies da América do Norte realizada por Tharp & Johnston (1961). Nesse estudo, os autores constataram que algumas espécies não se enquadravam no conceito do gênero, desta forma, propuseram uma nova circunscrição do gênero, além da primeira classificação subgenérica, com dois subgêneros: Dichondra Forst. & Forst., que inclui espécies com
13 fruto bilobado (utrículo), e Capsularia Tharp & Jhonst., com as espécies com fruto capsular.
O objetivo do presente trabalho foi realizar o tratamento taxonômico das espécies de Dichondra ocorrentes em todo o mundo, avaliando e buscando caracteres morfológicos que permitam reconhecer e diferenciar as espécies, além de solucionar problemas nomenclaturais. Aliado a esses objetivos, foram analisados grãos de polén com intuito de encontrar potenciais sinapomorfias de grupos, visto que caracteres polínicos são frequentemente relatados como importantes para a sistemática de outras linhagens de
Convolvulaceae. Também foram conduzidos estudos moleculares para propor uma hipótese filogenética questionando o monofiletismo dos subgêneros e para entedender as relações entre as espécies.
Os resultados apresentados estão organizados da seguinte forma:
CAPÍTULO 1: Palinologia. Este capítulo trata de um estudo descritivo com os grãos de polén das espécies de Dichondra. Foram analisados 13 taxa, dos quais oito foram estudados pela primeira vez. Os resultados revelam que a morfologia do grão de polén não é suficiente para distinguir espécies, contudo reportamos a presença de orbículos, o qual é um caracter que deve ser futuramente investigado na tribo Dichondreae. O título do artigo é “Pollen morphology in Dichondra J.R. Forst. & G. Forst. (Convolvulaceae)” e foi submetido ao periódico Grana.
CAPÍTULO 2: Filogenia. Este capítulo trata de uma análise filogenética do gênero Dichondra, foi realizada usando sequências de DNA de loci plastidiais (matK E trnL-trnF) e nuclear ribossomal ITS. O objetivo foi entender as relações entre as espécies de Dichondra, se os subgêneros são monofiléticos e esclarecer o que é Dichondra repens.
Nossos resultados mostraram um baixo suporte e uma incongruência entre as topologias
14 das árvores plastidiais e nuclear. Realizamos uma análise de árvore de espécies considerando a possibilidade de linhagem incompleta ou fluxo gênico. O título do artigo
é “A gleam in the dark: Phylogenetic and morphological species delimitation in the confusing genus Dichondra (Convolvulaceae)” será enviado para a revista Plant
Systematics and Evolution.
CAPÍTULO 3: Tratamento taxônomico. Este capítulo compreende dois artigos. O primeiro traz a tipificação de quatro espécies de Dichondra, o qual inclui uma neotipificação, este artigo intitulado “Typification of species names in Dichondra
(Convolvulaceae)” está publicado na Taxon 67(5): 1020-1013. O segundo, intitulado
“The creepy genus Dichondra (Convolvulaceae) in the world: the challenge to review weed plants” será submetido a revista Systematic Botany. Esse artigo trata da revisão do gênero Dichondra para o mundo no qual consideramos seis espécies, com descrições completas, período reprodutivo, dados sobre a distribuição geográfica, atualizações nomenclaturais, 14 novos sinônimos, uma chave de identificação e ilustrações.
15
REVISÃO BIBLIOGRÁFICA
1. Breve histórico da sistemática de Convolvulaceae
Convolvulaceae foi estabelecida por Jussieu (1789) na obra Genera plantarum sob o nome de Convolvuli e tendo como espécime tipo Convolvulus arvensis L.. Jussieu classificou a família em três grupos informais, um com gêneros que possuía um estilete
(e.g. Maripa Aulb., Convolvulus L. e Ipomoea L.), o segundo com os gêneros que apresentam mais de um estilete (e.g. Evolvulus L. e Cressa L.) e gêneros afins de
Convolvuli (e.g. Cuscuta L.).
Em 1833, Choisy organizou a família em quatro “seções”, baseando-se no gineceu (sincárpico ou aporcápico), tipo de fruto (deiscente ou indeiscente) e pela forma de obtenção de nutrientes (planta parasita ou não parasita). Em 1845, Choisy manteve o critério anterior para organização da família, contudo alterou a denominação de “seção” para tribo. Desta forma, foi o primeiro a sugerir um sistema de tribos: Argyreieae,
Convolvuleae, Dichondreae e Cuscuteae.
Mais tarde, Hallier (1893) realizou um estudo minucioso sobre Convolvulaceae.
Nesse estudo, ele incluiu dados morfológicos, anatômicos e palinológicos. Ele reconheceu formalmente nove tribos em dois grupos informais baseados na morfologia do pólen, estilete e fruto. Psiloconieae, composto por sete tribos (Cuscuteae, Wilsoniae,
Dichondreae, Dicranostyleae, Erycibeae, Poraneae, Convolvuleae), caracterizada por grãos de pólen com superfície lisa e Echinoconieae com duas tribos (Ipomoeae,
Argyreieae), caracterizado por grãos de pólen com superfície equinada.
Nas décadas seguintes, apesar de vários estudos sistemáticos com
Convolvulaceae (OOSTSTROOM, SHAW, 1966), poucas alterações significativas,
16 quanto a classificação da família, foram realizadas. Em 1973, Austin propôs a primeira hipótese evolutiva para Convolvulaceae baseada no número de cromossomos e caracteres morfológicos. Ele organizou a família em sete tribos e em um grupo incerto que nomeou de “Merremioides” (figura 1). Além disso, Austin removeu Cuscuta de Convolvulaceae e a tratou como uma família monotípica, Cuscutaceae.
Figura 1: esquema filogenético da família Convolvulaceae baseada em números de cromossomos e caracteres morfológicos proposto por Austin (1973).
As novas técnicas moleculares trouxeram novidades tanto no posicionamento de
Convolvulaceae em relação as demais famílias de angiospermas, quanto a classificação infrafamiliar (APG II 2003, STEFANOVIĆ ET AL, 2002). A família Convolvulaceae que já esteve inserida na ordem Polemoniales (CRONQUIST, 1981) e em Convolvulales
(TAKHTAJAN, 1997), hoje incluída em Solanales (APG IV, 2016). É uma família claramente monofilética e tem Solanaceae como grupo-irmão. Não existe uma sinapomorfia morfológica sem reversões para a família, contudo se considera a deleção
17 do intron rpl2 (presente nas demais angiospermas) como sinapomorfia molecular
(STEFANOVIĆ ET AL, 2002).
A família foi reclassificada e circunscrita com 12 tribos (STEFANOVIĆ ET AL,
2003). As tribos Ipomoeae e Argyreieae (sensu AUSTIN, 1973) não tiveram grandes alterações em sua circunscrição, contudo os gêneros que pertenciam a essas tribos passaram a ser subordinados à uma única tribo Ipomoeeae s.l. A tribo Cresseae teve poucas modificações na circunscrição com a inserção da tribo Hildebrandtieae (sensu
AUSTIN, 1973) e continuou como tribo Cresseae s.l. Cuscuta é reconhecido como gênero de Convolvulaceae e é bem suportado dentro da família, estando inserido na tribo
Cuscuteae. Quatro novas tribos foram propostas: Aniseieae, Cardiochlamyeae,
Jacquemontieae e Humbertieae. As tribos Convolvuleae e Erycibeae reduziram de tamanho e passaram a ter um ou dois gêneros, enquanto Maripeae e Dichondreae tiveram o conceito e o número de gênero ampliados. Os gêneros que pertenciam a Poraneae (sensu
AUSTIN, 1973) foram diluídos em outras tribos. E a tribo Merremieae emergiu polifilética, como preconizado por Austin (1973).
A tribo Merremieae foi objeto de estudo de Simões et al (2015, 2017). Os autores realizaram um estudo filogenético molecular com 57 taxa da tribo Merremieae e usaram
3 locis plastidiais (matK, trnL-trnF, rps16) e o nuclear ITS, como principais resultados confirmaram o polifiletismo da tribo, e propuseram rescircunscrição de Merremia e a circunscrição de outros gêneros os quais formaram linhagens monofiléticas com suporte molecular, palinológico e com caracteres morfológicos diagnósticos. Esses novos gêneros não têm uma posição tribal definida, sendo considerados incertae sedis.
18
2 Tribo Dichondreae
A tribo Dichondreae foi proposta pela primeira vez por Hallier (1893), o qual incluiu três gêneros (Nephrophyllum A. Rich, Dichondra J.R. Forst. & G. Forst., Falkia
Thunb.), e a caracterizou pelo pólen liso, tricolpado, estilete bífido, ginobásico e fruto uni-bilocular, com uma semente cada e pericarpo membranáceo. Esse conceito de tribo foi corroborado por Austin (1973). Com os estudos moleculares realizados por Stefanović et al (2002, 2003), os autores ampliaram o conceito de Dichondreae com a inclusão dos táxons (Dipteropeltis Hallier f., Metaporana N.E. Br., Porana Burm. f. Rapona Baill.,
Calycobolus Willd. ex Roem. & Schult.) tradicionalmente incluídos na tribo Poraneae sensu Hallier (1893).
A tribo passou então a ser caracterizada por compreender ervas prostradas a lianas; folha com base geralmente cordada, às vezes truncada; flor actinomorfa, bissexual; sépalas iguais, acrescentes ou não; filamento dilatado e pubescente; estiletes partidos a completamente divididos; estigmas globosos; frutos indeiscentes (utrículo); pólen 3- colpado, psilado (STEFANOVIĆ ET AL, 2003).
Dichondreae sensu Stefanović et al (2003) é monofilética e bem sustentada com
100% de bootstrap. A tribo está inserida no clado Dicranostyloideae, o clado dos estiletes bífidos. Embora a tribo apresente um forte suporte, as relações dentro deste clado não são bem resolvidas. A possível sinapomorfia morfológica da tribo seria o fruto utriculado, o qual está presente em outros gêneros de outras tribos (eg. Cardiochlamys Oliv.,
Poranopsis Roberty) STEFANOVIĆ ET AL, 2003), além disso, há espécies dentro da tribo (e.g. Dichondra brachypoda Wooton & Standl., D. argentea Humb. & Bonpl. ex
Willd.) que apresentam frutos do tipo cápsula (THARP & JOHNSTON, 1961).
19
Essa nova circunscrição da tribo gerou relações ambíguas, isto porque na antiga circunscrição (Dichondreae sensu Hallier 1893 e Austin 1973.), esta se distinguia claramente das demais Convolvulaceae por apresentarem ovário lobado, com os lóbulos unidos na base e estilete bífido e ginobásico, características que não estão presentes em
Poraneae sensu Hallier. Inclusive, os gêneros tradicionalmente incluídos na tribo
(Dichondra, Falkia, Nephrophyllum) apareceram em um clado monofilético com 75% de suporte, o qual Stefanović et al (2003) denominaram clado Dichondrinae.
3. O gênero Dichondra J.R.Forst. & G.Forst.
3.1. Histórico
Dichondra (do grego di- dois; krondros- grão, uma alusão à presença de dois mericarpos no fruto) foi descrito pelos Forsters em 1776. Os autores estabeleceram uma
única espécie Dichondra repens J.R.Forst. & G.Forst., a qual recebeu esse nome por ser rastejante, um caráter comum às demais espécies do gênero.
A característica ovário/fruto bicarpelar foi utilizada ao longo da história para classificar e posicionar Dichondra dentro das angiospermas. A primeira classificação foi proposta por Jussieu (1789) que inseriu Dichondra em Boraginaceae, na “seção” de frutos uni ou bicarpelar. Em 1829, Dumortier propôs a família Dichondraceae que agrupava as espécies com estilete bífido, fruto bicarpelar e monospérmico.
Para Choisy (1833), Dichondraceae não possuía características suficientes para se manter como família. Então, ele propôs a inserção de Dichondra em Convolvulaceae, subordinada à “seção” Dichondreae, a qual reúne as espécies com ovário apocárpico
(dialicarpelar). Hallier (1893), por sua vez, inseriu Dichondra na tribo Dichondreae e essa
20 decisão foi corroborada pelas principais classificações modernas (AUSTIN, 1973;
STEFANOVIĆ & ET AL, 2003).
O trabalho mais relevante sobre o gênero foi realizado por Tharp & Jhonston
(1961) com as espécies de Dichondra norte-americanas. Nesse estudo, eles reconheceram nove espécies na América do Norte e 14 em todo o mundo, destas, duas eram novas espécies (Dichondra donelliana Tharp & M.C. Johnst e D. recurvata Tharp &
M.C.Johnst) e uma era nova combinação [D. nivea (Brandegee) Tharp & M.C.Johnst].
Eles foram os primeiros a perceber que quatro espécies (D. argentea, D. brachypoda, D. nivea e D. occidentalis House) possuíam o fruto deiscente e em forma de cápsula e tal característica não se enquadrava no conceito adotado ao gênero anteriormente
(BENTHAM & HOOKER, 1876; HALLIER, 1893; PETER, 1891). Tharp & Jhonston
(1961) propuseram uma recaracterização de Dichondra e uma classificação infragenérica, com dois subgêneros: Dichondra Forst. & Forst. (10 spp.) para as espécies com fruto bilobado (utrículo), e Capsularia Tharp & Johnst. (4 spp.) para as espécies com fruto capsular (Tabela 1).
Tabela 1: Classificação infragenêrica de Dichondra proposta por Tharp & Johnston.
Subgênero Espécies
Dichondra brevifolia Buchanan
Dichondra D. carolinensis Michx.
D. evolvulacea (Lf.) Britton
D. donelliana Tharp & Johnst.
21
D. macrocalyx Meisn.
D. micratha Urb.
D. parvifolia Meisn.
Dichondra D. recurvata Tharp & Johnst.
D. repens J.R.Forst. & G.Forst.
D. sericea Sw.
Dichondra argentea Humb. & Bonpl. ex
Will.
D. brachypoda Wooton & Standl. Capsularia
D. nivea (Brandegee) Tharp & Johnst.
D. occidentalis House
Estudos com enfoque nas relações evolutivas com espécies de Dichondra são raros. Austin (1998) apresentou um dendrograma com uma provável relação entre as espécies utilizando 33 caracteres morfológicos analisados no MacClade e PAUP, sendo
Falkia e Nephrophyllum empregados como grupo-irmão. De acordo com esta análise D. argentea, espécie ocorrente em toda América, emergiu como grupo-irmão das demais espécies de Dichondra e os subgêneros descritos por Tharp & Jhonston não foram corroborados como grupos monofiléticos.
22
Na filogenia da família realizada por Stefanović et al (2002), Dichondra é um gênero monofilético com alto índice de suporte (98% bootstrap), contudo os autores não incluíram a variedade morfológica do fruto presente no gênero, utilizando apenas duas espécies (D. brachypoda e D. occidentalis), ambas do subgênero Capsularia.
Os demais trabalhos que citam Dichondra são floras de países, regiões ou checklists. O’ Donell foi responsável por algumas floras na América do Sul. Para o Chile
(1957) ele mencionou três variedades de D. repens; na Argentina (1959a), D. argentea e quatro variedades de D. repens; e no Uruguai (1959b), três variedades de D. repens.
Austin (1975) monografou Dichondra na flora do Panamá com apenas D. sericea e no Equador (1982) com três espécies D. argentea, D. microcalyx (Hallier f.)
Fabris e D. sericea. Os trabalhos mais recentes nas Américas são o da Flora da Argentina
(CHIARINI & ESPINAR, 2006) com três espécies (D. argentea, D. macrocalyx, D. microcalyx e três variedades de D. sericea) e o de Felger et al (2012) que citam três espécies no Noroeste do México (D. argentea, D. brachypoda, D. sericea). Os trabalhos extra-americano foram realizados na Austrália onde apenas citam D. repens J.R.Forst. &
G.Forst. (GRAY, 2011; JOHNSON ET AL, 2014) e na China com D. micrantha Urb.
(RHUI-CHENG1 & STAPLES, 1995).
Para o Brasil, a obra mais importante é a Flora Brasiliensis (MEISNER, 1869).
Nesse estudo, o autor descreveu quatro espécies, das quais duas eram novas (D. macrocalyx e D. parvifolia). Outra contribuição foi a de Falcão (1974) que realizou uma monografia sobre Dichondra no Brasil, porém nada foi acrescentado, e seus resultados são pouco esclarecedores. Atualmente, são reconhecidas oito espécies (FLORA DO
BRASIL, 2020), sendo D. parvifolia endêmica da Mata Atlântica.
23
3.2 Morfologia
Dichondra, como atualmente circunscrito, é morfologicamente caracterizado por serem ervas perenes, rastejantes, com tricomas malpighiáceos; folhas pecioladas, lâmina inteira, geralmente reniforme ou orbicular; flores pequenas, axilares, solitárias, pedunculadas; sépalas unidas apenas na base, acrescentes após antese; corola rotácea ou campanulada, 5-partida, tubo curto; filamento delgado, glabro; pólen 3-colpado; ovário bicarpelar, óvulos por carpelo, estilete 2-livres, gibobásico, lobos estigmáticos inteiros, capitados, rugosos; fruto redondo, truncado (cápsula) ou emarginado a bilobado (utrículo)
(THARP & JOHNSTON, 1961; CHIARINI & ESPINAR, 2006).
Os caracteres normalmente usados para separar as espécies de Dichondra são densidade do indumento na folha, forma das sépalas, proporção fruto e sépalas, e o tipo do fruto. As folhas variam de glabras a densamente seríceas/pilosas. Dois grandes grupos de espécies podem ser separados pelo ápice das sépalas: ápice agudo e ápice redondo a obtuso.
3.2.1. Fruto
São reconhecidos diferentes frutos em Convolvulaceae, cápsula, utrículo e baga por exemplo. O fruto é um dos caracters que tem sido utilizado para classificar grupos e delimitar gêneros (HALLIER, 1893, PETER, 1897; AUSTIN, 1998). Alguns gêneros
Rivea, Remirema, and Decalobanthus (comn. pers., STAPLES 2016) foram probremente descrito e necessitam ser revisados, tamém é o caso Dichondra. A terminologia do fruto de Dichondra é bastante confusa. Historicamente, o fruto de Dichondra é descrito como cápsula baseado em espécime com fruto indeiscente (FORSTER & FORSTER, 1776).
Na revisão feita para as espécies norte-americanas (THARP & JOHNSTON, 1961), os autores apontam pelo menos três tipos de frutos: cápsula, utrículo e “utrículo deiscente”.
24
3.2.2. Polén
Hallier (1893) reconheceu a importância do grão de pólen em Convolvulaceae e desde então a morfologia do pólen tem sido usado para separar gêneros morfologicamente relacionados (e.g. Calystegia × Convolvulus; Stylisma × Bonamia) (LEWIS & OLIVER,
1965, LEWIS, 1973), utilizado como critério para propor relações evolutivas
(SENGUPTA, 1972) e ajudar na delimitação de espécies (HSIAO & KUOH, 1995;
MENEMEN & JURY, 2002; WELSH ET AL, 2010).
Poucas informações sobre o polén de Dichondra está disponível na literatura. Os trabalhos se resumem a classificar o tipo do grão do pólen como tricolpado (HALLIER,
1893, OOSTSTROON, 1938, 1953) ou raro tetracolpado em D. repens (MOAR ET AL,
1993). Outros trabalhos descrevem brevemente os pólens de D. repens, que é a espécie mais estudada, (CRANWELL, 1942; HUANG, 1972, MOAR ET AL, 1993), e de D. argentea (BATALLA, 1940). Algumas espécies (D. sericea, D. argentea, D. microcalyx e D. sericea var. holosericea) da América do Sul foram estudadas e classicaram o grão do pólen como tricolpado, colpus longos com membrana do teto microgranulada
(TELLERÍA ET AL, 2003)
3.3 Diversidade e Distribuição Geográfica
A delimitação das espécies de Dichondra é complexa e dependendo do conceito taxonômico adotado, o número de espécies varia entre 5-15 (JOHNSON ET AL, 2014).
Até hoje já foram publicados 45 nomes (20 espécies e 25 variedades ou formas), o principal motivo para isto é que Dichondra exibe uma grande plasticidade fenotípica, principalmente das estruturas vegetativas. Na revisão mais recente, Tharp & Johnston
25
(1961) reconhecem 14 espécies e nenhuma variedade. O checklist das espécies de
Convolvulaceae (STAPLES, 2019) considera válidos 15 espécies e duas variedades.
Na flora da Argentina, Chiarini & Espinar (2006) apontaram diversas problemáticas em torno da circunscrição das espécies, desde descrições de espécies confusas a táxon infraespecífico que deveria ser elevado à categoria de espécie. Os autores evidenciaram a necessidade de reunir mais informações morfoanatômicas e citológicas para uma melhor compreensão das espécies.
O gênero pode ser considerado pantropical devido a uma espécie cultivada/naturalizada (Dichondra micrantha) em todos os continentes. Esta espécie é originária da América, onde é, possivelmente, o centro de diversidade do gênero. Duas espécies (D. repens e D. brevifolia Buchanan) são endêmicas da Austrália e Nova
Zelândia. Seis (D. brachypoda, D. carolinensis, D. donelliana, D. nivea, D. occidentalis,
D. recurvata) são endêmicas da América do Norte, quatro (D. evolvulacea, D. macrocalyx, D. microcalyx, D. parvifolia) são da América do Sul (AUSTIN, 1998) e a D. argentea e D. sericea estão presentes em toda América.
3.4. Importância Econômica de Dichondra
Sementes de Dichondra são vendidas em todo mundo como ornamental.
Dichondra argentea é a espécie do gênero mais utilizada na jardinagem devido suas folhas prateadas e seu crescimento em cascata, o fato pelo qual é conhecida popularmente de “Silver falls”. Dichondra micrantha é usada para substituir gramado ou como cobertura do solo em jardins (WIERSEMA & LEÓN, 2013; CUBEY, 2017).
Outra potencialidade do gênero é o uso medicinal. Estudos apontam a eficácia de Dichondra no tratamento de transtornos intestinais e também com um ótimo asséptico.
26
Além disso, são conhecidas propriedades anti-inflamatórias, antioxidantes e cicatrizantes para pelo menos cinco espécies (D. argentea; D. macrocalyx; D. micrantha; D. repens;
D. sericea) (AUSTIN, 1998).
27
REFERÊNCIAS
A.P.G. (Angiosperm Phylogeny Group) IV. 2016. An update of the Angiosperm
Phylogeny Group classification for the orders and families of flowering plants: APGIV.
Journal of the Linnean Society 181: 1-20
A.P.G (The Angiosperm Phylogeny Group) II. 2003. An update of the Angiosperm
Phylogeny Group classification for the orders and families of flowering plants:
APG II. Botanical Journal of the Linnean Society 141: 399-436.
AUSTIN, D. F. 1973. The American Erycibeae (Convolvulaceae): Maripa,
Dicranostyles, and Lysiostyles I. Systematics. Annals of the Missouri Botanical Garden
60: 306–412.
____1975. Flora of Panama. Annals of the Missouri Botanical Garden, 62: 198-201.
____1982. Convolvulaceae. Flora of Equador 15:1- 98.
____1998. The indiscriminate vector: human distribution of Dichondra micrantha
(Convolvulaceae). Economic Botany 52: 88-106.
BATALLA, M. A. 1940. Estudio morfologico de los granos de polen de las plantas vulgares del valle de Mexico. An. Inst. Biol. Univ. Nacl. Mex., 11: 129-161.
BENTHAM, G. & HOOKER, J. D. 1876. ff, genera plantarum 2: 878-879.
CHIARINI, F. & ESPINAR, L.A. 2006. Flora Fanerogámica Argentina: Convolvulaceae.
Proflora: Conicet, Córdoba, 81 pp.
CHOISY, J.D. 1833. Convolvulaceae. In A. DeCandolle, Prodromus 9: 323-465.
CHOISY, J.D. 1845. Convolvulaceae. In: De Candolle, ed. Prodromus systematics
Columbia University Press, 323-465.
28
CRANWELL, L.M. 1942. New Zealand Pollen Studies: 1. Key to the pollen grains of families and genera in the native flora. Records of the Auckland Institute and Museum
2(6): 280-308.
CRONQUIST, A. 1981. An integrated system of classification of flowering plants. New
York, Columbia University Press, p. 1262.
CUBEY, J. 2017. RHS Plant Finder 2017. London: Royal Horticultural Society.
DUMORTIER, B. C. 1829. Analyse des plantes.Paris: Tournay.
FALCÃO, J. I. A. 1974. As espécies brasileiras do gênero Dichondra Forster
(Convolvulaceae). Rodriguesia 39: 135-142.
FELGER, R.S., D.F. AUSTIN, T.R. VAN DEVENDER, J.J. SÁNCHEZ-ESCALANTE
& M. COSTEA. 2012. Convolvulaceae of Sonora, Mexico. I. Convolvulus, Cressa,
Dichondra, Evolvulus, Ipomoea, Jacquemontia, Merremia, and Operculina. J. Bot. Res.
Inst. Texas 6: 459–527.
FLORA DO BRASIL. 2020 em construção. Jardim Botânico do Rio de Janeiro.
Disponível em: < http://floradobrasil.jbrj.gov.br/ >. Acesso em: 13 Fev. 2018
FORSTER, J. R. & FORSTER, G. 1776. Characteres generum plantarum, quas m mnere ad insulas marts Australls, collegerunt, descnpserunt, dehnearunt, anms 1772-1775
London, B White, T. Cadell, and P. Elmsly cf 40 t 20.
GRAY A.M. 2011. Convolvulaceae, version 2011:1. In MF Duretto (Ed.) Flora of
Tasmania Online. 11 pp. (Tasmanian Herbarium, Tasmanian Museum & Art Gallery:
Hobart). ISBN 978-1-921599-36-1 (PDF). www.tmag.tas.gov.au/floratasmania
HALLIER, H. 1893. Vcrsuch einer natfirlichen gliederung der Convolvulaccen auf morphologischer und anatomischer Gruudlage. Bot. Jahrb. 16: 453-591.
29
HSIAO, L. AND C.S. KUOH. 1995. Pollen morphology of Ipomoea (Convolvulaceae) in Taiwan. Taiwania, 40: 299–316.
HUANG, T.C. 1972. Pollen Flora of Taiwan. National Taiwan University. Botany dept.
Press.
JOHNSON, R.W., LANG, P.J. & BARKER, R.M. 2014. Convolvulaceae (version 2). In:
Kellermann, J. (ed.), Flora of South Australia (ed. 5). 25 pp. (State Herbarium of South
Australia: Adelaide). www.flora.sa.gov.au/ed5.
JUSSIEU, A.L. 1789. Genera Plantarum Secundum Ordines Naturales Disposita. Parisiis,
Herissant/Theophilum Barrois.
LEWIS, W.H. & OLIVER, R.L. 1965. Realignment of Calystegia and Convolvulus
(Convolvulaceae). Annals of the Missouri Botanical Garden 52: 217-222.
LEWIS, W.H. 1971. Pollen differences between Stylisma and Bonamia
(Convolvulaceae). Brittonia 23:331-334.
MEISNER, C.F. 1869. Convolvulaceae. In: C.P.F. Martius & A.G. Eichler (eds.). Flora
Brasiliensis 7: 199-370.
MENEMEN, Y.& JURY, S. L. 2002. Pollen Studies on Some Species of the Genus
Convolvulus L. (Convolvulaceae) from Morocco. Turkish Journal of Botany 26: 141-14.
MOAR, N.T. 1993. Pollen grains of New Zealand dicotyledonous plants. Canterbury
(New Zealand): Manaaki Whenua Press.
O'DONELL, C. A. 1957. Convolvulaceas Chilenas. Bol. Soc. Arg. Bot. 6: 143-184.
