Characterization of Thiamin Phosphate Kinase in the Hyperthermophilic Archaeon Pyrobaculum Calidifontis

J Nutr Sci Vitaminol, 61, 369–374, 2015

Characterization of Thiamin Phosphate Kinase in the Hyperthermophilic Archaeon Pyrobaculum calidifontis

Maria Hayashi and Kazuto Nosaka*

2nd Department of Biochemistry, School of Pharmacy and Pharmaceutical Sciences, Mukogawa Women’s University, Nishinomiya, Hyogo 663–8179, Japan (Received May 8, 2015)

Summary Thiamin pyrophosphate is an essential cofactor in all living systems. In its biosynthesis, the thiamin structure is initially formed as thiamin phosphate from a thiazole and a pyrimidine moiety, and then thiamin pyrophosphate is synthesized from thiamin phosphate. Many eubacterial cells directly synthesize thiamin pyrophosphate by the phosphorylation of thiamin phosphate by thiamin phosphate kinase (ThiL), whereas this final step occurs in two stages in eukaryotic cells and some eubacterial cells: hydrolysis of thiamin phosphate to free thiamin and its pyrophosphorylation by thiamin pyrophosphokinase. In addition, some eubacteria have thiamin kinase, a salvage enzyme that converts the incorporated thiamin from the environment to thiamin phosphate. This final step in thiamin biosynthesis has never been experimentally investigated in archaea, although the putative thiL genes are found in their genome database. In this study, we observed thiamin phosphate kinase activity in the soluble fraction of the hyperthermophilic archaeon Pyrobaculum calidifontis. On the other hand, neither thiamin pyrophosphokinase nor thiamin kinase activity was detected, suggesting that in this archaeon the phosphorylation of thiamin phosphate is only way to synthesize thiamin pyrophosphate and it cannot use exogenous thiamin for the salvage synthesis of thiamin pyrophosphate. We also investigated the kinetic properties of thiamin phosphate kinase activity using the recombinant ThiL protein from P. calidifontis. Furthermore, the results obtained by site-directed mutagenesis suggest that the Ser196 of ThiL protein plays a pivotal role in the catalytic process. Key Words thiamin phosphate kinase, thiamin pyrophosphate, thiamin synthesis, ThiL, Pyrobaculum calidifontis

Thiamin, also known as vitamin B1, occurs in cells archaea (5, 6). Then the final product TPP is synthe- as free thiamin and as its phosphate esters, thiamin sized from TP in the de novo pathway (Fig. 1). Many phosphate (TP), thiamin pyrophosphate (TPP) and eubacterial cells synthesize TPP by the phosphoryla- thiamin triphosphate (1). TPP is a cofactor for many tion of TP in the presence of ATP and Mg21 by thiamin enzymes indispensable for glucose and energy metabo- phosphate kinase (TP kinase, ThiL, EC 2.7.4.16) (7). In lism, including pyruvate dehydrogenase, 2-oxogluta- eukaryotic cells and some eubacterial cells, this final rate dehydrogenase and transketolase. Thiamin con- step occurs in two stages: hydrolysis to free thiamin and sists of 2-methyl-4-amino-5-hydroxymethylpyrimidine its pyrophosphorylation by thiamin pyrophosphokinase (hydroxymethylpyrimidine, HMP) and 4-methyl-5-b- (yeast THI80) (8). In addition, most organisms have hydroxyethylthiazole (hydroxyethylthiazole, HET). The kinases involved in the salvage of thiamin and its com- de novo pathway of thiamin biosynthesis involves the ponents from the environment. The HET is converted to independent formation of HMP pyrophosphate (HMP- HET-P by HET kinase (ThiM) and the HMP is converted PP) and HET phosphate (HET-P), as well as their sub- to HMP-PP by HMP kinase/HMP-P kinase (ThiD). In sequent condensation to form TP by thiamin phosphate bacteria such as Escherichia coli and Serratia sp., whose synthase common in all organisms (2–4). In eubacteria TPP is synthesized from TP by TP kinase, incorporated and eukaryotes, ThiE protein and its orthologs play the thiamin is converted to TP by thiamin kinase (ThiK) (9). role of thiamin phosphate synthase, whereas ThiN pro- On the other hand, organisms having thiamin pyro- tein acts as the catalyst of the same reaction in most phosphokinase synthesize TPP from external thiamin by direct pyrophosphorylation.

