DOCSLIB.ORG

Characterization of Thiamin Phosphate Kinase in the Hyperthermophilic Archaeon Pyrobaculum Calidifontis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of Thiamin Phosphate Kinase in the Hyperthermophilic Archaeon Pyrobaculum Calidifontis J Nutr Sci Vitaminol, 61, 369–374, 2015 Characterization of Thiamin Phosphate Kinase in the Hyperthermophilic Archaeon Pyrobaculum calidifontis Maria HAYASHI and Kazuto NOSAKA* 2nd Department of Biochemistry, School of Pharmacy and Pharmaceutical Sciences, Mukogawa Women’s University, Nishinomiya, Hyogo 663–8179, Japan (Received May 8, 2015) Summary Thiamin pyrophosphate is an essential cofactor in all living systems. In its biosynthesis, the thiamin structure is initially formed as thiamin phosphate from a thia- zole and a pyrimidine moiety, and then thiamin pyrophosphate is synthesized from thia- min phosphate. Many eubacterial cells directly synthesize thiamin pyrophosphate by the phosphorylation of thiamin phosphate by thiamin phosphate kinase (ThiL), whereas this final step occurs in two stages in eukaryotic cells and some eubacterial cells: hydrolysis of thiamin phosphate to free thiamin and its pyrophosphorylation by thiamin pyrophosphoki- nase. In addition, some eubacteria have thiamin kinase, a salvage enzyme that converts the incorporated thiamin from the environment to thiamin phosphate. This final step in thiamin biosynthesis has never been experimentally investigated in archaea, although the putative thiL genes are found in their genome database. In this study, we observed thiamin phosphate kinase activity in the soluble fraction of the hyperthermophilic archaeon Pyrobaculum calidi- fontis. On the other hand, neither thiamin pyrophosphokinase nor thiamin kinase activity was detected, suggesting that in this archaeon the phosphorylation of thiamin phosphate is only way to synthesize thiamin pyrophosphate and it cannot use exogenous thiamin for the salvage synthesis of thiamin pyrophosphate. We also investigated the kinetic properties of thiamin phosphate kinase activity using the recombinant ThiL protein from P. calidifontis. Furthermore, the results obtained by site-directed mutagenesis suggest that the Ser196 of ThiL protein plays a pivotal role in the catalytic process. Key Words thiamin phosphate kinase, thiamin pyrophosphate, thiamin synthesis, ThiL, Pyrobaculum calidifontis Thiamin, also known as vitamin B1, occurs in cells archaea (5, 6). Then the final product TPP is synthe- as free thiamin and as its phosphate esters, thiamin sized from TP in the de novo pathway (Fig. 1). Many phosphate (TP), thiamin pyrophosphate (TPP) and eubacterial cells synthesize TPP by the phosphoryla- thiamin triphosphate (1). TPP is a cofactor for many tion of TP in the presence of ATP and Mg21 by thiamin enzymes indispensable for glucose and energy metabo- phosphate kinase (TP kinase, ThiL, EC 2.7.4.16) (7). In lism, including pyruvate dehydrogenase, 2-oxogluta- eukaryotic cells and some eubacterial cells, this final rate dehydrogenase and transketolase. Thiamin con- step occurs in two stages: hydrolysis to free thiamin and sists of 2-methyl-4-amino-5-hydroxymethylpyrimidine its pyrophosphorylation by thiamin pyrophosphokinase (hydroxymethylpyrimidine, HMP) and 4-methyl-5-b- (yeast THI80) (8). In addition, most organisms have hydroxyethylthiazole (hydroxyethylthiazole, HET). The kinases involved in the salvage of thiamin and its com- de novo pathway of thiamin biosynthesis involves the ponents from the environment. The HET is converted to independent formation of HMP pyrophosphate (HMP- HET-P by HET kinase (ThiM) and the HMP is converted PP) and HET phosphate (HET-P), as well as their sub- to HMP-PP by HMP kinase/HMP-P kinase (ThiD). In sequent condensation to form TP by thiamin phosphate bacteria such as Escherichia coli and Serratia sp., whose synthase common in all organisms (2–4). In eubacteria TPP is synthesized from TP by TP kinase, incorporated and eukaryotes, ThiE protein and its orthologs play the thiamin is converted to TP by thiamin kinase (ThiK) (9). role of thiamin phosphate