_____1959a. Convolvulaceas argentinas. Lilloa 29: 87-348.
_____1959b. Convolvuloideas de Uruguay. Lilloa 29: 350–376.
30
OOSTSTROOM, S. J. Van. 1953. Convolvalaceae. Flora Malesiana1 (4): 388-512.
PETER, A. 1891. Convolvulaceae. In A. Engler and K. Prantl [eds.], Die Nattirlichen
Pflanzenfamilien, 4: 1-40.
RHUI-CHENG, F. & STAPLES, G. 1995. Convolvulaceae In: Flora of China Editorial
Committee. Flora of China. Missouri Botanical Garden Press, St. Louis, v. 16, pp. 271–
325.
SENGUPTA, S. 1972. On the pollen morphology of Convolvulaceae with special reference to taxonomy. Review of Palaeobotany and Palynology 13: 157-212.
SHAW, H.K.; AIRY. 1966. Willis Dictionary of Flowering Plants and Ferns, ed. 7:
Cambridge University Press, London.
SIMÕES, A.R.; CULHAM, A. & CARINE, M. 2015. Resolving the unresolved tribe: a molecular phylogenetic framework for the Merremieae (Convolvulaceae). Botanical
Journal of the Linnean Society 179: 374-384.
SIMÕES, A.R.; STAPLES. 2017. G. Dissolution of Convolvulaceae tribe Merremieae and a new classification of the constituent genera. Botanical Journal of the Linnean
Society 183: 561-586
STAPLES, G. 2019. World Checklist of Convolvulaceae. Facilitated by the Royal
Botanic Gardens, Kew. Published on the Internet; http://apps.kew.org/wcsp/ Retrieved
January 2019.
STEFANOVIC, S.; KRUEGER, L. & OLMSTEAD, R.G. 2002. Monophyly of the
Convolvulaceae and circumscription of their major lineages based on DNA sequences of multiple chloroplast loci. American Journal of Botany 89: 1510-1522.
31
STEFANOVIC, S.; AUSTIN, D.F. & OLMSTEAD, R.G. 2003. Classification of
Convolvulaceae: A Phylogenetic Approach. Systematic Botany 28 (4): 791-806
TAKHTAJAN, A. 1997. Diversity and classification of flowering plants. New York.
TELLERÍA, M. C. AND DANERS, G. 2003. Pollen types in Southern New World
Convolvulaceae and their taxonomic significance. Plant Systematics and Evolution 243:
99-118.
THARP, B.C. & M.C. JOHNSTON. 1961. Recharacterization of Dichondra
(Convolvulaceae) and a revision of the North American species. Brittonia 13: 346-360.
WELSH, M.; STEFANOVIĆ, S. & COSTEA, M. 2010. Pollen evolution and its taxonomic significance in Cuscuta (dodders, Convolvulaceae). Plant Systematics and
Evolution 285: 83-101.
WIERSEMA J. H. & LEÓN B. 2013: World economic plants, a standard reference, ed.
2. – Boca Raton: CRC.
32
Capítulo 1: Palinologia
Artigo: Pollen morphology in Dichondra
(Convolvulaceae).
Autores: Geadelande Delgado, Francisco de Assis
Ribeiro dos Santos & Maria Teresa Buril
Revista: GRANA
STATUS: Submetido
33
Pollen morphology in Dichondra (Convolvulaceae)
Pollen in Dichondra (Convolvulaceae)
GEADELANDE CAROLINO DELGADO JUNIOR1, FRANCISCO DE ASSIS
RIBEIRO DOS SANTOS2 & MARIA TERESA BURIL1
1Graduate Program in Botany, Universidade Federal Rural de Pernambuco, 52171-
900, Recife, PE, Brazil.
2Departament of Biology, Universidade Estadual de Feira de Santana, Feira de
Santana, Brazil.
Abstract
The pollen morphology of Dichondra species was examined under optic and scanning electron microscopes. We studied 13 taxa of Dichondra, seven of which were examined for the first time. Pollen grains are monads, tricolporate, medium or large sized; subprolate, prolate or prolate-spheroidal in shape. Sexine ornamentation is perforate to microreticulate with microspines or granules. Orbicules are reported for the first time in
Dichondra and were found in all species, distributed on the apertural membrane or close to margin of colpi. Our results revealed that pollen grain morphology in Dichondra does not provide sufficiently distinguishing characters, however, further studies about the orbicule occurrence in the Dichondreae tribe could be important as a synapomorphic character.
Keywords: Dichondreae, orbircules, taxonomy
Correspondence: Geadelande Carolino Delgado Junior, Programa de Pós-graduação em
Botânica, Universidade Federal Rural de Pernambuco (UFRPE), 52171-900, Recife,
PE, Brazil. Email: [email protected].
34
Introduction
Since 1893 when Hallier recognized pollen morphology as a significant taxonomic character for Convolvulaceae, pollen been used to support classifications within the family. Hallier (1893) comprised the genera into two informal, non- taxonomic groups: Echinoconiae (echinate exine) and Psiloconiae (smooth exine). In addition, Hallier described the type of pollen morphology for all known genera at that time and, also based on other characters (fruit and stigma), he proposed a classification of the family. Molecular phylogenetic analyses confirmed Echinoconieae as monophyletic, mostly represented by the Ipomoeeae tribe and Psiloconiae was resolved as paraphyletic (Stefanović et al 2002).
Subsequent studies in Convolvulaceae used pollen morphology as one character to distinguish morphologically related genera. For example, Calystegia ×
Convolvulus (Lewis & Oliver 1965), Bonamia × Stylisma (Lewis 1971), Merremia s.l ×
Operculina × Ipomoea (Austin 1975). Pollen features have also been used as criteria to propose an evolutionary arrangement (Sengupta 1972; Austin 1973) and species-level delimitation in Convolvulaceae (Hsiao & Kuoh1995; Menemen & Jury 2002; Welsh et al. 2010).
In Cuscuta, pollen characters are not sufficient for reconstructing phylogenetic relationships within the genus, but pollen morphology can be useful to separate species among different clades (Welsh et al 2010). A palynologic study of Jacquemontia (Buril et al 2015) revealed groups that were corroborated with a phylogenetic and morphological approach (Buril 2013).
Dichondra is monophyletic genus, comprises ca. 15 species distributed from the southwestern United States to South America, Australia and New Zealand (Tharp &
35
Johnston 1961). This genus is included in the Dicranostyloideae (bifid style) clade, and it placed in the tribe Dichondreae based (Austin 1973; Stefanović et al 2002). The genus is characterized by the following set of characters: creeping and sprawling perennial herbs with reniform or orbicular-reniform leaves, entire-leaf margins, malpighiaceous trichomes, inconspicuous flowers and styles 2, distinct, gynobasic. (Chapter 3).
Dichondra is sudivided into two subgenera based exclusively on the fruit type:
Dichondra Tharp &Johnston (utricule) and Capsularia Tharp &Johnston (capsule),
(Tharp & Johnston 1961). Dichondra stands out due to its high morphological variation, making species delimitation a challenge. Depending on the taxonomic concept adopted, the number of species within the genus varies from 5 to 15 (Johnson et al 2014).
Pollen data on Dichondra are rare or imprecise. The most comprehensive palynological study, Hallier (1893) described pollen in Dichondreae as “Convolvulus- like” (3-colpate). Dichondra repens J.R. Forst. & G. Forst has been the species more extensively studied and described having as smooth surface; pores are slit-like with cross-furrows; oblate-spheroidal shape, and sexina is granulate (Ooststroon 1953;
Cranwell 1942; Huang 1972 and Moar et al. 1993). A study of three species [D. argentea Humb. & Bonpl., D. microcalyx (Hallier f.) Fabris and D. sericea Sw.] from
South America described the genus as tricolpate, with long colpi, tectate microgranulate membrane, and affirmed that Dichondra shares theses pollen features with other tricolpate genera, although is macromorphologically different to other Convolvulaceae
(Tellería & Danners 2003).
Considering the historical value of pollen morphology in Convolvulaceae, this study aims to characterize pollen grains of Dichondra and verify if they can point to natural groups within the genus.
36
Material and methods
Pollen morphology from 13 taxa was analyzed under scanning electron microscopy (SEM) (Fig 2, 3) and under light microscopy (LM), except Dichondra micrantha (Fig 1). Anthers were collected from specimens of following MO, PEUFR,
SI, WELT (herbarium acronyms follow Thiers, continuously updated) or from living specimens during field excursions in Brazil and the United States, vouchers deposited on MO and PEUFR.
The pollen grains were acetolyzed according to methodology of Erdtman
(1960), mounted with glycerine jelly and deposited into the pollen collection at the
Universidade Estadual de Feira de Santana (PUEFS). For SEM analyses, the samples were first treated with an ethanolic series (70%, 80%, 90% and 100%), pipetted onto stubs, air dried and then sputter coated with gold. Some pollen grain was metallized without prior acetolysis. Samples were examined using a thermionic emission SEM system with tungsten heated filament as electron source (VEGA3, TESCAN) at an accelerating voltage of 10 SEM HV and a working distance of 8-16 mm.
Pollen grain size and exine thickness were measured under LM. For pollen size, measurements were taken of the polar and equatorial axes (P and E) of 25 pollen grains, while exine thickness was measured from 10 pollen grains. Pollen morphology follows Punt et al (2007) and Erdtman (1952). Morphometric measurements from the current study are summarized in Table I.
37
Figure 1. Details of tricolpate pollen under light microscopy. Dichondra sericea (A),
Dichondra nivea (B). Optical section showing thickness of pollen wall.
Results
We increase the recorded knowledge about the morphological pollen features of Dichondra. Seven taxa were examined for the first time here: Dichondra brachypoda
Wooton & Standley, D. carolinensis Michx., D. donelliana Tharp & Johnston, D. macrocalyx Meisn., D. micrantha Urb (only under SEM), D. nivea (Brandg.) Tharp &
Johnst, D. occidentalis House. Another Dichondra species that had already examined in other works, we also study here. (Fig. 2-3).
Pollen grains are monads and their size vary from medium to large (P = 27.5–
52.5 μm, E = 20–45 μm). Dichondra nivea had the largest pollen grains (P = 52.5. ± 2.6
μm, E = 45 ± 4.4 μm), and D. carolinensis (P = 27.5 ± 1.5 μm, E = 20 ± 1.7 μm) along with D. sericea var. sericea (P = 11.9 ± 0.59 μm, E = 27.5 ± 2.9 μm) presented the smallest grains (Table 1). Pollen grain shape ranged from subprolate to prolate and prolate-spheroidal (P/E = 1–1.37; Fig. 2D; Table 1).
All species presented the tricolpate apertural type (Fig. 2A, 3C). The colpi were elongated and narrowed toward the poles. Apertural membrane had microspines in three different shapes (Fig 2B) and some orbicules; orbicules were also observed close to margin of colpi (Fig 2E).
38
Table I. Measurements of pollen grains of Dichondra (Convolvulaceae) species.
Pollen measurements (µm)
Species Polar axis (P) Equatorial axis (E) P/E Exine Shape
Dichondra argentea 30 ± 2.07 27.5 ± 2.3 1.09 3 Prolate spheirodal D. brachypoda 32.5 ± 3.15 30 ± 2.6 1.08 2 Prolate spheirodal D. brevifolia 27.5 ± 3.2 22.1 ± 5.6 1.2 1.9 Prolate D. carolinensis 27.5 ±1.5 20 ± 1.7 1.37 2 Prolate D. donelliana 27.5 ± 2.4 27.5 ± 1.4 1 1.8 Prolate spheirodal D. macrocalyx 30 ± 2.1 27.5 ± 2.1 1.1 1.9 Prolate spheirodal D. microcalyx 28.9 ± 3.5 22.5 ± 3.5 1.2 1.9 Subprolate D. nivea 52.5 ± 2.6 45 ± 4.4 1.2 4.2 Subprolate D. occidentalis 37.5 ± 2.5 32.5 ± 3.4 1.1 2.9 Subprolate D. repens 30 ± 2.1 23.7 ± 5.8 1.3 2 Subprolate D. sericea var 30 ± 3.1 27.5 ± 2.3 1.1 1.4 Prolate spheroid holosericea D. sericea var. 27.5 ± 1.6 27.5 ± 2.9 1 2.1 Prolate spheroid sericea
Exine exhibited perforate surface under the SEM, but when analyzed by LM it seemed more like microreticulate. Perforations are heterogeneous in outline, circular, elongate or irregular; and smaller near the apertures, irregularly scattered and with variable density among species. Tectum is thin (Fig. 2D, 3G) and also presents microspines or granules; columellae are small to medium, simple. Thickness of the exine varies from 1.9 to 4.2 µm. Sexine is thicker than the nexine.
Two distinct types of supratectal processes were observed: microspines and granule:
I. Microspines: are quite small, but with an elongate element tapering towards the apex, shorter than or equal to 1µm. The microspines exhibited three patterns:
a) Conic microspines: cone-shaped, broad at base and blunt at the apex; or broad at the base and gradually tapering towards the apex with more or less rounded tips. Taxa: Dichondra argentea (Fig 2C), D. brachypoda, D. carolinensis (Fig 2F), D.
39
donelliana (Fig 2H), D. macrocalyx (Fig 2I), D. micrantha (Fig 3A), D. microcalyx (Fig
3B), D. nivea (Fig 3D), D. occidentalis (Fig 3E), D. sericea var. sericea (Fig 3G) and
D. sericea var. holosericea (Fig 3I).
Figure 2. A-C. Dichondra argentea. A. Polar view. B. Orbicules, microespines conus and digitate C. Surface detail. D. D. brachypoda. Equatorial view. E. D. brevifolia. Orbicules and microespines digitate. F. Dichondra carolinensis. Orbicules, microespine conus and baculiform. G. Dichondra donelliana. Orbicules, microespine conus, digitate and baculiform. H.
Dichondra macrocalyx. Orbicules and microespine conus. Scale bars – 2 µm (B, C, E-I) 5 µm (D), 10 µm (A).
40
b) Digitate microspines: are broad from base to apex and the latter branches
distally into two parts. They are like two conic microspines coming together. Taxa:
Dichondra argentea (Fig 2C), D. brachypoda, D. brevifolia (Fig 2E), D. donelliana
(Fig 2H), D. occidentalis (Fig 3E), D. nivea (Fig 3D) and D. repens (Fig 3F).
Figure 3. A. Dichondra micrantha. Orbicules and microespine conus. B. D. microcalyx. Orbicules, microespine conus and baculiform. C-D. D. nivea. C. Polar view. D. Orbiculares, microespine conus and digitate. E. D. occidentalis.
Orbicules, microespine conus and digitate. F. D. repens. Orbicules, microespine digitate and baculiform. G-H.
Dichondra sericea var. sericea. G. Microespine conus and granules. H. Polar view and orbicules. I. D. sericea var. holosericea. Orbicules and microespine conus. Scale bars – 1 µm (E), 2 µm (A, B, F, G, I), 5 µm (D, H), 10 µm (C).
41
c) Baculiform microspines: cylindrical-shape with blunt to rounded apex.
Taxa: Dichondra carolinensis (Fig 2F), D. donelliana (Fig 2H), D. microcalyx (Fig 3B) and D. repens (Fig 3F).
II Granule: are very small and rounded or wart-like shaped, less than 0.5 µm long. It was only found in Dichondra sericea var. sericea (Fig 3G).
There are attached orbicules (Ubisch bodies) that are more or less globose to long, sometimes with few branches at apex. Orbicules are present in all species (Fig.
2C, E, F, H, I; 3A, B, D, E, G, I).
Discussion
All Dichondra species are tricolpate. However, Moar et al (1993) mentioned in study for the pollen fron New Zealand that D. repens rarely presents some tetracolpate grains. Pollen tricolpate has been interpreted as ancestral for the family (Sengupta 1972;
Austin 1973). If a fossil interpretation is adopted, the pantoporate fossil of
Calystegiapollis microechinatus predates the basic tricolpate Perfotricolpites digitatus
(Martin 2001), thus pantoporate grains are ancestral instead of tricolpate, which is what
Nair & Rehman (1963) have suggested for the family.
Convolvulaceae pollen has three different basic apertural types: tricolpate, pantocolpate, and pantoporate (Sengupta 1972; Tellería & Danners 2003). Each type occurred at different times over the evolutionary history of Convolvulaceae, even representatives of a single tribe can include different types of apertures (Stefanović et al
2003). For example, within the tribe Dichondreae, two types of pollen are reported: tricolpate, the most common, and pantocolpate, which occurs in some Calycobolus and
Petrogenia species (Stefanović et al 2003, Austin 1985, Staples 1987). Heteromorphism
42 in pollen aperture has been documented in other genera (e.g. Jacquemontia, Operculina)
(Buril et al 2013; Simões et al 2018), however we did not find different types, even
Dichondra presents two subgenera. The subgenera classification does not support by pollen morphology.
Pollen grains in Dichondra are medium sized, except for Dichondra nivea which presents large grains, reaching up to 57.5 µm in diameter. Crude (2009) suggested that pollen grain size is associated with stigma depth, which is in agreements to Dichondra genus. The unique larger sized pollen belongs to the unique species that having the largest style length and stigma depth in the genus. Other species with medium pollen have the style nearly at same length.
The most common shape of pollen grains in Dichondra is prolate-spheroidal, but either prolate and subprolate are also found in the genus according to literature
(Table 1). Huang (1972) documented oblate-spheroidal for Dichondra repens and
Tellería & Daners (2003) attributed suboblate-spheroidal to D. sericea and D. microcalyx. These shapes differ from our results, since we found subprolate for D. repens, prolate-spheroidal for D. sericea and subprolate for D. microcalyx. Pollen shape is not a stable character; different shapes may occur in the same taxon (Barth & Melhem
1988). Furthermore, the laboratory techniques used can influence the shape (Salgado-
Labouriau 1973). In addition, cultivated plants, such as the one studied here, are known to exhibit significative difference in pollen dimensions (Soliman 2013). Dichondra is a widespread genus, cultivated as an ornamental or occurring as a weed (Lawalree 1970).
Therefore, size and shape variation were not taxonomically informative at the genus level.
Supratectal process variation is a useful character in other Convolvulaceae. It has been used to classify groups into type of pollen grains (Sengupta 1972). For
43
Dichondra, we found the same surface pattern of the exine in every species. The tectum is microreticulate with microspines distributed across the surface. This pattern has been reported for other genera (e.g. Aniseia Choisy, Bonamia Thouars, Convolvulus L.,
Cressa L. Opercculina Silva Manso) (Tellería & Daners 2003; Simões et al 2018). In
Dichondra, intraspecific variations in the shape of microspines were found (e.g. D. brachypoda, D. nivea and D. microcalyx) and this heteromorphism has already been detected in many genera of Convolvulaceae, for example Ipomoea (Tellería & Daners
2003). In Dichondra, microspines are present in all species examined here, while granules only occur in D. sericea var. sericea. Perforations and spines density are hard to determine, and do not seem to be useful to distinguishing species.
In a review of orbicules in flowering plants, it was suggested that their absence or presence was observed from the earliest diverging angiosperms to most recent clades
(asterid) and may have potential value as a systematic character (Verstraete et al 2014).
In all the examined taxa orbicules of different sizes and density weew found. In
Convolvulaceae, they have been reported from Ipomoea, Convolvulus, Maripa,
Hewittia, Merremia and Jacquemontia (Halbritter & Berger 2017; Verstraete et al 2014,
Robertson 1974). In general, orbicules distribution is consistent at generic level, however Ipomoea does not follow this pattern (Verstraete et al 2014). In Dichondra, they have the same distribution, and are found attached to apertural membranes or at the margin of colpi, sometimes in the tectum.
Although our results revealed that pollen grain morphology in Dichondra is not sufficient to distinguish species, reporting orbicules in Dichondra might be of taxonomic value at the tribal level. Orbicules could be further analysed in the tribe, in the search for palynological synapomorphies, since tribe Dichondreae does not have a synapomorphic morphological character.
44
Conclusions
Dichondra is a genus with homogeneous pollen grains. It is a stenopalynous taxon, like other genera in the family. Even though pollen grains are similar, there is quite a variety in size, shape and ornamentation among species. Orbicules are present in all species, which suggests that an expanded character analysis could lead to improved tribal classification in the future.
Specimens examined
Dichondra argentea Humb. & Bonpl. ex Willd.: Delgado-Junior, G.C. & Staples, G.
849 (MO). (Analyzed under SEM and LM).
Dichondra brachypoda Wooton & Standl.: Delgado-Junior, G.C. & Staples G. 856
(MO). (Analyzed under SEM and LM).
Dichondra brevifolia Buchanan: Petrie, D. (WELT 32653). (Analyzed under SEM and
LM).
Dichondra carolinensis Michx.: Cronquist, A. 4271(MO). (Analyzed under SEM and
LM).
Dichondra donelliana Tharp & M.C.Johnst.: Beettle, A.A. 2598 (MO). (Analyzed under
SEM and LM).
Dichondra macrocalyx Meisn.: Zardini, E. & Soria, N. 5527 (MO). (Analyzed under
SEM and LM).
Dichondra microcalyx (Hallier f.) Fabris: Troncoso, N.S., 1220 (SI). (Analyzed under
SEM and LM).
45
Dichondra micrantha Urb.: Delgado-Junior, G.C. 825 (PEUFR). (Analyzed under
SEM).
Dichondra nivea (Brandegee) Tharp & M.C.Johnst.: Purpus 1901(MO). (Analyzed under SEM and LM).
Dichondra occidentalis House: Dequenes, O. 4734 (MO). (Analyzed under SEM and
LM).
Dichondra repens J.R.Forst. & G.Forst.: Petrie, D. (Welt 32662). (Analyzed under SEM and LM).
Dichondra sericea var. holosericea (O'Donnell) Fabris: Giardelli, M.L., 448 (SI).
(Analyzed under SEM and LM)
Dichondra sericea var. sericea Sw.: Delgado-Junior, G.C., 832 (PEUFR). (Analyzed under SEM and LM).
Acknowledgments
The authors gratefully thank the organizations that funded our research, including
CAPES (PhD scholarship for the first author) and CNPq (Process: PVE 314725/2014-
8), Jim Solomon for sampling assistance for the first author at Missouri Botanical
Garden. Special thanks to all who kindly shared personal observations and technical assistance to all students at the Laboratório de Micromorfologia Vegetal (UEFS). We also thank Sterling Herron and Nora Oleas for helping us with some literature.
46
Reference
Austin, D.F. 1973. The American Erycibeae (Convolvulaceae). Maripa, Dicranostyles
and Lysiostyles. II. Palynology. Pollen et Spores 15: 203–226.
Austin, D.F. 1975. Convolvulaceae. In: Flora of Panama (eds. R.E. Woodson & R.W.
Schery). Annals of the Missouri Botanical Garden 62: 157–224.
Austin, D.F. & Staples, G.W. 1985. Petrogenia as a synonym of Bonamia
(Convolvulaceae), with comments on allied species. Brittonia 37: 310–316.
Barth, O.M. & Melhem, T.S. 1988. Glossário ilustrado de palinologia. Campinas, Ed.
UNICAMP.
Buril, M.T. 2013. Sistemática e filogenia de Jacquemontia Choisy (Convolvulaceae).
PhD Thesis, Universidade Federal de Pernambuco, Recife, Brazil
Buril, M.T.; Oliveira, P.P.; Rodrigues, R.; Santos, F.A.R. & Alves, M. 2015. Pollen
morphology and taxonomic implications in Jacquemontia Choisy
(Convolvulaceae). Grana 54: 1-11.
Cranwell, L.M. 1942. New Zealand Pollen Studies: 1. Key to the pollen grains of
families and genera in the native flora. Records of the Auckland Institute and
Museum 2(6): 280-308
Cruden, R.W. 2009. Pollen grain size, stigma depth, and style length: the relationships
revisited. Plant Systematics and Evolution 278: 223–238.
Erdtman, G. 1952. Pollen morphology and plant taxonomy. Angiosperms. Stockholm:
Almqvist &Wiksell.
47
Erdtman, G. 1960. The acetolysis method, a revised description. Svensk Botanisk
Tidskrift 54: 561-564
Halbritter H., Berger A. 2017. Convolvulaceae. In: PalDat - A palynological database.
www.paldat.org/search/results/taxon:10300. accessed 2018-07-29
Hallier, H. 1893. Versuch einer naturlichen Gliederung der Convolvulaceen auf
morphologischer und anatomischer Grundlage. Engler, Botanic Jahrb 16: 453–
591.
Hsiao, L. and C.S. Kuoh, 1995. Pollen morphology of Ipomoea (Convolvulaceae) in
Taiwan. Taiwania, 40: 299–316.
Huang, T.C. 1972. Pollen Flora of Taiwan. National Taiwan University. Botany dept.
Press.
Lawalree, A. 1970. Definition, aire et mode de dessemination de Dichondra micrantha
Urban (Convolvulaceae). Acta Bot. Neerl. 19(5): 717-721.
Lewis, W.H. & Oliver, R.L. 1965. Realignment of Calystegia and Convolvulus
(Convolvulaceae). Annals of the Missouri Botanical Garden 52: 217–222.
Lewis, W.H. 1971. Pollen differences between Stylisma and Bonamia
(Convolvulaceae). Brittonia 23:331–334.
Johnson, R.W.; Lang, P.J. & Barker, R.M. 2014. Convolvulaceae In: Flora of South
Australia (ed Kellermann, J.), pp 25.
Martin, H.A. 2001. The family Convolvulaceae in the Tertiary of Australia: evidence
from pollen. Australia Journal Botany. 49: 221–234.
48
Menemen, Y.& Jury, S. L. 2002. Pollen Studies on Some Species of the Genus
Convolvulus L. (Convolvulaceae) from Morocco. Turkish Journal of Botany
26: 141-14.
Moar, N.T. 1993. Pollen grains of New Zealand dicotyledonous plants. Canterbury
(New Zealand): Manaaki Whenua Press.
Nair, P.K.K. & Rehman, K. 1963. Pollen grains of Indian plants – VI Convolvulaceae.
Bull. Nat. Bot.Gard. 83:1-16.
Ooststroon, S. J. Van. 1953. Convolvalaceae. Flora Malesiana1 (4): 388-512.
Punt, W., Hoen, P.P., Blackmore S., Nilsson, S., Le Thomas A. 2007. Glossary of
pollen and spore terminology. Review of Palaeobotany and Palynology 143: 1–
81
Robertson, K.R. 1974. Jacquemontiaovalifolia (Convolvulaceae) in Africa, North
America, and the Hawaiian Islands. Annals of the Missouri Botanical Garden
61: 502-513.
Salgado-Labouriau, M.L. 1973. Contribuição à Palinologia dos Cerrados. Acad. Bras.
de Ciências, Rio de Janeiro.
Sengupta, S. 1972. On the pollen morphology of Convolvulaceae with special reference
to taxonomy. Review of Palaeobotany and Palynology 13: 157-212.
Simões, A.R.G.; Furness, C.A. & Luz, C.F.P. da. 2018. The systematic value of pollen
morphology in Operculina (Convolvulaceae). Grana 58(1): 1-13.
Soliman, S.S. 2013. Investigations on the pollen morphology of some date palm males
(Phoenix dactylifera L.) in Saudi Arabia. Australian Journal CS 7(9):1355-
136.
49
Staples, G. 1987. A revision of Porana Burman f. (Convolvulaceae) and an evaluation
of the Poraneae. Doctoral dissertation, Harvard University, Cambridge.
Stefanović, S., L. Krueger & R. G. Olmstead. 2002. Monophyly of the Convolvulaceae
and circumscription of their major lineages based on DNA sequences of
multiple chloroplast loci. American Journal of Botany 89: 1510–1522.
Stefanović, S.; Austin, D.F. & Olmstead R.G. 2003. Classification of Convolvulaceae: a
phylogenetic approach. Systematic Botany 28: 791–806.