* To whom correspondence should be addressed. Thiamin biosynthesis in archaea is poorly under- E-mail: [email protected] stood and there seems to be no published literature Abbreviations: HET, 4-methyl-5-b-hydroxyethylthiazole; about TPP production from TP. However, the putative HMP, 2-methyl-4-amino-5-hydroxymethylpyrimidine; TP, thi- TP kinase genes (thiL) are found in the genome database amin phosphate; TPP, thiamin pyrophosphate. of archaea and the thiamin pyrophosphokinase gene

369 370 Hayashi M and Nosaka K

Fig. 1. The later steps in the biosynthesis of thiamin. Genes are indicated in italics. Dashed arrows indicate salvage reaction. Abbreviations are as defined in the text.

Fig. 2. Sequence alignment of randomly selected ThiL protein. Amino acid sequences of ThiL proteins from four eubacteria, Aquifex aeolicus (WP_010881388), Bacillus subtilis (WP_003225704), Escherichia coli (WP_001725779), and Ther- mus thermophilus (WP_011227924), and three archaea, Haloferax elongans (WP_008326801), Methanosarcina barkeri (WP_011306051), and Pyrobaculum calidifontis (WP_011849341), were aligned using the ClustalW program (http:// clustalw.ddbj.nig.ac.jp/). Residues identical in all sequences are highlighted in black and similar residues are highlighted in gray. Residues that were altered by site-directed mutagenesis in this study are indicated by asterisks.