synthase, whereas ThiN pro- On the other hand, organisms having thiamin pyro- tein acts as the catalyst of the same reaction in most phosphokinase synthesize TPP from external thiamin by direct pyrophosphorylation. * To whom correspondence should be addressed. Thiamin biosynthesis in archaea is poorly under- E-mail: [email protected] stood and there seems to be no published literature Abbreviations: HET, 4-methyl-5-b-hydroxyethylthiazole; about TPP production from TP. However, the putative HMP, 2-methyl-4-amino-5-hydroxymethylpyrimidine; TP, thi- TP kinase genes (thiL) are found in the genome database amin phosphate; TPP, thiamin pyrophosphate. of archaea and the thiamin pyrophosphokinase gene 369 370 HAYASHI M and NOSAKA K Fig. 1. The later steps in the biosynthesis of thiamin. Genes are indicated in italics. Dashed arrows indicate salvage reac- tion. Abbreviations are as defined in the text. Fig. 2. Sequence alignment of randomly selected ThiL protein. Amino acid sequences of ThiL proteins from four eubacte- ria, Aquifex aeolicus (WP_010881388), Bacillus subtilis (WP_003225704), Escherichia coli (WP_001725779), and Ther- mus thermophilus (WP_011227924), and three archaea, Haloferax elongans (WP_008326801), Methanosarcina barkeri (WP_011306051), and Pyrobaculum calidifontis (WP_011849341), were aligned using the ClustalW program (http:// clustalw.ddbj.nig.ac.jp/). Residues identical in all sequences are highlighted in black and similar residues are highlighted in gray. Residues that were altered by site-directed mutagenesis in this study are indicated by asterisks. (THI80) seems to be restricted to eukaryotes and eubac- is reported to be hardly ever obtained. This structural teria (10). A multiple sequence alignment of several biology study suggested that TP kinase utilizes direct putative ThiL proteins is shown in Fig. 2. The proteins in transfer of the g-phosphate of ATP to TP rather than Fig. 2 share 20–30% sequence identity with each other, a phosphorylated enzyme intermediate, and that the and there are significant amino acid identities among all binding of ATP with the active site precedes the binding 7 sequences. McCulloch et al. (11) analyzed the crystal of TP in the catalytic process. In this study, we con- structure of Aquifex aeolicus ThiL (AaThiL) with non- firmed experimentally that TPP of the hyperthermo- hydrolyzable b,g-methylene adenosine 5′-diphosphate philic archaeon Pyrobaculum calidifontis is formed by (AMP-PCP) and TP, and with the products of the reac- the phosphorylation of TP, isolated the thiL gene from tion, ADP and TPP. The g-phosphate of ATP is located this species, and carried out the enzymatic character- at a distance of only 2.7 Å away from the b-phosphate ization of the recombinant ThiL protein (PcThiL). We of TPP. They also prepared AaThiL crystals complexed also demonstrated using site-directed mutant proteins with AMP-PCP or ATP, but a binary complex with TMP that the two amino acid residues (Arg136 and Ser196) Archaeal Thiamin Phosphate Kinase 371 conserved in PcThiL are involved in the interaction with 10 mL of solution L (50 mM Na2HPO4 pH 7.5, 300 mM substrates or the catalytic reaction. NaCl) containing 20 mM imidazole, 1 mM phenylmeth- ylsulfonyl fluoride and 10 mL/mL Protease Inhibitor MATERIALS AND METHODS Cocktail for Histidine-Tagged Proteins (Sigma P8849, Plasmids and chemicals. The intact coding sequence Sigma-Aldrich), and sonicated 4 times in ice-cold water of P. calidifontis thiL was PCR-amplified from the genomic using a Bioruptor (Cosmo Bio, Tokyo, Japan) at 200 W DNA using specific primers, ATGACGATAAGGATCCGAT- for 30 s each with a 120 s interval. All subsequent steps GTCTGGCTTTGGGGGC and AGCTGCAGATCTCGAGTCA- were carried out at room temperature. Cell debris was CCCCCACCCGCG (nucleotides in italics are the sequence removed by centrifugation at 14,000 3g for 20 min, of the vector), and then the fragment obtained was sub- and the supernatant was applied to 1 mL of bed vol- cloned into pRSET B (Invitrogen, Carlsbad, CA) using an ume of TALON Metal Affinity Resin (Clontech, Moun- In-Fusion® HD