Tellería, M. C. and Daners, G. 2003. Pollen types in Southern New World
Convolvulaceae and their taxonomic significance. Plant Systematics and
Evolution 243: 99-118.
Tharp, B. C. & Johnston, M. C. 1961. Recharacterization of Dichondra
(Convolvulaceae) and a revision of the North American species. Brittonia 13:
346-360.
Verstraete, B.; Moon, H.K. Smets, E. & Huysmans, S. 2014. Orbicules in flowering
plants: a phylogenetic perspective on their form and function. Botanical
Review 80: 107–134.
Welsh, M.; Stefanović, S. & Costea, M. 2010. Pollen evolution and its taxonomic
significance in Cuscuta (dodders, Convolvulaceae). Plant Systematics and
Evolution 285: 83–101.
50
Capítulo 2: Filogenia
Título: A gleam in the dark: Phylogenetic and morphological species delimitation in the confusing genus
Dichondra (Convolvulaceae).
Autores: Geadelande Delgado, Gustavo Souza & Maria
Teresa Buril1
Revista: Plant Systematics and Evolution
Status: Não Submetido
51
Geadelande Delgado-Junior1,3, Gustavo Souza2 & Maria Teresa Buril1
A gleam in the dark: Phylogenetic and morphological species delimitation in the confusing genus Dichondra (Convolvulaceae).
1Programa de Pós-Graduação em Botânica, Departamento de Biologia, Universidade
Federal Rural de Pernambuco, 52171–900, Dois Irmãos, Recife, PE, Brasil.
2Laboratório de Citogenética e Evolução vegetal, Universidade Federal de Pernambuco,
50670-901, Cidade Universitária, Recife, PE, Brasil.
3Author for correspondence: [email protected] (+5583996917000)
ORCID: Geadelande Delgado: 0000-0002-6693-1540; Maria Teresa Buril: 0000-0001-
9615-2057; Gustavo Souza:
52
Abstract
Dichondra is a genus poorly understood taxonomically in Convolvulaceae. Different authors recognize 5 to 15 species, depending on taxonomic concept adopted. These plants occur naturally in America and Oceania but some of them are spread as weed or ornamental around the world. In this work, the systematics of the genus Dichondra and its intrageneric relationships were investigated based on molecular and morphologic data.
Molecular phylogenetic analysis was based on nuclear ITS and the chloroplast trnL-F and matK sequences. Considering the possibility of incomplete lineage sorting or gene flow, we performed a multilocus species-tree analysis. Our results show flow phylogenetic resolution and incongruent topologies between plastid and nuclear datasets. In general, we found D. argentea, D. brachypoda, D. nivea and D. occidentalis (Dichondra subg.
Capsularia) as early diverging linages of the genus, these species are characterized by dehiscent fruit, and Dichondra subg. Dichondra species, characterized by indehiscent fruit, were clustered in the same clade, however presented low internal resolution. The multilocus species-tree analysis revealed the existence of two diverging lineages indehiscent clade and dehiscent clade. Samples of indehiscent clade have overlapping/intermediate morphological characters, making impractical to circumscribe them as separate taxa and must be an evidence to purpose synonimization.
Keywords: Phylogeny, phylogenetic incongruence, ponysfoot, species tree, taxonomic complex.
53
Introduction
Convolvulaceae occurs around the world in tropical and temperate regions. It is known for its many ornamental species (morning glory) and the comestible sweet-potato
(Ipomoea batatas L.) (Staples & Brummitt 2007). Comprising around 59 genera and 1950 species (Staples 2019), the family is well-defined morphologically by its alternate leaves, sympetalous corolla and mid-petaline band evident, in general inflorescence cymose and fruit capsule (Staples & Brummitt 2007). It is monophyletic with strong molecular support with absence of the rpl2 intron as a molecular synapomorphy (Stefanović et al.
2003).
Taxa delimitation within Convolvulaceae is sometimes a challenge and several analysis tried to solve it using morphological (e.g. Wood et al. 2015a for Convolvulus L.;
Athiê-Souza et al. 2017 for Aniseia Choisy) or molecular (e.g. Simão et al. 2015, 2017 for Merremioid clade) data. A frequent issue is the intermediacy of morphological characters among individuals that lead to a hard placement into a species and may be indicative of natural hybrids (Carine et al. 2007). Hybridization has been already reported to Convolvulus, Calystegia R.Br and Cuscuta L. (Brummitt 2000; Carine et al. 2007;
García et al. 2018).
Dichondra J.R.Forst. & G.Forst. (vernacular name: ponysfoot) is one of the most controversial genus of Convolvulaceae, in terms of it species richness and taxa delimitation. Morphological characters traditionally used to recognize species (trichome density, branch thickness and apex shape of calyx) are continuous and frequently overlaps
(Tharp & Johnston 1961; Chapter 3). This complexity is reflected in the way that several authors recognized Dichondra over time. It was already considered as a single species
(D. repens J.R.Forst. & G.Forst.) with high morphological polymorphism (Oliver 1877;
LeJoly & Lisowski 1993), as several varieties of D. repens (O'Donell 1957; Adams 1972) 54 or also as distinct species (Tharp & Johnston 1961, Chiarini & Espinar 2006). According to Johnson et al. (2014) the number of Dichondra species varies between 5–15 depending on taxonomic concept adopted. For example, Forbe (1978) studied cultivated species in
New Zealand, the author compared D. micrantha Urb. × D. repens and concluded that they can be distinguished by characters such as density of trichomes on leaf surface, corolla length in relation to calyx, anthers color and fruit exceeding or not calyx at maturity. Also, he pointed out as the most significant feature of D. micrantha is the flowers growing hidden below leaves on short peduncles which later becomes recurvated.
Even though, all these characters may present intermediatery expressions in natural populations, what makes impossible to identify species with confidence (Chapter 3). This may be indicative of continuous gene flow between these species and maybe they are polymorphic populations of the same taxon or hybrids (Mcdade 1990; Mallet et al. 2015).
The most recent review of Dichondra (Tharp & Johnston 1964) recognized 14 species without varieties. In the World Checklist for Convolvulaceae, 15 species and two varieties are accepted for Dichondra (Staples 2019). Tharp and Johnston (1961) proposed the recharacterization of Dichondra and were first to realize difference on fruit type
(dehiscent × indehiscent) in Dichondra. They suggested, based on type fruit, an infrageneric classification with two subgenera: Dichondra subg. Dichondra Tharp &
Johnst. (10 species.) and Dichondra subg. Capsularia Tharp & Johnst. (4 species.).
The genus is morphologically characterized by being creep, prostate herbs, normally with entire, reniform leaves, ovary bicarpellary and 2-styles distinct, gynobasic and schizocarp fruit (Chapter 3). The species has a disjunct distribution, where naturally occurs in Americas and Oceania. Though Dichondra micrantha and D. argentea Humb.
& Bonpl. ex Willd., are found as ornamentals or cultivated around the world (Austin
1998).
55
The unique comprehensive phylogenetic hypothesis for Convolvulaceae, included only two species of Dichondra subg. Capsularia (D. brachypoda Wooton &
Standl. and D. occicentalis House), not sampling the morphological plasticity nor the geographical range of the genus (Stefanović et al. 2002). However, it indicates the monophiletism of the genus, and confirmed the close relationship with Falkia Thunb. and
Nephrophyllum A. Rich.. This relationship has already been suggested based on morphology (Demissew and Austin 1995), and together with Petrogenia I.M.Johnst. as its sister group, these genera compose the clade Dichondrineae (Stefanović et al 2003).
Here we present a phylogenetic analysis that samples the full morphological diversity and nearly the entire geographical range of the Dichondra genus. This analysis is based on two plastid loci (matK and trnL-F) and the nuclear ribosomal ITS region, providing improved sampling over Stefanović et al. (2002). We specifically addressed three questions: 1) What are the phylogenetic relationships of Dichondra species? 2) Are the subgenera proposed by Tharp and Johnston (1964) monophyletics? and 3) What is
Dichondra repens, a name arbitrarily used overtime?
Materials and methods
Morphological observations
We produced a list of accepted species names based on Tharp & Johnston (1964) and
Staples (2019). We used the typological concept to recognize species base on (Tharp &
Johnston(1964), protologues, typus as well morphological observations of specimens from the following herbaria: BHCB, BR*, BRIT, CESJ, COL, CORD, EAC*, ESA*,
FLOR, FURB, FUEL, GH, HAS, HCF, HUCP, HUCS, HUEFS, HUI* HURB, HVAT,
IEB, ICN, INPA*, IRAI, K, LINN*, LPB, M*, MBM, MO, MPUC, MVFA, MVJB,
56
MVM, NY, P*, PACA, PEL QCNE*, QCA, RB*, S*, SBT*, SI, SJRP, SMF, SRSC, TEX,
UB, UC, UEC*, UPCB, US, WELT (acronyms follow Thiers continuously updated *= consulted by virtual collection or photos). Fieldwork was executed in Brazil and Uruguay
(2015), United States (2016), Colombia, Bolivia and Ecuador (2018).
Taxa sampling
This study includes samples for 15 species, corresponding to 100% of Dichondra (Staples
2019) for at least one loci, which represents a considerable variable morphological diversity and geographical distribution. For ITS we got sequence to all Dichondra species, except Dichondra brevifolia Buchanan, including one variety D. sericea var. holosericea (O'Donnell) Fabris, at total 27 accessions. For trnL-F we got sequence of nine species with 24 accessions. For matK we got sequence for 10 species with 16 accessions. Samples were obtained from silica gel-dried obtained during fieldwork in
Bolivia, Brazil, Colombia, New Zealand, Uruguay and United State and herbarium specimens from MO, SI, WELT. Falkia, Ipomoea L., Merremia Dennst. ex Endl.,
Hewittia Wight & Arn., and Petrogenia, Polymeria R.BR. species previously published and available in GenBank were used as outgroups. Vouchers used in the analysis are listed on Supporting Information, Table 1).
DNA extraction, amplification and sequencing
DNA was extracted following a CTAB mini-extraction procedure (Doyle & Doyle 1987 and Ferreira & Grattapaglia 1995) from at least 30mg of dried leaf material (silica gel- dried or herbarium specimens). DNA quantification was done in a Nanodrop 2000c spectrophotometer (Thermo Scientifific). Plastid DNA barcoding region matK was amplified using universal primers 1RKIM and 3FKIM (Bremer et al. 2002). The trnL- trnF (e and f) gene was amplified using PCR conditions as described in Shaw et al. (2007).
57
The partial ITS region (ITS1-5.8S), was amplified with universal primers ITS 3 and ITS
4 (White et al. 1990). ITS PCR reactions were incubated at 95 ºC for 5 minutes, followed by 30 cycles of denaturation at 95°C for 1 min, primer annealing at 50°C for 1 min and primer extension at 72°C for 1 min; followed by a final extension step of 1 min at 72°C in an Applied Biosystems thermocycler. Amplifications were performed in 50 µL of reaction volume containing 200 ng od genomic DNA and final concentrations of 1× buffer, 0.3mMMgcl, 0.2mM DNTP, 0.1µM of each specific primers, 1.25 U taq DNA
POLYMERASE, 1 × TBT and MiliQ water to complete the volume. After visualizing the
PCR products in agarose 1 % gel, the products were purified by precipitation. Purified
PCR products were sequenced in 3500 Genetic Analyzer (Applied Bioystems).
Phylogenetic analysis
For phylogenetic analysis we aligned the sequences for the plastid spacer (matK and trnL-F) and nuclear ITS (ITS1-5.8S), using Clustal W (Larkin et al. 2007) available on Geneious 11.1.4 ((http://www.geneious.com, Kearse et al., 2012). The maximum likelihood (ML) and Bayesian inference (BI) searches were performed with matK, trnL-
F and ITS regions separately and combined plastids dataset. The most appropriate model of sequence evolution for each region was determined using the Akaike information criterion (AIC) as implemented in the program jModelTest 0.1.1 (Posada 2008).
Evolutionary models were determined for each subregion as follows: GTR+ I+G for
ITS1+5.8S and GTR for matK and trnL-F and GTR+I+G for plastids concatenated regions. ML analysis and bootstrap support calculations (1000 replicates) were performed using FastTree (Price et al. 2010) available on Geneious and the BI search was performed using Mr. Bayes v. 3.1.2 (Ronquist & Huelsenbeck 2003) under a partitioned model as implemented on CIPRES Science Gateway V.3.1 (www.phylo.org). The analysis was conducted for two independent runs and for 10000000 generations, sampling every 1000
58 trees. Tracer v. 1.0.1 (Rambaut & Drummond 2003) was used to ensure that the Markov chains had reached stationary and to determine the appropriate number of ‘burn-in’ runs for analysis. Posterior probabilities (PP) were estimated by constructing a 50% majority- rule consensus tree with the sampled trees. Trees were visualized using FigTree v. 1.3.1
(Rambaut 2009). Splitstree4 (Huson & Bryant 2006) was used to generate relationship networks for plastids datasets based on incongruities between plastid and nuclear loci, and therefore, signs of hybridization. The network was performed based on the standard function of maximum parsimony.
Species-tree and divergence-time estimation
We used a multispecies coalescent model to estimate the species tree based on multi-locus data under the Star BEAST (BEAST) option implemented in BEAST v1.6.1
(Drummond & Rambaut 2007; Heled & Drummond 2009). This approach outperforms gene-concatenation methods in both species-tree topology inference and speciation-time estimation (Heled & Drummond 2009). Sequence data were tripartitioned into ITS, matK, and trnL-F. Bayesian MCMC was performed for 120-million generations with a sampling frequency at every 1000 generations. Burn-in period was determined by Tracer 1.0.1
(Rambaut & Drummond 2003). Node ages were calculated as mean node heights from the maximum clade credibility tree summarized from the posterior distribution trees, which were displayed with FigTree v 1.3.1 (Rambaut 2009).
Divergence time estimates were performed in BEAST v.1.8.3 (Drummond &
Rambaut 2007; Drummond et al. 2012) fixing the tree topology of the species-tree analyses. An uncorrelated relaxed lognormal clock (Drummond et al. 2006) and a Yule
Process speciation model (Gernhard 2008) were applied. Two independent runs of
10000000 generations each were performed, sampling every 10.000 generations. In order to verify the effective sampling of all parameters and assess the convergence of 59 independent chains, we examined their posterior distributions in Tracer v.1.6, and the
MCMC sampling was considered sufficient at an ESS >200. After removing 25 % of samples as burn-in, the independent runs were combined and a maximum clade credibility
(MCC) tree was constructed using TreeAnnotator v.1.8.2. (Drummond et al. 2012). A secondary calibration was used: divergence Ipomoea and Merremia (47.8–56.0 Mya:
Eserman et al. 2014). The dated tree was viewed on FigTree v1.3.1
Results
The number of polymorphic sites varied among the three loci analyzed. In general,
ML topologies presented better resolution than BI topologies. All the trees generated by the different methods and loci are shown in Supporting Information. Total aligned matrix for trnL-F comprised 400 characters, which 339 (84.75%) are conserved, 57 (14.25%) are variable and 21 (5.25%) phylogenetically informative sites. The trnL-F topology resulted in two linages with unresolved internal relationships. The linage I (red color) includes by the Dichondra subg. Capsularia species (D. brachypoda, D. occidentalis, D. nivea and D. argentea) and the linage II (green color) includes Dichondra sub. Dichondra species (D. donelliana, D. sericea, D. macrocalyx, D. repens, D. microcalyx). For matK the total aligned matrix comprised 703 characters, which 592 (84.21%) are conserved,
103 (14.65%) are variable and 62 (8.82%) phylogenetically informative sites, the analysis result is similar to trnL-F topology (Supporting Information: Appendix Figure).
Total aligned matrix for ITS1+5.8S comprised 303 characters, which 244
(80.52%) are conserved, 55 (18.15%) are variable and of these 39 (12.87%) phylogenetically informative sites. ITS topology showed less resolved than plastids topology. Incongruences were observed between the ITS and the trnL-trnF/matK (Fig. 1).
60
This divergence was due by the species of the Dichondra subg. Capsularia species (D. argentea, D. nivea and D. brachypoda) appeared mixed with species Dichondra subg.
Dichondra (Supporting Information: Appendix Figure). Because this incongruence, we did not combine plastid and nuclear data.
According the analysis database for each plastid loci provided similar topologies, we did a concatenated trnL-F+matK analysis. The concatenated plastid databased resulted on matrix of 884 characters, where 768 (86.88%) are conserved, 110 (12.44%) are variable and 66 (7.66%) are phylogenetically informative sites. ML tree with concatenated plastid data were better resolved and it reveals that subgenus Capsularia
(D. occidentalis, D. brachypoda, D. argentea and D. nivea) is not monophyletic, however the subgenus Dichondra (D. repens, D. macrocalyx, D. micrantha, D. parvifolia, D. sericea, D. microcalyx, D. recurvata¸ D. donelliana, D. sericea var. holosericea) is monophyletic (Fig. 1).
The concatenated plastid analyses indicate that Dichondra presents three clades.
The Dichondra subg. Capsularia is the early diverging linages in Dichondra, and it divides in clades I and II, each one with two species. The clade I comprises two species from North America, which D. occidentalis is restricted to sites along the coast in
California and D. brachypoda occurs in southwest USA and Mexico. The clade II includes D. nivea, endemic from arid area of Mexico and D. argentea occurs naturally in almost all America and as ornamental around the world. Even though the relationship between clade III and II are clear and well supported, the internal relationship in clade III
(Dichondra subg. Dichondra) is uncertain with low support values and short branches.
61
Figure 1: Maximum likelihood (ML) consensus topology of combined plastid matK and trnL-F (left) and ITS1-5.8S (right) data for Dichondra. Numbers above the lines are fast tree support (0-
1). Branches without number corresponds to fast tree support > 0.7. The color green (subg. Dichondra) corresponds to clade indehiscent and color red (subg. Capsularia) to dehiscent in specie- tree topology.
62
Network tree and Species tree
Based on the incongruence between plastid and nuclear loci, and our morphologic study that showed characters overlap between species, we explore the possibility of reticulated relationships in Dichondra species. The figure 2 shows a Splitstree4 network based on plastids dataset of Dichondra samples. Alternative topologies in the network do not differ greatly and a complex arrangement is observed among the clade III. Species of clade III are divided into three lineages. Group A: samples from South America (D. sericea, D. parvifolia, Dichondra GD47 and GD48 represents morphologically intermediary between D. sericea and D. micrantha) and New Zealand (Dichondra GD14 and GD53 are morphologically similar to D. repens). This Group A is weekly supported in the phylogeny plastid tree. Group B is well-supported clade in the plastid trees, it includes samples of South (D. microcalyx and Dichondra sp GD41) and North (D. donelliana and D. recurvata) America. Group C: samples from New Zealand (D. repens,
Dichondra GD15, GD17 and D. micrantha) and from South America (D. macrocalyx and
D. sericea var. holosericea), also group C low supported in plastid tree.
Specie-tree
Unlike the plastid trees, the multi-locus species tree resolves the subgenera Dichondra
(Fig. 3). The subgenus Capsularia (clade dehiscent) and subgenus Dichondra (clade indehiscent) are sister group. Relationships among this species cannot be resolved with traditional phylogenetic approaches (see Fig. 1 and 2) and all of them were analyzed as three groups defined based on network analysis (Fig. 2). Given their admixture pattern in nuclear and plastid trees and the weak features morphologic used to recognize species, it is most appropriately to treats the three groups as a complex.
63
Figure 2: The network tree shows the phylogenetic relationship between Dichondra subg. Dichondra
(green) into 3 clusters, while species of Dichondra subg. Capsularia (red) diverged into two different linages.
Figure 3: A multilocus species-tree inferred by Star BEAST (BEAST) from all loci (ITS, trnL-F and matK) for Dichondra species. The posterior probability is depicted in each branch. As in Figure 1, colors indicated clades dehiscent (red), corresponding to subg. Capsularia (clade I and II) and indehiscent (green) corresponding to subg. Dichondra (Clade III).
64
Morphologic traits
Three groups present similar morphology without obvious characters to separate them. After examined ca. 3000 specimens, we realized that features historically used to recognize species are plastic, continuous and overlap. Indicating a lack of diagnostic characters for a clear taxa delimitation. Considering the calyx, a character used to separate species in Dichondra, it is tremendously variable in shape (between narrow oblong to obovate) and apex (round to acute). Other common character used is density of indumentum on leaves, it varies among individuals from dense to sparse and sometimes glabrous. Thus, it is not enough to distinguish species, especially intermediate individuals. Proportion between calyx and fruit or branch thickness are often used, however they are not consisting, its variable in all Dichondra taxa.
Figure 4: Phylogenetic tree shows relationship between Dichondra species. The clade III presents continuous morphologic variation into Dichondra repens. Shape of calyx, apex and density of trichomes overlaps. The age of the genus Dichondra was estimated at 25 Mya.
65
Discussion
Complex phylogenetic relationships in the confusing genus Dichondra
Here we present the first phylogenetic analysis of Dichondra including a representative sampling of its morphological diversity and distribution. Phylogenetic analysis with ML and BI based on plastid and nuclear loci were inconclusive because it presents incongruent and/ or poorly resolved topologies This incongruence might suggest different biological process (e.g. hybridization, lineage sorting, reticulate evolution)
(Degnan & Rosenberg 2009; Pelser et al. 2010; Nishimoto et al. 2003). This can also be related to a recent diversification (Willyard et al. 2009) and a better resolution was obtained by species-tree analysis. It is a common practice to assume that a species phylogeny equals a single-gene genealogy (including trees derived from gene concatenation). A gene tree represents only one realization of the stochastic process embedded inside the species tree (Ho & Shapiro 2011). Discrepancies between species trees and gene trees can arise if lineage sorting is incomplete among recently diverged species (Pamilo & Nei 1988) as is the case of Dichondra.
Different studies estimated the divergence time for the Convolvulaceae between
47.80 to 85 Mya (Wikström et al. 2001, Dillon et al. 2009, Eserman et al. 2014). Our data suggest a origin for the genus Dichondra with origin to ~25 Mya and diversification of its main clades to around 5-15 Mya. This short period of time has not yet been sufficient for the accumulation of mutations (morphological or molecular) that clearly distinguish nearby species. This reflects on the instability in Dichondra, especially in indehiscent clade. Dichondra repens was the first species described with New Zealand as type locality
(Forster & Forster 1776). Since then the epithet repens has been used indistinctly for identifying any Dichondra species (Delgado-Junior et al 2018). Tharp & Johnston (1964) used density of trichomes, apex sepal and quantitative character to recognize Dichondra 66 repens. Also, they affirmed it is a species restricted to New Zealand and Australia. These characters overlap with other species (e.g. D. sericea, D. macrocalyx, D. microcalyx) thus are plastic and continuous. In this way are insufficient to identify Dichondra repens reliably.
The fruit type defines the two main lineages of the genus Dichondra
Fruit morphology has been largely used to classify groups in Convolvulaceae and different types are recognized (e.g. capsule, utricle, berry) (Hallier 1893, Peter 1891;
Austin 1998). For some genera, the fruit were poorly or wrongly described such as the ones found in Dichondra (Tharp and Johnston 1964). Fruit in Dichondra was first described as capsule base on a specimen [Dichondra repens, Forster 61(P)] which actually present an indehiscent fruit (Forster. & Forster 1776). And later species descriptions (D. sericea and D. carolinensis) also were referred as capsules (Swartz 1788;
Michaux 1803). Tharp and Johnston (1964) classified fruit in Dichondra as capsule or utricle.
Our results confirm the subgenera proposted by Tharp and Johnston (1961) as monophyletic supported by species tree analysis. Although subg. Capsularia is showed as non-monophyletic in plastid tree. The dehiscent fruit type does not appear in the first linage in Convolvulaceae (Stefanovic et al. 2003), however it is the most common type present in the most diverse genera in the family (e.g. Evolvulus, Jacquemontia, Ipomoea
(Ooststroom 1934, Buril 2013, Wood et al 2015b). Dehiscent fruit type early diverged in tribe Dichondreae, probably in Dichondra (Fig 1) and is also present on Falkia, its sister group (Supporting Information). Fruit evolution, however, is not well traced for the family as a whole.
67
The indehiscent fruit, named utricle, has controversy morphology in several species in Convolvulaceae because, by definition, utricle is one-seeded fruit with inflated pericarpium (Spjut 1994). So, several species in the family have more than one seed but still are classified as utricle, for example Calycobolus glaber (Staples & Austin 2009).
Many Dichondra specimens examined had from one to four seeds, nevertheless we here decided using the general term indehiscent fruit for Dichondra species and proposed the clade dehiscent and Clade indehiscent (Fig. 3)
Indehiscent fruit in Cuscuta looks an enhanced dispersal capability to the detriment of dehiscent fruit, being more widely distributed (Ho & Costea 2018).
Dichondra species with indehiscent fruit also are more widely distributed, occurring naturally in all America and Oceania while capsular species are restricted to America, with three species endemic to North America (Tharp and Johnston 1961; Chapter 3). It might be one of the factors influencing the large distribution of this clade, but cannot be considered itself, since this is also the group with cultivated species, most of them we cannot assume if are naturalized or natural populations. Besides that, seeds dispersion has been overlooked on this genus.
In dehiscent clade (Fig. 3), Dichondra occidentalis and D. brachypoda are closely related by sharing vegetative characters, dehiscent fruit and flower in anthesis exceeding the calyx, D. occidentalis distinguished by sepals shape (lanceolate to ovate × obovate to oblong), corolla glabra (x pilose) and styles pilose (x glabrous). In its turn,
Dichondra argentea and D. nivea share the same leave pattern, flabellate and reniform with appearance silver. Dichondra argentea is distinguished by corolla yellowish (x white) with lobes smaller than 1.5 mm (x up to 5 mm) (chapter 3).
68
The indehiscent clade corresponds to a single species: Dichondra repens
Our results reject monophyly of D. repens based on morphological concept of species and show taxa clustered in three groups that corroborated no delimitation of species in clade III of plastid tree (Fig 1) and network tree (Fig 2). Dichondra sericea and
D. parvifolia were clustered together with two specimens from New Zealand, one from
South Brazil and one from Uruguay, these represent group A. It is geographic similar to group C with species D. repens, D. macrocalyx, D. micrantha, D. sericea var. holosericea and specimens from New Zealand. These groups are separated from group B that include
D. donelliana, D. microcalyx, D. recurvata and one specimen from Colombia.
Group A and C has a disjunct distribution between South America and New
Zealand, it is a biogeographical pattern already known, which connected species from
South America, Australia and New Zealand (Meudt & Simpson 2006; Heads 1998). In group B the close relationship between D. microcalyx (South America) with D. donelliana and D. recurvata (North America) is already reported by Austin (1982) who mentioned that there are no obvious characters can be used to distinguish them. Given the recent origin of the genus, our data suggest that all such disjunctions observed in
Dichondra are the result of long-distance dispersal events.
The indehiscent clade (Fig. 3) reflects the complex history taxonomy of
Dichondra, it includes three groups with high support (PP > 1), together share indehiscent fruit and represent a morphologic complex of species. The features (density of trichomes, apex and shape of sepal and quantitative character as branch thickness) used to recognize within this group are plastic, continuous and overlap (Tharp & Johnston 1961). Several authors (e.g. O’Donell 1959) already considered these taxa as varieties or forms of D. repens. Two possibilities for this clusters are possible: first, the group A, B and C corresponding 3 species distinct or subspecies, however reproductive isolating barriers 69 probably does not exist between them, hybrids are produced with molecular and morphologic characters evidences. Second, these groups are linages from an unique species (D. repens) and are sufficiently young, into first stages of diversification, and incomplete lineage sorting could explain conflicting placements of D. repens.