(THI80) seems to be restricted to eukaryotes and eubac- is reported to be hardly ever obtained. This structural teria (10). A multiple sequence alignment of several biology study suggested that TP kinase utilizes direct putative ThiL proteins is shown in Fig. 2. The proteins in transfer of the g-phosphate of ATP to TP rather than Fig. 2 share 20–30% sequence identity with each other, a phosphorylated enzyme intermediate, and that the and there are significant amino acid identities among all binding of ATP with the active site precedes the binding 7 sequences. McCulloch et al. (11) analyzed the crystal of TP in the catalytic process. In this study, we con structure of Aquifex aeolicus ThiL (AaThiL) with non- firmed experimentally that TPP of the hyperthermo- hydrolyzable b,g-methylene adenosine 5′-diphosphate philic archaeon Pyrobaculum calidifontis is formed by (AMP-PCP) and TP, and with the products of the reac- the phosphorylation of TP, isolated the thiL gene from tion, ADP and TPP. The g-phosphate of ATP is located this species, and carried out the enzymatic character- at a distance of only 2.7 Å away from the b-phosphate ization of the recombinant ThiL protein (PcThiL). We of TPP. They also prepared AaThiL crystals complexed also demonstrated using site-directed mutant proteins with AMP-PCP or ATP, but a binary complex with TMP that the two amino acid residues (Arg136 and Ser196) Archaeal Thiamin Phosphate Kinase 371 conserved in PcThiL are involved in the interaction with 10 mL of solution L (50 mm Na2HPO4 pH 7.5, 300 mm substrates or the catalytic reaction. NaCl) containing 20 mm imidazole, 1 mm phenylmethylsulfonyl fluoride and 10 mL/mL Protease Inhibitor MATERIALS AND METHODS Cocktail for Histidine-Tagged Proteins (Sigma P8849, Plasmids and chemicals. The intact coding sequence Sigma-Aldrich), and sonicated 4 times in ice-cold water of P. calidifontis thiL was PCR-amplified from the genomic using a Bioruptor (Cosmo Bio, Tokyo, Japan) at 200 W DNA using specific primers, ATGACGATAAGGATCCGAT- for 30 s each with a 120 s interval. All subsequent steps GTCTGGCTTTGGGGGC and AGCTGCAGATCTCGAGTCA- were carried out at room temperature. Cell debris was CCCCCACCCGCG (nucleotides in italics are the sequence removed by centrifugation at 14,000 3g for 20 min, of the vector), and then the fragment obtained was sub- and the supernatant was applied to 1 mL of bed vol- cloned into pRSET B (Invitrogen, Carlsbad, CA) using an ume of TALON Metal Affinity Resin (Clontech, Moun- In-Fusion® HD Cloning Kit (Takara Bio, Otsu, Japan). tain View, CA) equilibrated with solution L containing The resultant plasmid pRSET-ThiL was used to express 20 mm imidazole. After being washed with 20 mL of the and purify the protein. Plasmids pRSET-ThiL-R136M same solution, the purified protein was eluted with solu- and -S196A to express the mutant ThiL proteins were tion L containing 125 mm imidazole. Combined eluted made using a PrimeSTAR® Mutagenesis Basal Kit fractions (3 mL) were concentrated to about 0.5 mL dur- (Takara Bio) with pRSET-ThiL as a template. The prim- ing exchange of the buffer to 50 mm Tris-HCl, pH 7.5, ers used to generate point mutations are GTGGGGATG- by ultrafiltration using Amicon Ultra 4 (10 kDa cut-off, GCGCCCCGCCCCGGCGACGTCCTT (nucleotide in italics Millipore, Billerica, MA). is mutated) and GGGCGCCATCCCCACACGCGCCCGC- Enzyme assay. The TP kinase activity was assessed GCCCACCC for the R136M mutant, and GGACTCCGC- by determining the increase in the amount of reaction CGACGGCCTTGGCGACGTCCTGTGG and CCGTCGGC- product, TPP. In the standard assay, 80 mL of a mixture GGAGTCCATGGCTGCAGTCACACACT for the S196A containing 50 mm Tris-HCl, pH 7.0, 10 mm TP, 1.0 mm mutant. All of the plasmids were verified to have been ATP, 10 mm MgCl2 and enzyme source was