Cloning Kit (Takara Bio, Otsu, Japan). tain View, CA) equilibrated with solution L containing The resultant plasmid pRSET-ThiL was used to express 20 mM imidazole. After being washed with 20 mL of the and purify the protein. Plasmids pRSET-ThiL-R136M same solution, the purified protein was eluted with solu- and -S196A to express the mutant ThiL proteins were tion L containing 125 mM imidazole. Combined eluted made using a PrimeSTAR® Mutagenesis Basal Kit fractions (3 mL) were concentrated to about 0.5 mL dur- (Takara Bio) with pRSET-ThiL as a template. The prim- ing exchange of the buffer to 50 mM Tris-HCl, pH 7.5, ers used to generate point mutations are GTGGGGATG- by ultrafiltration using Amicon Ultra 4 (10 kDa cut-off, GCGCCCCGCCCCGGCGACGTCCTT (nucleotide in italics Millipore, Billerica, MA). is mutated) and GGGCGCCATCCCCACACGCGCCCGC- Enzyme assay. The TP kinase activity was assessed GCCCACCC for the R136M mutant, and GGACTCCGC- by determining the increase in the amount of reaction CGACGGCCTTGGCGACGTCCTGTGG and CCGTCGGC- product, TPP. In the standard assay, 80 mL of a mixture GGAGTCCATGGCTGCAGTCACACACT for the S196A containing 50 mM Tris-HCl, pH 7.0, 10 mM TP, 1.0 mM mutant. All of the plasmids were verified to have been ATP, 10 mM MgCl2 and enzyme source was incubated at constructed correctly by sequencing using an ABI Prism 100˚C. The reaction was stopped by placing the tube on 377 DNA sequencer (Applied Biosystems, Waltham, crushed dry ice. The amount of TPP in the reaction solu- MA). Thiamin hydrochloride, TP chloride and TPP chlo- tion was determined by HPLC after conversion to thio- ride were purchased from Nacalai Tesque, Inc. (Kyoto, chrome by alkaline oxidation with cyanogen bromide, Japan). All other chemicals were of analytical grade. as described previously (12). When the phosphorylation Strains and media. P. calidifontis JCM 11548 was used of thiamin or TP in the cell-free extract was assessed, to prepare the cell-free extract and the genomic DNA. the reaction mixture contained 50 mM Tris-HCl, pH 7.5, P. calidifontis was cultured in 1 L Erlenmeyer flasks in 1.0 mM ATP, 10 mM MgCl2, 1.0 mM dithiothreitol, medium (300 mL, pH 7.0, adjusted with NaOH) con- enzyme source and 10 mM precursor in a final volume taining 10 g/L tryptone, 1 g/L yeast extract and 3 g/L of 50 mL.
Load more

Recommended publications
  • Progressive Increase in Mtdna 3243A>G Heteroplasmy Causes Abrupt
    Progressive increase in mtDNA 3243A>G PNAS PLUS heteroplasmy causes abrupt transcriptional reprogramming Martin Picarda, Jiangwen Zhangb, Saege Hancockc, Olga Derbenevaa, Ryan Golhard, Pawel Golike, Sean O’Hearnf, Shawn Levyg, Prasanth Potluria, Maria Lvovaa, Antonio Davilaa, Chun Shi Lina, Juan Carlos Perinh, Eric F. Rappaporth, Hakon Hakonarsonc, Ian A. Trouncei, Vincent Procaccioj, and Douglas C. Wallacea,1 aCenter for Mitochondrial and Epigenomic Medicine, Children’s Hospital of Philadelphia and the Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, PA 19104; bSchool of Biological Sciences, The University of Hong Kong, Hong Kong, People’s Republic of China; cTrovagene, San Diego, CA 92130; dCenter for Applied Genomics, Division of Genetics, Department of Pediatrics, and hNucleic Acid/Protein Research Core Facility, Children’s Hospital of Philadelphia, Philadelphia, PA 19104; eInstitute of Genetics and Biotechnology, Warsaw University, 00-927, Warsaw, Poland; fMorton Mower Central Research Laboratory, Sinai Hospital of Baltimore, Baltimore, MD 21215; gGenomics Sevices Laboratory, HudsonAlpha Institute for Biotechnology, Huntsville, AL 35806; iCentre for Eye Research Australia, Royal Victorian Eye and Ear Hospital, East Melbourne, VIC 3002, Australia; and jDepartment of Biochemistry and Genetics, National Center for Neurodegenerative and Mitochondrial Diseases, Centre Hospitalier Universitaire d’Angers, 49933 Angers, France Contributed by Douglas C. Wallace, August 1, 2014 (sent for review May
    [Show full text]
  • Branched Chain A-Ketoacid Dehydrogenase to Thiamine and Thiamine Pyrophosphate