Considering the continuous variation that exists between the population of
Dichondra (Fig 4), historical problematic to delimitate species in the genus and no molecular support to recognize different species. We suggeste synonimizing all names of the Dichondra subg. Dichondra under Dichondra repens.
Conclusions and future prospects
Results here presented might indicate that taxonomists who suggested
Dichondra had only five species are probably correct. Dichondra repens could be considered so far as a unique species with a large morphologic variation, found around the world as naturalized, cultivated or natural. Thus, Dichondra probably is one of the lineages in Convolvulaceae with a low diversity, which is not rare in the family (e.g.
Daustinia, Aniseia, Dinetus and several other genera are monotipic or has less than 5 species). Future studies should investigate reproductive biology in Dichondra associated to genetic population in order to understand if gene flow explain the relationship among species.
70
Table 1. Species dataset used in this analysis. Regions sequenced are marked with a XXXXX. Taxa Voucher Locality GenBank No. trnL-F matK ITS D. argentea GD 10 Delgado G & Staples EUA XXXXX XXXXX XXXXX 850 D. brachypoda GD Delgado G & Staples EUA XXXXX XXXXX XXXXX 11 853 D. carolinensis GD45 Staples G 1636 EUA - - XXXXX D. donelliana GD 17 SNN 182 EUA XXXXX XXXXX XXXXX Dichondra Delgado G 866 Colombia - - XXXXX evolvulacea GD 42 D. macrocalyx GD9 Delgado G 834 Brazil XXXXX - XXXXX D. micrantha GD 20 AQ931155 New Zealand - - XXXXX D. micrantha GD 37 Delgado G824 Brazil - - XXXXX D. micrantha GD 39 Delgado G 842 EUA - - XXXXX D. microcalyx GD 25 Solomon JC 7203 Bolivia XXXXX - XXXXX D. microcalyx GD 35 Delgado G 865 Bolivia - XXXXX XXXXX D. microcalyx GD 63 Delgado G 867 Ecuador XXXXX XXXXX - D. nivea GD26 Mexico XXXXX - XXXXX D. occidentalis GD SNN 181 EUA XXXXX - - 16 D. parvifolia GD 38 Motta JJ 1175 Brasil - XXXXX -
71
D. parvifolia GD 50 G. Hatschbach 4291 Brasil - - XXXXX D. rercuvata GD 43 Delgado G 844 EUA - XXXXX XXXXX D. repens GD 13 Bean 29084 New Zealand - - XXXXX D. repens GD 59 QM 9410 New Zealand XXXXX - - D. repens GD 60 Van Klaplake 3 New Zealand XXXXX - XXXXX D. repens GD 61 CDK 1710 New Zealand XXXXX - XXXXX D. repens GD 62 CDK 2595 New Zealand XXXXX - XXXXX D. repens GD 64 WELT 32679 New Zealand - - XXXXX D. sericea GD12 Delgado G 828 Brazil XXXXX XXXXX XXXXX D. sericea var. Delgado G 864 Uruguay - XXXXX - holosericea GD 41 D. sericea var. Delgado G 863 Uruguay - - XXXXX holosericea GD 66 Dichondra GD14 QM 1889 New Zealand XXXXX XXXXX XXXXX Dichondra GD15 CDK1715 New Zealand XXXXX - - Dichondra GD 47 Delgado G 831 Uruguay - XXXXX - Dichondra GD 48 Delgado G 829 Brazil XXXXX XXXXX - Dichondra GD 49 Delgado G 833 Uruguay XXXXX XXXXX Dichondra GD 52 CDK 1711 New Zealand XXXXX - Dichondra GD 53 QM 1879 New Zealand XXXXX XXXXX XXXXX Dichondra GD 54 CDK 1730 New Zealand XXXXX - Dichondra GD 55 AQ 890836 New Zealand XXXXX XXXXX
72
Dichondra GD 56 AQ 797537 New Zealand XXXXX - Dichondra GD 57 CDK 1671 New Zealand XXXXX XXXXX Dichondra GD 58 CDK 1656 New Zealand XXXXX - outgroup Falkia repens - - AY101133.1 - - Hewittia malabarica - - KP236615.1 KR024909.1 KP261950.1 Ipomoea tiliacea - - AY101070.1 - KC621801.1 Ipomoea triloba - - - MF159429.1 MH050212.1 Merremia quinata - - KP236682.1 KR024982.1 KP262001.1 Polymeria mollis - - KC529166.1 - KC528816.1 Petrogenia repens - - AY101134.1 - -
73
Table 2. Sequencing features used in the analysis
Number of Alignment No. of No. of No. of parsimony Best Model Loci Primers sequences (including length (bp) variable conserved (%) informative sites outgroups) sites (%) (%) trnL-F f: ATTGAACTGGTGACACGAG 29 400 14.25 84.75 5.25 GTR+I+G (Taberlet et al. 1991) matK 20 703 14.65 84.21 8.82 GTR+I+G ITS ITS4: TCCTCCGCTTATTGATATGC 32 303 18.15 80.52 12.87 GTR+G ITS5: GGAAGTAAAAGTCGTAACAAGG (White et al. 1990) ITS5sty CGGAAGGATCATTGTCGATG ITS4sty CTGACCTGAGGTCGCGCT (Stappen et al. 2002) Plastid loci 30 884 12.44 86.88 7.66 GTR+G
74
Reference
Adams C D (1972) Flowering Plants of Jamaica. Mona, University of the West Indies.
Athiê–Souza SM, Staples G, Zickel CS, Buril MT (2017) Towards a Better
Understanding of the Tribe Aniseieae: Revisiting Aniseia and Iseia
(Convolvulaceae). Systematic Botany 42(3): 590–605.
Austin DF (1998) The indiscriminate vector: human distribution of Dichondra micrantha
(Convolvulaceae). Econ Bot 52: 88–106.
Austin DF (1982) Convolvulaceae. Flora of Equador 15:1–98.
Bremer B, Bremer K, Heidari N, Erixon P, Olmstead RG, Anderberg AA, ... &
Barkhordarian E (2002) Phylogenetics of asterids based on 3 coding and 3 non-
coding chloroplast DNA markers and the utility of non-coding DNA at higher
taxonomic levels. Molecular phylogenetics and evolution, 24(2), 274-301.
Brummitt RK (2000) Calyestegia (Convolvulaceae) hybrids in West Wales. Watsonia 23:
161–165.
Buril MT (2013) Sistemática e Filogenia de Jacquemontia Choisy (Convolvulaceae).
Tese de doutorado. Universidade Federal de Pernambuco, Recife.
Carine MA, Robba L, Little R, Russell S, Guerra AR (2007) Molecular and
morphological evidence for hybridization between endemic Canary Island
Convolvulus. Botanical Journal of the Linnean Society 154: 187–204.
Chiarini F, Espinar LA (2006) Flora Fanerogámica Argentina: Convolvulaceae. Proflora:
Conicet, Córdoba.
75
Degnan JH, Rosenberg NA (2009) Gene tree discordance, phylogenetic inference and the
multispecies coalescent. Trends in Ecology and Evolution 24(6): 332–340.
Delgado-Junior, GC, Staples G, Buril MT (2018) Typification of species names in
Dichondra (Convolvulaceae). Taxon 67(5): 1020-1023.
Demissew S, Austin D (1995) The genus Nephrophyllum (Convolvulaceae, tribe
Dichondrieae) in Ethiopia. Kew Bulliten 50: 103–108.
Dillon MO, T u T, Xie L, Quipuscoa Silvestre V, Wen J (2009) Biogeographic diversifi
cation in Nolana (Solanaceae), a ubiquitous member of the Atacama and Peruvian
Deserts along the western coast of South America. Journal of Systematics and
Evolution 47: 457 – 47
Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh
leaf tissue. Phytochem; Bull Bot Soc Am 19: 11–15.
Drummond AJ, Ho SYW, Phillips MJ, Rambaut A (2006) Relaxed phylogenetics and
dating with confidence. PLoS Biology 4(5): e88.
Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling
trees. BMC Evol Biol 7: 214.
Drummond AJ, Suchard MA, Xie D, Rambaut A (2012) Bayesian phylogenetics with
BEAUti and the BEAST 1.7. Mol Biol Evol 29:1969–1973.
Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling
trees. BMC Evol Biol 7: 214.
Eserman LA, Tiley GP, Jarret RL, Leebens-Mack JH, Miller RE (2014). Phylogenetics
and diversification of morning glories (tribe Ipomoeeae. Convolvulaceae) based
on whole plastome sequences. Am J Bot 101: 92–103
76
Ferreira ME, Grattapaglia D (1995) Introdução ao uso de marcadores RAPD e RFLP em
Análise Genética. Embrapa, Cenargem, Brasília, DF.
Forbe MB (1978) The cultivated Dichondra. New Zealand Journal of Botany. 16: 283–
5.
Forster, JR, Forster G (1776) Characteres generum plantarum, quas m mnere ad insulas
marts Australls, collegerunt, descnpserunt, dehnearunt, anms 1772-1775 London,
B White, T. Cadell, and P. Elmsly cf 40 t 20.
García MA, Stefanović S, Weiner C, Costea M. (2018) Cladogenesis and reticulation in
Cuscuta sect. Denticulatae (Convolvulaceae). Organisms Diversity & Evolution.
18 (4): 383–398.
Gernhard T (2008). The conditioned reconstructed process. J. Theor. Biol. 253, 769–77.
Hallier H (1893) Vcrsuch einer natfirlichen gliederung der Convolvulaccen auf
morphologischer und anatomischer Gruudlage. Bot. Jahrb. 16: 453-591.
Heads M (1998) Biodiversity in the New Zealand divaricating tree daisies: Olearia sect.
nov. (Compositae). Botanical Journal of the Linnean Society 127: 239–285.
Heled J, Drummond AJ (2009). Bayesian inference of species trees from multilocus data.
Mol Biol Evol 27: 570–580.
Ho SY, Shapiro B (2011). Skyline‐plot methods for estimating demographic history from
nucleotide sequences. Mol Ecol Res. 11: 423–43.
Ho A, Costea M (2018) Diversity, evolution and taxonomic significance of fruit in
Cuscuta (Dodder, Convolvulaceae); the evolutionary advantages of indehiscence.
Perspectives in Plant Ecology, Evolution and Systematics 32: 1–17.
77
Huson D, Bryant D, (2006). Application of Phylogenetic Networks in Evolutionary
Studies. Molecular Biology and Evolution 23(2) 254–267.
Johnson RW, Lang PJ & Barker RM (2014). Convolvulaceae In: Kellermann, J. (ed) Flora
of South Australia, pp.25.
Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper
A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. (2012)
Geneious Basic: An Integrated and Extendable Desktop Software Platform for the
Organization and Analysis of Sequence Data. Bioinformatics, 28: 1647–1649.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H,
Valentin F, Wallace IM, Wilm A, other authors (2007). CLUSTAL W and
CLUSTAL X version 2.0. Bioinformatics 23: 2947–2948.
Lejoly J, & Lisowski S (1993). Les Convolvulaceae dans la flore d’Afrique Centrale
(Zaire, Rwanda, Burundi). Fragm Florist Geobot 38: 351–400.
Mallet J, Besansky N, Hahn MW (2015) How reticulated are species? Bioessays 38: 140–
149.
Mcdade L. (1990) Hybrids and Phylogenetic Systematics I. Patterns of Character
Expression in Hybrids and Their Implications for Cladistic Analysis. Evolution
44:1685–1700
Meudt H, Simpson BB (2006) The biogeography of the austral, subalpine genus Ourisia
(Plantaginaceae) based on molecular phylogenetic evidence: South American
origin and dispersal to New Zealand and Tasmania. Biological Journal of the
Linnean Society 87(4):479–513.
78
Michaux A (1803) Flora boreali-americana: sistens caracteres plantarum quas in America
septentrionali collegit et detexit Andreas Michaux. Parisiis et Argentorati: apud
fratres Levrault.
Nishimoto Y, Ohnishi O, Hasegawa M (2003) Topological incongruence between nuclear
and chloroplast DNA trees suggesting hybridization in the urophyllum group of
the genus Fagopyrum (Polygonaceae). Genes Genet Syst 78:39–153.
O'donell CA (1959) Convolvulaceas argentinas. Lilloa 29: 87-348.
Ooststroom SJV (1934) A monograph of the genus Evolvulus. Mededeelingen van het
botanisch museum en herbarium van de rijks universiteit te Utrecht 14: 1267.
Oliver D (1877) Flora of tropical Africa 3 6 London, L. Reeve and Co.
Pamilo P, Nei M. (1988) Relationships between gene trees and species trees Mol Biol.
Evol 5:568–583.
Pelser PB, Kennedy AH, Tepe EJ, Shidler JB, Nordenstam B, Kadereit JW, Watson LE
(2010) Patterns and causes of incongruence between plastid and nuclear
Senecioneae (Asteraceae) phylogenies. American Journal of Botany 97: 856–873.
Peter A (1891) Convolvulaceae. In A. Engler and K. Prantl [eds.] Die Nattirlichen
Pflanzenfamilien. 4:1-40.
Posada D (2008) jModelTest: phylogenetic model averaging. Mol Biol Evol 25: 1253–
1256.
Price MN, Dehal PS, Arkin AP (2010) FastTree 2–approximately maximum-likelihood
trees for large alignments. PloS One 5(3): e9490
79
Rambaut A (2009) FigTree, version 1.3. 1. Computer program distributed by the author,
website: http://treebioedacuk/software/figtree/[accessed January, 2019].
Rambaut A, Drummond A (2003) Tracer: a program for analysing results from Bayesian
MCMC programs such as BEAST & MrBayes. University of Edinburgh, UK.
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under
mixed models. Bioinformatics 19: 1572–1574.
Shaw J, Lickey EB, Schilling EE, Small RL (2007). Comparison of whole chloroplast
genome sequences to choose noncoding regions for phylogenetic studies in
angiosperms: the tortoise and the hare III. American journal of botany, 94(3), 275–
288.
Simões AR, Culham A, Carine M (2015). Resolving the unresolved tribe: a molecular
phylogenetic framework for the Merremieae (Convolvulaceae). Botanical Journal
of the Linnean Society 179: 374-384.
Simões AR, & STAPLES G (2017). Dissolution of Convolvulaceae tribe Merremieae and
a new classification of the constituent genera. Botanical Journal of the Linnean
Society 183: 561-586
Spjut RW (1944) A systematic treatment of fruit types. Memoirs of the New York
Botanical Garden, New York.
Staples GW, Brummitt RK (2007) Convolvulaceae. In: Heywood VH, Brummit RK,
Culham A, Seberg O (eds) Flowering plant families of the World. Kew: Royal
Botanic Gardens, 108–110.
Staples G, Austin D (2009) Revision of Neotropical Calycobolus and Porana
(Convolvulaceae). Edinburgh Journal of Botany 66 (1): 133-153.
80
Staples GW. 2019. World Checklist of Convolvulaceae. Royal Botanic Gardens, Kew.
http://wcsp.science.kew.org/ [accessed 10 April 2018].
Stefanovic S, Krueger L, Olmstead RG. 2002. Monophyly of the Convolvulaceae and
circumscription of their major lineages based on DNA sequences of multiple
chloroplast loci. American Journal of Botany 89: 1510–1522.
Stefanovic S, Austin DF, Olmstead RG. 2003. Classification of Convolvulaceae: a
phylogenetic approach. Systematic Botany 28: 791–806.
Swartz, O.P. 1788. Nova genera & species plantarum. Stockholm: Bibliopoliis Acad. M.
Swederi. 231
Tharp, B.C. & Johnston, M. C. 1961. Recharacterization of Dichondra (Convolvulaceae)
and a revision of the North American species. Brittonia 13: 346–360.
Willyard A, Cronn R, Liston A (2009) Reticulate evolution and incomplete lineage
sorting among the Ponderosa pines. Molecular Phylogenetics and Evolution
52(2):498–511.
White TJ, Bruns, T, Lee, SJWT, Taylor, JW (1990) Amplification and direct sequencing
of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to
methods and applications, 18, 315–322.
Wood JRI, Williams B, Mitchell TC, Carine AM, Harris DJ, Scotland R W (2015a) A
foundation monograph of Convolvulus L. (Convolvulaceae). PhytoKeys 51: 1-
282.
Wood JR I, Carine, M. A., Harris, D., Wilkin, P., Williams, B. & Scotland, R. W. (2015b).
Ipomoea (Convolvulaceae) in Bolivia. Kew Bull. 70 (31): 1 – 124.
81
Wikström N, Savolainen V, Chase MV (2001) Evolution of the angiosperms: Calibrating
the family tree. Proceedings of the Royal Society 268: 2211–2220
82
Appendix Figure 1. Bayesian phylogram comprising diploid and allopolyploid speci es.
The posterior probabilities are displayed left of each branch. Clade I is represented
a s red,
Clade II as blue and Clade III as green.
83
Capítulo 3: Taxonomia
Artigo 1: Typification of species names in Dichondra
(Convolvulaceae)
Autores: Geadelande Delgado, George Staples, Maria
Teresa Buril
Revista: Taxon
STATUS: Publicado
84
Typification of species names in Dichondra (Convolvulaceae)
Geadelande Carolino Delgado Junior1 G. Staples1 & Maria Teresa Buril1
1Graduate Program in Botany, Universidade Federal Rural de Pernambuco, 52171-900,
Recife, PE, Brazil.
Author for correspondence. E-mail: [email protected]
Abstract Dichondra is a genus of creeping and sprawling herbs with reniform leaves, entire leaf margins and inconspicuous flowers. It is included in the tribe Dichondreae
(Convolvulaceae). Dichondra is a taxonomically complex genus with multiple unsolved nomenclatural problems. We propose lectotypes for Dichondra argentea, D. parvifolia,
D. macrocalyx and D. sericea and a neotype for Demidofia repens, the basionym of
Dichondra carolinensis.
Keywords: America; Demidofia; lectotypification; neotypification; nomenclature
Short title: Typification of Dichondra
85
INTRODUCTION
Dichondra J.R. Forst. & G. Forst. (Forster & Forster, 1776) is one the oldest genus names published in the Convolvulaceae. The genus is estimated to comprise 15 species, which are naturally distributed in the Americas, New Zealand and Australia
(Tharp & Johnston, 1961; Austin, 1998; Staples et al., 2017). Although Dichondra was described early, it remains poorly understood taxonomically now and has several unresolved nomenclatural issues (Tharp & Johnston, 1961). Dichondra is economically important: its seeds have been sold around the world as ornamentals and lawn grass substitutes (Austin, 1998; Wiersema & León 2013; Cubey, 2017); some of these cultivated species (e.g. Dichondra micrantha Urb.) have escaped to become naturalized far outside their natural range (Lawalrée, 1970; Austin, 1998). However, the environmental impress for these diminutive alien species has scarcely been evaluated.
The early species names in Dichondra are mostly untypified, which contributes to misunderstanding of names beyond the ambiguity in taxonomic delimitation. Since the genus was described in 1776, the name D. repens has been used indiscriminately for most of the Dichondra around the world. Because of this, specifically that all the morphological diversity pertaining to Dichondra was accommodated under this single name, delimitation of the species has been obscured and has led to confusion over what constitutes other species in the genus (Austin 1998). The lectotypification of Dichondra repens by Nicolson & Fosberg (2003) with original material collected by the Forsters in
New Zealand has stabilized this name; it is now possible and desirable from the standpoint of nomenclatural stability to typify other early names that have been proposed. Alonso and Amaya (1991) lectotypified Dichondra evolvulacea (L.f.) Britt., based on Sibthorpia evolvulacea L.f.; we propose typifications here for the remaining names in Dichondra published in the eighteenth and nineteenth centuries.
86
After analyzing the protologues and carefully studying the literature and historical collections of Dichondra species available online in virtual herbaria, we conclude that four species names require lectotypification and one basionym requires a neotypification. We here propose these typifications in order to stabilize application of the names in current use in accordance with Articles 9.11, 9.12 and 9.13 of the
International Code of Nomenclature (ICN) adopted in Melbourne (McNeill et al.,
2012). We also list the homotypic synonyms based upon the same types.
TYPIFICATIONS
Dichondra carolinensis Michx., Fl. Bor.-Amer. 1: 136. 1803. Demidofia repens J.F.
Gmel., Syst. Nat., ed. 13. 2(1): 458. 1791 ≡ ≡ Dichondra repens var. carolinensis
(Michx.) Poir. in J.B.A.M.de Lamarck, Encycl., Suppl. 2: 470. 1812 ≡ Dichondra evolvulacea var. carolinensis (Michx.) Kuntze, Revis. Gen. Pl. 3(2): 216 (1898) –
Neotype (designated here): [U.S.A.] “in Carolina, circa Charlstown”, A. Michaux s.n.
(P, barcode P00608606 [digital image!]). Image of neotype available at https://science.mnhn.fr/institution/mnhn/collection/p/item/p00608606?listIndex=12&list
Count=594
Walter (1788) published “Anonymos repens” in his Flora Caroliniana. Gmelin (1791) proposed the name Demidofia repens for the plant that had been called “Anonymos repens” by Walter. Seemingly, Gmelin did not analyze any specimen when he proposed the new name, rather, he simply paraphrased the description from Walter’s Flora
Caroliniana. Years later, Michaux (1803) described Dichondra carolinensis, provided a complete description, a locality, and cited Gmelin’s work. Dichondra carolinensis is a
87 replacement name for Demidofia repens Gmel. (Art. 6.11), because Michaux could not transfer the epithet repens to Dichondra (it is preoccupied in that genus) (Art. 53.1).
According to the Code, “Anonymos repens” is a designation and not a valid and legitimate name because Walter used “Anonymos” to refer to multiple different genera to indicate that they were without names (Art. 20.4, ex. 9) (McNeill et al., 2012).
The specimens attributed to Thomas Walter in the BM herbarium are not digitized and were not available for our study (R. Prakash was unable to locate any specimen for
“Anonymos repens” at BM, pers. comm., 2016). However, Bernice G. Schubert photographed all specimens attributed to Walter (1740–1788) in 1946–47 and we were able to examine one set of these photos, bound in book form. We did not find any specimen photo identified as “Anonymos repens”. Likewise, we did not find any specimens bearing the name Demidofia that were potentially analyzed by Gmelin.
Because we failed to locate any original material representative of Demidofia repens or “Anonymous repens”, we here designate a neotype for it. In this case, the replacement name is automatically based on the same type as the replaced synonym
(Art 7.3 and 7.4). To best stabilize the name in current use, we chose one of Michaux’s specimens as the neotype because the specimens represent the species widely known in the southeastern USA as Dichondra carolinensis. Furthermore, Michaux was an important collector in North America during the eighteenth century, more or less contemporaneously with Walter, and Michaux’s specimens were collected in the same region: the Carolinas.
We located three authentic specimens collected by Michaux; two are in the general herbarium at Paris (barcodes P00608606, P00608607) and one is conserved in the Michaux historical herbarium housed separately in Paris (barcode P00320327). We choose the specimen (barcode P00608606) as neotype for Demidofia repens because it 88 is a complete collection with flowers and fruits, and the material furthermore shows the variable shape of sepals characteristic of the species. In addition, the specimen matches closely with the description provided by Gmelin.
Dichondra argentea Humb. & Bonpl. ex Willd., Hort. Berol. 2(7): t.81. 1806 ≡
Dichondra evolvulacea var. argentea (Willd.) Kuntze, Revis. Gen. Pl. 3[3]: 216. 1898 –
Lectotype (designated here): [Germany. Berlin] cultivated in Berlin Botanic Garden,
Willdenow s.n. (B-W, barcode 05468-01 [digital image!]). Image of lectotype available at http://herbarium.bgbm.org/object/BW05468010.
The original protologue has a detailed description and a complete illustration based on live plants in cultivation at Hortus Berolinense (Willdenow, 1806). We found two specimens in the Willdenow herbarium at Berlin (B-W) as well as the original plate published with the protologue; these three elements are likely original material for this name. McDonald (1993: 16) indicated, based on the IDC microfiche for the Willdenow
Herbarium, that the holotype was deposited at B, without additional details. However,
McDonald did not cite the earliest publication for D. argentea but instead wrongly cited
“Enum. Pl. Horti. Berol. 297. 1809” (Willdenow, 1809: 297). In this later work,
Willdenow cited a locality and a collection “Colombia, Tolima, ca. Honda, Humboldt &
Bonpland s.n.” This locality and collection do not appear in the protologue and are irrelevant to the typification now.
In the B-W virtual herbarium, we located two specimens (B-W 05468-01; B-W
05468-02) of D. argentea. The first (B-W 05468-01) matches very closely with the published illustration and the description in the protologue. The second (B-W 05468-
02) looks different from the plate and the details of this specimen do not agree with
89 some points in the protologue. Furthermore, this second specimen has a label
“Dichondra argentea (W)” in different handwriting and we suspect it is the collection made by Humboldt and Bonpland and sent to Willdenow that he cited in 1809; however, it has no locality information on the label to document its provenance. For this reason, we do not consider this second specimen (B-W 05468-02) as original material for D. argentea.
According to Art 9.12 a lectotype should be designated from among the available specimens comprising the original material and an illustration would only be chosen if it can be proven that no specimen exists. We choose the first specimen (B-W
05468-01) as the lectotype because it matches the protologue more closely, is complete, fertile material, and agrees so minutely with the plate 81 that it might be the specimen used by the artist to prepare this illustration. In particular, the long petioles with a flaring triangular apex shown in plate 81 are clearly visible on the lectotype specimen, as well as the large leaf blades. These features indicate a plant grown in cultivation under glass, with ample water and nutrients, just as Willdenow described it in the protologue.
Dichondra macrocalyx Meisn., Fl. Bras. 7: 358. 1869 ≡ Dichondra evolvulacea f. macrocalyx (Meisn.) Kuntze, Revis. Gen. Pl. 3(2): 216. 1898 ≡ Dichondra repens var. macrocalyx (Meisn.) Hoehne, Anexos Mem. Inst. Butantan, Secç. Bot. 1(6): 34. 1922 –
Lectotype (designated here): Brazil. without locality, anno 1827, Maximilian Wied-
Neuwied s.n. (BR, barcode BR0000006588243) [digital image!]). Image of lectotype: http://www.br.fgov.be/RESEARCH/COLLECTIONS/HERBARIUM/detail.php?ID=42
8321
90
In the protologue, Meisner cited seven collections: six from Brazil and one of unknown origin that he guessed might be from Chile (Meisner, 1869: 359). We were able to locate two Brazilian specimens: one is Maximilian Wied-Neuwied s.n. (BR, barcode BR0000006588243) and the other is Lindberg 493 (BR, barcode
BR0000005796151). These two elements are original material (syntypes) for Dichondra macrocalyx. We also located a photograph in the Field Museum Berlin Negatives
(2017) of a third specimen, collected by Sellow 194a (F0BN013709), which had been deposited in B (but is now destroyed), this photograph is not considered original material.
We here designate the specimen of Maximilian Wied-Neuwied s.n. as lectotype because it fits the protologue and represents the species known as Dichondra macrocalyx in Brazilian herbaria and botanical literature. By choosing this specimen as the lectotype, we stabilize the name D. macrocalyx as it is currently used.
Dichondra parvifolia Meisn., Fl. Bras. 7: 360. 1869 ≡ Dichondra repens var. parvifolia (Meisn.) Hallier f., Jahrb. Hamburg. Wiss. Anst. 16(Beih. 3): 20. 1899 –
Lectotype (designated here): Brazil. without locality, Lhotsky s.n. (NY! barcode
00621734). Image of lectotype: http://sweetgum.nybg.org/science/vh/specimen_details.php?irn=536096
Meisner (1869: 360) cited two collections in the protologue: a Sellow collection from São Paulo state and a Lhotsky specimen without locality. We did not find any Sellow specimens from São Paulo identified as D. parvifolia in any herbaria.