incubated at constructed correctly by sequencing using an ABI Prism 100˚C. The reaction was stopped by placing the tube on 377 DNA sequencer (Applied Biosystems, Waltham, crushed dry ice. The amount of TPP in the reaction solu- MA). Thiamin hydrochloride, TP chloride and TPP chlo- tion was determined by HPLC after conversion to thio- ride were purchased from Nacalai Tesque, Inc. (Kyoto, chrome by alkaline oxidation with cyanogen bromide, Japan). All other chemicals were of analytical grade. as described previously (12). When the phosphorylation Strains and media. P. calidifontis JCM 11548 was used of thiamin or TP in the cell-free extract was assessed, to prepare the cell-free extract and the genomic DNA. the reaction mixture contained 50 mm Tris-HCl, pH 7.5, P. calidifontis was cultured in 1 L Erlenmeyer flasks in 1.0 mm ATP, 10 mm MgCl2, 1.0 mm dithiothreitol, medium (300 mL, pH 7.0, adjusted with NaOH) con- enzyme source and 10 mm precursor in a final volume taining 10 g/L tryptone, 1 g/L yeast extract and 3 g/L of 50 mL. The amount of thiamin phosphoesters in the Na2S2O3·5H2O at 90˚C under aerobic conditions. E. coli reaction solution was determined by HPLC as above. strains DH5a and BL21(DE3) codon plus RIL (Strata- RESULTS AND DISCUSSION gene, La Jolla, CA) were used to amplify plasmids and express the recombinant protein, respectively. TPP synthesis by cell-free extract of P. calidifontis Preparation of cell-free extract. P. calidifontis cells were To confirm that in archaea, as in eubacteria, TPP is grown for 24 h in 600 mL of medium. The cells were formed from TP directly, we first investigated whether suspended in 4.5 mL of 50 mm Na2HPO4, pH 7.5, con- TPP is produced by the incubation of TP with ATP, taining 300 mm NaCl, 1 mm phenylmethylsulfonyl fluo- MgCl2 and cell-free extract of P. calidifontis. After incu- ride (PMSF) and 10 mL/mL Protease Inhibitor Cocktail bation at 100˚C for 5 min, TPP was detected in the for Bacterial Cells (Sigma P8465, Sigma-Aldrich, St. reaction mixture and its level increased with time up to Louis, MO), and disrupted by ultrasonication on ice. 60 min (Fig. 3), suggesting that TP kinase is present in After centrifugation at 10,000 3g for 20 min to remove the cell-free extract of P. calidifontis. On the other hand, any remaining intact cells and the cell debris, the super- when thiamin was used as the substrate instead of TP, natant (about 3 mL) was dialyzed twice against 1.5 L of neither TPP nor TP was detected within the same time. the same buffer at room temperature. The prepared cell- Thus, the phosphorylation of thiamin did not take place free extract was stored at 220˚C after adding an equal in this biochemical experiment. From this finding and volume of glycerol. the apparent absence of the thiamin pyrophosphoki- Purification of recombinant proteins. The pRSET- nase gene (THI80) and the thiamin kinase gene (thiK) in based plasmids were transformed into E. coli strain the genome, it is highly likely that the phosphorylation BL21(DE3) codon plus RIL. Bacterial cells were grown of TP by TP kinase is the only way to synthesize TPP and overnight at 37˚C in 10 mL of LB medium containing the salvage enzymes converting TPP or TP from thia- 50 mg/mL ampicillin, pelleted and grown for 3 h in min are lacking in P. calidifontis. Although P. calidifontis 100 mL of fresh medium. The cells were further shaken contains an ABC transport system (ThiBPQ) ortholog, at 37˚C for 1 h with 0.5 mm isopropyl-b-d-thiogalac- which is used for the active transport of thiamin and its topyranoside to induce expression of the recombinant phosphoesters in enteric bacteria (13), this hyperther- protein. The cells were then pelleted and resuspended in mophilic archaeon appears not to reuse external thia- 372 Hayashi M and Nosaka K