    Pediat. Res. 12: 235-238 (1978) Branched chain amino acids thiamine maple syrup urine disease vitamin responsiveness mitochondrial membranes In Vivo and in Vitro Response of Human Branched Chain a-Ketoacid Dehydrogenase to Thiamine and Thiamine Pyrophosphate DEAN J. DANNER,'27' FRANCES B. WHEELER, SANDRA K. LEMMON, AND LOUIS J. ELSAS I1 Department of Pediatrics, Division of Medical Genetics, Emory University School of Medicine, Atlanta, Georgia, USA Summary lability at 37"; and failure to respond to added NAD+, CoASH, and MgZ+. In a homozygous affected patient with maple syrup urine We propose that "excess" thiamine led to increased available disease, pharmacologic doses of thiamine lowered urinary excre- thiamine pyrophosphate which stabilized the branched chain a- tion of branched chain a-ketoacids and stimulated branched ketoacid dehydrogenase, decreased biologic turnover, increased chain a-ketoacid dehydrogenase (BCKAD) in his peripheral enzyme specific activity and produced in vivo tolerance to blood leukocvtes. Suvvlementation of his branched chain ami- branched chain aminoacids in these patients with maple syrup noacid restricted diei hth 100 mglday of thiamine eliminated urine disease. recurrent episodes of ketoacidosis.~heseclinical responses were Speculation studied in vitro using mitochondria1 inner membranes prepared from his cultured skin fibroblasts and those from another By studying the partially purified normal and mutant branched thiamine-responsive patient from Canada. BCKAD in both chain a-ketoacid dehydrogenases from cultured human fibro- mutant cell lines had similarities to normal enzyme including: blasts, direct in vitro effects of thiamine pyrophosphate can be identical apparent K,,, value for thiamine pyrophosphate; similar measured and related to in vivo clinical responses.
    [Show full text]
  • Supplementary Information
    Supplementary information (a) (b) Figure S1. Resistant (a) and sensitive (b) gene scores plotted against subsystems involved in cell regulation. The small circles represent the individual hits and the large circles represent the mean of each subsystem. Each individual score signifies the mean of 12 trials – three biological and four technical. The p-value was calculated as a two-tailed t-test and significance was determined using the Benjamini-Hochberg procedure; false discovery rate was selected to be 0.1. Plots constructed using Pathway Tools, Omics Dashboard. Figure S2. Connectivity map displaying the predicted functional associations between the silver-resistant gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S3. Connectivity map displaying the predicted functional associations between the silver-sensitive gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S4. Metabolic overview of the pathways in Escherichia coli. The pathways involved in silver-resistance are coloured according to respective normalized score. Each individual score represents the mean of 12 trials – three biological and four technical. Amino acid – upward pointing triangle, carbohydrate – square, proteins – diamond, purines – vertical ellipse, cofactor – downward pointing triangle, tRNA – tee, and other – circle.
    [Show full text]
  • Supplementary Informations SI2. Supplementary Table 1
    Supplementary Informations SI2. Supplementary Table 1. M9, soil, and rhizosphere media composition. LB in Compound Name Exchange Reaction LB in soil LBin M9 rhizosphere H2O EX_cpd00001_e0 -15 -15 -10 O2 EX_cpd00007_e0 -15 -15 -10 Phosphate EX_cpd00009_e0 -15 -15 -10 CO2 EX_cpd00011_e0 -15 -15 0 Ammonia EX_cpd00013_e0 -7.5 -7.5 -10 L-glutamate EX_cpd00023_e0 0 -0.0283302 0 D-glucose EX_cpd00027_e0 -0.61972444 -0.04098397 0 Mn2 EX_cpd00030_e0 -15 -15 -10 Glycine EX_cpd00033_e0 -0.0068175 -0.00693094 0 Zn2 EX_cpd00034_e0 -15 -15 -10 L-alanine EX_cpd00035_e0 -0.02780553 -0.00823049 0 Succinate EX_cpd00036_e0 -0.0056245 -0.12240603 0 L-lysine EX_cpd00039_e0 0 -10 0 L-aspartate EX_cpd00041_e0 0 -0.03205557 0 Sulfate EX_cpd00048_e0 -15 -15 -10 L-arginine EX_cpd00051_e0 -0.0068175 -0.00948672 0 L-serine EX_cpd00054_e0 0 -0.01004986 0 Cu2+ EX_cpd00058_e0 -15 -15 -10 Ca2+ EX_cpd00063_e0 -15 -100 -10 L-ornithine EX_cpd00064_e0 -0.0068175 -0.00831712 0 H+ EX_cpd00067_e0 -15 -15 -10 L-tyrosine EX_cpd00069_e0 -0.0068175 -0.00233919 0 Sucrose EX_cpd00076_e0 0 -0.02049199 0 L-cysteine EX_cpd00084_e0 -0.0068175 0 0 Cl- EX_cpd00099_e0 -15 -15 -10 Glycerol EX_cpd00100_e0 0 0 -10 Biotin EX_cpd00104_e0 -15 -15 0 D-ribose EX_cpd00105_e0 -0.01862144 0 0 L-leucine EX_cpd00107_e0 -0.03596182 -0.00303228 0 D-galactose EX_cpd00108_e0 -0.25290619 -0.18317325 0 L-histidine EX_cpd00119_e0 -0.0068175 -0.00506825 0 L-proline EX_cpd00129_e0 -0.01102953 0 0 L-malate EX_cpd00130_e0 -0.03649016 -0.79413596 0 D-mannose EX_cpd00138_e0 -0.2540567 -0.05436649 0 Co2 EX_cpd00149_e0
    [Show full text]
  • Imaging Metabolite Dynamics in Living Cells Using a Spinach-Based
    Imaging metabolite dynamics in living cells using a PNAS PLUS Spinach-based riboswitch Mingxu You1, Jacob L. Litke1, and Samie R. Jaffrey2 Department of Pharmacology, Weill Medical College, Cornell University, New York, NY 10065 Edited by Jennifer A. Doudna, University of California, Berkeley, CA, and approved April 24, 2015 (received for review March 6, 2015) Riboswitches are natural ligand-sensing RNAs typically that are 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI) (6, 7). found in the 5′ UTRs of mRNA. Numerous classes of riboswitches Similar to the manner by which GFP induces fluorescence in HBI, have been discovered, enabling mRNA to be regulated by diverse Spinach binds to the otherwise nonfluorescent DFHBI and and physiologically important cellular metabolites and small mol- switches it to a highly fluorescent state. This property has allowed ecules. Here we describe Spinach riboswitches, a new class of ge- Spinach to be used to tag and image specific RNAs in living cells (6). netically encoded metabolite sensor derived from naturally occur- We recently converted the constitutively fluorescent Spinach– ring riboswitches. Drawing upon the structural switching mechanism DFHBI complex into sensors that fluoresce in proportion to the of natural riboswitches, we show that Spinach can be swapped for concentration of specific metabolites (5). These sensors comprise the expression platform of various riboswitches, allowing metabo- two domains: Spinach and a target-binding aptamer. The target- lite binding to induce Spinach fluorescence directly. In the case of the binding aptamer is inserted into a structurally critical stem of thiamine 5′-pyrophosphate (TPP) riboswitch from the Escherichia Spinach (5). Because the target-binding aptamer is unstructured coli thiM gene encoding hydroxyethylthiazole kinase, we show without the target molecule, the critical stem is disrupted, pre- that insertion of Spinach results in an RNA sensor that exhibits venting Spinach from folding and binding DFHBI.
    [Show full text]
  • 12) United States Patent (10
    US007635572B2 (12) UnitedO States Patent (10) Patent No.: US 7,635,572 B2 Zhou et al. (45) Date of Patent: Dec. 22, 2009 (54) METHODS FOR CONDUCTING ASSAYS FOR 5,506,121 A 4/1996 Skerra et al. ENZYME ACTIVITY ON PROTEIN 5,510,270 A 4/1996 Fodor et al. MICROARRAYS 5,512,492 A 4/1996 Herron et al. 5,516,635 A 5/1996 Ekins et al. (75) Inventors: Fang X. Zhou, New Haven, CT (US); 5,532,128 A 7/1996 Eggers Barry Schweitzer, Cheshire, CT (US) 5,538,897 A 7/1996 Yates, III et al. s s 5,541,070 A 7/1996 Kauvar (73) Assignee: Life Technologies Corporation, .. S.E. al Carlsbad, CA (US) 5,585,069 A 12/1996 Zanzucchi et al. 5,585,639 A 12/1996 Dorsel et al. (*) Notice: Subject to any disclaimer, the term of this 5,593,838 A 1/1997 Zanzucchi et al. patent is extended or adjusted under 35 5,605,662 A 2f1997 Heller et al. U.S.C. 154(b) by 0 days. 5,620,850 A 4/1997 Bamdad et al. 5,624,711 A 4/1997 Sundberg et al. (21) Appl. No.: 10/865,431 5,627,369 A 5/1997 Vestal et al. 5,629,213 A 5/1997 Kornguth et al. (22) Filed: Jun. 9, 2004 (Continued) (65) Prior Publication Data FOREIGN PATENT DOCUMENTS US 2005/O118665 A1 Jun. 2, 2005 EP 596421 10, 1993 EP 0619321 12/1994 (51) Int. Cl. EP O664452 7, 1995 CI2O 1/50 (2006.01) EP O818467 1, 1998 (52) U.S.