The Lhotsky specimen, deposited in Berlin, was destroyed; a photograph of it
(F0BN013710) is present in the Field Museum Berlin Negatives website (2017) and this
91 provides a visual image for the species concept Meisner had. We located a duplicate of the Lhotsky specimen at NY; the label indicates it was sent there from the Berlin herbarium. We here designate this specimen as the lectotype because it has Meisner’s handwritten autograph label stating “Dichondra parvifolia Nob.” [mine]. Additionally, this specimen matches closely with the protologue.
Dichondra sericea Sw., Prodr. 54. 1788 ≡ Dichondra repens var. sericea (Sw.) Poir.,
Encycl., Suppl. 2: 470. 1812 ≡ Dichondra repens var. sericea (Sw.) Choisy, Prodr. 9:
451. 1845, isonym ≡ Dichondra evolvulacea var. sericea (Sw.) Kuntze, Revis. Gen. Pl.
3(2): 216. 1898 – Lectotype (designated here): Jamaica. without locality, Swartz s.n.
(LINN-HS 477.4, barcode. LINN-HS477-4 [digital image!]). Image of lectotype: http://linnean-online.org/32921/.
Swartz (1788: 54) described D. sericea based on his own collection from
Jamaica. We located five authentic Swartz specimens from Jamaica in different herbaria
(the J.E. Smith herbarium, barcode LINN-HS 477.4; S, barcodes S11-13947, S-R-1473;
SBT, barcode SBT12882 – 2 sheets;) as well as two more Swartz specimens (S, barcode
S11-13948; M, barcode M0184353) without precise label data corresponding to the protologue; the latter two are very likely syntypes but we cannot verify their authenticity.
The five Swartz specimens all contain fertile material but the specimen in the
Smith Herbarium at the Linnean Society of London is the most complete, having an open flower that was carefully pressed such the internal structures are clearly visible, as are a fruit and leaves with both upper and lower faces visible. These characters are all important to recognize D. sericea. The material in the S herbarium has flowers and fruits, but the open flower is pressed underneath a leaf and it is impossible to see details
92 of floral structures. Therefore, we here designated LINN-HS477-4 as lectotype because this specimen more clearly shows all the features critical to confidently recognize D. sericea.
Previous efforts to typify this name do not meet the requirements of the ICN.
Tharp and Johnston (1961: 348) suggested that the holotype is at “S?” but they did not locate any specimen at this herbarium. McDonald (1993: 18) also indicated “holotype S, isotype BM!” but he did not see the Stockholm specimens. Curiously, we have not found the Swartz specimen McDonald cited as present in the BM. According to the
ICN, Art. 9.1, a holotype is a specimen or illustration designated by the author who described the species. Swartz did not choose a holotype, but we did find five elements that represent original material (syntypes) for his D. sericea. Because we are not obligated to choose a specimen in Stockholm as the lectotype and the LINN-Smith sheet is the best prepared of the available syntypes, the latter represents the best choice with which to typify this name.
ACKNOWLEDGEMENTS
We thank the organizations that funded our research, including CAPES (PhD scholarship for the first author) and CNPq (Process: PVE 314725/2014-8). We thank the
REFLORA project, which allowed the first author to study the collection at MO. We appreciate the help of curators Ranee Prakash (BM), Veronique Andro (P) and Jim
Solomon (MO), and of librarians Mary Stiffler (MO) and Gretchen Wade (Harvard
Botany Libraries).
93
Author Contributions
Design of research: Staples, Buril.
Performance of research: Delgado, Staples.
Data collection, analysis, interpretation: Delgado, Staples.
Manuscript writing: Delgado, Staples; reviewed by Buril; revised by all authors.
94
LITERATURE CITED
Alonso, J. L. F. & Amaya, J. A. 1991. Historia del nombre generico Escallonia Mutis
ex L. fil. Caldasia 16(78): 317--326.
Austin, D. F. 1998. The indiscriminate vector: human distribution of Dichondra
micrantha (Convolvulaceae). Econ. Bot. 52: 88--106.
https://doi.org/10.1007/BF02861300.
Cubey, J. 2017. RHS Plant Finder 2017. London: Royal Horticultural Society.
Field Museum Berlin Negatives. 2017.
http://emuweb.fieldmuseum.org/botany/search_berlin.php (accessed 20
November 2017).
Forster, J. R. & Forster, G. 1776. Characteres Generum Plantarum. Londini: B.
White, T. Cadell & P. Elmsly.
Gmelin, J. F. 1791. Systema naturae per regna tria naturae: secundum classes,
ordines, genera, species, cum characteribus, differentiis, synonymis, locis.
Lipsiae: Impensis Georg Emanuel Beer.
Lawalree, A. 1970. Definition, aire et mode de dessemination de Dichondra
micrantha Urban (Convolvulaceae). Acta Bot. Neerl. 19(5): 717--721.
McDonald, A. 1993. Convolvulaceae I. Pp. 1--49 in: Sosa, V. (ed.), Flora de
Veracruz. Xalapa: Instituto de Ecología, A.C.
McNeill, J., Barrie, F. R., Buck, W. R., Demoulin, V., Greuter, W., Hawksworth,
D. L., Herendeen, P. S., Knapp, S., Marhold, K., Prado, J., Proud’Homme
van Reine, W. F., Smith, J. F., Wiersema, J. H. & Turland, N.J. 2012.
International Code of Nomenclature for algae, fungi, and plants (Melbourne
Code). Regnum Vegetabile 154. Königstein: Koeltz Scientific Books.
95
Meisner, C. F. 1869. Convolvulaceae. Pp. 199--370 in: Martius, C. F. P. & Eichler, A.
W. (eds.), Flora Brasiliensis. 7. Lipsiae: apud Frid. Fleischer in comm.
Michaux, A. 1803. Flora boreali-americana: sistens caracteres plantarum quas in
America septentrionali collegit et detexit Andreas Michaux. Parisiis et
Argentorati: apud fratres Levrault.
Nicolson, D. H. & Fosberg, F. R. 2003. The Forsters and the botany of the second
Cook expedition (1772--1775). Regnum Vegetabile 139. Königstein: Koeltz
Scientific Books.
Staples, G., Austin, D. F., Buril, M. T., Carine, M., & McDonald, J. A. 2017.
World Checklist of Convolvulaceae. Facilitated by the Royal Botanic Gardens,
Kew. Published on the Internet; http://apps.kew.org/wcsp/ Retrieved November
2017.
Swartz, O. P. 1788. Nova genera & species plantarum. Stockholm: Bibliopoliis Acad.
M. Swederi.
Tharp, B. C. & Johnston, M. C. 1961. Recharacterization of Dichondra
(Convolvulaceae) and a revision of the North American species. Brittonia 13:
346--360.
Walter, T. 1740--1788. The Herbarium of Thomas Walter at the British Museum
(Natural History). South Kensington, London, England. [black and white
photographs of the Thomas Walter herbarium, photographed by Bernice
Schubert 1946--7, bound in book form. Gray Herbarium, Harvard University].
Walter, T. 1788. Flora Caroliniana. Londini: J. Fraser.
Wiersema, J. H. & León, B. 2013. World Economic Plants. edit. 2. Boca Raton: CRC
Press.
96
Willdenow, C. L. 1806. Hortus Berolinensis. Tomus II. Berolini: Impensis Fr.
Schüppel.
Willdenow, C. L. 1809. Enumeratio plantarum Horti Regii Botanici Berolinensis.
Berolini: Libraria Scholae Realis.
97
Artigo 2: The creepy genus Dichondra (Convolvulaceae) in the world: the challenge to review weed plants.
Autores: Geadelande Delgado, Maria Teresa Buril
Revista: Systematic Botany
STATUS: Não submetido
98
DELGADO-JUNIOR & BURIL: REVIEW OF DICHONDRA IN THE WOLD
The creepy genus Dichondra (Convolvulaceae) in the world: the challenge to
review weed plants
Geadelande Carolino Delgado-Junior1,2 & Maria Teresa Buril1
1Programa de Pós-graduação em Botânica, Universidade Federal Rural de Pernambuco,
Recife, PE, Brazil
2Author for correspondence: [email protected]
Abstract—Dichondra is included in the tribe Dichondreae and can be recognized by being creeping and sprawling herbs with reniform leaves, entire margin, small flowers and accrescent sepals. An extensive herbarium analysis, literature search and field work were carried out to produce a taxonomic treatment for Dichondra species for the world.
Our results show the species richness in genus was overestimated. Here, Dichondra is represented by six species distributed mostly in America. Most of them are restricted to small area as D. brevifolia endemic to New Zealand, D. nivea to arid region in Mexico and D. occidentalis to California coast, USA, while Dichondra repens is spread around the world as cultivated or invasive species. Dichondra argentea is widely distributed as ornamental. An identification key, descriptions and information on geographic
99 distribution are provided. Taxonomic relationship is discussed, and we proposed 14 new synonyms under Dichondra repens and lectotype for name Dichondra micrantha.
Keywords—America, biodiversity, morphology, species delimitation, taxonomy
Dichondra (greek di- two; krondros- grain, a reference to fruit with two mericarps that reminds grain) was described by Forsters in 1776 during a field trip with
Capt. Cook into New Zealand (Nicolson and Fosberg 2003). They recognized only one species, Dichondra repens J.R.Forst. & G.Forst., which has this epithet for being creeping, a character common to other species of the genus.
Dichondra was first included in Boraginaceae by Jussieu (1789) into section of uni/bicarpelar fruit, then Dumortier (1829) proposed the family Dichondraceae characterized by bifid style, bicarpelar and monospermic fruit to include Dichondra.
Years later, Choisy (1833) suggested to include Dichondra in Convolvulaceae, the following systematics (e.g., Peter 1891, Halier 1893, Austin 1973) that studied
Convolvulaceae maintained this decision, which was confirmed by a phylogenetic hypothesis to the family (Stefanović et al. 2002). Together with another seven genera,
Dichondra forms a well-supported monophyletic group recognized as the tribe
Dichondreae (sensu Stefanović et al. 2003).
Dichondra occurs naturally in the Americas, New Zealand and Australia (Tharp and Jonhston 1961). Dichondra micrantha Urb. is widespread throughout the warmer regions of both hemispheres as a weed or horticultural subject (Lawalrée 1970) and D. argentea Humb. & Bonpl. ex Willd. is cultivated as ornamental.
Even though it is a monophyletic genus, easy to recognize by morphology, species delimitation can be a difficult task. Depending on the taxonomic concept adopted the number of species varies between 5–15 (Johnson et al. 2014). There are 100 subtle differences between the Dichondra taxa (Austin 1998) that become a challenge to recognize them, this is because the characters used, such as trichome density or apex shape of calyx (Tharp and Johnston 1961) are plastic and overlap.
It led several authors to recognize Dichondra taxa in different ways: all as one variable species (LeJoly and Lisowski 1993, Oliver 1877); or as varieties of Dichondra repens (O'Donell 1957, Adams 1972); either as distinct species (Tharp & Johnston
1961, Chiarini and Espinar 2006).
The most recent taxonomic treatment was carried out by Tharp and Johnston
(1961) who revised the North American species but also included taxonomic comments about species from other regions. They recognized 14 species for the genus, recharacterized Dichondra and established two subgenera based on fruit morphology:
Dichondra subgenera Dichondra (fruit indehiscent, very deeply bilobed, utricle type) with 10 species and Dichondra subgenus Capsularia (fruit dehiscent, entire or merely emarginate, capsule type) with four species. After this revision, one species [(D. microcalyx (Hallier f.) Fabris (Fabris 1965)] and two varieties of Dichondra sericea [D. sericea var. tomentosa W.R.Buck ex Tronc. & Bacigalupo (Troncoso and Bacygalupo
1977) and D. sericea var holosericea (O'Donnell) Fabris (Fabris 1965) were described to South America.
Historically, Dichondra has been under-collected and few samples are available in most herbaria. Probably collecting bias is a negative factor: the plants are small, creeping, and often overlooked by botanists. It is also difficult to find fertile specimens in the wild and it similarity with other widespread weed as Centella and
Hydrocotyle that collectors dismiss or refuse to collect.
Although there is a recent review for North American Dichondra species, it remains problematic to delimitate species and several unresolved nomenclatural issues
101
(Delgado et al. 2018). This work reviewed all names in the literature to Dichondra and examined the extremes of morphological variation between taxa for purposing to better characterize the Dichondra taxa around world, contributing to its taxonomy. We provided an identification key, complete descriptions, lectotypifications, synonymy, information on geographic distribution, reproductive period, habitat and taxonomic comments.
MATERIALS AND METHODS
This study was based on field expeditions and analysis of herbarium collections.
The field trips were directed to South America (Brazil, Bolivia, Colombia, Ecuador and
Uruguay) and United States. The vouchers collected were incorporated to the herbarium
PEUFR with duplicates, when possible, sent to MO and RB. Specimens, historical and type collections from 55 herbaria were studied. Europe: Belgium: BR*, France: P*,
Germany: M*, Sweden: S*, SBT*, UK: K, LINN*. Oceania: New Zealand: WELT
North America: Mexico: IEB. United States: BRIT, GH, MO, NY, SRSC, TEX, UC,
US. South America: Argentina: CORD, SI. Bolivia: LPB. Brazil: BHCB, CESJ,
EAC*, ESA*, FLOR, FURB, FUEL, HAS, HCF, HUCP, HUCS, HUEFS, HUI* HURB,
HVAT, ICN, INPA*, IRAI, MBM, MPUC, PACA, PEL, RB*, SMDB, SJRP, UB,
UEC*, UPCB. Colombia: COL. Ecuador: QCNE*, QCA. Peru: SMF. Uruguay:
MVFA, MVJB, MVM. (acronyms follow Thiers continuously updated). [*= consulted by virtual collection or photos].
Morphological analyses were performed using dried specimens and material preserved in alcohol. Morphological terminology follows Harris and Harris (2000),
Radford et al (1974), Spjut (1994). Distribution and habitat, and reproductive period based on label information of specimens studied.
102
Morphological characters and their use in species delimitation
Here we discussed a range of characters useful for species delimitation and explained how these characters are plastic and variable between species.
Habit—Dichondra species are herbs, however the branch becomes woody when old in some species (D. brachypoda and D. occidentalis, rarely in D. repens). All species are prostate and creeping. They grow densely and theirs leaves form a mat-like covering the substrate. Dichondra argentea when used as ornamental its leaves grows like waterfall.
Trichomes—There are two types of trichomes: Simple and malpighiaceous.
Trichome simple is unbranched, it presents on abaxial, adaxial surface mixed with trichome malpighiaceous (D. brachypoda, sometimes in D. repens), corolla (D. argentea, D. brachypoda, D. brevifolia, D. nivea, sometime D. repens), sepals, ovary and fruit of every species.
Trichome malpighiaceous are present in all species on stems, leaves, petioles, bracts, peduncles, bracteoles, pedicels, sepals and ovary. There are two branches which can be divaricate or bifurcated. The branches are equal or different in length.
Indumentum—Traditionally indumentum density has been used to separate
Dichondra species. In this study we understand indumentum varies from sparse to dense in all species, except D. brevifolia that varies from sparse sericeous to glabrous; however, some species are easily recognized by indumentum color on leaves. Also, it’s important to mention that older parts become glabrescent or glabrous, while young part normally has dense indumentum. In general, there are three indumentum types: sericeous, pilose and villous. These indumentum types can be found mixed together.
103
Dichondra argentea and D. nivea have long hairs covering both leave surfaces with silvery appearance. Sometimes, D. repens has whitish appearance on abaxial leave face, in dry material it may looks yellowish or brownish.
Leaf shape— All Dichondra species has the same leave shape, reniform with base auriculate, however the sinus of base can be deep or slightly deep. Other shapes are found such as orbicular to suborbicular with base cordate (D. repens); and depressed ovate (D. argentea, D. brevifolia D. nivea) or flabellate (D. argentea) with base attenuate. These other shapes always present together with reniform leaves.
Inflorescence—Flower solitary and monochasial with up to 3 flowers. It arranged in axilla. Solitary flower is present in all species, it is pedunculate with two bracts at base, the peduncle varies in length and always it is straight. Sometimes monochasial is present in D. sericea and D. repens, the peduncle is not always obvious and does not exceed 0.5 mm long, are paired with bracts.
Calyx—It is a character useful for recognize species in Convolvulaceae and it has been applied to Dichondra species. However, during our morphology studies we realized that sepals are not a consistent character to separate species within the genus.
Often five sepals are found, and less frequently, some D. repens specimens examined present six sepals. At same population is common more than one calyx type, sepals are extremally variable in shape or width size, also the apex is variable. Trichomes exceed margin sepals looking ciliate.
Corolla—The corolla of all Dichondra species is rotate except for D. nivea, which is funnel-shaped. Usually a short basal tube included in the calyx while lobes exceed (D. argentea, D. brachypoda, D. brevifolia, D. occidentalis, D. nivea and extremely rare in D. repens) not exceed than calyx (D. repens). It is 5–lobed, lobes are
104 free from each other and midpetaline bands are not present. The color varies from white, greenish, pale creamy to yellowish and purple. Dichondra nivea has corolla white to yellowish with purple colored inside on the tube and D. ociddentalis has purple to pale purple corolla.
Androecium—Stamens are equal in length with anthers linear or oblong, glabrous, whitish to pale yellow, some D. repens populations may present purple anthers.
Gynoecium—Style are two, distinct, gynobasic and it varies in length. They can be unequal, subequal or equal, glabrous, except for Dichondra occidentalis which has trichomes at the base to the medium part. Stigma are capitate in all species. Ovary is superior, bicarpelar, biovulate, densely pilose and globoid. The locules are almost distinct but are attached at the base, it looks an intermediary between apocarpous and syncarpous gynoecium. When fertilized one or both carpels develop, and dehiscent or indehiscent fruit are produced.
Fruit—Historically Dichondra fruit was classified as capsule, however
O’Donell (1959) realized that some species has indehiscent fruit. Tharp & Johnston
(1961) classified the indehiscent fruit as utricle. However, after we exhaustedly analyze several specimens, we concluded (based on Sjut 1994) neither capsule or utricle are suitable to describe the fruits found in Dichondra. According to that author, we believe that the closest concept is the one for schizocarpic fruit. Here, we adopted this classification. Two types can be actually found: schizocarpic dehiscent (D. argentea, D. brachypoda, D. occidentalis) and schizocarpic indehiscent (D. brevifolia and D. repens). The schizocarp dehiscent is globoid, bilocular or unilocular (by abortion) with
1 to 4 seeds, it opens with dehiscence regular or irregular. Schizocarp indehiscent often breaking into two mericarps with 1 or 2 seeds each one. It has the same indumentum as 105 the ovary and the style is persistent. Fruit in D. nivea is unknow but the phylogenetic hypothesis showed its in dehiscent fruit clade.
TAXONOMIC TREATMENT
DICHONDRA J.R.Forst. & G.Forst., Char. Gen. Pl.: 40. 1776. TYPE: NEW
ZEALAND. [without information], Forster 61 (lectotype designated by Nicolson &
Fosberg 2003: 369, P [photo!]).
=Demidofia J.F.Gmel., Syst. Nat., ed. 13. 2(1): 458. 1791. TYPE: UNITED STATE. in
Carolina, circa Charlstown”, [without information], A. Michaux s.n. (neotype designated by Delgado-Junior et al. 2018: P-00608606 [digital image!]).
=Steripha Banks ex Gaertn., Fr. & Sem. P1. 2: 81. 1791. TYPE: not seen.
= Dichondropsis Brandegee, Univ. Calif. Publ. Bot. 3: 388. 1909. TYPE: MEXICO.
Puebla: Cerro de Santa Lucia, [without information] Purpus, 2563 (holotype: MO-
152734!).
Perennial, creeping and sprawling herbs; latex absent; indumentum sericeous, pilose, villous and glabrous; trichomes malpighiaceous and simple. Stem 0.2–2 mm thick; internodes 0.4–7.5 cm long., villous-sericeous or sericeous-pilose. Leaves alternate, simple, margin entire, membranaceous, lamina reniform, orbicular to suborbicular, depressed ovate and flabellate; apex obtuse to slightly emarginate; base auriculate, cordate and attenuate, silvery or greenish, petiolate. Inflorescence axillary, solitary or monochasial 2–3 flowered; bracts 2, linear, sericeous; bracteoles absent or present. Calyx with 5 sepals free than each other, membranaceous or chartaceous, obovate, oblong, obelliptic, spatulate, ovate, oblanceolate, lanceolate and elliptic, apex acute, obtuse and round, sericeous, pilose, villous, glabrous, accrescent and persistent.
106
Corolla gamopetalous, rotate or funnel-form, pale greenish, white, yellowish, creamy, purple; 5–lobed, lobes equal, entire, oblong, elliptic, rotund, deltoid and obovate, apex acute, obtuse, round and sometimes emarginated, glabrous and pilose outside, glabrous inside; stamens 5, included, filaments equal, glabrous, anthers oblong, longitudinally dehiscent, pollen grains medium or larger, prolate spheirodal, tricolpate, surface microspine; pistil included or exerted, ovary subgloboid, bilobed, densely pilose, 2– locular, 2 ovules per locule, styles 2, distinct, inserted our exserted, equal, subequal or unequal, entire, glabrous or pilose, stigma capitate, verrucose, glabrous. Fruit schizocarp dehiscent regular to irregular and indehiscent, globoid globose, pilose. Seeds ovoid and obovoid, black, dark brown and brownish, glabrous.
KEY TO DICHONDRA SPECIES AROUND THE WORLD
1. Indumentum villous-sericeous on abaxial and adaxial surfaces leaves (appearance
silver leaves on both face). 2
1. Indumentum pilose to glabrous or sericeous-pilose to glabrous on abaxial and adaxial
surface leaves (appearance greenish on both face, sometimes canescent on
abaxial surface). 3
2. Sepals ovate or lanceolate. Corolla funnel-form with lobes > 5 mm. 4. D. nivea
2. Sepals oblong or obelliptic. Corolla rotate with lobes ≤ than 1.5 mm. 1. D. argentea
3. Leaves tiny ≤ 5 mm long. and corolla with lobes ≥ 2.5 mm. 3. D. brevifolia
3. Leaves large normally ≥ 1cm long. (rare < 1 cm) and corolla with lobes ≤ 2 mm. 4
4. Corolla purple mixed to white. Style exerted and pilose at the base. 5. D. occidentalis
4. Corolla white, greenish or creamy. Style inserted and glabrous. 5
107
5. Corolla normally exceeding the calyx. Fruit schizocarp dehiscent. 2. D. brachypoda
5. Corolla not exceeding calyx (rare excedding). Fruit schizocarp indehiscent. 6. D.
repens.
1. DICHONDRA ARGENTEA Humb. & Bonpl. ex Willd., Hort. Berol. 2(7): t.81. 1806
≡ Dichondra evolvulacea var. argentea (Willd.) Kuntze, Revis. Gen. Pl. 3[3]:
216. 1898. — TYPE: GERMANY. Berlin: cultivated in Berlin Botanic Garden,
[without information], Willdenow s.n. (lectotype designed by Delgado-Junior et
al 2018: B-W, 05468-01 [digital image!]).
Stems 0.5–1 mm thick; internodes 1–3.5 cm long., densely villous-sericeous to villous-sericeous. Leaf lamina 0.4–1.8 × 0.1–2 cm, reniform, flabellate and depressed ovate, base auriculate or attenuate; adaxial surface densely villous-sericeous to sparsely villous-sericeous, abaxial surface densely villous-sericeous to rare sparsely villous- sericeous, silvery; petioles 0.1–5 cm long., 0.5 mm thick, villous-sericeous.
Inflorescence solitary flower to monochasial 2–3 flowers; bracts 2, 1–1.5 mm long., linear, densely sericeous; peduncle 2–8 mm long., densely sericeous, peduncle in flower straight, peduncle in fruit recurved at base or slightly recurved at middle. Calyx at anthesis 2–2.5 × 1–1.5 mm, sepals membranaceous, oblong with apex acute, rare obtuse or obelliptic with apex obtuse, densely villous-sericeous outside and sericeous to sparsely sericeous at top, rare glabrous inside. Calyx in fruit 2.5–3 × 1–1.5 mm, sepals oblong with apex acute, rare obtuse or obelliptic with apex obtuse, villous-sericeous outside and sericeous to sparsely sericeous at top, rare glabrous inside. Corolla rotate, yellowish to pale yellowish, lobes 0.8–1.5 × 0.4–0.6 mm, deltoid to oblong, apex acute to emarginate, pilose outside, tube 1.5–1.8 mm long.; filaments 0.5–1.4 mm long.,
108 attached in the middle of tube, anthers ca. 0.4 mm long.; styles 1.2–2 mm long., inserted, subequal, rare equal, glabrous. Fruits 2–3.5 mm in diameter, schizocarp dehiscent, globoid. Seeds ca. 2 mm long., ovoid, dark brown to black. (Figures 1 a–l; 2 a–f).
Etymology—Dichondra argentea is a reference to the silvery leaves. Under sunlight the leaves reflect an intense silver glow.
Vernacular name—silver fall, silver ponysfoot or silver nickel vine.
Distribution and Habitat—Distributed naturally in North (USA and Mexico) and South America (Colombia, Bolivia, Peru, Argentina, Uruguay). It grows naturally in dry areas, trailing over rocks and mounts. Often occurs in altitude up to 2.000 m elev.
Tharp & Johnston (1961) reported D. argentea to Brazil. Although we haven’t found any material deposited in herbarium, we saw pictures of this species cultivated in south of Brazil. Dichondra argentea is cultivated around the world as an ornamental foliage plant.
Reproductive period—In South America, flowering from January to March and fruiting from March to April. In North America is flowering and fruiting from May to
December with a peak of flowering in August and September.
Taxonomic comments—Dichondra argentea is easily recognized by appareance silver leaves, together to Dichondra nivea are the only species that share this character. Even sharing these silvery leaves, D. argentea is completely different from D. nivea by the corolla rotate with lobes ≤ than 1.5 mm (vs. funnel-form with lobes > 5 mm) and sepals ovate or lanceolate (vs. oblong or obelliptic). Another character easy to recognize are flabellate leaves, present only D. argentea even though they are not always present in all individuals. We found one specimen (Standford et al 2640 -GH,
109
MO, NY) glabrous from Mexico. However, it was possible to recognize as D. argentea because has leaves flabellate and also corolla colors and shapes matched. Some specimens specially from Jujuy (Argentina), Zacatecas and Hidalgo (Mexico) have smaller leaves (≤ 0.6 cm), almost sessile (> 5 mm).
Specimens examined: Argentina.—CATAMARCA: Valle Viejo, ruta 64, cuesta del Portezuelo, 1680 m, fr. 23 Mar 1960, A. E. Cocucci & E. di Fulvio (MBM
377629). —CORDOBA: Colón, Sierra Chica, fr., 3 Jan 1951, A. T. Hunziker 8723
(MBM) Depto. Río Cuarto, Alta Garcia, 31º 37’ 25” S, 65º 29’ 31” W, 746 m. 10 Dec.
2009, fr., J.J Cantero. & C.O. Núñez 5835 (CORD). —CORRIENTES: San Martín, 3 cerros, co. Capará, fl., 15 Sep 1979, A. Schinini et al. 18518 (CTES; MBM) —JUJUY:
24 February 1916, fl., Lillo 1657 (GH). Depto. Humahuaca. Viniendo por ruta nº 9, a 1 km de la entrada para aceder al caminho para Iturbe, 22º 59’ 30” S, 65º 21’ 36” O, 3500 m. 7 March 2002, fl., M. Negritto et al. 375 (CORD; BRIT). Tres Cruces, ca. 3600 m 16
March 1982, fl., R. Kiesling et al. 3675 (SI). 21 January 1929, fl., S. Venturi 8861 (US).