Fig. 3. Thiamin pyrophosphate (TPP) synthesis from Fig. 5. Effect of temperature and substrates on the thiamin phosphate (TP) or thiamin by the cell-free stability of PcThiL. The enzyme mixture contain- extract of Pyrobaculum calidifontis. The reaction mixture ing 50 mm Tris-HCl, pH 7.0, and 10 mm MgCl2 in the and the assay procedure are described in “Materials and absence (closed circle) or presence of substrate (open Methods” using 30 mg of protein. The control values circle, 10 mm TP; closed diamond, 1.0 mm ATP) was obtained in the absence of substrates were subtracted. preincubated at 100˚C for the indicated time. Since the The amounts of thiamin phosphate in the reaction thiamin structure is readily hydrolyzed into the pyrimi- mixture (50 mL) are shown. Each value is the mean dine and thiazole moieties at high temperatures, every from two experiments. Symbols indicate the following reaction was started by the addition of both substrates. combinations of substrate and product: closed circle, The activity upon 2 min preincubation is indicated as TPP from TP; open circle, TPP from thiamin; closed dia- 100%. mond, TP from thiamin.

histidine tag at the N-terminus in E. coli and purified. The PcThiL protein was readily expressed in the soluble fraction, and about 30 mg of the recombinant protein could be purified from 100 mL of culture. The migration of PcThiL polypeptide corresponding to 34 kDa in SDS/ PAGE gels was consistent with the calculated value (Fig. 4). The relative molecular mass of PcThiL determined by size-exclusion chromatography was estimated to be about 66,000 (data not shown), suggesting that the native enzyme has a homodimeric structure. Then, the TPP synthesis ability of the recombinant PcThiL protein was assessed using thiamin or TP as the substrate under standard conditions. When TP, not thiamin, was used as the substrate, the TPP content increased with time, indi- cating that PcThiL can catalyze the TP kinase reaction (data not shown). Fig. 4. SDS-PAGE analysis of the purified proteins. Characterization of TP kinase activity of PcThiL Purified fractions (1 mg of protein) of histidine-tagged The thermostability of the recombinant PcThiL pro- PcThiL (lane 2), PcThiL-R136M (lane 3) and PcThiL- tein was examined (Fig. 5). Unexpectedly, the recombi- S196A (lane 4) were analyzed using 10% SDS-PAGE nant ThiL protein was found to be unstable so that the followed by Coomassie blue staining. Lane 1 shows the protein lost about 45% of its activity after heating for molecular standard proteins (Bio-Rad). 15 min at 100˚C. With heat treatment at 100˚C for 1 h, the enzyme retained only about 20% of its activity. However, the enzyme was not so intensely inactivated min for TPP synthesis. We recently reported that HET in the presence of ATP at 100˚C, suggesting that the kinase (ThiM), another salvage enzyme, is also lacking proper folding of PcThiL was maintained by the interac- in P. calidifontis (6). Since thiamin is chemically labile, tions with ATP under high-temperature conditions. On especially in a high-temperature environment, and a the other hand, the effect of TP on the thermostability pyrimidine moiety is generally more stable than a thia- of PcThiL was only modest. The addition of 0.5 m NaCl zole one (14), it seems likely that the salvage enzyme for or 0.5 m KCl to the enzyme solution did not improve the only the HMP moiety derived from thiamin degradation thermostability. has evolved in this hyperthermophilic archaeon. The TP kinase activity of the PcThiL protein increased TPP synthesis ability of recombinant histidine-tagged with an increase in temperature from 80 to 120˚C, and PcThiL the highest activity was observed at 120˚C (data not In order to investigate whether TP kinase of archaea shown). The activities at 100˚C and 80˚C were about is coded by the thiL gene, we cloned the homolog gene 50% and 10% of that at 120˚C, respectively. The opti- from P. calidifontis genomic DNA (GenBank: CP000561), mum pH was around 7.0, and the activity at pH 8.0 and PcThiL (293 amino acids) was expressed with a retained about 90% of the highest activity (data not Archaeal Thiamin Phosphate Kinase 373

Fig. 6. Inhibition patterns of thiamin phosphate (TP) kinase activity by AMP. The activity was determined with 0.06 mg of the purified PcThiL in 80 mL of solution containing 50 mm Tris-HCl, pH 7.0, and 10 mm MgCl2 in the absence (closed circle) or presence of 1.0 mm AMP (open circle). (a) Double-reciprocal plots of the initial velocity versus the TP concentration at a constant concentration of ATP (1.0 mm). (b) Double-reciprocal plots of the initial velocity versus the ATP concentration at a constant concentration of TP (10 mm).

Table 1. Kinetic parameters for wild-type and mutant Among the tested compounds, only AMP, but not its PcThiL proteins. product, inhibited the activity by 40% at a concentration of 1.0 mm. As it was found that the mode of AMP k K TP K ATP k /K TP k /K ATP TP Enzyme cat m m cat m cat m inhibition is uncompetitive for both TP (Ki : 560 mm) (s21) (mm) (mm) (s21 m21) (s21 m21) ATP and ATP (Ki : 530 mm) (Fig. 6), AMP may bind to PcThiL when the complex between the enzyme and the 5 3 Wild-type 0.063 0.20 39 3.2310 1.6310 substrate is formed, although the exact reason for the R136M 0.092 1.3 280 3 4 3 2 6.8 10 3.3 10 effect of AMP has not yet been clarified. On the other S196A 0.0060 0.043 0.13 1.43105 4.63104 hand, HMP and HET phosphate inhibited the activity by