    [Show full text]
  • Imaging Metabolite Dynamics in Living Cells Using a Spinach-Based
    Imaging metabolite dynamics in living cells using a PNAS PLUS Spinach-based riboswitch Mingxu You1, Jacob L. Litke1, and Samie R. Jaffrey2 Department of Pharmacology, Weill Medical College, Cornell University, New York, NY 10065 Edited by Jennifer A. Doudna, University of California, Berkeley, CA, and approved April 24, 2015 (received for review March 6, 2015) Riboswitches are natural ligand-sensing RNAs typically that are 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI) (6, 7). found in the 5′ UTRs of mRNA. Numerous classes of riboswitches Similar to the manner by which GFP induces fluorescence in HBI, have been discovered, enabling mRNA to be regulated by diverse Spinach binds to the otherwise nonfluorescent DFHBI and and physiologically important cellular metabolites and small mol- switches it to a highly fluorescent state. This property has allowed ecules. Here we describe Spinach riboswitches, a new class of ge- Spinach to be used to tag and image specific RNAs in living cells (6). netically encoded metabolite sensor derived from naturally occur- We recently converted the constitutively fluorescent Spinach– ring riboswitches. Drawing upon the structural switching mechanism DFHBI complex into sensors that fluoresce in proportion to the of natural riboswitches, we show that Spinach can be swapped for concentration of specific metabolites (5). These sensors comprise the expression platform of various riboswitches, allowing metabo- two domains: Spinach and a target-binding aptamer. The target- lite binding to induce Spinach fluorescence directly. In the case of the binding aptamer is inserted into a structurally critical stem of thiamine 5′-pyrophosphate (TPP) riboswitch from the Escherichia Spinach (5). Because the target-binding aptamer is unstructured coli thiM gene encoding hydroxyethylthiazole kinase, we show without the target molecule, the critical stem is disrupted, pre- that insertion of Spinach results in an RNA sensor that exhibits venting Spinach from folding and binding DFHBI.
    [Show full text]
  • Semi-Automated Curation of Metabolic Models Via Flux Balance Analysis: a Case Study with Mycoplasma Gallisepticum Eddy J
    University of Connecticut OpenCommons@UConn Open Access Author Fund Awardees' Articles UConn Library 9-5-2013 Semi-automated Curation of Metabolic Models via Flux Balance Analysis: A Case Study with Mycoplasma Gallisepticum Eddy J. Bautista University of Connecticut - Storrs Joseph Zinski University of Connecticut - Storrs Steven M. Szczepanek University of Connecticut - Storrs Erik L. Johnson University of Connecticut - Storrs Edan R. Tulman University of Connecticut - Storrs See next page for additional authors Follow this and additional works at: https://opencommons.uconn.edu/libr_oa Part of the Engineering Commons, and the Medicine and Health Sciences Commons Recommended Citation Bautista, Eddy J.; Zinski, Joseph; Szczepanek, Steven M.; Johnson, Erik L.; Tulman, Edan R.; Geary, Steven J.; and Srivastava, Ranjan, "Semi-automated Curation of Metabolic Models via Flux Balance Analysis: A Case Study with Mycoplasma Gallisepticum" (2013). Open Access Author Fund Awardees' Articles. 19. https://opencommons.uconn.edu/libr_oa/19 Authors Eddy J. Bautista, Joseph Zinski, Steven M. Szczepanek, Erik L. Johnson, Edan R. Tulman, Steven J. Geary, and Ranjan Srivastava This article is available at OpenCommons@UConn: https://opencommons.uconn.edu/libr_oa/19 Semi-automated Curation of Metabolic Models via Flux Balance Analysis: A Case Study with Mycoplasma gallisepticum Eddy J. Bautista1., Joseph Zinski1.¤a, Steven M. Szczepanek2,3, Erik L. Johnson1¤b, Edan R. Tulman2,4, Wei-Mei Ching5, Steven J. Geary2,4, Ranjan Srivastava1,6* 1 Department of Chemical
    [Show full text]