Depto Tilcara, Quebrada de Huasamayo, 2600-280 m. 13 February 1980, fl., A.L.
Cabrera et al. 31573 (SI). Depto. Tumbaya, ruta nac.9, Quebrada de Coíruro, 3 km al N de Volcán, 2100-2200 m. 12 February 1985, fl., Kiesling et al. 5090 (SI). Volcán, 2300 m. 14 February 1927, fl. S. Venturi 4922 (SI; US). Volcán, 2500 m. 22 February 1924, fl., S. Venturi 3428 (US). Volcán, 2500 m. 22 February 1924, fl., Schreiter 264 (GH).
Volcán, 2200 m. 6 February 1918, fl., Castrelín 468 (GH). Volcán. 15 January 1927, fl.,
Castrelín 111 (GH). Depto. Yavi, Ruta Nac. 9, 12 km de La Quiaca, 22º 10’S, 65º
37’W, 3600 m. 19 February 1997. F.O. Zuloaga et al. 6050 (SI). La Quiaca, 3442 m. 15
February 1931, fl., L.R. Parodi, 965 (GH). La Quiaca, 3450. 15 February 1940, fl.,
Mayer s.n. (GH). La Quiaca, 3450 m. 15 February 1940, fl., Mayer s.n. (GH). Viniendo desde Abra de Lizoite, passando unos 10 km del desvio, 22º 08’ 52” S, 65° 24’ 58” W,
110
4000 m. 08 March 2002, fl., M.A. Negritto et al. 437 (CORD). —MISIONES: Guaraní,
26º54’59’’S, 54º18’W, fr., 2 Nov 1999, S.G. Tressens 6442 (CTES, MBM).
Bolivia.—COCHABAMBA: La Cabaña, 2100 m. 23 May 1958, sterile, without collect
(US 2405296). —MURILO: Mun. La Paz, Hills directly South of Los Pinos suburb, 16º
32’ S, 68º 05’ W, 3300-3700 m. 17 March 1982, fl., J.C. Solomon 7202 (MO). —
POTOSÍ: Mun. Betanzos. Mar 1933, fl., M. Cárdenas 457 (US). —TARIJA: Mendez, localidade de Paicho Norte, Abra Sunchal, borde del rio Villamontes, 21º 06’ 39,7” S,
64º 54’ 13” W, 3200–3600 m. 18 February 2007, fl., I.L. Foronda 940 (MO). Tarija a
Narvaez, 2000-2500m. 19 March 1982, fl.; fr., R. Kiesling et al. 3761 (SI).
Mexico.—CHIHUAHUA: 4 km E of Rancho Chupaderos, 27º 11’ N, 104 º 38’ W,
1590 m. 29 August 1972, fl., fr., Chiang, F. et al. 8978 (MO). 26 mi, S of Chihuahua on
Mexico Federal rte. 45. 26 August 1971, fl., fr., Keil, D. & McGill, L.A. 8257 (GH).
Mun. Jiménez, 23.2 miles S of Jiménez along Hwy 49 in Cerros Colorados along road to Microondas Est. Coloado. 16. September 1973, fr., Henrickson, J. 13050 (US). Mun.
Mapula, Sierra Azul, Southwest of Mapula, 1550-1600 ft. September, fl., fr., Pennell,
F.W. 18634 (GH; US). Mun. Ojinaga, Sierra del Virulento, 2-3 miles east of Rancho
Virulento. A precipitous Sierra of bedded lavas about 65 miles South of Ojinaga. 11
August 1941, fl., Johnston, I.M. 8088 (GH). Vicinity of Fierro, in the igneous Sierra de
Encinillas, 28º 15’ N. 8 July 1941, fl., fr., Stewart, R.M. 745 (GH). —COAHUILA: 12
July 1946, fl., Hernandez Corzo, A. et al. 16M563 (GH). Mun. Saltillo, Estación
Carneros, camino a la torre de micro-ondas 3 km al W de la Estación, 30 Km al Sur de
Saltillo. 30 August 1982, fl.; fr., Rodríguez, L.E. & Villarreal J.A. 1753 (BRIT). About
5 miles South of Saltillo. 13 September 1946, fl., Barkley, F.A. 16039 (GH). Sierra
Madre Oriental, South of Saltillo. 10-13 July 1934, fr., Pennell, F.W. 17318 (US).
Canyon San Lorenzo, área of Canyon just above pumping station; 3.1 mi SE of Mex. 54
111
(SE of Saltillo), ca. 1900 m. 17 August 1979, fr., Wagner, W.L. et al. 4165 (MO).
Monclova, La muralla Pass, 40mi S of Monclova on Highway 57. 3 April 1970, fl.,
Mahler, F. & Thieret, J.W. 5685 (BRIT). Picacho de Noche Buena, ca. 28º 20’. 12
August 1940, fl., Johnston, I.M. & Muller, C.H. 183 (GH). Sierra del Pino, vicinity of
La Noria. 20-26 August 1940, fl., Johnston, I.M. & Muller, C.H. 684 (GH). Western
Slopes of the Sierra del Carmen 8 km east of Hacienda de la Encantada. 12 September
1941, fr., Stewart, R. M. 1599 (GH). —DURANGO: 28 miles N of vientisiete de
Noviembre along Hwy 40, 24º 12’ N, 104° 29’ W. 15 August 1978, fr., Wagner, W.L.
3955 (MO). 85 miles northeast of Durango. 11 August 1959, fr., Waterfall, U.T. 15397
(BRIT). 20 miles south of Durango. 17 July 1966, fl., David, J. et al. 36030 (GH). Cerro de mercado, North of Durango, Sierra Madre Occidental. 24-25 August 1934, fl.; fr.,
Pennell, F.W. 18214 (US). —GUANAJUATO: route de San Miguel de Allende vers
Dolores, km 25, 21° 10’ N, 100° 50’ W, 1850 m. 20 May 1994, fl.; fr., Billiet, F. &
Jadin, B. 6210 (MO). 10 miles east of Guanajuato, 7500 ft.. 22 June 1963, fl., fr.,
Harris, S.K. 25683 (GH). Vinicity of Guanajuato. 7 August 1947, fl., Kenoyer, L.A.
1776 (GH). —HIDALGO: Mun. Huichapan, 5 km al Este de Huichapan, desv. a
Chichimequillas, 2000 m. 24 June 1980, fr., Magaña, R. H. 4535 (MO). Mun.
Ixmiquilipan, 9 miles N of Ixmiquilipan along Mex 85. 20 August 1971, fl., Spellman,
D. et al. 963 (MO). Mun. Jacala, highway southwest of Jacala, ca. 4700 ft. 11 July
1948, fl., Moore Jr, H.E. & Wood Jr, C.E. 3939 (GH). 8 December 1937, fl., Edwards
M. T. 793 (MO). Mun. Metztitlan, between Zoquital and Los Venados, ca. 2000m. 31
July 1948, fl., fr., Moore Jr, H.E. & Wood Jr, C.E. 4205 (GH). Mun. Pachuca, between
Tizayuca and road to Tolcayuca (km 61). 30 July 1948, fl., fr., Moore Jr, H.E. & Wood
Jr, C.E. 4124 (GH). Mun. Tlaxiaca, 4 km al este de Tlaxiaca, 2300m. 24 June 1981, fr.,
Hernández, R. et al. 6149 (MO). Zempoala, 2km al sur de Zempoala, 2400m. 2
112
September 1980, fl., Magaña, R. H. 4828 (MO). Mun. Zimapán, vinicity of Zimapán 22
June 1947, fl., kenoyer, L.A. 1028 (GH). Along Hwy. 85, near the N turnoff to Zimapán, ca. 6400ft.. 16 August 1979, fr., Case, P. et al. 257 (MO). —JALISCO: 11 miles southeast of Lagos de Mareno. 16 August 1957, fl., Waterfall, U.T. & Wallis C.S. 13875
(BRIT). Mun. Ojuelos, 20 August 1973, fr., Ramirez, G.A. 14524 (MO). —MEXICO
CITY: 1.5 miles northeast of intersection of pyramid road with Highway 85, northeast of Mexico City. 22 August 1961, fl., Waterfall, U.T. 16477 (BRIT). Mun. Chiautla,
Atenguillo, 2200m. 17 May 1984 Mun. Teotihuacan. 1938, Balls, E.K. 4015 (US).
NUEVO LEON: —Mun. Galena, 1650 m. 23 July 1999, fr. Estrada, E.C. 10439
(BRIT). Arroyo Hondo, Hacienda San Jose de las Raices. 1 August 1935, fl.; fr.,
Muller, C.H. 2326 (GH; MO). Hacienda Pablillo. 5 August 1936, fr., Taylor, M. 94
(MO). Sierra Madre Oriental, 15 m S.W. of Galeana, 7500 ft.. 25 May 1934, fl.; fr.,
Mueller, C.H. & Mueller, M.T. 569 (GH). Mun. Pablillo, around edge of cienega near
Pablillo. 6370 ft.. 29 August 1940, fl.; fr., Shreve F. & Tinkham, E.R. 9753 (GH). Mun.
Saltillo, 38 miles southeast of Saltillo. 25 August 1961, fl., Waterfall, U.T. 16619
(BRIT). 18 miles West of Monterrey, 1250m. 30 September 1955, fl., Johnston, M.C.
2799 (BRIT). —OAXACA 5 Km al NE de Chazumba. 5 July 1981, fl., Chiang, F. et al
2122 (MO). —PUEBLA: Esperanza. August 1908, fr., Purpus, C.A. 3076 (MO). Mun.
Guadalupe Victoria, 2400m. 10 July 1970, fl., Ventura A., F. 1579 (MO). —SAN LUIS
POTOSI: 5.7 miles E of Salinas along Zaz-SLP hwy 49, 22º 34’ N, 101º 44’ W, 2100m.
23 September 1978, fl., Henrickson, J. & Lee, E. 17538 (MO). Along Mex 80, 20mi Ne of San Luis Potosi. 07 July 1966, fl.; fr., Ward, D.B. 5816 (BRIT). 44mi S of Huisache
Junction along highway 56. 22 July 1969, fl., Bierner, M. & Turner, B.L. 107 (BRIT).
Sierra de San Miguelito, South of San Luis Potossi. 28 July 1934, fl.; fr., Pennel, F.W.
17722 (GH; US). Mun. Charcas. July-August 1934, fl.; fr., Lundell, C.L. 5594 (US). —
113
VERA CRUZ: Mun. Alto Lucero de Guitiérrez Barrios, cerca de El Limón. 20
September 1967, fl.; fr., Ramos, C.H. s.n. (GH). —TAMAULIPAS: Near Miquihuana,
2460 m. 9 August 1941, fr., Sranford, L.R. et al 843 (GH; MO; NY). Mun. Marcella and
Hermosa. 22 July 1949, fl., Stanford et al. 2640 (GH; MO; US). Mun. Tula, Ejido
Ricardo Garcia o La Presita KM 66 Carretera Tula-Vitoria, 1730m. 02 June 1986, fl.,
Martinez, M. 1172 (MO). —ZACATECAS:3 September 1897, fl., Rose, J.N. 3639
(US). 2 miles north of Ojocaliente, 6800 ft., 6 October 1955, fr., Johnston, M.C. 2924
(BRIT). 4 miles southeast of Mazaril, 8425 ft. 6 August 1969, fl., fr., Taylor, J. &
Taylor, C. 5806 (BRIT). Mun. Concepción del oro, Ejido Noria de Guadalupe. 1820 m.
1 August 1975, fr., Marroquín, J. & González, M. 3500 (MO).
Peru. —AYACUCHO: Ayacucho. 7 February 1968, fl., Soukup, J. 5549 (US).
United States. —NEW MEXICO: 1851-52, fl., Wright, C. 162 (MO); Western Texas to
El Paso, fl., Wright, C. 517 (MO) —TEXAS: Brewster Co., Chisos mts. 27 July 1931, fl., Mueller, C.H. 8128 (GH). Chisos mts. 19 July 1932, fl., Muller, C.H. s.n. (GH). On cherts mountains at “Post” Pena Colorado, 5 miles S of Marathon. 23 June 1964, fl.,
Correll, D.S. & Correll, H.B. 26108 (GH). On cherts mountains at “Post” Pena
Colorado, 5 miles S of Marathon. 23 June 1964, sterile, Correll, D.S. & Hanson Craig
29855 (GH). Pena Blanca Mts., in anda round rock dikes in low moutains, about 6 miles east of highway 385. 30 September 1962, fl., Correll, D.S. & Correll, H. B. 26108
(GH). just north of college campus, along Highway 223. 17 May 1946, fl.; fr., Cory,
V.L. 53114 (BRIT). Spring-Chisos Mts. 3 December 1937, fl.; fr., Warnock, B. H. 1058
(GH). Mun. Alpine, S of Alpine. 7 June 1941, fl., Wolff S.E. s.n. (BRIT). On rocky ridges at Paisano Pass campground about 10 miles West of Alpine, Rte 90. 1 November
1966, fr., Correll, D.S. 34103 (GH). Jeff Davis Co., Davis Mountains, 1370m. 11 June
1931, fl., Moore, J.A. & Steyermark, J.A.3025 (MO). Fern Canyon Girl´s Scout Camp.
114
26 August 1953, fl., Tharp et al 3174 (BRIT). Trailing ove rocks, along rte. 17, near county line, South of Toyahvale. 19 September 1966, fl.; fr., Correl, D.S. 33659 (GH).
Goat Canyon, Davis mts.. 17 Octuber 1936, fl.; fr., Hinckley L.C. s.n. (GH). Below Mc
Donald observatory, Davis mts.. 14 June 1941, fl., Innes, R.R. et al. 1120 (GH). El Paso co. Canyon in Van Horn, 11 July 1900, fl., Eggert, H. s.n. (MO).
Uruguay. —MONTEVIDEO: Cerro de Montevideo. Without date, fr., Gibert 396
(MVM).
CULTIVATED AND WEED
Colombia. —CUDINAMARCA. Bogotá, Jardín Botánico José Celestino Mutis. 9 Jan
2004, fl., J.F. Fernández-Alonso & F. Sánchez 21068 (COL); Universidade Nacional,
2600 m. 28 Apr 1986, J.F. Fernández-Alonso et al. 6379 (COL). Suesca, 7.3 km al sureste del caserio. 18 Dec, C. Saravia et al 3038 (COL).
Mexico. —PUEBLA: Chiautla, pastizal em terreno plano; parcela de cultivo, 2250 m.
15 September 1983, fl., Ventura, E. 1407 (MO).
United States. —FLORIDA: Alachua co. Gainesville, University of Florida campus, in experimental trial Garden near Fifield Hall, 29º 38’ 20.5” N 82º 21’ 39.5” W. 23 May
2008, fl., Abbott, J.R. 24770 (MO).
2. DICHONDRA BRACHYPODA Wooton & Standl., Contr. U.S. Natl. Herb. 16: 160.
1913. — TYPE: UNITED STATED. New Mexico: in Filmore Canyon in the
Organ Mountains, [without information], Wooton, E.O. & Standley, P.C. s.n.
[holotype: US-564085!].
115
Stems 0.5–1 mm thick; internodes 1–7.5 cm long., pilose to sparsely pilose.
Leaf lamina 1–4.5 × 1–6.5 cm, reniform, base auriculate; adaxial surface pilose to sparsely pilose or glabrous, abaxial surface densely pilose to sparsely pilose; petioles
0.5–15 cm long., 0.3–0.6 mm thick, pilose to sparsely pilose, greenish. Inflorescence solitary flower, rare monochasial 2 flowers; bracts 2, 1–1.5 mm long., linear, glabrous, ciliate; peduncle 0.5–2.5 cm long., pilose to sparsely pilose, peduncle in flower straight, peduncle in fruit recurved at top or at middle. Calyx at anthesis 1.5–2.5 × 0.8–1.2 mm, sepals membranaceous, obelliptic with apex obtuse or oblong with apex obtuse to acute, pilose to sparsely pilose outside and glabrous inside. Calyx in fruit 3–4 × 1–2 mm, sepals obovate with apex obtuse or oblong with apex obtuse to acute, sparsely pilose outside and glabrous inside. Corolla rotate, white, lobes 1.4–2 × 1–1.5 mm, elliptic, apex obtuse to slightly emarginate, pilose to sparsely pilose outside, tube 1.5–2 mm long.; filaments 8–1.2 mm long., attached in the middle of tube, anthers ca. 0.3 mm long.; styles 1.2–1.7 mm long., inserted, unequal, glabrous. Fruits 4–8 mm in diameter, schizocarp dehiscent, globoid. Seeds 2–4 mm long., ovoid, brown. (Figures 1 m–v; 3 a– h).
Etymology:—“Brachypoda” is derived from Greek words brakhus meaning short and podos meaning foot, maybe referring to the sort pedicel.
Vernacular name:—new mexico ponysfoot
Distribution and Habitat:—Distributed in EUA and Mexico. It grows naturally in open woodlands, in shaded areas lawns. Usually grows under shade of Quercus
(Fagaceae), and is also found in anthropized area as highway, parks. Tharp & Johnston
(1961) cited one specimen (Reineck s.n Porto Alegre, 6 Jun. GH) to Brazil, we examined the specimen and couldn´t confirm which species is. The specimen is sterile
116 with large leaves sparsely pilose to glabrous that reminds D. brachypoda. Here, we report the first record to Bolivia.
Reproductive period: —Flowering and fruiting from July to October with peak of flowering and fruiting in September and October.
Taxonomic comments: —Dichondra brachypoda often presents leaves large with deep sinus in base and long petiole, however there is variation in size among populations. Also, it is the species with the largest fruit when mature, always exceeding the calyx. It is distinguished by corolla white in anthesis with trichomes outside and lobes usually slight emarginated, exceeding calyx or peduncle on fruit recurved with fruit exceeding calyx. Specimens studied from USA and Bolivia has leaves sparsely pilose to glabrous while species in Mexico are pilose. It can be confused with individual of Dichondra repens that have larger leaves and peduncle recurved on fruit but differs by fruit dehiscent (vs indehiscent) and corolla normally exceeding the calyx (vs. corolla not exceeding calyx) and with D. occidentalis by individual that has sparse trichomes on abaxial but distinguished by corolla pilose (vs. corolla glabrous) and styles inserted
(vs. exserted).
Selected specimens examined: Bolivia. —ARCE: Padcaya, Reserva Nacional de Flora y Fauna Tariquía, 21º53’58.6’’S 64º35’13.1’’W, fl., M. Serrano et al.
6149 (MO). —CABALLERO: Santa Cruz, 18º07’S, 64º18’W, 1675 m, 11 Jul
1998, M. Nee & D. Atha (50061). —MURILLO: La Paz, 16º32’S, 68º5’W, 3300 m, fl., fr. 17 Mar 1982, J.C. Solomon 7203 (MO).
Mexico. —CHIHUAHUA: Mapula, Sierra Azul, Southwest of Mapula, 1700 m. 10
September 1934, fl., Pennell, F.W. 18654 (GH). —COAHUILA: Villa Acuña, near
Santo Domingo. 4 July 1936, fr., Wynd, F.L. & Muller, C.H. 474 (GH; MO). 12 miles E
117 of Boaquillas in Sierra del Carmen, 29°12’N 102°45’W, 5500 ft. 27 July 1973, fl.,
Henrickson, J. 11505 (MO). —DURANGO: Panuco de Coronado, Ejido F.J. Mina, 24 km al NW de Fco, 1. Madero, 2250 m. 7 October 1989, fl., fr., Gonzalez, S. et al 4210
(IEB). —GUANAJUATO: Cortazar, parte alta del Cerro Culiacán, 2750 m. 3 October
1986, fl., Rzedowski 40688 (IEB). San Felipe, aprox. 32 km de León, carr. a San Felipe.
San, 2550 m. 28 May 2005, sterile, Carranza, E & Silva, I 6979 (IEB); 10-12 km al NW de San Felipe Torres Mochas, cerca de Herrerías, 2190 m. 12 October1996, fr.,
Carranza, E. 5171 (IEB); 8 km al ESE de Laguna de Guadalupe, 2350 m. 21 August
1991, fl., Rzedowski 50692 (IEB). Luis de la Paz, La Labor, 2000 m. 4 July 1990, fl.,
Ventura, E.& López, E. 8220 (IEB). Victoria, Puerto del Aire, por la Sierra de Victoria,
2300 m. 12 November 1991, fr., Ventura, E. & López, E. 9794 (IEB). —HIDALGO:
Huichapan, Nopal Leña Mts. West of Leña Station, 2600 m. 10 October 1946, fr.,
Moore-Jr., H.E. 1421 (GH). —JALISCO: San José de Gracia, 7.5 km al SW de La
Congoja, 2600 m. 17 October 1973, fr., Rzedowski & McVaugh 842 (MO). —NUEVO
LEON: Monterrey, Cliff sides along arroyo in desert between mountains, 22 miles west of Monterrey. 10 August 1959, fl., Waterfall, U.T. 15326 (BRIT).
United States. —ARIZONA: Cochise Co., in reacreation area, Rucker Canyon,
Chiricahua Mountains, 6000 ft. 5 October 1947, fl., Gould, F.W. & Haskell, H.S. 4610
(BRIT). —NEW MEXICO: Sierra Co., Kingston, 6700 ft. 19 September 1904, fr.,
Metcalfe, O.B. 1377 (GH). —TEXAS: Brewster Co., 10 miles west of Alpine, Rte. 90. 1
November 1966, fr., Correll, D.S. 34098 (GH). Chisos Mts. 23 August 1931, fr.,
Mueller, C.H. 8127 (GH); 29 July 1932, fl., Mueller, C.H. s.n. (GH); 26 August 1938, fl., fr., Warnock, B.H. 326 (GH). Glass Mts., limestone on north side of Bisset hill. 3
July 1941, fl., fr., Warnsck, B.H. W501 (BRIT); on N-side of Bisset Hill. 3 July 1941, fr., Warnock, B.H. 501 (GH). Culberson Co., Diablo Mountains, northwest of Van
118
Horn. 28 August 1953, fr., Tharp et al 3235 (BRIT). Jeff Davis Co., Davis Mountains, roadside at turn to Summit Drive, 30°35'46"N 103°56'05"W, 1532 m. 12 September
2016, fl., Delgado Junior, G.C. & Staples, G. 853 (MO; PEUFR); Davis mts Scenic
Loop, in front of M' Donald Observatory, 30°40'51"N 104°00'53"W, 2019 m. 12
September 2016, fl., fr., Delgado Junior, G.C. & Staples, G. 854 (MO; PEUFR); 9
October 1926, fr., Palmer, E.J. 32143 (MO); Madera Canyon. 26 July 1952, fl.,
Webster, G.L. 4492 (BRIT; GH); Goat Canyon near Livermore, 1700 m. 21 August
1935, fl., Hinckley, L.C. s.n. (GH); Point of Rocks roadside park on scenic drive, about
11 mi. from Fort Davis. 19 September 1966, fr., Correll, D.S.33700 (GH). Pecos Co.,
Rest area on I-10 west, 30°51'21"N 102°04'12"W, 744 m. 11 September 2016, fr.,
Delgado-Junior, G.C. & Staples G. 846 (MO; PEUFR). 24 July 1943, fr., Tharp, B.C.
43774 (MO). Presidio Co., Sierra Tierra Vieja, 5000 ft. 30 July 1941, Hinckley, L.C.
2051 (GH). Terrell Co, Oasis Ranch Quadrangle, 30º27’617’’ N, 101º 45.189’, 1930 ft.
30 April 2002, fr., Carr, W.R. 20832 (TEX).
3. DICHONDRA BREVIFOLIA Buchanan, Trans. & Proc. New Zealand Inst. 3: 208.
1871 ≡ Dichondra repens var. brevifolia (Buchanan) Kirk, Trans. & Proc. New
Zealand Inst. 10: App.37. 1878.
Stems 0.3–0.6 mm thick; internodes 0.5–1 cm long., sparsely pilose to glabrous.
Leaf lamina 4–5 × 5–6 mm, reniform to depressed ovate, base auriculate to cordate; adaxial surface glabrous, abaxial surface sparsely sericeous-pilose, greenish; petioles
0.4–1.5 cm long., 0.2–0.3 mm thick, sparsely pilose. Inflorescence solitary flower, rare monochasial 2 flowers; bracts 2, 1–2 mm long., linear, sparsely sericeous; peduncle
0.8–1.3 mm long., sericeous to sparsely sericeous, rare glabrous, peduncle in flower straight, peduncle in fruit recurved at top. Calyx at anthesis 0.8–2.4× 0.5–1.8 mm, 119 sepals chartaceous, oblong with apex obtuse to subacute, oblanceolate with apex obtuse to subacute or obovate with apex obtuse, sericeous to sparsely sericeous outside and glabrous inside. Calyx in fruit 2.5–3 × 0.5–2 mm, sepals oblong with apex obtuse to acute, oblanceolate with apex obtuse to subacute or obovate with apex obtuse, sericeous to sparsely sericeous outside and glabrous inside. Corolla rotate, pale yellowish to white, lobes 2.5–3 × 1.3–2 mm, rotund to oblong, apex rounded to obtuse, pilose outside, tube 1.3 –1.9 mm long.; filaments 1.3–2 mm long., attached in the apex of tube, anthers ca. 0.4 mm long.; styles 1.6–2.5 mm long., inserted, equal, glabrous. Fruits 2 mm in diameter, schizocarp indehiscent, globoid. Seeds ca. 2 mm long., ovoid, dark.
(Figures 1 w–z; 5 a–b).
Etymology—“Brevifolia” is derived from Latin brevi- (small, tiny) and -folia
(leaved) components meaning short-leaved.
Vernacular name—unknown.
Distribution and Habitat—Endemic to New Zealand, growing in grassland of coastal or mountain area.
Phenology—Flowering from September to December, flowering peak in
November. Information about fruit is not available on labels.
Taxonomic comments—Dichondra brevifolia is a singular species easily recognized by leaves smaller than 6 mm long. with peduncle longer than the petiole and corolla with trichomes outside, lobes larger exceeding the calyx. Maybe sterile can be confused with D. repens individual that has small leaves. However, it is distinguished by wide corolla lobos ≥2.5 mm (vs. narrow< 2 mm).
Nomenclatural comments—Dichondra brevifolia was described by Buchanan in 1871 based on his own collect, without number, from Popotunoa, Otago. We couldn’t
120 confirm any specimens as type to D. brevifolia. We contacted the largest herbarium in
New Zealand (OTA, CHR WELT) and localized one specimen from Popotunoa, Otago collected by Kirk (WELT 070293) and one Buchanan´s specimen (WELT 032646) without number and locality. This specimen represents a mix of two specimens D. repens and D. brevifolia. Even studied exhaustively, we did not feel confident to choose it as lectotype, also we did not choose a neotype because it necessary to study more specimens for sure. Here our conception of D. brevifolia is following the protologue and specimens examined from WELT herbarium.
Specimens examined—New Zealand. Strath Taieri, 45º30’S 170º7’E.
November 1892, fl., D. Petrie s/n. (WEL32653/A); Bulls. 28 Sep1895, fl., Miss Begg
(WELT64224) —CANTERBURY: near Burnham, 43º37’S 172º7’E. 19 November
1883, fl. Kirk, T. s/n (WELT 032652); Mt Torlesse. 12 Nov. 1909, fl., without information (WELT 6016); canterburry plains. Nov 1883, fl. T. Kirk (WELT43513).