The catalytic constant kcat was calculated using the equa- only 10%, and the influence of the presence of thiamin tion kcat5Vmax/[PcThiL monomer]. Each value is the and ADP was barely observed, suggesting that PcThiL mean from two experiments. strictly recognizes the thiamin structure with a mono- phosphoric acid ester. Mutational studies shown). In contrast to E. coli TP kinase, whose activity From the crystal structure of A. aeolicus ThiL protein is activated by about fivefold in the presence of 0.33 m (AaThiL), the two residues in the active site of AaThiL K1 (15), the activity of PcThiL was neither activated nor seem to participate directly in the catalysis (11): the inhibited by K1 at concentrations from 0.1 m to 0.5 m. It b-phosphate group of ADP is hydrogen-bonded to one is noted that the thiamin structure is readily hydrolyzed h-nitrogen atom of the guanidinium group of Arg142 into HMP and HET at high temperatures, and it was and the b-phosphate group of TPP is hydrogen-bonded hard to accurately determine the TP kinase activity at to the side-chain hydroxyl oxygen atom of Ser209. 120˚C. Therefore, in the following experiments, we mea- In addition, Ser209 can donate a hydrogen bond to sured the TP kinase activity at 100˚C and pH 7.0 in the the g-phosphate of ATP. Both amino acid residues are presence of 10 mm TP, 1.0 mm ATP and 10 mm Mg21, strictly conserved in ThiL proteins of eubacterial and under which conditions the specific activity of this frac- archaeal species (Fig. 2). We began a site-directed mutation was 108 mmol TPP formed mg21 min21, which was genesis approach by targeting Arg136 and Ser196 of about half the activity of the native TP kinase purified PcThiL, which correspond to Arg142 and Ser209 of from E. coli cells (15). AaThiL, to examine their contributions to the catalytic Steady-state kinetic studies of PcThiL illustrated that function of TP kinase. Both the mutant proteins comi- the dependences of the initial reaction rate on TP (in grated with the wild-type protein in both SDS/PAGE the range of 0.10–2.0 mm) and ATP concentrations gels (Fig. 4) and size-exclusion chromatography (data (20–500 mm) were both hyperbolic. The calculated Km not shown), suggesting that none of the amino acid values for TP and ATP from the secondary plots (Fig. 6) residues introduced with a mutation is essential for the were 0.20 mm and 39 mm, respectively (Table 1). These dimer formation of the PcThiL polypeptide. The steady- TP ATP Km and Km values were about 6 and 7 times lower state kinetic parameters of the purified mutant enzymes TP ATP than that of E. coli TP kinase (Km : 1.1 mm, Km : were determined and compared with those of the wild- 270 mm), respectively (15). type PcThiL (Table 1). When Arg136 was replaced by ATP The inhibitory effects of several compounds includ- a methionine (R136M), the kcat/Km value was 20% ing thiamin and its precursors (HMP, HET and HET of that of the wild-type enzyme owing to a significant ATP phosphate), as well as the nucleotides (ADP and AMP), increase in the Km value although the kcat value was on the TP kinase activity of PcThiL were investigated. also increased by 1.5-fold compared with that in the 374 Hayashi M and Nosaka K wild type. This finding is compatible with the observa- 2014. Enzymatic and structural characterization of an tion in the structural analysis that Arg142 of AaThiL archaeal thiamin phosphate synthase. Biochim Biophys is involved in the interaction with ATP. As for the other Acta 1844: 803–809. mutant (S196A), the activity (the k value) fell to 10% 7) Webb E, Downs D. 1997. Characterization of thiL, cat encoding thiamin-monophosphate kinase, in Salmonella of that of the wild-type enzyme. This finding suggested typhimurium. J Biol Chem 272: 15702–15707. that Ser196 of PcThiL is critical for TP kinase activity. 