  • Investigations Into How Bacteria Influence Nutrient Availability in Their Environment
    INVESTIGATIONS INTO HOW BACTERIA INFLUENCE NUTRIENT AVAILABILITY IN THEIR ENVIRONMENT A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by David Robert Sannino December 2017 © 2017 David Robert Sannino INVESTIGATIONS INTO HOW BACTERIA INFLUENCE NUTRIENT AVAILABILITY IN THEIR ENVIRONMENT David Robert Sannino, Ph. D. Cornell University 2017 Bacteria shape many of their interactions with other organisms through the manipulation of nutrient availability, whether through cooperation by providing nutrients, or through competition for nutrients. Thiamin is an essential vitamin necessary for all life, however, how bacteria shape the ecological interactions between organisms for this nutrient is not well understood. We employed a Drosophila melanogaster-microbiota model utilizing a chemically defined diet to understand the interaction between how the host is influenced by the microbiota’s interaction with the dietary component thiamin. We found that the Drosophila melanogaster microbiota provisions thiamin to its host in a low thiamin environment. This provision rescued development of Drosophila on a no thiamin diet, as axenic flies were unable to develop on this diet. Our study was a clear demonstration supporting the long standing hypothesis that animal microbiotas function to provision thiamin and other vitamins to their host. A small subset of bacteria produce the enzyme thiaminase I, which degrades thiamin to its two moieties. The biological function of this enzyme is not understood. We used a genomic approach to investigate a potential function of this enzyme and found that it is located in a conserved operon in three thiaminase I producing Paenibacillus species, with other genes involved in thiamin salvage and production of the thiamin antimetabolite bacimethrin, suggesting it may play a role in thiamin salvage and competition for this nutrient.
    [Show full text]
  • Hypoxia Regulates Endogenous Double-Stranded RNA Production Via Reduced Mitochondrial DNA Transcription Esther Arnaiz1,2
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.31.230300; this version posted July 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Hypoxia regulates endogenous double-stranded RNA production via reduced 2 mitochondrial DNA transcription 3 Esther Arnaiz1,2#, Ana Miar1,3#, Antonio Gregorio Dias Junior4,5, Naveen Prasad3, Ulrike 4 Schulze6, Dominic Waithe6, Jan Rehwinkel4, Adrian L. Harris1* 5 1Department of Medical Oncology, Molecular Oncology Laboratories, Weatherall Institute of 6 Molecular Medicine, University of Oxford, John Radcliffe Hospital, Oxford, OX3 9DS, UK 7 2Current address: Cambridge Institute for Therapeutic Immunology & Infectious Disease. 8 Jeffrey Cheah Biomedical Centre. Puddlecombe Way, Cambridge, CA CB20AW, UK 9 3Department of Oncology, Old Road Campus Research Building, University of Oxford, 10 Oxford, OX3 7DQ, UK 11 4Medical Research Council Human Immunology Unit, Medical Research Council Weatherall 12 Institute of Molecular Medicine, Radcliffe Department of Medicine, University of Oxford, 13 Oxford OX3 9DS, UK. 14 5Current address: Division of Infectious Diseases and Vaccinology, School of Public Health, 15 University of California, Berkeley, USA. 16 6Radcliffe Department of Medicine, Weatherall Institute of Molecular Medicine, University of 17 Oxford, John Radcliffe Hospital, Oxford, OX3 9DS, UK 18 19 #equal contribution 20 *To whom correspondence should be addressed: Adrian L. Harris Department of Oncology, 21 Weatherall Institute of Molecular Medicine, University of Oxford, John Radcliffe Hospital, 22 OX3 9DS, UK. E-mail: [email protected]. Phone: +44 (0)1865 222457 (PA). 23 Short title: Hypoxia effect on dsRNA in cancer 24 This work has been supported by Breast Cancer Now (grant reference 2015MayPR479) and 25 Breast Cancer Research Foundation.