—OTAGO: without information. Without information, fl., J Buchanan (WELT 32646);
Vicinity of Dunedin. Without information, fl., fr., D. Petrie s/n (WELT 32678);
Maniototo. Without information, fl., D. Petrie s/n. (WELT 32679); Lake Wanaka. Nov
1893, fl., D. Petrie s/n (WELT 032683); Strath Taieri. Nov 1892, fl., D. Petrie s/n
(WELT 32653/A) —WELLINGTON: Titahi Bay, 41º6.5’ S 174º50,5’ E. Without date, fl., Aston, B.C. s/n. (WELT 32650); Seatoun. 9 Nov 1941, fl., WRB Oliver (WELT
64504); Vicinity of Dunedin. Without information, fr., D. Petrie (WELT 32678). —
SOUTH ISLAND: without information, fl., T. Kirk s/n. (GH); Palmerston, Horse
Range., Without information, fl., D. Petrie s/n (WELT 032677). — WHAITAKI:
Kurow. 17 Dec 1957, fl., WRB Oliver (WELT 39423); Oct 1893, fl., Petrie s/n (WELT
32680/A)
121
4. DICHONDRA NIVEA (Brandegee) Tharp & M.C.Johnst., Brittonia 13: 356. 1961.
—TYPE: MEXICO. Puebla: Cerro de Santa Lucia, [without information],
Purpus, 2563 (holotype: MO-152734!).
Stems 0.6–1.5 mm thick; internodes 0.3–2.5 cm long., densely villous-sericeous.
Leaf lamina 0.5–1.6 × 0.5–2 cm, depressed ovate to reniform, base attenuate or auriculate; adaxial surface densely villous-sericeous, abaxial surface densely villous- sericeous, silvery; petioles 0.5–5 cm long., 0.2–0.5 mm thick, villous-sericeous.
Inflorescence solitary flower; bracts 2, 0.8–3 mm long., linear, densely sericeous– pilose; peduncle 1–2.5 cm long., villous-sericeous, peduncle in flower straight, peduncle in fruit unknown. Calyx at anthesis 2–3.6 × 0.7–1.5 mm, sepals chartaceous, ovate or lanceolate with apex acute, sericeous to sparsely sericeous outside and glabrous inside.
Calyx in fruit unknown. Corolla funnel-form, white to pale yellowish with purple outside on the lobes, lobes 5–5.4 × 2–3 mm, obovate to rotund or elliptic, apex round to obtuse, pilose outside, tube 2–2.7 mm long.; filaments 2–2.7 mm long., attached in the middle of tube, anthers 1–1.3 mm long.; styles 8–13 mm long., exserted, subequal, glabrous. Fruits unknown. (Figures 4 a–e; 5 c–d).
Etymology—“Nivea” is a Latin name that means snowy. It maybe refers to silver leaves growing in tufts after spreading in branch, reminding snowflakes.
Vernacular name: — unknown
Distribution and Habitat: — Endemic to Mexico. It grows in arid area.
Reproductive period: — Flowering from July to September; fruiting not seen
Taxonomic comments: — This species vegetative is very similar to D. argentea due to the silvery leaves. The difference was already discussed under comments of that species. Dichodra nivea is very distinct because the leaves grow clustered then
122 spreading along the branch, the most common leaves type is depressed ovate instead of reniform and also it has the biggest corolla in the genus with lobes up 5 mm.
Specimens examined: Mexico. — CHIHUAHUA: without information. fl., Jul
1907, J. Greqq 715 (MO). —GUANAJUATO: Dolores Hidalgo, 9.5 km de Dolores
Hidalgo, carretera a San Felipe, 2070 m, fl., 23 Ago 2005, E. Carranza 7023 (IEB); 10 km de Dolores Hidalgo, carretera a Guanajuato, al W de Los Hernández, 2000 m, fl., 23
Ago 2005, E. Carranza 7031 (IEB); 1.4 km de Trancas, camino a Dolores Hidalgo,
2060 m, fl., 23 Ago 2005, E. Carranza 7025 (IEB); 10.5 km de Dolores Hidalgo, por la carretera a San Felipe, 21º 13’ 35’’N, 101º 00’ 17’S, 2070 m, fl., 07 Jul 2005, E.
Carranza & I. Silva 7000 (IEB), 10 km de Dolores Hidalgo, carretera a Guanajuato, al
W de Los Hernández, 2000 m, fl., 19 Set 2005, E. Carranza 7070 (IEB); 10 km al N de
Dolores Hidalgo, sobre la carretera a San Felipe, 2050 m, fl., 06 Set 1988, Rzedowski
47328 (IEB); 10 km al NW de Dolores Hidalgo, sobre la carretera a San Felipe, 2050 m, fl., 23 Ago 1988, Rzedowski 47172 (IEB). PUEBLA: Vicinity of San Luis Tultitlanapa, fl., Jul 1907, C. A. Purpus 2563 (MO, NY). —TAMAULIPAS: en route to Pena Nevada out of Hermosa, fl., Jul 1949, Stanford, Lauber & Taylor 2528 (MO).
5. DICHONDRA OCCIDENTALIS House, Muhlenbergia 1: 160. 1906.—TYPE:
UNITED STATED. California: San Diego, January 7, 1884. Orcutt, C.R. s.n.
[holotype: US-61113!].
Stems 0.8–1 mm thick; internodes 0.5–2.5 cm long., densely sericeous-pilose to sericeous. Leaf lamina 1–3 × 1.5–4 cm, reniform, base auriculate; adaxial surface glabrous, abaxial surface sparsely pilose to glabrous, greenish; petioles 3.5–9 cm long.,
0.4–0.6 mm thick, sparsely sericeous to sericeous-pilose. Inflorescence Solitary flower;
123 bracts 2, 2–3 mm long., linear, sericeous-pilose to sparsely pilose; peduncle 0.5–3 cm long., sericeous-pilose to sparsely pilose; peduncle in flower straight, peduncle in fruit recurved at top. Calyx at anthesis 1.5–2.5 × 0.5–1 mm, sepals membranaceous, oblong to lanceolate or elliptic with apex acute to obtuse, sericeous-pilose to sparsely sericeous- pilose outside and glabrous inside. Calyx in fruit 2–3 × 0.8–1.2 mm, sepals oblong to lanceolate with apex acute to obtuse or ovate with apex obtuse, sparsely-pilose outside and glabrous inside. Corolla rotate, purple to pale purple or white to pale purple, lobes
1.3–2 × 0.6–1 mm, deltoid to oblong, apex obtuse to acute, glabrous outside, tube 0.7–1 mm long.; filaments 0.9–1 mm long., attached in the middle of tube, anthers 0.3–0.4 mm long.; styles 1.9–2.3 mm long., unequal, pilose at base. Fruits 2–3.5 mm in diameter, schizocarp dehiscent, globoid. Seeds 1.5-2.5 mm long., obovoid, black.
(Figures 4 f–m; 5 e–f).
Etymology—“Occidentalis’’ means Western. It is a reference to locality where the species was collected, California – West of United States.
Vernacular name—Western Ponysfoot.
Distribution and Habitat—Endemic to Southern and Central California, EUA.
It grows in sandy hills, close to ocean and dry slope.
Reproductive period—Flowering and fruiting from March to July.
Taxonomic comments—Dichondra occidentalis vegetative can be confused to individual of D. brachypoda and D. repens that have sparse trichomes on abaxial leaves. However, D. occidentalis usually has appearance glabrous on leaves and steams densely sericeous and these two species do not. Dichondra occidentalis is distinguished by the following set of characters: stems sericeous, adaxial leaves glabrous, flower
124 purple and exceeding the calyx, fruiting peduncle recurved and it is the only species with trichomes at the base of styles.
Specimens examined: United States. —CALIFORNIA: Baja California, ridge
2 miles east of Cerro del Coronel, 500 m, fl., Jun 1975, without information (MO);
Todos Santos Island, fl. fr., Mar 1897, A. W. Anthony 191 (MO, NY, GH). Los Angeles,
Santa Catalina Island, 350m, fr., May 1931, F. R. Fosberg 54916 (NY); fr., Abr 1898,
B. Trask (US 340387). San Diego, Sandy hills, fr., Apr 1919, M. F. Spencer 895 (NY); fl., Dec 1884, C. R. Orcutt s.n (NY; US 1336126); Near Oxnard, fl., fr., Jul 1933, O.
Degener 4734 (NY); 1000 m, fl., Apr 1902, B. Grant (US 468223); May 1984, D.
Cleveland (US 771409).
6. DICHONDRA REPENS J.R.Forst. & G.Forst., Char. Gen. Pl.: 40. 1776.—TYPE:
NEW ZEALAND. Without locality or date, Forster 61 (lectotype designated by
Nicolson & Fosberg 2003: 369, P! [image!]).
Dichondra carolinensis Michx., Fl. Bor.-Amer. 1: 136. 1803. Demidofia repens J.F.
Gmel., Syst. Nat., ed. 13. 2(1): 458. 1791. Dichondra repens var. carolinensis
(Michx.) Poir. in J.B.A.M.de Lamarck, Encycl., Suppl. 2: 470. 1812. Dichondra
evolvulacea var. carolinensis (Michx.) Kuntze, Revis. Gen. Pl. 3(2): 216. 1898.
Dichondra caroliniana Willd. ex DC. in A.P.de Candolle, Prodr. 9: 451. 1845.
orth. var.—TYPE: UNITED STATED. in Carolina, circa Charlstown, [without
information] A. Michaux s.n. (neotype designed by Delgado-Junior et al 2018, P-
00608606 [digital image!]); syn. nov.
Dichondra evolvulacea (L.f.) Britton, Mem. Torrey Bot. Club 5: 268. 1894. Sibthorpia
evolvulacea L. f. Suppl. Pl. 288. 1781.—TYPE: COLOMBIA. Cudinamarca,
125
[without information], Mutis 113 (lectotype designed by Alonso 1991, LINN-
793.5 [digital image!]); syn. nov.
Dichondra donelliana Tharp & M.C.Johnst., Brittonia 13: 352. 1961.—TYPE:
UNITED STATES. California, Marin County [without information], Mason, H.L.
5217 (holotype: GH!); syn. nov.
Dichondra macrocalyx Meisn., Fl. Bras. 7: 358. 1869. Dichondra evolvulacea f.
macrocalyx (Meisn.) Kuntze, Revis. Gen. Pl. 3(2): 216. 1898. Dichondra repens
var. macrocalyx (Meisn.) Hoehne, Anexos Mem. Inst. Butantan, Secç. Bot. 1(6):
34. 1922.—TYPE: BRAZIL. [without information], 1827, Maximilian Wied-
Neuwied s.n. [lectotype designed by Delgado-Junior et al 2018, BR-06588243.
(digital image!)]; syn. nov.
Dichondra micrantha Urb., Symb. Antill. 9: 243. 1924. Dichondra repens var.
micrantha (Urb.) Lu, Quart. J. Chin. Forest. 6: 116 (1972).—TYPE: CUBA.
Province Oriente, prope Baracoa ad sinum Taco prope domum, 11 December
1914, E. L. Ekman 3851a, [lectotype, designated here: G227219 (image!);
isolectotype: NY111076! S04-1917 (image!)], US1508153 (image!)]; syn. nov.
Dichondra microcalyx (Hallier f.) Fabris, Fl. Prov. Buenos Aires 5: 74. 1965.
Dichondra sericea var. microcalyx (Hallier f.) H.T.Buck, Fl. Ilustr. Entre Ríos 5:
152. 1979.—TYPE: ARGENTINA. Cabrera, A.L. 10142 (holotype: LP [digital
image!]), syn. nov.
Dichondra parvifolia Meisn., Fl. Bras. 7: 360. 1869. Dichondra repens var. parvifolia
(Meisn.) Hallier f. (1899: 20).—TYPE: BRAZIL. [Without information], Lhotsky
s.n. (lectotype designed by Delgado-Junior et al. 2018, NY-00621734 [digital
image!]); syn. nov.
126
Dichondra recurvata Tharp & M.C.Johnst., Brittonia 13: 351. 1961.—TYPE: UNITED
STATES. TEXAS, Travis County, [without information], Tharp, s.n. (holotype:
TEX175280!); syn. nov.
Dichondra repens var. longipetiolata Mattos, Loefgrenia 70: 4. 1976. TYPE: BRAZIL.
São Paulo, Butatan, 01 June 1917, F.C. Hoehne s.n (holotype SP 170 [image!],
syn. nov.
Dichondra sericea Sw., Prodr.: 54. 1788. Dichondra repens var. sericea (Sw.) Poir.,
Encycl., Suppl. 2: 470. 1812. Dichondra repens var. sericea (Sw.) Choisy, Prodr.
9: 451. 1845. Dichondra evolvulacea var. sericea (Sw.) Kuntze, Revis. Gen. Pl.
3(2): 216. 1898. —TYPE: JAMAICA. [without information], Swartz s.n.
(lectotype designed by Delgado-Junior et al. 2018, LINN-HS 477.4 [digital
image!]); syn. nov.
Dichondra sericea var. tomentosa W.R.Buck ex Tronc. & Bacigalupo, Darwiniana 21:
177. 1977 publ. 1978.—TYPE: ARGENTINA. Entre Rios. Dep. La Paz, 10 Km al
sur de La Paz, [without information], Burkat A.,30072 (holotype: SI!); syn. nov.
Dichondra villosa Parodi, Anales Soc. Ci. Argent. 13: 9. 1882. =Dichondra repens var.
villosa (Parodi) O'Donell, Lilloa 29: 328. 1959. =Dichondra evolvulacea var.
villosa (Parodi) Kuntze, Revis. Gen. Pl. 3(2): 216. 1898.
Stems 0.2–2 mm thick; internodes 0.4–3.5 cm long., densely sericeous-pilose to sparsely sericeous-pilose, rare glabrous. Leaf lamina (0.3–)1–3 (–4.6) × (0.3–)1–3(–5.6) cm, reniform, orbicular to suborbicular and depressed ovate, base auriculate or cordate; adaxial surface sericeous-pilose to sparsely sericeous-pilose, rare densely sericeous- pilose or glabrous, abaxial surface densely sericeous-pilose to sparsely sericeous-pilose, rare glabrous; petioles (0.2–)1–12(–18) cm long., 0.3–0.9 mm thick, sericeous-pilose to
127 sparsely sericeous-pilose, rare glabrous, greenish or , rare canescent on abaxial surface.
Inflorescence solitary flower to monochasial 2, rare 3 flowers; bracts 2, 0.5–2(–3) mm long., linear, densely sericeous-pilose to sericeous-pilose; peduncle (0.2–)1–4(–6) mm long., densely sericeous-pilose to sparsely sericeous-pilose, peduncle in flower straight, peduncle in fruit straight to slightly recurved or recurved on top. Calyx at anthesis
(1.2–)2–3.5(–4.5) × (0.3–)0.8–2.5 mm, sepals oblong, obovate, elliptic, obelliptic, spatulate or oblanceolate with apex obtuse to acute or round to obtuse, densely sericeous-pilose to sparsely sericeous-pilose, rare glabrous outside and sparsely pilose to glabrous inside. Calyx in fruit (1.5–)2.5–4(–5.5) × (0.3–)0.8–2.5 mm, sepals membranaceous, oblong, obovate, elliptic, obelliptic, spatulate or oblanceolate with apex obtuse to acute or round to obtuse, sericeous-pilose to sparsely sericeous-pilose, rare glabrous outside and sparsely sericeous-pilose to glabrous inside. Corolla rotate, pale greenish to white or pale creamy, lobes 1–2 × 0.4–1 mm, deltoid, obelliptic or oblong, apex obtuse to acute rare, emarginate, glabrous, rare pilose outside, tube 0.8–1.5 mm long.; filaments 0.3–1 mm long., attached in the top of tube, anthers 0.2–0.5 mm long.; styles 0.4–2.1 mm long., inserted, subequal to equal, glabrous. Fruits 2–3.5 mm in diameter, schizocarp indehiscent, globoid to 2-globoid. Seeds 1.5–2.5 mm long., obovoid, dark brown to black. (Figures 4 n–p; 6 a–z; 7 a–e; 8 a–f).
Etymology: —“Repens” is a Latin word that means creeping, prostrate. It is a reference to its growth form.
Vernacular name: — North America: carolina ponysfoot, oakwoods ponyfoot. South
America: orelha-de-rato, oreja del ráton, lingua-de-sapo, grama-japonea, Asia: Japanese grass. Oceania: Kidney-weed
Distribution and Habitat: — Dichondra repens is widely distributed around the world as weed/naturalized, cultivated or natural. In North America (Mexico and United 128
States), in USA grows gravely oak woodlands, pineland and lakeshores, also stony and grassy slopes, less than 600 m hight. It is cultivated as ornamental in gardens around
EUA. Central America (Costa Rica, Guatemala, Honduras, Nicaragua, Panama), South
America (Argentina, Bolivia, Brazil, Chile, Colombia, Ecuador, Paraguay, Uruguay) and Caribbean Islands (Cuba, Dominican Republic, Haiti, Jamaica, Puerto Rico). It grows naturally in shady places, on rocks and in Araucaria forest, also in open areas mixed with grass, on road sides, and spread on sidewalks as weeds. It occurs in
Australia and New Zealand, growing in plains grassland, red gum and coastal banksia woodland, dry forest and grassy low open forest. Found in Africa and Asia in disturbed area and as cultivated as ground cover for gardens.
Reproductive period:—Flowering from September to January; fruiting August to
February.
Taxonomic comments:— Dichondra repens was the first species described for the genus in 1776, based on a specimen from New Zealand collected by Forsters. They characterized it by calyx and corolla lanceolate and did not described the indumenta on leaves. When we studied the protologue illustration either the type specimen, we realized that calyx and corolla are variable, from ovate to oblong.
After an exhaustive analysis of specimens, we suspected that D. repens could be a species tremendously variable morphologically. After all the efforts to find discontinuous characters among at least nine species included on this “repens” complex, we conclude that several new taxa were described based on morphologic extremes over the last years.
The phylogenetic hypothesis based on plastid loci supports the Dichondra repens as non-monophyletic as currently circumscribed, since it emerged clustered with other species in clade with low internal resolution (Chapter 2).
129
Thus, from molecular and morphology evidences, we here propose to synonymize D. carolinensis, D. donelliana, D. evolvulacea, D. macrocalyx, D. micrantha, D. microcalyx, D. parvifolia, D. recurvata, D. repens var. longepetiolata, D. repens var. peruviana, D. sericea, D. sericea var. holosericea, D. sericea var. tomentosa and D. villosa under D. repens.
From here we explain in a chronologic order, a brief history for each species synonimized, based on types and protologues, highlighting the most important morphological incongruences/overlaps.
Dichondra sericea was described in 1788 by Swartz, which considered relevant the leaf densely sericeous on abaxial face and sepals obovate. This set of characters is not enough to delimitate species because it is continuous and seems to be influenced by the habitat. Specimens from EUA, Mexico and Central America often present in a same branch, leaves with indumentum varying from densely sericeous to sparsely sericeous on abaxial face.
Dichondra carolinensis has been used for Dichondra in southeastern, USA. It was described by Michaux (1803), who mentioned calyx spatulated-oblong, corolla with lobes ovate and did not inform any indumentum. Specimens examined from
Southeastern, USA, in general are sparsely sericous-pilose.
Dichondra repens var. peruviana (1805) was described by Persoon based on description of D. repens in Flora Peruviana. It was distinguished from other by the leaves sericeous on abaxial face and glabrous on adaxial, sepals obovate with apex obtuse and corolla with lobes ovate. Here it was possible to verify the ovelap with both “D. sericea” and “D. carolinensis” definitions.
Meisner (1869) in Flora Brasiliensis described two new species: D. parvifolia characterized by sepals lanceolate and leaves sericeous on abaxial face (it looks a mix of
130
Dichondra sericea and D. repens s.s); and D. macrocalyx by sepals spatulate with apex obtuse and leaves “densely adpressed pubescent” (or sericeous), this description reminds “D. carolinensis” with a denser indumentum.
Dichondra evolvulacea was described based on a material from New Granada
(Colombia, Ecuador, Panama and Venezuela) collected by Mutis. It was characterized by leaves subtomentose on abaxial face, it was not mentioned calyx and corolla shapes.
The name D. evolvulacea have been used only for specimens in Colombia and neglected by other American researchers.
In 1924, Urban described D. micrantha with leaves glabrous on adaxial face and sparsely pilose on abaxial, calyx and corolla oblong to linear, further mentioned tiny leaves. These features were usually found in specimens cultivated or ruderal but are inconsistent.
Tharp and Johnston (1961) described two species: D. recurvata (endemic to Texas) and
D. donelliana (endemic to California). Both taxa share sepals wider than longer
(obovate or oblong) and leaves dense to sparsely pubescent. They used only numeric characters (internodes distance, leaf, branch thickness and corolla size) to separate them, but always overlapping.
Years later Fabris (1965) described D. microcalyx from Argentina and that name has been used through South America. In 1977 Dichondra sericea var. tomentosa was described by Burkat also to Argentina. These two species share the same set of characters than “D. donelliana” and “D. recurvata”, only trichomes density are distinct.
Dichondra repens var. longepetiolata was described by Mattos (1976) as a new variety only based on the size of petiole (long petiole – but with no objective information) and it shares all vegetative and reproductive characters with “D. sericea and D. parvifolia”.
131
Dichondra repens is highly polymorphic regarding sepals and corolla size, shape and trichomes density. Together with D. brevifolia (see taxonomic notes) composes the unique group of species with fruit schizocarp indehiscent. Vegetative stage can be confused to D. brachypoda and D. occidentalis (differences already discussed under the comments of these species). It is hard to define diagnostic characters common for all individuals, but in general corolla lobes are narrow (≤1 mm) and smaller or equal the calyx (rarely exceeding a little bit the calyx) and fruit schizocarp indehiscent.
Nomenclatural notes:—In the protologue of Dichondra micrantha, Urban (1923) cited the specimen E. L. Ekman 3851a and we traced four duplicates deposited at G, NY, S and US herbaria. We choose the best preserved specimen (G227219) as the lectotype.
We could not study the type for Dichonda villosa because Parodi´s herbarium is lost and its current whereabouts is unknown according to Austin et al (2015), also the type for Dichondra repens var. peruviana that requires typification.
Selected specimens examined: Argentina. —BUENO AIRES: Pdo. de Ensenada,
Reserva Natural Estricta Punta Lara, 34º49’2.9’’S, 58º04’20.6”W, fr., 17 Dec 2004, S.
Torres Robles & R. Herrera 2245 (LP;MO). —CORRIENTES: Empedrado, fl., fr., 25
Aug 1982, T. M. Pedersen 13392 (MO); Mburucuyá, Santa Maria, fr., 18 Nov 1950, T.
R. Pedersen 861 (MO) —ENTRE RIOS: Gualeguaychú, 11 Nov 1973, fl., fr., A.
Burkart et al. 30.088 (SI); ruta La PAZ, Villaguay, fr., 10 Nov 1973, A. Burkart et al.
300064 (MO; SI).
Australia. —SOUTH WALES: Maryland Creek, 28º38’S, 151º 38’E, fr., 31 Dec 1981
K. L. Wilson 4262 (MO) —SYDNEY: Genowlan Mountain, 7 miles north-east of
Capertee. 23 Sep 1964, fr., E. F. Constable 5020 (NY).
Bermuda. —without local. 14 May 1910, fr., N. F. Flynn, (MO 805854).
132
Bolivia. —MURILO: La Paz, hills directly south of Los Pinos suburb, 16º 32’ S, 68º
05’ W. 17 Mar 1982, fr., J. C. Solomon 7203 (NY).
Brazil. —BAHIA: Boa Nova, Parque Nacional de Boa Nova, setor Sul, Fazenda
Cotermaia, 06 Jan 2013, fr., L. Y. S. Aona et al. 1929 (HUEFS, HURB). Piatã, encosta da Serra do Barbado, 06 Sep 1996, fl., fr., R. M. Harley et al 28317 (HUEFS). —
MINAS GERAIS: Andradas, 5 Jun 1942, fl., J. E. de Oliveira 1068 (BHCB). Belo
Horizonte, Carlos Prates, 24 Dec 1980, fl., T. S. M. G. 515 (BHCB). Camanducaia 29
Mar 2003, fr., L. D. Meireles & G. J. Shepherd 1336 (UEC). Campos Altos, Parque
Nacional Caparaó, 19 Nov 1988, fl., Lkrieger et al 23980 (UFJF). Gonçalves, 26 Oct
2008, fl., L. H. Y. Kamino et al 1223 (BHCB). Iguatama, Fazenda Faroeste, 10 Aug
2003, fl., P.H.A. Melo & G. P. Santos 815 (BHCB). Ouro Preto, Serra de Capanema, 11
Sep 2007, fl., F. F. Carmo 1052 (BHCB). Poços de Caldas, São Domingos, 24 May
1988, fl., fr., J. T. Motta 1175 (MBM). Santa Barbara, Serra de Gandarela, 26 Dec
2007, fl., F. F. Carmo 1535 (BHCB). —PARANÁ: Balsa Nova, 08 Nov 1976, fl., G.
Hatschbach 39162 (MBM). Campo Mourão, 31 Aug 2009, fl., fr., M. G. Caxambu 2681
(HCF, MBM). Colombo, Rio Palmital, 01 Nov 1973, fl., fr., G. Hatschbach 32810
(MBM). Curitiba, Cabral, 27 May 1985, fl., D. Sbalchiero et al. 137 (UPCB);
Capanema, 13 Nov 1973, fl., R. Kummrow 45 (MBM); Sítio cercado, 22 Oct 2005, fl., fr., J. Cordeiro 2260 (CESJ, FURB, HUEFS, HUCS). Lapa, Rio Passa 2, 30 Sep 1969, fl., fr., G. Hatschbach 22243 (MBM, NY). Marechal Candido Rondon, 10 Dec 1977, fl.,
G. Hatschbach 40582 (MBM). Palmeira, Fazenda Padre Ignacio, 14 Oct 1947, fl., fr.,
G. Tessmann 2483 (MBM). Palmeira, 14 Oct 1947, fl., G. Tessmann s.n. (PACA
48290). Piraquara, 28 Sep 1951, fl., fr., G. Hatschbach 2506 (MBM). Guarapuava, 15
Nov 1957, fl., fr., G. Hatschbach 4291 (MBM). Jundaí do Sul, 01 Feb 2001, fr., J.
Carneiro 1051 (FURB, MBM). —RIO DE JANEIRO: Petrópolis, 15 Aug 1943, fl., fr.,
133
C. Goes sn. (RB264135). Rio de Janeiro, without date, fr., G. Gardner 219 (NY
720055).—RIO GRANDE DO SUL: Agronomia, 16 Jul 1975, fl., T. Strehl s.n. (MPUC
1224). Agudo, Morro Agudo, 27 Sep 1985, fl., D. B. Falkenberg 3332 (MBM, FLOR,
ICN); Morro Agudo, Sep 1985, fl., fr., M. Sobral et al. 4350 (ICN, INPA, MBM, NY,
SP). Arroio do Rato, fl., 8 Fev 1942, B. Rambo (PACA8449); 16 Dec 1975, fr., K.
Hagelund 10288 (ICN); Fazenda Fazinal, 14 Oct 1975, fr., K. Hagelund 13100 (ICN).
Bom Jesus, Arroio da Goiabeira, 17 Sep 2014, fl., E. D. Lozano 2778 (MBM, UPCB);
20 Nov 2007, fl., fr., P. P. A. Ferreira 56 (ICN); Serra da Rocinha, 14 Feb 1947, fr., B.
Rambo s.n. (PACA 35210); 03 Feb 1953, fl., fr., B. Rambo s.n. (PACA 53765).
Caçapava, Guaritas, 13 Oct 1985, fl., fr., J. R. Stehmann 678 (ICN); 24 Aug 1974, fl., K.
Hagelund 8076 (ICN). Caçapava do Sul, pedra do segredo, 12 Nov 1980, fl., J. Mattos
21597 (HAS, PEUFR). Cambará do Sul, Dec 1983, fr., J. Stehmann 249 (ICN); 23 Jan
2011, fr., G.A. Dettke 568 (ICN). Parque Nacional dos Aparados da Serra, fr., 20 Dec
2004, K. T. Bottega Kerber 35 (PACA). Gramado, 26 Dec 1949, fr., B. Rambo s.n.