8) Nosaka K, Kaneko Y, Nishimura H, Iwashima A. 1993. However, since the replacement of Ser196 with Ala Isolation and characterization of a thiamin pyrophos- ATP caused a 30-fold increase in kcat/Km , it is unlikely phokinase gene, THI80, from Saccharomyces cerevisiae. J that Ser196 participates in the dephosphorylation of Biol Chem 268: 17440–17447. the g-phosphate of ATP. We also assume that the phos- 9) Melnick J, Lis E, Park JH, Kinsland C, Mori H, Baba T, phorylation of Ser196 in order to become the phospho- Perkins J, Schyns G, Vassieva O, Osterman A, Begley TP. enzyme intermediate may not take place during the 2004. Identification of the two missing bacterial genes catalytic process because the TP kinase activity was not involved in thiamine salvage: thiamine pyrophosphoki- completely inactivated by the replacement of Ser196 by nase and thiamine kinase. J Bacteriol 186: 3660–3662. a nonphosphorylatable amino acid. Further molecular 10) Rodionov DA, Vitreschak AG, Mironov AA, Gelfand MS. 2002. Comparative genomics of thiamin biosynthesis in and chemical investigations are necessary to clarify the procaryotes. J Biol Chem 277: 48949–48959. role of Ser196 in the catalytic mechanism of the TP 11) McCulloch KM, Kinsland C, Begley TP, Ealick SE. 2008. kinase activity. Structural studies of thiamin monophosphate kinase in complex with substrates and products. Biochemistry 47: Acknowledgments 3810–3821. This work was supported in part by a research grant 12) Onozuka M, Konno H, Kawasaki Y, Akaji K, Nosaka from the Vitamin B Research Committee of Japan. K. 2008. Involvement of thiaminase II encoded by the THI20 gene in thiamin salvage of Saccharomyces cerevi- REFERENCES siae. FEMS Yeast Res 8: 266–275. 1) Friedrich W. 1988. Vitamins. Walter de Gruyter, Berlin. 13) Webb E, Claas K, Downs D. 1998. thiBPQ encodes an 2) Nosaka K. 2006. Recent progress in understanding thia- ABC transporter required for transport of thiamine and min biosynthesis and its genetic regulation in Saccharo- thiamine pyrophosphate in Salmonella typhimurium. J myces cerevisiae. Appl Microbiol Biotechnol 72: 30–40. Biol Chem 273: 8946–8950. 3) Jurgenson CT, Begley TP, Ealick SE. 2009. The structural 14) Zallot R, Yazdani M, Goyer A, Ziemak MJ, Guan JC, and biochemical foundations of thiamin biosynthesis. McCarty DR, de Crécy-Lagard V, Gerdes S, Garrett TJ, Annu Rev Biochem 78: 569–603. Benach J, Hunt JF, Shintani DK, Hanson AD. 2014. Sal- 4) Goyer A. 2010. Thiamine in plants: Aspects of its metab- vage of the thiamin pyrimidine moiety by plant TenA olism and functions. Phytochemistry 71: 1615–1624. proteins lacking an active-site cysteine. Biochem J 463: 5) Morett E, Korbel JO, Rajan E, Saab-Rincon G, Olvera L, 145–155. Olvera M, Schmidt S, Snel B, Bork P. 2003. Systematic 15) Nishino H. 1972. Biogenesis of cocarboxylase in Esch- discovery of analogous enzymes in thiamin biosynthe- erichia coli. Partial purification and some properties sis. Nat Biotechnol 21: 790–795. of thiamine monophosphate kinase. J Biochem 72: 6) Hayashi M, Kobayashi K, Esaki H, Konno H, Akaji 1093–1100. K, Tazuya K, Yamada K, Nakabayashi T, Nosaka K.