    [Show full text]
  • A Combined Growth Factor-Deleted and Thymidine Kinase-Deleted Vaccinia Virus Vector
    (19) & (11) EP 2 325 321 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 25.05.2011 Bulletin 2011/21 C12N 15/863 (2006.01) A61K 48/00 (2006.01) (21) Application number: 10179286.9 (22) Date of filing: 26.05.2000 (84) Designated Contracting States: • Bartlett, David L. AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU Darnestown, MD 20878 (US) MC NL PT SE • Moss, Bernard Bethesda, MD 20814 (US) (30) Priority: 28.05.1999 US 137126 P (74) Representative: Donald, Jenny Susan (62) Document number(s) of the earlier application(s) in Forrester & Boehmert accordance with Art. 76 EPC: Pettenkoferstrasse 20-22 00939374.5 / 1 180 157 80336 München (DE) (71) Applicant: THE GOVERNMENT OF THE UNITED Remarks: STATES OF AMERICA as •This application was filed on 24-09-2010 as a represented by the SECRETARY OF THE divisional application to the application mentioned DEPARTMENT OF under INID code 62. HEALTH AND HUMAN SERVICES •Claims filed after the date of filing of the application Rockville, MD 20852 (US) / after the date of receipt of the divisional appliaction (Rule 68(4) EPC). (72) Inventors: • McCart, Andrea J. Silver Springs, MD 20910 (US) (54) A combined growth factor-deleted and thymidine kinase-deleted vaccinia virus vector (57) A composition of matter comprising a vaccinia virus expression vector with a negative thymidine kinase phe- notype and a negative vaccinia virus growth factor phenotype. EP 2 325 321 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 325 321 A1 Description Background of the Invention 5 Field of the Invention [0001] The present invention relates to mutant vaccinia virus expression vectors The mutant expression vectors of the present invention show substantially no virus replication in non dividing cells and as such are superior to previous vaccinia virus expression vectors.
    [Show full text]
  • All Enzymes in BRENDA™ the Comprehensive Enzyme Information System
    All enzymes in BRENDA™ The Comprehensive Enzyme Information System http://www.brenda-enzymes.org/index.php4?page=information/all_enzymes.php4 1.1.1.1 alcohol dehydrogenase 1.1.1.B1 D-arabitol-phosphate dehydrogenase 1.1.1.2 alcohol dehydrogenase (NADP+) 1.1.1.B3 (S)-specific secondary alcohol dehydrogenase 1.1.1.3 homoserine dehydrogenase 1.1.1.B4 (R)-specific secondary alcohol dehydrogenase 1.1.1.4 (R,R)-butanediol dehydrogenase 1.1.1.5 acetoin dehydrogenase 1.1.1.B5 NADP-retinol dehydrogenase 1.1.1.6 glycerol dehydrogenase 1.1.1.7 propanediol-phosphate dehydrogenase 1.1.1.8 glycerol-3-phosphate dehydrogenase (NAD+) 1.1.1.9 D-xylulose reductase 1.1.1.10 L-xylulose reductase 1.1.1.11 D-arabinitol 4-dehydrogenase 1.1.1.12 L-arabinitol 4-dehydrogenase 1.1.1.13 L-arabinitol 2-dehydrogenase 1.1.1.14 L-iditol 2-dehydrogenase 1.1.1.15 D-iditol 2-dehydrogenase 1.1.1.16 galactitol 2-dehydrogenase 1.1.1.17 mannitol-1-phosphate 5-dehydrogenase 1.1.1.18 inositol 2-dehydrogenase 1.1.1.19 glucuronate reductase 1.1.1.20 glucuronolactone reductase 1.1.1.21 aldehyde reductase 1.1.1.22 UDP-glucose 6-dehydrogenase 1.1.1.23 histidinol dehydrogenase 1.1.1.24 quinate dehydrogenase 1.1.1.25 shikimate dehydrogenase 1.1.1.26 glyoxylate reductase 1.1.1.27 L-lactate dehydrogenase 1.1.1.28 D-lactate dehydrogenase 1.1.1.29 glycerate dehydrogenase 1.1.1.30 3-hydroxybutyrate dehydrogenase 1.1.1.31 3-hydroxyisobutyrate dehydrogenase 1.1.1.32 mevaldate reductase 1.1.1.33 mevaldate reductase (NADPH) 1.1.1.34 hydroxymethylglutaryl-CoA reductase (NADPH) 1.1.1.35 3-hydroxyacyl-CoA
    [Show full text]