(PACA 44994). Guaiba, Fazenda São Maximiano BR 116 Km 308, 17 Sep 2006, fl.,
L.F. Lima sn. (ICN 151442). Muçum, mata ciliar do Rio Taquari, 29º08’02’’S,
51º49’94’’W, fr., 22 Apr 2015, E. Freitas (HVAT 2972); Linha Barra das Contas, 08
Jan 2014, fr., E. Freitas s.n. (HVAT 2972). Quarai, Cerro do Jarau, 03 Dec 2010, fl., fr.,
P. P. A. Ferreira & G. A. Dettke 508 (ICN); Estrada para o Passo do Guarda, 04 Dec
2010, fr., P. P. A. Ferreira & J. Durigon 517 (ICN). Rio Grande, Estação Ecológica do
Taim, Jul 1976, fl., P. L. Oliveira & M. L. Porto s.n. (ICN116291). Rosário do Sul,
Serra do Caverá, 10 Feb 2012, fr., P. P. A. Ferreira et al. 875 (ICN). Santa Maria, fl.,
30 Aug 1997 R. Záchia et al. 2662 (SMDB). São Borja, fl., fr., 14 Set 1996, R. A.
Záchia 2387 (SMDB); Serra da Rocinha, fl., fr., 3 Fev 1953, B. Rambo (PACA53769).
São Borja, Garruchos, 08 Nov 1988, fr., S. M. Nunes et al s.n. (MPUC 8287). São
134
Francisco de Assis, Fazenda Joquim Paz, 26 Nov 2007, fr., E. Freitas 434 (ICN). São
Leopoldo, 1907, fl., F. Theissen s.n. (PACA 7859); Fião, 29 May 1949, fr., B. Rambo
(PACA 41748). São Marcos, Criúva, 26 Nov 2011, fl., P. P. A. Ferreira 442 (ICN). São
Nicolau, Passo do Auto, 26 May 1989, fr., S.M. Nunes et al s.n. (MPUC 8173). Sarandi,
22 May 1977, fr., J. Mattos 17182 (HAS). Vacaria, 1947, fl., fr., B. Rambo (PACA
34979); Passo do Socorro, 27 Dec 1951, fl., fr., B. Rambo s.n. (PACA 51623). —
SANTA CATARINA: Alfredo Wagner, Campo dos Padres, 22 Jan 1957, fl., fr., B.
Rambo s.n. (PACA 60102). Araranguá, Lagoa azul, 12 Dec 2014, fl., L. A. Funez 3638
(FURB). Bocaína do Sul, Serra dos Pessegueiros, 08 Nov 2010, fl., fr., P.P.A. Ferreira et al 415 (ICN). Cerro Negro, rio Tijolos, 16 Dec 2007, fl., Grupo de estudos- reófitas uhbg 2526 (MBM). Chapecó, Guatambú, 15 Oct 1964, fr. L. B. Smith & P.R. R. Reitz
12540 (FLOR, MO, NY). Sombrio, fl., fr., 23 Set 1944, R. Reitz 1224 (PACA). Lages,
07 Nov 2010, fr., P. P. A. Ferreira 406 (ICN). São Joaquim, 21 Sep 2014, fl., E.D.
Lozano 2815 (MBM); Postinho, 09 February 1954, fr., J. Mattos 1277 (HAS). Sombrio para Araranguá, 23 Sep 1944, fl., fr., R. Reitz 1244 (PACA). Urupema, caminho para
Rio Rufino, 08 Nov 2010, fl., P. P. A. Ferreira et al 418 (ICN). SÃO PAULO: Campos do Jordão, 5 May 2012, fr., M. Carvalho-Silva 1229 et al (MA, UB). Itaraé, without date, fr., V.C. Souza et al. 3976 (ESA). Piquete, 7 May 2012, fr., M. Carvalho-Silva
1310 et al (MA, UB). Santo Amaro, Jul 1952, fl., fr., L. Roth s.n. (CESJ85).
Chile.—VALDIVIA. Panguipulli, 160 m. Oct 1927, fl., Werdermann, E. 1906 (NY).
Ecuador. —GALAPAGOS ISLANDS: Isabela Island, Volcano Alcedo, fr., May 1980,
L. Fowler (MO3038900); Isla Santa Cruz, 650 m, fl., fr. 11 Nov 1966, Uno & I.
Eliasson (MO 3751754). —PICHINCHA. Quito, Bosque Protector Pasochoa, 30 km SE de Quito, 78º 28’ W, 0º 27’ S, 2850m. 29 Oct 1988, fr., Naranjo, J.F. 87 (QCA).
135
Kenya.— MARSABIT: Kulal, Gatab, 1740 m, fl., fr., 29 Nov 1978, F. N. Hepper & P.
M. L. Jaeger 7149 (MO).
New Zealand. —NORTH ISLAND: fl., T. Kirk & N. Z. Wellington (US 808814); fl. T.
Kirk & N. Z. Wellington (US 0102882). —RODNEY COUNTY: Flat Top Hill, 36º 35’
30’’ S, 600 m fr., 11 May 1979, R. O. Gardner 2545 (US). —AUCKLAND: Motu Tapu, fr., Feb 1949, F. R. Fosberg 30316 (US); Bay of Islands region, fr. 10 Apr 1949, E. H.
Walker 5372 (US). —WELLINGTON: Pohutukawana forest. 16 Oct 1949, fl., Lush, A s/n (WELT 32674).
Paraguay. —MACIZO ACAHAY: Virgen de Fatima, 26º52’S, 57º 10’O, fr., 16 Nov
1993, T. Florentin Peña et al 1136 (MO).
United States. —ALABAMA: Montgomery Co, sandy right of way by leep by pass. 01
May 1972, fl., fr., Kral, R. 46134 (MO). —CALIFORNIA: Marin co., Keutfield. 19
May 1912, fl., Eastwoodi, A. 24 (MO). —TEXAS: fr., 16 Mar 1956, B. C. Tharp et al
(MBM 103525); Austin, fr., 16 May 1941, B. C. Tharp (MBM 103524); Austin, north of Windson Road, west of Exposition Blvd fr., 6 Jun 1941 B. C. Tharp (MBM 103521);
Austin, fl, 25 Mar 1914, B. C. Tharp (MBM 103524); Austin, vicinity of 2300 block of
Indian trail, fr., 26 May 1941 B. C. Tharp (MBM 103522); Austin, north Bull Creek, fr.,
8 Jun 1941, B. C. Tharp (MBM 103523); Columbia, fr., Apr 1899, B. F. Bush
(MO2644450); Jefferson co., Beaumont, fr., 16 Mar 1918, E. J. Palmer 13087 (MO);
Leon co. 2 miles north of Leona, fr., 8 May 1965, D. S. Correll & J. Crutchfield (MO).
Uruguay. —SALTO: Del puerto de Salto, entre Espinillar y Rio Arapey. 22 Nov 1977, fr., wihout colector (MVFA 14589)
136
CULTIVATED OR WEED
Brazil. —PERNAMBUCO: Recife, Canteiro do Centro de Biociência da Universidade
Federal de Pernambuco, 27 Aug 2015, fl., G. C. Delgado Junior 824 (PEUFR). —
MINAS GERAIS: Belo Horizonte, Rua Maria Dinelli de Menezes, G. C. Delgado
Junior (PEUFR); Caiçara, Jul 1982, fl., R. Coeli F. 4631 (BHCB). Viçosa, Universidade
Federal de Viçosa, 05 Oct 2017, fl., fr., G. Staples et al 1737 (PEUFR, SP). —
PARANA: Curitiba, Jardim Botânico municipal de Curitiba, 2 Nov 1996, fl., J.
Cordeiro & J. M. Cruz 1310 (FLOR, MBM, SJRP); Parque Barigui, 02 Oct 1996, fl., V.
A. de O. Dittrich & C. Koreza 206 (UPCB); Parque Barigui, without date, fl., V. A. de
O. Dittrich, 266 (NY). Parque Naútico, 18 Oct 1987, fl., fr., J.M. Silva 379 (MBM);
Prado Velho, 24 Oct 1983, fl., M. C. G. Flameiro s.n. (HUCP 2135); Prado-PUC, 03
Oct 1984, fl., A. P. Alves 11 (HUCP); PUC, próximo ao rio Belém, 17 Jun 1986, fl., V.
S. Ribeiro s.n. (HUCP 2134); Universidade Federal do Paraná, Centro Politécnico, 10
Oct 1989, fl., A. C. Cervi & O. Guimarães s.n. (BHCB 61273; HUCP 19151, UPCB
19151). Pinhais, Centro Paranaense de Referência em Agroecologia, Jardim Boa Vista,
20 Sep 2009, fl., A. C. L. Miranda & R. Ristow 195 (MBM, IRAI); Parque Newton
Freire Maia, 21 Sep 2009, fl., R. Ristow & A. C. L. Miranda 200 (IRAI, MBM). São
Bento do Sul, Pátio da Assoc. Func. Do SAMAE, 12 Oct 2016, fl., fr., P. Schwirkowski
1965 (FURB). Xanxerê, centro, 17 Dec 2011, fl., fr., L.A. Funez 245 (FURB). —RIO
DE JANEIRO: Rio de Janeiro, Jardim Botânico do Rio de Janeiro, 13 May 1944, fr.,
J.G. Kuhlmann sn. (RB00264138); Canteiro 5D no JBRJ, 22 Jul 2015, fl., J.R. Mattos
147 (RB). —RIO GRANDE DO SUL: Arroio dos Ratos para São Jeronimo, 08 Feb
1942, fl., B. Rambo s.n. (PACA 8449). Bajé, no Km 101, 30 Sep 1982, fl., J. Mattos
24618 (HAS); na rodovia Bajé-Lavras, 12 Nov 1980¸fr., J. Mattos 21645 (HAS); Km
92 da rodovia Caçapava do Sul, 30 Oct 1982, fl., J. Mattos 25648 (HAS); na rodovia
137 para Caçapava do Sul, 02 Sep 1988, fl., N. Silveira 7176 (HAS). Caçapava do Sul, rodovia Caçapava/Bajé, 22 Oct 1986, fr., J. Mattos 30135 (PEUFR, HAS); 30°31’ 26” S
53°35’ 54” O, 11 Oct 2011, fl., J. Dungon 682 (ICN); Cerca de 8 km da BR 290, 15 Oct
1979, fl., fr., J. Mattos 19337 (HAS); rodovia Caçapava/Bajé, 22 Oct 1986, fr., J.
Mattos 30135 (PEUFR, HAS); 30°31’ 26” S 53°35’ 54” O, 11 Oct 2011, fl., J. Dungon
682 (ICN); Cerca de 8 km da BR 290, 15 Oct 1979, fl., fr., J. Mattos 19337 (HAS).
Passo Fundo, a 14 Km da cidade na rodovia para Marau, 28 Oct 1987, fl., fr., N. Silveira
6709 (HAS); Esteio para São Leopoldo, 14 Nov 1955, fl., B. Rambo s.n. (PACA
57110). Guaibá, BR 116, Km 32, fl., N.I. Matzenbacher s.n. (MPUC 16084); Fazenda
São Maximiano, 01 Nov 2010, fr., G.A. Dettke & L.F. Lima 430 (ICN).
Mun. Quaraí, Jan 1945, fl., B. Rambo s.n. (PACA 26157). Porto Alegre, calçada da usina do Gasômetro, 12 Sep 2015, fr., G. C. Delgado Junior 829 (PEUFR); bairro
Ipanema, 31 Dec 1947, fr., B. Rambo s.n. (PACA 37253). bairro de Petrópolis, 09 Aug
1958, fl., O. R. Camargo 83 (PACA); Campus da PUCRS, 16 Sep 1993, fl., S. M. Nunes s.n. (MPUC 8172); Campus central da UFRGS, Bonfim, wihout date, fl., D. B.
Falkenberg 581 (FLOR, ICN, MBM); Jardim botânico da FZB, 17 Nov 1981, fl., fr., O.
Bueno 3324 (HAS); Jardim Botânico da FZB, 28 Sep 1981, fl., O. Bueno 3091 (HAS);
Parque S. Hilaire, 30 Sep 1970, fl., fr., E. Vianna s.n. (ICN 7901); Km 183, rodovia
Porto Alegre- Rosário, 07 Oct 1987, fr., J. Mattos & N. Mattos 31507 (HAS); Vila
Manresa, 25 Aug 1945, fl., B. Rambo s.n. (PACA 29043); Vila Manresa para Porto
Alegre, 22 Sep 1948, fl., B. Rambo s.n. (PACA 37732). São Leopolodo Universidade do
Vale do Rio dos Sinos, 8 Sep 2015, fl., G. C. Delgado Junior 828 (PEUFR); Viamão,
Morro Grande, 21 Oct 1998, fr., S. C. Muller 45 (ICN); Vila Mansa, fr., 19 Nov 1954,
B. Rambo (PACA 56040); fl., 3 Nov 1945, B. Rambo (PACA29208); Vila Oliva, fl., fr.,
31 Dec 1945, B. Rambo (PACA30855). —SANTA CATARINA: Penha, praia da
138 paciência, 14 Jul 2012, fl., L.A. Funez 679 (FURB). —SÃO PAULO: Santos, Canteiro na Av. Dona Costa-Gonzaga, 28 Oct 2015, fr., G. C. Delgado Junior, 835 (PEUFR).
Colombia. —CUDINAMARCA: Mosquera, zona “La Herrera” parte baja del “Zanjón de las Cátedras”. 12 Aug 1986, fr., F. Alonso et al. 6665 (COL). —VALLE: Cali,
Universidad del Valle, fl., fr. 2 Jun 1985, F. A. Silverstone-Sopkin 1982 (MO).
Costa Rica.—CARTAGO: 3 km SE of Cartago, 1200 m, fr., 10 Aug 1967, R. J. Taylor
4243 (MO).
Honduras.—FCO MORAZÁN: Quebrada Seca vicinity of Cerro de Hule near 21 km to
Tegucigalpa, 1300 m, fl., 01 Jan 1990, A. R. Molina & A. R. Molina 34229 (MO).
Paraguay.—CAAZAPA: Tavai-Bosque del hospital, fl., fr., 29 Oct 1988, I. Basualdo
1670 (MO, FCQ). MBATOVI, fl., fr., 6 Jul 1989, I. Basualdo (MO; FCQ). Peru.—
HUANCAYO: Junin, 3317 m, fl., J. Soukup (MO 1591236). —RECUAY: Marca,
Orilla de acequia, 2700 m, fl., fr., 6 Apr. J. Gómez 300 (MO). —TAYACAJA:
Huancavelica, between Izcuchaca and Acostambo, south of Huancayo and north of La
Mejoarada, Km 372 on Carretera Central, 2930 m. 28 Feb 1964, fr., Hutchison, P.C.
4202 (NY)
Tanzania. —TANGANUIKA: Arusha, Arusha National Park, 150ft., fl., fr., 3 Apr
1968, P.J. Greenway & Kanuri 13401(MO).
Salisbury. —RHODESIA, fr., 24 Mar 1953, N. C. Chase 4881 (MO).
South Africa. —TRANSVAAL: Letaba, Gallery forest, disturbed area, fl., fr., 14 Apr
1958, J. C. Seheepers (MO 1771188). Zuurberg Pass, grassland, fl., fr., 20 Oct 1976, R.
D. A. Bayliss 7771 (MO).
139
Figure 1 a—l. Dichondra argentea. a-b. Habit. c-d. Flower. e-f. Calyx. g-h. Corolla (inside, stames attached on the middle part of tube) and outside respectively. i.Ovary and styles equal and subequal. j-l. Fruit schizocarp dehiscent in different shapes. m—v Dichondra brachypoda. m. Habit. n. Abaxial face leave. o-p. Flower. q. Corolla inside. r. Calyx. s. ovary and unequal styles. t-v. Fruit squizocarp dehiscent. w—z. Dichondra brevifolia. w. Ovary and equal styles. x. Habit. y. corolla inside, stames attached on the top of tube. z corolla pilose outside.
140
A B
C D
E F
Figure 2 a—f. Dichondra argentea. a-b. Habit and leaves silvery. c- Flower. d. fruit. e-f. Dichondra argentea as ornamental. (Photo e: google imagens; f: G Staples).
141
A B
C D
E F
G H
Figure 3 a—h. Dichondra brachypoda. a-b. Habit. c-d- Flower. e-h. Fruit in different development
142
Figure 4 a—e. Dichondra nivea. a. Habit. b Flower. c-d Corolla, c-corolla funnel-form; d corolla pilose outside on lobes. e. Calyx. f—m Dichondra occidentalis. f. Habit. g. Corolla. h. ovary i. Calyx. j. Styles with trichomes on base to middle part. k. Corolla inside with stames attache on middle part of tube. l. Flower. n—p. Dichondra repens. Habits.
143
\\\\\\\\\
A B
C D
E F Figure 5. a—b Dichondra brevifolia. a. Habit, flower, and tiny leaves. c—d Dichondra nivea. c. Habit, flower, and silvery leaves. d. Dry flower. e—f Dichondra occidentalis. e. Habit. f. Corolla, leaves sparse pilose and stems sericeous.(Photos: A herbarium WELT; C, E, F iNaturalist.org)
144
Figure 6. a—z. Dichondra repens. a-b. Habits. c-f. Flower, c-e- corolla not ultrapassing calyx, f. corolla ultrapassing calx. g-j. Corola, g-h. stames attached on top of tube, i. Pilose outside, j. Glabrous outside. k-r. calyx. diffents shapes. s-y. Fruits. z. Ovary and styles.
145
Figure 7 a—e Dichondra repens. a-b. Flower and leaves sericeous-pilose. c. Fruit. d. Flower and leaves glabrous. Dichondra argentea as ornamental. (Photo e: google imagens; f: G Staples)
146
D
E
Figure 8 a—f. Dichondra repens. a. Fruit. b. leaves sericeous with canescent abaxial face. c- Flower, corolla not excedding calyx. d. Flower, corolla excedding calyx. e. Fruit. f-g. Flower.
147
Reference
Adams, C.D. 1972. Flowing Plants of Jamaica. Mona, University of the West Indies.
Austin, D.F. 1973. The American Erycibeae (Convolvulaceae). Maripa, Dicranostyles and Lysiostyles. II. Palynology. Pollen et Spores 15: 203–226.
Austin DF (1982) Convolvulaceae. Flora of Equador 15:1–98.
Austin, D. F. 1998. The indiscriminate vector: human distribution of Dichondra
micrantha (Convolvulaceae). Econ. Bot. 52: 88-106.
Austin, D. F. Staples, G. and Simão-Bianchini, R. 2015. A synopsis of Ipomoea (Convolvulaceae) in the Americas: Further corrections, changes, and additions. Taxon 64(3): 625:633.
Buchanan, J. 1871 ("1870"): On some New Species and Varieties of New Zealand Plants. Transactions and Proceedings of the Royal Society of New Zealand 3: 208–212.
Burkat, W.R. 1977. In: Troncoso, N.S. and Bacigalupo, M.N. 1977. Plantas Vasculares Nuevas e interesantes de la Flora de Entre Ríos, III. Darwiniana 21: 177.
Chiarini, F. and Espinar, LA (2006) Flora Fanerogámica Argentina: Convolvulaceae. Proflora: Conicet, Córdoba.
Choisy, J.D. 1833. Convolvulaceae. In A. DeCandolle, Prodromus 9: 323-465.
Delgado-Junior, G.C Staples and G. Buril, M.T. 2018. Typification of species names in
Dichondra (Convolvulaceae). Taxon 67(5): 1020-1023.
Dumortier, B. C. 1829. Analyse des plantes.Paris: Tournay.
Fabris, H. A. 1965. Convolvulaceae, en A. L. Cabrera (ed.), Fl. prov. Buenos Aires 5: 66-
95.
Forster, JR and Forster G. 1776. Characteres generum plantarum, quas m mnere ad insulas
marts Australls, collegerunt, descnpserunt, dehnearunt, anms 1772-1775 London,
B White, T. Cadell, and P. Elmsly cf 40 t 20.
148
Hallier, H. 1893. Vcrsuch einer natfirlichen gliederung der Convolvulaccen auf
morphologischer und anatomischer Gruudlage. Bot. Jahrb. 16: 453-591.
Harris, J.G. and Harris, M.W. 2000. Plant identification terminology: an illustrated
glossary. Spring Lake Publishing, Spring Lake, 197 pp.
Johnson, R.W. Lang, P.J.and Barker, R.M. 2014. Convolvulaceae In: Kellermann, J. (ed) Flora of South Australia, pp.25.
Jussieu, A.L. 1789. Genera Plantarum Secundum Ordines Naturales Disposita. Parisiis, Herissant/Theophilum Barrois.
Lawalrée, A. 1970. Definition, aire et mode de dissemination de Dichondra micrantha Urban (Convolvulaceae). Plant biology 19(5): 717–721.
Lejoly J, & Lisowski S (1993). Les Convolvulaceae dans la flore d’Afrique Centrale (Zaire, Rwanda, Burundi). Fragm Florist Geobot 38: 351–400.
Mattos, N.F. 1976. Novidades taxonomicas em plantas do Brasil II. Loefregnia 70: 3-
Meisner, C.F. 1869. Convolvulaceae. In: Martius, C. P. F & Eichler, A. G (Eds.) Flora Brasiliensis 7: 199–370.
Michaux, A. 1803. Flora boreali-americana: sistens caracteres plantarum quas in America septentrionali collegit et detexit Andreas Michaux. Parisiis et Argentorati: apud fratres Levrault, 330 pp.10.
Nicolson, D. H. and Fosberg, F. R. 2003. The Forsters and the botany of the second Cook expedition (1772--1775). Regnum Vegetabile 139. Königstein: Koeltz Scientific Books.
O'Donell C. A .1957. Convolvulaceas Chilenas. Bot Soc Arg Bo 6:143–184.
O’Donell, C. A. 1959. Convolvulaceas argentinas. Lilloa 29: 87-348.
Oliver, D. 1877. Flora of tropical Africa 3 6 London, L. Reeve and Co.
Persoon, C. H. (1805). Synopsis Plantarum 1. C. F. Cramer, Paris and J. G. Cottam,
Tubingen.
149
Peter, A. 1891. Convolvulaceae. In A. Engler and K. Prantl [eds.] Die Nattirlichen
Pflanzenfamilien. 4:1-40.
Radford, A.E. Dickison, W.C. Massey, J.R. and Bell, C.R. 1974. Vascular Plant
Systematics. Harper & Row Publishers, New York. 891pp.
Spjut, R.W. 1994. A systematic treatment of fruit types. Memoirs of the New York
Botanical Garden, New York.
Stefanovic. S. Krueger, L. and Olmstead, R.G. 2002. Monophyly of the Convolvulaceae and circumscription of their major lineages based on DNA sequences of multiple chloroplast loci. American Journal of Botany 89: 1510–1522.
Stefanovic, S. Austin, D.F. and Olmstead, R.G. 2003. Classification of Convolvulaceae: a phylogenetic approach. Systematic Botany 28: 791–806.
Swartz, O.P. 1788. Nova genera & species plantarum. Holmiae, Upsaliæ & Aboæ: in
bibliopoliis Acad. M. Swederi, Stockholm, 158 pp.
Tharp, B.C. and Johnston, M. C. 1961. Recharacterization of Dichondra (Convolvulaceae) and a revision of the North American species. Brittonia 13: 346–360.
THIERS, B. [Continuously updated]. Index Herbariorum: a global directory of public herbaria and associated staff. New York Botanical Garden's Virtual Herbarium. http://sweetgum.nybg.org/ih/ (last acess 4/02/2012).
Troncoso, N.S. and Bacigalupo, M.N. 1977. Plantas Vasculares Nuevas e interesantes de la Flora de Entre Ríos, III. Darwiniana 21: 177.
Urban, I. 1923. Symbolae Antillanae, seu, Fundamenta florae Indiae Occidentalis 9. Borntraeger, Leipzig, 568 pp.
150
CONSIDERAÇÕES FINAIS
A partir da integração dos estudos palinológico, molecular e morfológico apresentamos um novo panorama da riqueza do gênero Dichondra para o mundo. Um gênero que historicamente variou de 5 a 15 espécies, aqui são consideradas seis espécies claramente delimitadas morfologicamente.
A quantidade de atualizações nomenclaturais e taxonômicas propostas (14 sinônimos e 5 lectotipificações) foi essencial para estabilizar o conceito de Dichondra repens. Uma recirscuncrição foi proposta abrangendo toda variação morfológica dos indivíduos de diferentes habitats. A espécie ocorre ao redor do mundo e exibe caracteres plásticos que variam dentro das populações.
Foi desafiador encontrar características descontínuas para separar as espécies em
Dichondra, sendo necessário desapegar do conceito tipológico de espécie e entender que indivíduos de um mesmo táxon estão em processos diferentes e que o estudo morfológico corresponde a um pequeno recorte da história evolutiva. Por isso, é importante atrelar outras ferramentas para auxiliar nas decisões taxonômicas que melhor reflitam as relações de ancestralidade entre as espécies.
O caso de Dichondra ilustra o risco de descrever novas espécies em
Convolvulaceae baseada em poucas amostras ou em caracteres que sofrem interferência do ambiente, como densidade de tricomas, espessuras de ramos ou largura das folhas. O que historicamente levou uma proliferação de nomes e consequente instabilidade nomenclatural. É urgente que os especialistas invistam esforços na compreensão de até que ponto o ambiente influencia a plasticidade fenotípica das espécies de
Convolvulaceae.
151
Com o estudo palinólogico não foi possível reconhecer grupos dentro
Dichondra, contudo servirá para reconstruir relações evolutivas da família, podendo ser
útil no reconhecimento de sinapomorfias para tribo Dichondreae. Uma das dificuldades para realizar esse estudo foi encontrar anteras férteis e ou grãos de pólens viáveis. A viabilidade polínica e os mecanismos reprodutivos em Dichondra é um campo interessante que pode contribuir com a compreensão do grupo.
A filogenia foi uma ferramenta fundamental na tomada de decisões, visto que corroborou as interpretações morfológicas. É interessante destacar como classificações baseadas na morfologia muitas vezes são coerentes com a história natural dos grupos. A classificação infragenérica de Dichondra proposta com base na morfologia de Tharp &
Johnston (1964) foi corroborada com os dados moleculares, demonstrando que os autores estavam certos sobre a importância do fruto nas relações de ancestralidade entre as espécies. O estudo molecular teve dois grandes empecilhos: 1. Coletar amostras em campo, já que é um gênero que praticamente não ocorre no Brasil. 2. Conseguir amostras de coletas recentes, 80% das exsicatas analisadas são da década passada.
Uma das propostas era o estudo detalhado da formação dos frutos em Dichondra.
Contudo, as populações acompanhadas nos últimos anos não produziram nenhum fruto, o que inviabilizou estabelecer uma terminologia mais precisa. Um estudo ontogenético deve ser conduzido para entender como um mesmo tipo de ovário bilobado, 2-locular, aparentemente sincárpico pode produzir dois diferentes tipos de frutos em espécies próximas.
Por fim, destaca-se a relevância de estudos com plantas ruderais e cultivadas na mesma intensidade que são estudadas aquelas de lugares remotos. É importante entender como essas plantas se espalharam pelo mundo como naturalizadas e/ou ruderais. No estudo molecular foi sugerido uma possibilidade de fluxo gênico ou hibridização das 152 espécies de Dichondra. Até então nunca mencionado na literatura para o gênero. Estudos populacionais e reprodutivos devem ser realizados para entender as relações filogenética sugeridas nessa tese.
153